- Email: [email protected]
Polymerase chain reaction-based deletion analysis of spontaneous and arsenite-enhanced gpt mutants in CHO-AS52 cells
Fundamental and Molecular Mechanisms of Mutagenesis
ELSEVIER
Mutation Research 356 (1996) 255-259
Polymerase chain reaction-based deletion analysis of spontaneous and arsenite-enhanced gpt mutants in CHO-AS,, cells Ziqiang Meng a**, Abraham W. Hsie b ’ Division of Erwironmental
Biological
Toxicology
and Department
of Environmental
Science.
Shark
Vniuersity,
Tuiyuan 030006,
P.R.
China b Department
of PreL)entice Medicine
and Community Health, The Uniuersity of Texas Medical Branch, 77555,
Received 29 December
2. 102 Ewing Hull, Galrvston,
TX
USA
1995; revised 4 March 1996; accepted
19 March 1996
Abstract In this study, we have examined the mutagenicity of sodium arsenite at the xanthine-guanine phosphoribosyltransferase locus ( ypt) in a pSV2 gpt-transformed CHO cell line, AS52. Our results provide very weak evidence for arsenite as a gene mutagen because the chemical at high doses and at high cytotoxicity enhances barely a doubling of mutant frequency (MF) and a doubling of the gpt gene deletion frequency compared to controls. We suggest that the increase in MF in arsenite-treated cells results from arsenic, as comutagen, enhancing the induction effect of any unknown endogenous or exogenous factors on the spontaneous mutagenesis of AS52 cells. Nested PCR analysis mutants has a total deletion of the gpt gene. For the spontaneous, 50 p,M arsenite- and 100 pM arsenite-enhanced spontaneous mutants in AS52 cells. the percentages of total deletion of the gpt gene are 36.00%, 54.72% and 66.67%, respectively. We suggest that a high proportion of the gene deletion in arsenite-enhanced mutants may be due to the high cytotoxicity of the chemical. Keywords:
Arsenite: PCR; gpt; Xanthine-guanine
phosphoribosyltransferase;
1. Introduction Arsenic nature have
is a metalloid
and industrial shown
and is widely
wastes.
that arsenic
lated with the increased
distributed
Epidemiological
exposure incidence
is, indeed,
in
studies corre-
of skin, lung, and
liver cancers in human beings (IARC, 1980, 1990). However, the mechanism of arsenic-induced carcinogenesis is still unknown. Arsenic is highly toxic and its genotoxic effect has been shown in various studies. The chemical induces DNA strand
possibly
* Corresponding 0027-5107/96/$15.00 PII SOO27-5
author.
Deletion; Thioguanine-resistant
mutant; CHO cell: AS52 cell
breaks, sister chromatid exchanges (SCE), and chromosomal aberrations (CA), but does not induce detectable gene mutations at specific genetic loci (Rossman et al., 1980; Lee et al., 1985). Hartmann and Speit (1994) also found that arsenite at high concentrations induced an increase in DNA strand breaks in human lymphocytes in the single-cell gel assay. Recently, Moore et al. (1995) have reported that the majority of mutants, which are induced by arsenic in L5178Y mouse lymphoma cells, are small colony mutants that result from the induction of chromosomal mutations but not single gene mutations. In the present study, we evaluated arsenite at
Copyright 0 1996 Elsevier Science B.V. All rights reserved. 107(96)000681
high concentrations for its ability to enhance 6-TGresistant mutants in CHO-ASS? cells. and its ability to enhance the total deletion of the xanthine-guanine phosphoribosyltranferase ( tgpt) gene in mutants from arsenite-treated cells.
2. Materials
and methods
2. I. Cell dturr The CHO cell derivative As,, (ASS2 cells) was used throughout this study. ASS2 cells carry a single stable copy of a transfected E. cvli gpt gene located on autosome presumably chromosome 6 or 7 (Tindali et al.. 1984, 1986; Michaelis et al., 1994). The cell line was maintained in plastic tissue-culture dishes with containing Ham’s F 12 medium supplemented 5% fetal calf serum (F12FCM5). Cultures were maintained under standard conditions of 5% CO, in air at 37°C in a humidified incubator (Hsie et-al.. 1975. 198 1, Hsie, 1987). AS52 cells were first treated with MPA medium (F12FCMS plus 350 t.~g/ml xanthine, 25 kg/ml adenine. 50 t_r,M thymidine. 3 PM aminopterin and IO p.g/ml mycophenolic acid) for 2 or 3 days to eminate the pre-existing ,ept mutants and then grown in Fl2FCM.5 for another 2 days prior to chemical treatment.
Sodium arsenite was purchased from Sigma Chemical Co. (St. Louis, MO. USA). The cells were plated at a density of 5 x IOi tells/25-cm” plastic flask in 5 ml FI2FCM5 medium. After 24 h, exponentially growing cells (about l-l.5 X 1Oh cell per flask) were treated with sodium arsenite at different concentrations. The chemical was freshly dissolved in serum-free F12 medium. The cells were incubated in the presence of the chemical for 4 h and then washed .3 times with Dulbecco’s phosphate-buffered saline (PBS). 2.3. Determinutim gpt r?lutunts
of‘ cytotosicity
cmd selectior~ (!f’
Our previously published procedure was used to determine both cytotoxicity and mutagenicity (Hsie
et al.. 1975; O’Neill et al., 1977). For determination of cytotoxicity. 200 treated cells were plated in triplicate onto 60-mm dishes in 5 ml F12FCMS. After 7 days of incubation. the colonies were counted and cytotoxicity was expressed as percent survival relative (RS) to those from similarly plated untreated control. For determination of mutagenicity. the treated cells were maintained in F12FCM5 for expression of the mutant phenotype, and one or two subcultures were performed during this period depending on the extent of cell survival after chemical treatment. At the end of expression (7 days), 3 X IO’ cells were plated onto each of five IOO-mm dishes in hypoxanthine-free F12 medium containing 5% dialyzed fetal calf serum and 10 yM 6-TG. The survival of these cells was determined by plating 200 cells in triplicate onto 60-mm dishes with the TG-free and hypoxanmine-free Fl:! medium. Mutatant frequency was calculated as the number of TG resistant colonies per IO’ clonable cells at the end of selection (7 days). For the selection of gpt mutants at the end of expression period, 2 X 10’ cells from the cultures of each original 60-mm dish were plated in each of five IOO-mm dishes to select for independent mutants in hopyxathine-free F,, FCM, medium containing IO I_LM6-TG. After a 7-day incubation, only one mutant colony was picked from five IOO-mm mutant-selecderived mutant tion dishes. This independently colony was isolated by trypsinization in a stainless steel ring sealed to the bottom of the dish with autoclaved silicone lubricant (Dow Corning). The isolated mutant colonies were then grown to approx. 2 X I@’ cells in medium FlZFCM5 for molecular analyses (An and Hsie. 1993).
A modified procedure combinining the methods of Miller et al. (1988) and Engel and Hedrick (1988) was used to isolate DNA. Approx. 2 X 1Oh cells from each mutant were trypsinized and collected in a ?.O-ml microcentrifuge tube, followed by resuspension of the cells in 300 ~1 of ice-cold RNA lysis buffer (0.14 M NaCl, 1.5 mM 10 mM Tris-HCI. pH 7.8). 20 p_l of IO% M&l?, Nonidet P40 (USB) was added to the above mixture. followed by incubation in ice for 5 min. After cen-
Z. Meng, A. W. Hsie /Mutation Table I Cytotoxicity
and mutagenicity
of sodium arsenite in AS52 cells *
Chemical
Concentration
RS (o/o) MF+ SD ( X lO-6)
Sodium arsenite
none 50 pM 100 JLM
100.00 24.04 15.13
EMS
3222 pM
60.19
50.78 + 11.66 80.07 + 14.20 101.25+ 16.66 479.50*
121.83
* Means are from three independent experiments. The cytotoxicity is measured by the cloning effeciency (CE) and expressed as Relative Survival (RS). For comparision, the CE values of control are set at 100%. All treatment values are expressed as a percentage of the control values. The absolute values of CE for controls are ranged from 70% to 90% for AS52 cells. EMS, ethyl methanesulfonate.
trifugation of 8000 r-pm for 5 min, the supematant was discharged. The nuclear pellet was resuspended in 300 p,l of DNA lysis buffer (10 mM Tris-HCl. 400 mM NaCl, 2 mM Na,EDTA, pH 8.2). The nuclear lysates were incubated overnight at 37°C with 30 ~1 10% sodium dodecyl sulfate (SDS), and 10 pl of 10 mg/ml proteinase K (0.5 mg proteinase K in 1% SDS and 2 mM Na,EDTA), followed by mixing with 150 p,l saturated NaCl and vortexing for 10 s, and centrifugation at 8000 rpm for 20 min. The supernatant was mixed with 2 ~01s. of pre-cold absolute ethanol in a fresh tube and the DNA was precipitated by inverting the tube several times. After 20 min of centrifugation at 13 000 rpm, the DNA pellet was washed with 70% ethanol, dried, and then resuspended in distilled water. 2.5. PCR deletion screening Oligonucleotide primers for PCR amplification were synthesized on a 380B DNA synthesizer (Applied Biosystems). A nested PCR procedure to am-
Table 2 Deletion proportion
Spontaneous
mutants
Induced mutants - 50 pM arsenite - 100 p,M arsenite
of spontaneous
and enhanced
GPT-mutants
Research 356 (1996) 255-2.59
257
plify the gpt gene was adapted (Tindall and Stankowski Jr., 1989). The primer sequences of the gpt gene were based on Tindall and Stankowski Jr. (1989). They were XPl; .t9,AAGCTTG GACACAAGACAGGCT (+ >; XP2:,,, ACAAAGATCCGGGGCCCACTCA (-- >; XP5: _,,86GTGCGCCAGATCTCTATAATCTCGCGC (+); XP6: ,,sAGGGTTTCGCTCAGGTTTGCCTGTGTC (- >. XPl and XP2 served as a pair of external primers used in the first round of PCR amplification. XP5 and XP6 were used in the second round of PCR amplification as a pair of internal primers. Both rounds of PCR were carried out in a 30-pl mixture containing 200 ng of template DNA, 2 mM MgCl,, 50 mM KCl, 10 mM Tris-HCl, 0.25 mM of each dNTP and 0.08 (LM of each primers. Overlaid with light mineral oil, the samples were run in 94°C 20 s; 57”C, 20 s; and 72°C 20 s, for 15 cycles in the first round and 25 cycles in the second round. 3 p_l of the product of the gpt gene amplification were analyzed by electrophoresis on 1.5% agarose gels stained with ethidium bromide.
3. Results 3.1. Cytotoxicity
and mutagenicity
of sodium arsenite
Sodium arsenite-induced cytoxicity and mutagenicity were assessed by AS52/gpt assay. Treatment of As,, cells with sodium arsenite at the concentrations from 50 to 100 pM for 4 h resulted in dose-dependent increases in cell lethality and mutant frequency (Table 1). The results indicate that in the tested arsenite concentrations, the highest arsenite-induced mutant frequency (MF) in AS52 cells was 101.25 X 10e6,
in AS52 cells
Total mutants isolated t%)
Percentage
of non-deletion
mutants (%o)
50 (100)
32 (64.00)
18 (36.00)
53 (100) 21(100)
24 (45.28) 7 (33.33)
29 (54.72) 14 (66.67)
Percentage
of deletion mutant (%I
MW 1
2
3 4
5
6
7
8
9
10
11
out of SO): that of the 50 p_M arsenite-enhanced mutants was 54. 72% (29 out of 53); and that of the IO0 pM arsenite-enhanced mutants was 66.67% (14 out of 2 I) (Table 2). High proportion of the gpt gene deletion in arsenite-enhanced mutants may be results from DNA damage caused by high cytotoxicity of the chemical. Fig. I shows some examples of the nested gpt gene amplification.
4. Discussion
which was about l-fold increase over the background frequency. These results provided very weak evidence for arsenite as a gene mutagen even if the chemical at the high concentrations. We suggest that arsenite is a comutagen to enhance an increase of spontaneous mutant frequency in AS52 cells.
Fifty-three independent 50 FM sodium arseniteand 21 independent 100 FM sodium arsenite-%y/Tr mutants. and SO independent spontaneous ,ypt mutants in AS52 cells were isolated and analyzed by the nested PCR. Screening results of the gpt gene deletions showed that the percentage of deletion mutations in the spontaneous
Our experiments reported here provide very weak evidence for arsenite as a mutagen, sodium arsenite at high concentrations (SO and 100 FM) induces barely a doubling of mutant frequency in ASS2 cells compared to spontaneous mutant frequency. This increase is generally not sufficient by the usual standards to demonstrate the mutagenicity of sodium arsenite in this mammalian cell mutagenicity assay. We suggest that the spontaneous mutants in ASS2 cells are to be induced by any unknown endogenous or exogenous factor(s). arsenite as a comutagen enhances the mutagenicity of the factor(s). It results in an increase of spontaneous mutant frequency. This is consistent with the comutagenic evidence of arsenic reported by several investigators (Rossman et al.. 1980: Lee et al.. 1985; Jan et al., 1986; Li and Rossman. 1989; Li and Rossman, 1991; Jha et al.. 1992: Weincke and Yager. 1992; Lee-Chen et al.. 1994). The comutagenicity of sodium arsenite with ultraviolet radiation has been demonstrated (Li and Rossman. 1989, 1991: Weincke and Yager, 1992). Jan et al. ( 1986) found that sodium arsenite enhanced the clastogenicity of ethyl methanesulfonate (EMS). Our results have shown that the proportion of the total ,q/>t-gene deletions in gpt mutants enhanced by arsenite at high concentrations is significantly higher ( p < 0.05, X?-test) than that in spontaneous mutants. The mechanisms for the gene deletion are complicated and may involve different pathways. fat example. DNA strand breakage, error in DNA damage repair, and other kinds of DNA damages (Hutchinson. 1985: Simic et al.. 1989; Sankaranarayanan, 1991). We suggest that the high proportion of the gene deletion in the arsenite-enhanced mutants may be due to DNA damage caused by high cytotoxicity of sodium arsenite at high doses.
2. Meng, A. W. Hsie / Mutntion Research 356 ( 1996) 255-259
Briefly, sodium arsenite, as comutagen, enhances an increase of spontaneous mutant frequency in AS52 cells. Arsenite at high doses not only could enhance the mutagenicity of exogeneous mutagens but enhance the mutagenicity of endogenous mutagenic chemicals. High proportion of the gpt-gene deletion may be due to DNA damage caused by high cytotoxicity of arsenite.
References An. J. and A.W. Hsie (1993) Polymerase chain reaction-based deletion screening of bleomycin induced 6-thioguanine-resistant mutants in Chinese hamster ovary cells: The effects of an inhibitor and a mimic of superoxide dismutase. Mutation Res., 289. 215-222. Engel, I. and S.M. Hedrick (1988) Site-directed mutations in the VDJ junctional region of a T cell receptor B-chain cause changes in antigenic peptide recognition. Cell, 54, 473-484. Hartmann, A. and G. Speit (1994) Comparative investigations of the genotoxic effects of metals in the single cell gel (SCG) assay and the sister chromatid exchange (SCE) test. Environ. Mol. Mutagen., 23, 299-305. Hsie. A.W. (1987) The use of the hpgrt versus gpt locus for quantitative mammalian cell mutagenesis, in: M.M. Moore. D.M. DeMarini, F.J. de Serres and K.R. Tindall (Eds.), Banbury Report 28: Mammalian Cell Mutagenesis, cold Spring Harbor Laboratory, Cold Spring Harbor. New York, pp. 37-46. Hsie, A.W., P.A. Brimer. T.J. Mitchell and D.G. Glosslee (1975) The dose-response relationships for ethyl methanesulfonate-induced mutations at the hypoxanthine-quanite phosphoribosyl transferase locus in Chinese hamster overy cells. Somat. Cell Genet., I, 247-261. Hsie. A.W., D.A. Casciano, D.B. Couch, D.F. Krahn, J.P. O’Neill and B.L. Whitfield (1981) The use of Chinese hamster every cells to quantify specific locus mutation and to determine mutagenicity of chemicals. Mutation Res., 86, 193-214. Hutchinson. F. (1985) Chemical changes in DNA by ionizing radiation. Prog. Nucleic Acid Res. Mol. Biol., 32, 115-154. IARC (International Agency for Research on Cancer) (1980) IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans. Vol. 20. Some Metals and Metallic Compounds, IARC Lyon. IARC (International Agency for Research on Cancer) (1990) IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans. Vol. 50, Pharmaceutical Drugs, IARC. Lyon. Jan, K.Y.. R.Y. Huang and T.C. Lee (1986) Different modes of action of sodium arsenite, 3-aminobenzamide, and caffeine on the enhancement of ethyl methasulfonate clastogenicity. Cytogenet. Cell Genet.. 41, 202-208.
Jha,
759
A.N., M. Noditi. R. Nilsson and A.T. Natarajan (1992) Genotoxic effects of sodium arsenite on human cells. Mutation Res.. 284, 215-221. Lee, T.C., R.Y. Huang and K.Y. Jan (1985) Sodium arsenite enhances the cytotoxicity, clastogenicity. and h-thioquanineresistance mutagenicity of ultraviolet light in Chinese hamster ovary cells. Mutation Res.. 148, 83-86. Lee-Chen, S.F.. C.T. Yu. D.R. Wu and K.Y. Jan (1994) Differential effects of luminol. nickel, and arsenite on the rejoining of ultraviolet light and alkylation-induced DNA breaks. Environ. Mol. Mutagen., 23, 116-120. Li, J.H. and T.G. Rossman (1989) Mechanism of comutagenesis of sodium arsenite with N-methyl-N-nitrosourea. Biol. Trace Element Res.. 21, 373-381. Li. J.H. and T.G. Rossman (1991) Comutagenesis of sodium arsenite with ultraviolet radiation in Chinese hamster V79 cells. Biol. Metals. 4, 197. Michaelis, K.. L. Helvering. D. Kinding. M. Garriott and K. Richardson (1994) Localization of the xanthine-guanine phosphoribosyltransferase gene f gpr) of E. cdi in AS52 metaphase cells by fluorescence in situ hybridization. Environ. Mol. Mutagen., 19 (Suppl. 20). 42. Miller, S.A., D.D. Dykes and H.F. Polesky (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acid Res., 16. 1215-1221. Moore, M.M., K. Harrington-Brock and C.L. Doerr f 1995) Genotoxicity of arsenic and its methylated metabolites. Submitted. O’Neill, J.P.. D.B. Couch, R. Machanoff, J.R. San Sebastian, P.A. Breimer and A.W. Hsie (1977) A quantitative assay of mutation induction at the hypoxanthine-quanine phosphoribosyltransferase locus in Chinese hamster ovary cells fCHO/HGPRT system): Utilization with a variety of mutagenic agents. Mutation Res., 45, 9L-101. Rossman, T.G.. M. Stone, M. Molina and W. Troll (1980) Absence of arsenite mutagenicity in Escherichia coli and Chinese hamster cells. Environ. Mutagen.. 2, 37 l-379. Sankaranarayanan, K. (1991) Ionizing radiation and genetic risks 111; Nature of spontaneous and radiation-induced mutations in mammalian in vitro systems and mechanisms of induction of mutations by radiation. Mutation Res., 258, 75-97. Simic, M.G., D.S. Bergtold and L.R. Karam (1989) Generation of oxy radicals in biosystems. Mutation Res.. 214. 3-12. Tindall. K.R. and L.F. Stankowski Jr. (1989) Molecular analysis of spontaneous mutations at the gpt locus in Chinese hamster ovary fAS52) cells. Mutation Res.. 220, 241-253. Tindall, K.R., L.F. Stankowski Jr.. R. Machanoff and A.W. Hsie (1984) Detection of deletion mutations of pSV2 gpt-transformed cells. Mol. Cell. Biol.. 4. 141 I-1415. Tindall, K.R., L.F. Stankowski Jr.. R. Michanoff and A.W. Hsie (1986) Analyses of mutation of pSV2 gpt-transformed CHO cells. Mutation Res.. 160. 121-131. Weincke, J.K. and J.W. Yager (1992) Specificity of arsenite in potentiating cytogenetic damage induced by the DNA crosslinking agent diepoxybutane. Environ. Mol. Mutagen., 19. 195-200.
ELSEVIER
Mutation Research 356 (1996) 255-259
Polymerase chain reaction-based deletion analysis of spontaneous and arsenite-enhanced gpt mutants in CHO-AS,, cells Ziqiang Meng a**, Abraham W. Hsie b ’ Division of Erwironmental
Biological
Toxicology
and Department
of Environmental
Science.
Shark
Vniuersity,
Tuiyuan 030006,
P.R.
China b Department
of PreL)entice Medicine
and Community Health, The Uniuersity of Texas Medical Branch, 77555,
Received 29 December
2. 102 Ewing Hull, Galrvston,
TX
USA
1995; revised 4 March 1996; accepted
19 March 1996
Abstract In this study, we have examined the mutagenicity of sodium arsenite at the xanthine-guanine phosphoribosyltransferase locus ( ypt) in a pSV2 gpt-transformed CHO cell line, AS52. Our results provide very weak evidence for arsenite as a gene mutagen because the chemical at high doses and at high cytotoxicity enhances barely a doubling of mutant frequency (MF) and a doubling of the gpt gene deletion frequency compared to controls. We suggest that the increase in MF in arsenite-treated cells results from arsenic, as comutagen, enhancing the induction effect of any unknown endogenous or exogenous factors on the spontaneous mutagenesis of AS52 cells. Nested PCR analysis mutants has a total deletion of the gpt gene. For the spontaneous, 50 p,M arsenite- and 100 pM arsenite-enhanced spontaneous mutants in AS52 cells. the percentages of total deletion of the gpt gene are 36.00%, 54.72% and 66.67%, respectively. We suggest that a high proportion of the gene deletion in arsenite-enhanced mutants may be due to the high cytotoxicity of the chemical. Keywords:
Arsenite: PCR; gpt; Xanthine-guanine
phosphoribosyltransferase;
1. Introduction Arsenic nature have
is a metalloid
and industrial shown
and is widely
wastes.
that arsenic
lated with the increased
distributed
Epidemiological
exposure incidence
is, indeed,
in
studies corre-
of skin, lung, and
liver cancers in human beings (IARC, 1980, 1990). However, the mechanism of arsenic-induced carcinogenesis is still unknown. Arsenic is highly toxic and its genotoxic effect has been shown in various studies. The chemical induces DNA strand
possibly
* Corresponding 0027-5107/96/$15.00 PII SOO27-5
author.
Deletion; Thioguanine-resistant
mutant; CHO cell: AS52 cell
breaks, sister chromatid exchanges (SCE), and chromosomal aberrations (CA), but does not induce detectable gene mutations at specific genetic loci (Rossman et al., 1980; Lee et al., 1985). Hartmann and Speit (1994) also found that arsenite at high concentrations induced an increase in DNA strand breaks in human lymphocytes in the single-cell gel assay. Recently, Moore et al. (1995) have reported that the majority of mutants, which are induced by arsenic in L5178Y mouse lymphoma cells, are small colony mutants that result from the induction of chromosomal mutations but not single gene mutations. In the present study, we evaluated arsenite at
Copyright 0 1996 Elsevier Science B.V. All rights reserved. 107(96)000681
high concentrations for its ability to enhance 6-TGresistant mutants in CHO-ASS? cells. and its ability to enhance the total deletion of the xanthine-guanine phosphoribosyltranferase ( tgpt) gene in mutants from arsenite-treated cells.
2. Materials
and methods
2. I. Cell dturr The CHO cell derivative As,, (ASS2 cells) was used throughout this study. ASS2 cells carry a single stable copy of a transfected E. cvli gpt gene located on autosome presumably chromosome 6 or 7 (Tindali et al.. 1984, 1986; Michaelis et al., 1994). The cell line was maintained in plastic tissue-culture dishes with containing Ham’s F 12 medium supplemented 5% fetal calf serum (F12FCM5). Cultures were maintained under standard conditions of 5% CO, in air at 37°C in a humidified incubator (Hsie et-al.. 1975. 198 1, Hsie, 1987). AS52 cells were first treated with MPA medium (F12FCMS plus 350 t.~g/ml xanthine, 25 kg/ml adenine. 50 t_r,M thymidine. 3 PM aminopterin and IO p.g/ml mycophenolic acid) for 2 or 3 days to eminate the pre-existing ,ept mutants and then grown in Fl2FCM.5 for another 2 days prior to chemical treatment.
Sodium arsenite was purchased from Sigma Chemical Co. (St. Louis, MO. USA). The cells were plated at a density of 5 x IOi tells/25-cm” plastic flask in 5 ml FI2FCM5 medium. After 24 h, exponentially growing cells (about l-l.5 X 1Oh cell per flask) were treated with sodium arsenite at different concentrations. The chemical was freshly dissolved in serum-free F12 medium. The cells were incubated in the presence of the chemical for 4 h and then washed .3 times with Dulbecco’s phosphate-buffered saline (PBS). 2.3. Determinutim gpt r?lutunts
of‘ cytotosicity
cmd selectior~ (!f’
Our previously published procedure was used to determine both cytotoxicity and mutagenicity (Hsie
et al.. 1975; O’Neill et al., 1977). For determination of cytotoxicity. 200 treated cells were plated in triplicate onto 60-mm dishes in 5 ml F12FCMS. After 7 days of incubation. the colonies were counted and cytotoxicity was expressed as percent survival relative (RS) to those from similarly plated untreated control. For determination of mutagenicity. the treated cells were maintained in F12FCM5 for expression of the mutant phenotype, and one or two subcultures were performed during this period depending on the extent of cell survival after chemical treatment. At the end of expression (7 days), 3 X IO’ cells were plated onto each of five IOO-mm dishes in hypoxanthine-free F12 medium containing 5% dialyzed fetal calf serum and 10 yM 6-TG. The survival of these cells was determined by plating 200 cells in triplicate onto 60-mm dishes with the TG-free and hypoxanmine-free Fl:! medium. Mutatant frequency was calculated as the number of TG resistant colonies per IO’ clonable cells at the end of selection (7 days). For the selection of gpt mutants at the end of expression period, 2 X 10’ cells from the cultures of each original 60-mm dish were plated in each of five IOO-mm dishes to select for independent mutants in hopyxathine-free F,, FCM, medium containing IO I_LM6-TG. After a 7-day incubation, only one mutant colony was picked from five IOO-mm mutant-selecderived mutant tion dishes. This independently colony was isolated by trypsinization in a stainless steel ring sealed to the bottom of the dish with autoclaved silicone lubricant (Dow Corning). The isolated mutant colonies were then grown to approx. 2 X I@’ cells in medium FlZFCM5 for molecular analyses (An and Hsie. 1993).
A modified procedure combinining the methods of Miller et al. (1988) and Engel and Hedrick (1988) was used to isolate DNA. Approx. 2 X 1Oh cells from each mutant were trypsinized and collected in a ?.O-ml microcentrifuge tube, followed by resuspension of the cells in 300 ~1 of ice-cold RNA lysis buffer (0.14 M NaCl, 1.5 mM 10 mM Tris-HCI. pH 7.8). 20 p_l of IO% M&l?, Nonidet P40 (USB) was added to the above mixture. followed by incubation in ice for 5 min. After cen-
Z. Meng, A. W. Hsie /Mutation Table I Cytotoxicity
and mutagenicity
of sodium arsenite in AS52 cells *
Chemical
Concentration
RS (o/o) MF+ SD ( X lO-6)
Sodium arsenite
none 50 pM 100 JLM
100.00 24.04 15.13
EMS
3222 pM
60.19
50.78 + 11.66 80.07 + 14.20 101.25+ 16.66 479.50*
121.83
* Means are from three independent experiments. The cytotoxicity is measured by the cloning effeciency (CE) and expressed as Relative Survival (RS). For comparision, the CE values of control are set at 100%. All treatment values are expressed as a percentage of the control values. The absolute values of CE for controls are ranged from 70% to 90% for AS52 cells. EMS, ethyl methanesulfonate.
trifugation of 8000 r-pm for 5 min, the supematant was discharged. The nuclear pellet was resuspended in 300 p,l of DNA lysis buffer (10 mM Tris-HCl. 400 mM NaCl, 2 mM Na,EDTA, pH 8.2). The nuclear lysates were incubated overnight at 37°C with 30 ~1 10% sodium dodecyl sulfate (SDS), and 10 pl of 10 mg/ml proteinase K (0.5 mg proteinase K in 1% SDS and 2 mM Na,EDTA), followed by mixing with 150 p,l saturated NaCl and vortexing for 10 s, and centrifugation at 8000 rpm for 20 min. The supernatant was mixed with 2 ~01s. of pre-cold absolute ethanol in a fresh tube and the DNA was precipitated by inverting the tube several times. After 20 min of centrifugation at 13 000 rpm, the DNA pellet was washed with 70% ethanol, dried, and then resuspended in distilled water. 2.5. PCR deletion screening Oligonucleotide primers for PCR amplification were synthesized on a 380B DNA synthesizer (Applied Biosystems). A nested PCR procedure to am-
Table 2 Deletion proportion
Spontaneous
mutants
Induced mutants - 50 pM arsenite - 100 p,M arsenite
of spontaneous
and enhanced
GPT-mutants
Research 356 (1996) 255-2.59
257
plify the gpt gene was adapted (Tindall and Stankowski Jr., 1989). The primer sequences of the gpt gene were based on Tindall and Stankowski Jr. (1989). They were XPl; .t9,AAGCTTG GACACAAGACAGGCT (+ >; XP2:,,, ACAAAGATCCGGGGCCCACTCA (-- >; XP5: _,,86GTGCGCCAGATCTCTATAATCTCGCGC (+); XP6: ,,sAGGGTTTCGCTCAGGTTTGCCTGTGTC (- >. XPl and XP2 served as a pair of external primers used in the first round of PCR amplification. XP5 and XP6 were used in the second round of PCR amplification as a pair of internal primers. Both rounds of PCR were carried out in a 30-pl mixture containing 200 ng of template DNA, 2 mM MgCl,, 50 mM KCl, 10 mM Tris-HCl, 0.25 mM of each dNTP and 0.08 (LM of each primers. Overlaid with light mineral oil, the samples were run in 94°C 20 s; 57”C, 20 s; and 72°C 20 s, for 15 cycles in the first round and 25 cycles in the second round. 3 p_l of the product of the gpt gene amplification were analyzed by electrophoresis on 1.5% agarose gels stained with ethidium bromide.
3. Results 3.1. Cytotoxicity
and mutagenicity
of sodium arsenite
Sodium arsenite-induced cytoxicity and mutagenicity were assessed by AS52/gpt assay. Treatment of As,, cells with sodium arsenite at the concentrations from 50 to 100 pM for 4 h resulted in dose-dependent increases in cell lethality and mutant frequency (Table 1). The results indicate that in the tested arsenite concentrations, the highest arsenite-induced mutant frequency (MF) in AS52 cells was 101.25 X 10e6,
in AS52 cells
Total mutants isolated t%)
Percentage
of non-deletion
mutants (%o)
50 (100)
32 (64.00)
18 (36.00)
53 (100) 21(100)
24 (45.28) 7 (33.33)
29 (54.72) 14 (66.67)
Percentage
of deletion mutant (%I
MW 1
2
3 4
5
6
7
8
9
10
11
out of SO): that of the 50 p_M arsenite-enhanced mutants was 54. 72% (29 out of 53); and that of the IO0 pM arsenite-enhanced mutants was 66.67% (14 out of 2 I) (Table 2). High proportion of the gpt gene deletion in arsenite-enhanced mutants may be results from DNA damage caused by high cytotoxicity of the chemical. Fig. I shows some examples of the nested gpt gene amplification.
4. Discussion
which was about l-fold increase over the background frequency. These results provided very weak evidence for arsenite as a gene mutagen even if the chemical at the high concentrations. We suggest that arsenite is a comutagen to enhance an increase of spontaneous mutant frequency in AS52 cells.
Fifty-three independent 50 FM sodium arseniteand 21 independent 100 FM sodium arsenite-%y/Tr mutants. and SO independent spontaneous ,ypt mutants in AS52 cells were isolated and analyzed by the nested PCR. Screening results of the gpt gene deletions showed that the percentage of deletion mutations in the spontaneous
Our experiments reported here provide very weak evidence for arsenite as a mutagen, sodium arsenite at high concentrations (SO and 100 FM) induces barely a doubling of mutant frequency in ASS2 cells compared to spontaneous mutant frequency. This increase is generally not sufficient by the usual standards to demonstrate the mutagenicity of sodium arsenite in this mammalian cell mutagenicity assay. We suggest that the spontaneous mutants in ASS2 cells are to be induced by any unknown endogenous or exogenous factor(s). arsenite as a comutagen enhances the mutagenicity of the factor(s). It results in an increase of spontaneous mutant frequency. This is consistent with the comutagenic evidence of arsenic reported by several investigators (Rossman et al.. 1980: Lee et al.. 1985; Jan et al., 1986; Li and Rossman. 1989; Li and Rossman, 1991; Jha et al.. 1992: Weincke and Yager. 1992; Lee-Chen et al.. 1994). The comutagenicity of sodium arsenite with ultraviolet radiation has been demonstrated (Li and Rossman. 1989, 1991: Weincke and Yager, 1992). Jan et al. ( 1986) found that sodium arsenite enhanced the clastogenicity of ethyl methanesulfonate (EMS). Our results have shown that the proportion of the total ,q/>t-gene deletions in gpt mutants enhanced by arsenite at high concentrations is significantly higher ( p < 0.05, X?-test) than that in spontaneous mutants. The mechanisms for the gene deletion are complicated and may involve different pathways. fat example. DNA strand breakage, error in DNA damage repair, and other kinds of DNA damages (Hutchinson. 1985: Simic et al.. 1989; Sankaranarayanan, 1991). We suggest that the high proportion of the gene deletion in the arsenite-enhanced mutants may be due to DNA damage caused by high cytotoxicity of sodium arsenite at high doses.
2. Meng, A. W. Hsie / Mutntion Research 356 ( 1996) 255-259
Briefly, sodium arsenite, as comutagen, enhances an increase of spontaneous mutant frequency in AS52 cells. Arsenite at high doses not only could enhance the mutagenicity of exogeneous mutagens but enhance the mutagenicity of endogenous mutagenic chemicals. High proportion of the gpt-gene deletion may be due to DNA damage caused by high cytotoxicity of arsenite.
References An. J. and A.W. Hsie (1993) Polymerase chain reaction-based deletion screening of bleomycin induced 6-thioguanine-resistant mutants in Chinese hamster ovary cells: The effects of an inhibitor and a mimic of superoxide dismutase. Mutation Res., 289. 215-222. Engel, I. and S.M. Hedrick (1988) Site-directed mutations in the VDJ junctional region of a T cell receptor B-chain cause changes in antigenic peptide recognition. Cell, 54, 473-484. Hartmann, A. and G. Speit (1994) Comparative investigations of the genotoxic effects of metals in the single cell gel (SCG) assay and the sister chromatid exchange (SCE) test. Environ. Mol. Mutagen., 23, 299-305. Hsie. A.W. (1987) The use of the hpgrt versus gpt locus for quantitative mammalian cell mutagenesis, in: M.M. Moore. D.M. DeMarini, F.J. de Serres and K.R. Tindall (Eds.), Banbury Report 28: Mammalian Cell Mutagenesis, cold Spring Harbor Laboratory, Cold Spring Harbor. New York, pp. 37-46. Hsie, A.W., P.A. Brimer. T.J. Mitchell and D.G. Glosslee (1975) The dose-response relationships for ethyl methanesulfonate-induced mutations at the hypoxanthine-quanite phosphoribosyl transferase locus in Chinese hamster overy cells. Somat. Cell Genet., I, 247-261. Hsie. A.W., D.A. Casciano, D.B. Couch, D.F. Krahn, J.P. O’Neill and B.L. Whitfield (1981) The use of Chinese hamster every cells to quantify specific locus mutation and to determine mutagenicity of chemicals. Mutation Res., 86, 193-214. Hutchinson. F. (1985) Chemical changes in DNA by ionizing radiation. Prog. Nucleic Acid Res. Mol. Biol., 32, 115-154. IARC (International Agency for Research on Cancer) (1980) IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans. Vol. 20. Some Metals and Metallic Compounds, IARC Lyon. IARC (International Agency for Research on Cancer) (1990) IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to Humans. Vol. 50, Pharmaceutical Drugs, IARC. Lyon. Jan, K.Y.. R.Y. Huang and T.C. Lee (1986) Different modes of action of sodium arsenite, 3-aminobenzamide, and caffeine on the enhancement of ethyl methasulfonate clastogenicity. Cytogenet. Cell Genet.. 41, 202-208.
Jha,
759
A.N., M. Noditi. R. Nilsson and A.T. Natarajan (1992) Genotoxic effects of sodium arsenite on human cells. Mutation Res.. 284, 215-221. Lee, T.C., R.Y. Huang and K.Y. Jan (1985) Sodium arsenite enhances the cytotoxicity, clastogenicity. and h-thioquanineresistance mutagenicity of ultraviolet light in Chinese hamster ovary cells. Mutation Res.. 148, 83-86. Lee-Chen, S.F.. C.T. Yu. D.R. Wu and K.Y. Jan (1994) Differential effects of luminol. nickel, and arsenite on the rejoining of ultraviolet light and alkylation-induced DNA breaks. Environ. Mol. Mutagen., 23, 116-120. Li, J.H. and T.G. Rossman (1989) Mechanism of comutagenesis of sodium arsenite with N-methyl-N-nitrosourea. Biol. Trace Element Res.. 21, 373-381. Li. J.H. and T.G. Rossman (1991) Comutagenesis of sodium arsenite with ultraviolet radiation in Chinese hamster V79 cells. Biol. Metals. 4, 197. Michaelis, K.. L. Helvering. D. Kinding. M. Garriott and K. Richardson (1994) Localization of the xanthine-guanine phosphoribosyltransferase gene f gpr) of E. cdi in AS52 metaphase cells by fluorescence in situ hybridization. Environ. Mol. Mutagen., 19 (Suppl. 20). 42. Miller, S.A., D.D. Dykes and H.F. Polesky (1988) A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acid Res., 16. 1215-1221. Moore, M.M., K. Harrington-Brock and C.L. Doerr f 1995) Genotoxicity of arsenic and its methylated metabolites. Submitted. O’Neill, J.P.. D.B. Couch, R. Machanoff, J.R. San Sebastian, P.A. Breimer and A.W. Hsie (1977) A quantitative assay of mutation induction at the hypoxanthine-quanine phosphoribosyltransferase locus in Chinese hamster ovary cells fCHO/HGPRT system): Utilization with a variety of mutagenic agents. Mutation Res., 45, 9L-101. Rossman, T.G.. M. Stone, M. Molina and W. Troll (1980) Absence of arsenite mutagenicity in Escherichia coli and Chinese hamster cells. Environ. Mutagen.. 2, 37 l-379. Sankaranarayanan, K. (1991) Ionizing radiation and genetic risks 111; Nature of spontaneous and radiation-induced mutations in mammalian in vitro systems and mechanisms of induction of mutations by radiation. Mutation Res., 258, 75-97. Simic, M.G., D.S. Bergtold and L.R. Karam (1989) Generation of oxy radicals in biosystems. Mutation Res.. 214. 3-12. Tindall. K.R. and L.F. Stankowski Jr. (1989) Molecular analysis of spontaneous mutations at the gpt locus in Chinese hamster ovary fAS52) cells. Mutation Res.. 220, 241-253. Tindall, K.R., L.F. Stankowski Jr.. R. Machanoff and A.W. Hsie (1984) Detection of deletion mutations of pSV2 gpt-transformed cells. Mol. Cell. Biol.. 4. 141 I-1415. Tindall, K.R., L.F. Stankowski Jr.. R. Michanoff and A.W. Hsie (1986) Analyses of mutation of pSV2 gpt-transformed CHO cells. Mutation Res.. 160. 121-131. Weincke, J.K. and J.W. Yager (1992) Specificity of arsenite in potentiating cytogenetic damage induced by the DNA crosslinking agent diepoxybutane. Environ. Mol. Mutagen., 19. 195-200.