- Email: [email protected]
Polyphyletism of Celastrales Deduced from a Chloroplast Noncoding DNA Region
MOLECULAR PHYLOGENETICS AND EVOLUTION
Vol. 7, No. 2, April, pp. 145–157, 1997 ARTICLE NO. FY960380
Polyphyletism of Celastrales Deduced from a Chloroplast Noncoding DNA Region Vincent Savolainen,*,† Rodolphe Spichiger,* and Jean-Franc¸ois Manen* *Laboratoire de Botanique Syste´matique et Floristique, Conservatoire et Jardin Botaniques de la Ville de Gene`ve, CH-1292 Chambe´sy, Geneva, Switzerland; and †Laboratory of Molecular Systematics, Royal Botanic Gardens, Kew, Surrey TW9 3DS, United Kingdom Received January 18, 1996; revised May 20, 1996
In a previous study we examined the phylogeny of four families related to the angiosperm order Celastrales based on chloroplast rbcL 58 flanking sequences. We have added here several additional dicots, sampled from 6 of the 7 families of Celastrales sensu Cronquist and 19 putatively related genera. Based on a cladistic analysis of these DNA sequences, the order Celastrales appears polyphyletic: it is here restricted to Celastraceae (including Hippocrateaceae and Brexia) with Parnassia as sister; Aquifoliaceae plus Helwingia are included in Asteridae. Neither Salvadoraceae nor Geissolomataceae, Icacinaceae, Phellinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Stackhousiaceae, or Goupiaceae are related to Celastrales. The usefulness of this noncoding region is discussed and the influence of the A 1 T content of neighboring bases on the increase of transversions is also observed as previously shown in chloroplast noncoding regions of monocots. r 1997 Academic Press
INTRODUCTION From a morphological perspective, the order Celastrales mainly comprises woody plants with small tetraor pentamerous flowers in which the single set of stamens is alternate with the petals (Cronquist, 1981). Cronquist (1981), whose classification scheme is one of the most widely used, defined the order as including the families Celastraceae (incl. Goupiaceae), Hippocrateaceae, Aquifoliaceae (incl. Phellinaceae, Sphenostemonaceae), Icacinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Geissolomataceae, Salvadoraceae, Stackhousiaceae, and Cardiopteridaceae. This circumpscription has, however, been questioned by several other authors (e.g., Dahlgren, 1975, 1983; Thorne, 1983, 1992). In a previous article in Molecular Phylogenetics and Evolution we examined the phylogeny of four families related to Celastrales based on the rbcL 58 flanking sequences (Savolainen et al., 1994). This analysis based on a noncoding region showed that the two families
Aquifoliaceae and Icacinaceae were not related to Celastraceae and Hippocrateaceae (Spichiger et al., 1993; Savolainen et al., 1994), although these two latter form the core of the order. Analysis of the rbcL coding region itself also separated Aquifoliaceae and Celastraceae, rendering Celastrales sensu Cronquist at least diphyletic (Chase et al. 1993, Morgan and Soltis 1993, Olmstead et al., 1993). In these previous studies, however, representatives of several smaller families were not available. We now have included members of all the families mentioned above (except Cardiopteridaceae and Sphenostemonaceae, for which we could not acquire material) as well as 19 putatively related genera (Table 1). These geographically restricted families are of great interest from an evolutionary point of view. For example Geissolomataceae, which has a single species in South Africa (Geissoloma marginatum Juss.), was suggested as being the ancestral family derived from Rosales by Cronquist (1981). Additionally, Aextoxicaceae, which has a single species in Chile (Aextoxicon punctatum Ruiz & Pav.), was considered, with Dichapetalaceae, as intermediate between Celastrales and Euphorbiales (Cronquist, 1981). Thus, we present here a much expanded molecular phylogeny for the order Celastrales, based on a cladistic analysis of the rbcL 58 flanking chloroplast region (atpB–rbcL spacer). The procedure described by Morton (1995) was also used to analyze the influence of flanking base composition upon substitutions in this noncoding DNA region among dicots. MATERIALS AND METHODS Total DNAs of species listed in Table 1 were extracted using the method of Webb and Knapp (1990) as modified by Savolainen et al. (1994) or with the method of Gustinchich et al. (1991). The chloroplast atpB–rbcL spacer was amplified by the polymerase chain reaction (standard PCR) with oligonucleotides 2 (58GAAGTAGTAGGATTGATTCTC38) and 5 (58TACAGTTGTCCATGTACCAG38). Amplified fragments were then purified by electrophoresis in 1% agarose gels and eluted from the
145
1055-7903/97 $25.00 Copyright r 1997 by Academic Press All rights of reproduction in any form reserved.
146
SAVOLAINEN, SPICHIGER, AND MANEN
TABLE 1 List of Plant Samples with Voucher Specimens or Source and EMBL/GenBank Accession Numbers of DNA Sequences Taxa Aextoxicaceae (AEX) Aextoxicon punctatum Ruiz & Pav. Aquifoliaceae (AQF) Ilex aquifolium L. Ilex pernyi Franchet Ilex ciliospinosa Loes. Ilex crenata Thunb. Nemopanthus mucronatus Druce Asteraceae (AST) Bellis perennis L. Brexiaceae (BRX) Brexia madagascarensis Thouars Buxaceae (BUX) Buxus sempervirens L. Celastraceae (CEL) Euonymus bungeanus Maxim. Euonymus maackii Komarov Siphonodon australe Benth. Cornaceae (COR) Cornus mas L. Helwingia japonica F. Dietr. Corynocarpaceae (CNC) Corynocarpus laevigatus Forst. Cunoniaceae (CNN) Weinmannia sylvicola Soland. Dichapetalaceae (DCH) Dichapetalum crassifolium Chod. Escalloniaceae (ESC) Roussea simplex Sm. Euphorbiaceae (EUP) Euphorbia esula L. Euphorbia dulcis L. Euphorbia characias L. Mercurialis annua L. Geissolomataceae (GSL) Geissoloma marginatum Juss. Goupiaceae (GOU) Goupia glabra Aubl. Hippocrateaceae (HPC) Hippocratea richardiana Cambess. Salacia pallescens Oliver Hydrangeaceae (HDR) Kirengeshoma palmata Yatabe
Voucher/source
Accession no.
Savolainen & Guisan, 403289 G
X83986
Savolainen iaq4 G Savolainen ipe3 G Bot. Gard. Geneva Nagamasu s.n. K Chase 119 NCU Savolainen nmul G
X69741 X69744 X69742 X91003 L01928 X69747
Bot. Gard. Geneva
X91000
Schwerdtfeger 25471 B
X83987
Haute-Savoie, France
X69729
Savolainen 0016 G
X69734
Savolainen ema6 G
X69738
Gadek & Fernando 21750 UNSW
X83996
Bot. Gard. Geneva Kew 1953-24705
X83988 X94941
Sample from P. Morat, P
X69731
Bot. Gard. Geneva
X69756
Abidjan, Ivory Cost
X69733
Mauritius Sugar Industry Res. Instit.
X83995
Savolainen 0010 G Savolainen 0018 G Bot. Gard. Geneva Savolainen 0019 G
X69737 X69736 X69735 X69745
Claremont, South Africa
X83990
Pre´vost 3031 CAY
X83991
Savolainen hri5 G
X69740
Van Der Laan 373 WAG
X69754
Bot. Gard. Geneva
X83993
TABLE 1—Continued Taxa Icacinaceae (ICC) Icacina mannii Oliver Lecythidaceae (LCY) Eschweilera simiorum Eyma Magnoliaceae (MAG) Magnolia liliflora Desr. Olacaceae (OLC) Heisteria parvifolia Sm. Phellinaceae (PLN) Phelline comosa Labill. Rhamnaceae (RHM) Rhamnus cathartica L. Colletia armata Miers Rosaceae (ROS) Rosa damascena Mill. Geum coccineum Smith cv. borisii Malus X domestica Borck. Salvadoraceae (SLV) Salvadora persica L. Saxifragaceae (SAX) Parnassia fimbriata Banks Stackhousiaceae Stackhousia minima Hook Theaceae (TEA) Camellia sinensis Kuntze
Voucher/source
Accession no.
Van Setten 460 WAG
X69743
Pre´vost CAY
X91001
Savolainen 0017 G
X69746
Abidjan, Ivory Cost
X83992
Savolainen pcol G
X69748
Savolainen 0011 G Savolainen 0012 G
X69752 X69730
Savolainen 0013 G Savolainen 0014 G
X69753 X69739
Horticulture Centre, Lullier
X69749
Sample from B. Verdcourt, K
X69755
Soltis & Soltis s.n. WS
X83989
Soltis & Soltis s.n. WS
L01939
Molloy s.n. CHR
X94940
Savolainen csi2 G
X69732
gel using Prep-A-Gene (Bio-Rad). Double-strand DNA was sequenced directly following the snap-cooling method of Kusukawa et al. (1990). Both strands were sequenced for 50–75% using the amplification primers and additional 7 (58CCCTACAACTCATGAATTAAG38), 10 (58CATCATTATTGTATACTCTTTCC38), and 11 (58GTAAATCCTAGATGTAAAA38) internal primers (but approximately 50 base pairs were not determined in Kirengeshoma, Weinmannia, and Aextoxicon; see Fig. 1). Because noncoding regions often show a high rate of indels which requires introduction of numerous gaps in the alignment, the following procedures were performed previously to cladistic analysis: an initial alignment was set up using PILEUP (Genetics Computer Group, GCG software, Version 7.3-AXP, 1993, Madison, WI) with gapweight 5 3 and lengthweight 5 0.1; then minor adjustments were made in order to align accurately the promoter sequences of the adjacent genes
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
that we know to be homologous (Manen et al., 1994a), to reach a 1307-site matrix; finally 646 sites were deleted because no satisfactory alignment was performed (see Fig. 1). PAUP 3.1.1 (Swofford, 1993) was used to search for the most parsimonious trees (heuristic search using 1000 random replicates). PAUP also served to calculate the consistency index (CI) and the retention index (RI) (Swofford, 1993) and to perform 100 bootstrap replicates to evaluate the strength of the nodes (Felsenstein, 1985). The jackknife procedure (Farris et al., 1996) was used to perform 1000 jackknife replicates using PAUP 4.0.0 (jackknife with 50% deletion, fast stepwiseaddition, retain groups with frequency . 63%, test version d41 kindly provided by D. Swofford). The A 1 T content of neighboring base for transitions and transversions was scored in terms of the number of As and Ts at the two sites (numbered 0, 0.5, 1, 1.5, and 2; 0.5 and 1.5 were scored when A 1 T content was conserved at only one of the sites as a result of neighboring substitution events; Morton, 1995). These calculations were made for 19 pairwise comparisons of closely related taxa (Table 2) for which the alignments were unambiguous to avoid spurious and multiple substitutions. We assume that the bias of scoring some single events several times through pairwise comparison does not alter the conclusions that we made under Discussion since it is distributed equally in the elements that we compared. RESULTS In the final DNA matrix which included 40 taxa and 661 sites (Fig. 1), 530 (80.2%) were variable and 391 TABLE 2 Transversion/Transition Ratio and A 1 T Contents of Neighboring Bases for 19 Pairwise Comparison (Euonymus/Siphonodon, Euonymus/Hippocratea, E. bungeanus/E. maackii, Rosa/Geum, Ilex/Phelline, Ilex/Nemopanthus, Phelline/Nemopanthus, Ilex/Helwingia, Brexia/Parnassia, Hippocratea/Parnassia, Hippocratea/Salacia, Salacia/Siphonodon, Hippocratea/Siphonodon, Dichapetalum/Euphorbia, Colletia/Rhamnus, Cornus/Kirengeshoma, Malus/Rosa, Eschweilera/Camellia, and Bellis/ Roussea) A 1 T Content
Tv
Ts
% Tv
Tv/Ts
0 0.5 1 1.5 2
10 16 84 19 118
30 19 105 30 103
25.0 45.7 44.4 38.8 53.4
0.33 0.84 0.80 0.63 1.14
Note. The proportion of transversions increases significantly when the A 1 T content of immediately neighboring bases increase: only 25% of the substitutions are transversions when A 1 T content 5 0 whereas 53.4% of the observed substitutions are transversions when both flanking nucleotides are A or T (x 2 5 13.57, P , 0.01).
147
(59.2%) were informative. The cladistic analysis of these characters resulted in 36 equally most parsimonious trees after 1000 replicates (length 1243 steps, CI 0.595, RI 0.655); the strict consensus is presented in Fig. 2. The order Celastrales appears highly polyphyletic (see Discussion and Fig. 2) and restricted here to Celastraceae s.l. (Euonymus and Siphonodon, plus Hippocratea, Salacia, and Brexia; bootstrap and jackknife values 100%). Stackhousia, Dichapetalum, and Goupia are sister to Euphorbiaceae (bootstrap value 100%, jackknife value 86%). Corynocarpus, Geissoloma, and Salvadora are included within Rosidae but their respective placements are not supported by bootstrap and jackknife values. Aquifoliaceae s.s. (Ilex-Nemopanthus) are sister to Helwingia (bootstrap and jackknife values 100%). Their sister group comprises dilleniids (Eschweilera and Camellia), Icacinaceae (Icacina), and the asterid group Bellis–Phelline–Roussea (supported by a jackknife value of 86%). Cornus and Kirengeshoma are sister to the latter clades. All of them represent the group of Asteridae sensu Olmstead et al. (1993) and are supported by a bootstrap value of 100% and a jackknife value of 96%. Aextoxicon is sister to Asteridae but this placement is only supported by the bootstrap value (100%). The results from scoring neighboring base composition and Tv/Ts are presented in Table 2. The proportion of transversions increases when the A 1 T content of immediately neighboring bases increases, as already shown for the chloroplast noncoding regions in rice and maize (Morton, 1995). Only 25% of the substitutions are transversions when both the 58 and the 38 flanking nucleotides are G or C, whereas 53.4% of the observed substitutions are transversions when both flanking nucleotides are A or T. This increase is significant; by testing as a 5 3 2 table, the x2 is 13.57 (P , 0.01). DISCUSSION In a previous molecular analysis of Celastrales, we showed that it was at least diphyletic, with Aquifoliaceae and Icacinaceae being separated from Celastraceae and Hippocrateaceae (Savolainen et al., 1994). In the more comprehensive analysis presented here, we show that the order Celastrales is polyphyletic and that it is composed of at least eight distinct lineages. For example Aextoxicaceae, which Thorne (1992) put in ‘‘Taxa Incertae Sedis,’’ are here basal to Asteridae, which is in agreement with unpublished studies using the rbcL and atpB genes (Savolainen and Chase). As another example, Cronquist (1981) suggested that the simple leaves and the stamens that alternate with the sepals indicate a close relationship between Corynocarpaceae and Rhamnales. He preferred, however, to include Corynocarpaceae in the Celastrales because of the development of staminodes and some wood anatomi-
FIG. 1. Aligned DNA matrix: the atpB–rbcL spacer was aligned for 40 taxa using the program PILEUP (GCG software, gapweight 5 3, lengthweight 5 0.1), and minor adjustments were made to align promoter sequences (Manen et al., 1994a). The data matrix is 1307 sites in length but only the 661 sites for which a satisfactory alignment was performed were kept for the analysis (conserved sites are indicated by an asterisk; deleted sites are as follows: 1–40 60–69 91–105 114–121 137–142 155–160 179–185 203–235 254–258 270–275 284–321 329–345 380–385 410–413 444–471 495–501 509–538 561–566 574–723 743–750 803–819 833–950 967–989 998–1000 1015–1025 1075–1083 1111–1120 1155–1161 1175–1178 1215–1219 1234–1237 1253–1257). 148
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
FIG. 1—Continued
149
150
SAVOLAINEN, SPICHIGER, AND MANEN
FIG. 1—Continued
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
FIG. 1—Continued
151
152
SAVOLAINEN, SPICHIGER, AND MANEN
FIG. 1—Continued
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
FIG. 1—Continued
153
154
SAVOLAINEN, SPICHIGER, AND MANEN
FIG. 2. Strict consensus tree of 36 equally parsimonious cladograms (length 1243 steps, CI 0.595, RI 0.655) resulting from an heuristic search using PAUP 3.1.1. (1000 random replicates) from 40 sequences of the atpB–rbcL spacer. Bootstrap (100 replicates) followed by jackknife (1000 replicates) values are indicated above the branches in percentages. Asterisks indicate taxa which were included in Celastrales, showing that this order appears highly polyphyletic (see text).
cal characters. Our analysis, which places Corynocarpus as sister to Rhamnaceae and Rosaceae, could agree with his initial hypothesis, but based on rbcL Corynocarpus is sister to Cucurbitaceae, Datiscaceae, and Begoniaceae (Chase, personal communication) for which we have no representatives here. In the last classification of Thorne (1992), Corynocarpus also is considered as ‘‘Taxa Incertae Sedis.’’ Our analyses agree with Thorne (1992) and Takhta-
jan (1980) concerning the taxonomic position of Dichapetalaceae. Indeed, these authors placed them in Euphorbiales because of palynological characteristics. Goupiaceae and Stackhousiaceae are also sister to Euphorbiaceae in our cladograms. Thus, our results do not support the views of Cronquist (1981), who included Goupia in Celastraceae, despite considering it as an aberrant genus because of its free styles and numerous ovules.
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
Salvadoraceae are not related to Celastraceae based on our molecular data, but their close relationship with Heisteria may be due to undersampling. Indeed, based on rbcL sequences, Rodman et al. (1995) showed that Salvadora is well placed among a capparalean clade whose representatives produce ‘‘mustard oils,’’ but we have not included them in the present analysis. Once again, Salvadora was considered as ‘‘Taxa Incertae Sedis’’ by Thorne (1992). Similarly, the placement of Geissolomataceae based on the atpB–rbcL spacer analysis also may be due to undersampling. Based on rbcL, Geissolomataceae are sister to Crossosomataceae and Greyiaceae (Savolainen and Chase, unpublished results). Following the classification of Cronquist (1981, 1988), the Aquifoliaceae are generally considered close to Celastraceae. Prior to Cronquist, other botanists had considered the two families to be closely related based on their flower morphology which differs in that Aquifoliaceae do not have a nectary disk (De Candolle, 1813; Bentham and Hooker, 1862; Loesener 1901, 1908, 1942). The ovular morphology is also presented as an argument for the inclusion of Aquifoliaceae in Celastrales. Bentham and Hooker (1862) noted the similarity in the dorsal raphe and descendent placenta, whereas Loesener (1908) considered that the thick funiculus of Aquifoliaceae was homologous to the aril of Celastraceae. Pollen features also would indicate affinity between Celastraceae and Aquifoliaceae (Takhtajan 1980). Our molecular analysis does not support the traditional views, but instead places Aquifoliaceae in Asteridae sensu Olmstead et al. (1993) and Chase et al. (1993). In these latter publications of the wide-scale rbcL study, Ilex was sister to Asterales in Asteridae s.l. This placement of Aquifoliaceae in a clade containing mostly gamopetalous plants is supported because its petals are often connate into a tube and because of its unitegmic ovules. A similar hypothesis was proposed by Van Tieghem (1898), who placed Aquifoliaceae near Solanaceae because of the unitegmic ovule and the isomerous alterni-petals stamens. Based on pollen studies, Lobreau-Callen (1969, 1975, 1977) also placed Aquifoliaceae near Gentianales and Campanulales. Roussea simplex, which is the only species of the genus, native to Mauritius, also has connate petals. Our data place Phelline with free petals in the Asteridae s.l., suggesting that gamopetaly may have arisen several times in the asterids (Olmstead et al., 1993). In addition, the placement of Phelline in the Bellis clade instead of in the Ilex–Nemopanthus clade supports its familial status rather than its inclusion in Aquifoliaceae, as already discussed by Baas (1975), studying vegetative anatomy. This latter author also pointed out that even if Aquifoliaceae are often regarded as close to Celastraceae, they do not have many anatomical features in common (Baas, 1975). Aquifoliaceae (Ilex,
155
Nemopanthus, excl. Phelline) and Phellinaceae are thus definitely out of place in the order Celastrales. Icacinaceae were included in Celastrales by Cronquist (1981, 1988), in Theales by Thorne (1983), and in Cornales by Dahlgren (1983) and by Thorne (1992). Their unitegmic ovules and connate petals support their placement within asterids, as suggested by our molecular data. Because Icacinaceae, Aquifoliaceae, and Phellinaceae retain many primitive wood anatomical features, Baas (1975) suggested that they could constitute a natural assemblage of families. Our analysis agrees with this view since they are all included in asterids, although they do not form a monophyletic group. A broader study based on the rbcL and atpB genes shows that Icacinaceae are close to lamiids sensu Takhtajan (1980) whereas Phellinaceae would form a separate lineage with Roussea (Savolainen and Chase, unpublished results). Finally, Celastrales are restricted in our analysis to Celastraceae s.l. (including Hippocrateaceae and Brexia), sister to Parnassia (Saxifragaceae). This is in agreement with the rbcL analysis of Chase et al. (1993) and Morgan and Soltis (1993), who also resolved a clade comprising Euonymus (Celastraceae)–Brexia–Parnassia. Because our analysis places Hippocrateaceae (i.e., Salacia and Hippocratea) within Celastraceae (i.e., between Siphonodon and Euonymus), we do not support the familial status proposed by Cronquist (1981) for Hippocrateaceae. CONCLUSION Noncoding DNA sequences, such as chloroplast gene spacers or internal transcribed spacers of nuclear ribosomal genes, are often more variable than coding sequences and thus their use could be considered more appropriate at lower taxonomic levels (Manen et al., 1994b; Gielly and Taberlet, 1994; Smith and Klein, 1994). However, when used in distantly related taxa, these regions have often shown a rate of indels at least as high as the rate of substitutions, associated with short repeats (Clegg and Zurawski, 1992). Their alignment is thus difficult and requires introduction of numerous gaps (Zurawski et al., 1984; Golenberg et al., 1993). For these reasons, some authors prefer to use rapidly evolving genes such as matK (e.g., Johnson and Soltis, 1994) to infer phylogeny at a low taxonomic level, whereas others propose sophisticated methods to analyze indels in noncoding regions (e.g., Gatesy et al., 1993; Barriel, 1994). Golenberg et al. (1993) questioned the usefulness of the atpB–rbcL spacer used here, arguing that indels often occur at labile sites and may result in spurious homologies. This is obviously true for some indels, but an examination in which indels were coded as a character by shared length and position would indicate that
156
SAVOLAINEN, SPICHIGER, AND MANEN
more than 60% are autapomorphic and that those remaining are not more homoplastic than nucleotide substitutions (CIs and RIs did not differ by more than 0.02, data not shown). Gaps are, however, biased when using programs which estimate distances to generate initial pairwise alignments (Morton, 1995). To avoid this bias we have deleted approximately 50% of the sites, keeping for the analysis only those for which a satisfactory alignment was performed. These features would not, however, seriously affect the analysis since we obtained similar results after 1000 heuristic replicates using all sites (data not shown). If indel problems can be avoid by deleting these sites from the analysis, substitutions themselves are subject to bias. We have shown that neighboring bases influence the nature of the substitutions, with regions with a higher A 1 T content having a higher proportion of transversions as already reported for chloroplast regions (including the atpB–rbcL spacer) in two monocot species (Morton, 1995). This latter observation clearly violates the site independence which is often postulated in phylogenetic reconstructions, and it is just one illustration of the complexity of evolutionary processes in DNA sequences. Despite the lack of knowledge concerning the evolution of the noncoding region studied here, the phylogenetic information contained in these DNA sequences seems reliable enough to infer the correct phylogeny. Indeed, the results presented here are in agreement with analysis using the rbcL and atpB adjacent coding sequences (Chase et al., 1993; Savolainen and Chase, unpublished results) whereas our results disagree with the definitions of the order Celastrales as proposed by Bentham and Hooker (1862), Scholz (1964), Dahlgren (1983), Takhtajan (1980), Cronquist (1981, 1988), and Thorne (1992). ACKNOWLEDGMENTS We are especially grateful to institutions and persons who provided plant samples. We also thank A. Bruneau, M. W. Chase, P. Cue´noud, M. D. P. Martinez, C. Morton, G. Reeves, and C. Thebaud, as well as the Swiss National Foundation for Scientific Research, the City of Geneva, the Royal Botanic Gardens of Kew, and the Royal Society, which partially supported this work.
REFERENCES Barriel, V. (1994). Phyloge´nies mole´culaires et insertions-de´le´tions de nucle´otides. C. R. Acad. Sci. Paris 317: 693–701. Baas, P. (1975). Vegetative anatomy and the affinities of Aquifoliaceae, Shenostemon, Phelline, and Oncotheca. Blumea 22: 311–407. Bentham, C., and Hooker, J. D. (1862). ‘‘Genera Plantarum,’’ London. Candolle De, A. P. (1813). ‘‘The´orie e´le´mentaire de la botanique,’’ Paris. Chase, M. W., Soltis, D. E., Olmstead, R. G., Morgan, D., Les, D. H., Mishler, B. D., Duvall, M. R., Price, R. A., Hills, H. G., Qiu, Y.-L., Kron, K. A., Rettig, J. H., Conti, E., Palmer, J. D., Manhart, J. R.,
Sytsma, K. J., Michaels, H. J., Kress, W. J., Karol, K. G., Clark, W. D., Hedren, M., Gaut, B. S., Jansen, R. K., Kim, K.-J., Wimpee, C. F., Smith, J. F., Furnier, G. R., Strauss, S. H., Xiang, Q.-Y., Plunkett, G. M., Soltis, P. S., Swensen, S. M., Williams, S. E., Gadek, P. A., Quinn, C. J., Eguiarte, L. E., Golenberg, E., Learn Jr, G. H., Graham, S. W., Barrett, S. C., Dayanandan, S., and Albert, V. A. (1993). Phylogenetics of seed plants: An analysis of nucleotide sequences from the plastid gene rbcL. Ann. Missouri Bot. Gard. 80: 528–580. Clegg, M. T., and Zurawski, G. (1992). Chloroplast DNA and the study of plant phylogeny: Present status and future prospects. In ‘‘Molecular Systematics of Plants’’ (D. E. Soltis, P. S. Soltis, and J. Doyle, Eds.), Chapman & Hall, New York. Cronquist, A. (1981). ‘‘An integrated system of classification of flowering plants,’’ Columbia Univ. Press, New York. Cronquist, A. (1988). ‘‘The Evolution and Classification of Flowering Plants,’’ Allen Press, Lawrence, KS. Dahlgren, R. (1975). The distribution of characters within an angiosperm system. Bot. Notiser 128: 181–197. Dahlgren, R. (1983). General aspects of angiosperm evolution and macrosystematics. Nordic J. Bot 3: 119–149. Farris, J. S., Albert, V. A., Kallersjoj, M., Lipscomb, D., and Kluge, A. G. (1996). Parsimony jackknifing outperforms neighbourjoining. Cladistics, in press. Felsenstein, J. (1985). Confidence limits on phylogenetics: An approach using the bootstrap. Evolution 39: 783–791. Gatesy, J., DeSalle, R., and Wheeler, W. (1993). Alignment-ambiguous nucleotide sites and the exclusion of systematic data. Mol. Phylogenet. Evol. 2: 152–157. Gielly, L., and Taberlet, P. (1994). The use of chloroplast DNA to resolve plant phylogeny: Noncoding versus rbcL coding sequences. Mol. Biol. Evol. 11: 769–777. Golenberg, E. M., Clegg, M. T., Durbin, M. L., Doebley, J., and Pow Ma, D. (1993). Evolution of a noncoding region of the chloroplast genome. Mol. Phylogenet. Evol. 2: 52–64. Gustincich, S., Manfioletti, G., Del Sal, G., Schneider, C., and Carninci, P. (1991). A fast method for high-quality genomic DNA extraction from whole human blood. BioTechniques 11: 298–302. Johnson, L. A., and Soltis, D. E. (1994). matK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. str. Syst. Bot. 19: 143–156. Kusakawa, N., Uemori, T., Asakada, K., and Kato, I. (1990). Rapid and reliable method protocol for direct sequencing of material amplified by polymerase chain reaction. BioTechniques 9: 66–72. Lobreau-Callen, D. (1969). Les limites de l’ ‘‘ordre’’ des Ce´lastrales d’apre`s le pollen. Pollen Spores 11: 499–555. Lobreau-Callen, D. (1975). ‘‘Le pollen des Ce´lastrales et groupes apparente´s,’’ The`se Doct. Sc. Nat., Univ. du Languedoc, A.O. au C.N.R.S., 8071, Montpellier. Lobreau-Callen, D. (1977). Nouvelle interpre´tation de l’ ‘‘ordre’’ des Ce´lastrales a` l’aide de la palynologie. C. R. Acad. Sci. Paris 284: 915–918. Loesener, T. (1901). Monographia Aquifoliacerum I. nova Acta Acad. Caes. Leop.-Carol. German Nat. Cur. 78. Loesener, T. (1908). Monographia Aquifoliacerum II. nova Acta Acad. Caes. Leop.-Carol. German Nat. Cur. 89. Loesener, T. (1942). Aquifoliaceae. In ‘‘Nat. Pflanzen-Fam. Aufl. 2., 20b’’ (Engler and Prantl., Eds.), pp. 36–86, Borntra¨ger, Berlin. Maddison, W. P., and Maddison, D. R. (1992). ‘‘MacClade: Analysis of Phylogeny and Character Evolution. Version 3.04,’’ Sinauer Associates, Sunderland, MA. Manen, J.-F., Savolainen, V., and Simon, P. (1994a). The atpB and
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA rbcL promoters in plastid DNAs of a wide dicot range. J. Mol. Evol. 38: 577–582. Manen, J.-F., Natali, A., and Ehrendorfer, F. (1994b). Phylogeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region. Plant Syst. Evol. 190: 195–211. Morgan, D. R., and Soltis, D. E. (1993). Phylogenetic relationships among members of Saxifragaceae sensu lato based on rbcL sequence data. Ann. Missouri Bot. Gard. 80: 631–660. Morton, B. R. (1995). Neighboring base composition and transversion/ transition bias in a comparison of rice and maize chloroplast noncoding regions. Proc. Natl. Acad. Sci. USA 92: 9717–9721. Olmstead, R. G., Bremer, B., Scott, K. M., and Palmer, J. D. (1993). A parsimony analysis of the Asteridae sensu lato based on rbcL sequences. Ann. Missouri Bot. Gard 80: 700–722. Rodman, J. E., Karol, K., Price, R., and Savolainen, V. (1995). Salvadoraceae are Capparalean, all but one of the mustard oil taxa form a monophyletic clade and Dahlgren was right. Abstract. Am. J. Bot. S82: 459. Savolainen, V., Manen, J.-F., Douzery, E., and Spichiger, R. (1994). Molecular phylogeny of families related to Celastrales based on rbcL 58 flanking sequences. Mol. Phylogenet. Evol. 3: 27–37. Scholz, A. (1964). Aquifoliaceae. In ‘‘A Engler’s Syllabus Der Pflanzenfamilien’’ (Melchior, Ed.), Borntra¨ger, Berlin. Smith, D. E., and Klein, A. S. (1994). Phylogenetic inferences on the
157
relationships of North American and European Picea species based on nuclear ribosomal 18S sequences and the internal transcribed spacer 1 region. Mol. Phylogenet. Evol. 3: 17–26. Spichiger, R., Savolainen, V., and Manen, J. F. (1993). Systematic affinities of Aquifoliaceae and Icacinaceae from molecular data analysis. Candollea 48: 459–464. Swofford, D. L. (1993). ‘‘PAUP: Phylogeny Analysis Using Parsimony, Version 3.1.1,’’ computer program distributed by the Smithsonian Institution. Takhtajan, A. (1980). Outline of the classification of flowering plants. Bot. Rev. 46: 225–359. Thorne, R. F. (1983). Proposed new realignments in the angiosperms. Nordic J. Bot. 3: 85–117. Thorne, R. F. (1992). Classification and geography of the flowering plants. Bot. Rev. 58: 225–348. Van Tieghem, P. (1898). Structure de quelques ovules et parti qu’ on peut tirer pour ame´liorer la classification. J. Bot. Morot. 13/14: 199–201. Webb, D. M., and Knapp, S. J. (1990). DNA extraction from previously recalcitrant plant genus. Plant Mol. Biol. 8: 180–185. Zurawski, G., Clegg, M. T., and Brown, A. H. D. (1984). The nature of nucleotide sequence divergence between barley and maize chloroplast DNA. Genetics 106: 735–749.
Vol. 7, No. 2, April, pp. 145–157, 1997 ARTICLE NO. FY960380
Polyphyletism of Celastrales Deduced from a Chloroplast Noncoding DNA Region Vincent Savolainen,*,† Rodolphe Spichiger,* and Jean-Franc¸ois Manen* *Laboratoire de Botanique Syste´matique et Floristique, Conservatoire et Jardin Botaniques de la Ville de Gene`ve, CH-1292 Chambe´sy, Geneva, Switzerland; and †Laboratory of Molecular Systematics, Royal Botanic Gardens, Kew, Surrey TW9 3DS, United Kingdom Received January 18, 1996; revised May 20, 1996
In a previous study we examined the phylogeny of four families related to the angiosperm order Celastrales based on chloroplast rbcL 58 flanking sequences. We have added here several additional dicots, sampled from 6 of the 7 families of Celastrales sensu Cronquist and 19 putatively related genera. Based on a cladistic analysis of these DNA sequences, the order Celastrales appears polyphyletic: it is here restricted to Celastraceae (including Hippocrateaceae and Brexia) with Parnassia as sister; Aquifoliaceae plus Helwingia are included in Asteridae. Neither Salvadoraceae nor Geissolomataceae, Icacinaceae, Phellinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Stackhousiaceae, or Goupiaceae are related to Celastrales. The usefulness of this noncoding region is discussed and the influence of the A 1 T content of neighboring bases on the increase of transversions is also observed as previously shown in chloroplast noncoding regions of monocots. r 1997 Academic Press
INTRODUCTION From a morphological perspective, the order Celastrales mainly comprises woody plants with small tetraor pentamerous flowers in which the single set of stamens is alternate with the petals (Cronquist, 1981). Cronquist (1981), whose classification scheme is one of the most widely used, defined the order as including the families Celastraceae (incl. Goupiaceae), Hippocrateaceae, Aquifoliaceae (incl. Phellinaceae, Sphenostemonaceae), Icacinaceae, Aextoxicaceae, Corynocarpaceae, Dichapetalaceae, Geissolomataceae, Salvadoraceae, Stackhousiaceae, and Cardiopteridaceae. This circumpscription has, however, been questioned by several other authors (e.g., Dahlgren, 1975, 1983; Thorne, 1983, 1992). In a previous article in Molecular Phylogenetics and Evolution we examined the phylogeny of four families related to Celastrales based on the rbcL 58 flanking sequences (Savolainen et al., 1994). This analysis based on a noncoding region showed that the two families
Aquifoliaceae and Icacinaceae were not related to Celastraceae and Hippocrateaceae (Spichiger et al., 1993; Savolainen et al., 1994), although these two latter form the core of the order. Analysis of the rbcL coding region itself also separated Aquifoliaceae and Celastraceae, rendering Celastrales sensu Cronquist at least diphyletic (Chase et al. 1993, Morgan and Soltis 1993, Olmstead et al., 1993). In these previous studies, however, representatives of several smaller families were not available. We now have included members of all the families mentioned above (except Cardiopteridaceae and Sphenostemonaceae, for which we could not acquire material) as well as 19 putatively related genera (Table 1). These geographically restricted families are of great interest from an evolutionary point of view. For example Geissolomataceae, which has a single species in South Africa (Geissoloma marginatum Juss.), was suggested as being the ancestral family derived from Rosales by Cronquist (1981). Additionally, Aextoxicaceae, which has a single species in Chile (Aextoxicon punctatum Ruiz & Pav.), was considered, with Dichapetalaceae, as intermediate between Celastrales and Euphorbiales (Cronquist, 1981). Thus, we present here a much expanded molecular phylogeny for the order Celastrales, based on a cladistic analysis of the rbcL 58 flanking chloroplast region (atpB–rbcL spacer). The procedure described by Morton (1995) was also used to analyze the influence of flanking base composition upon substitutions in this noncoding DNA region among dicots. MATERIALS AND METHODS Total DNAs of species listed in Table 1 were extracted using the method of Webb and Knapp (1990) as modified by Savolainen et al. (1994) or with the method of Gustinchich et al. (1991). The chloroplast atpB–rbcL spacer was amplified by the polymerase chain reaction (standard PCR) with oligonucleotides 2 (58GAAGTAGTAGGATTGATTCTC38) and 5 (58TACAGTTGTCCATGTACCAG38). Amplified fragments were then purified by electrophoresis in 1% agarose gels and eluted from the
145
1055-7903/97 $25.00 Copyright r 1997 by Academic Press All rights of reproduction in any form reserved.
146
SAVOLAINEN, SPICHIGER, AND MANEN
TABLE 1 List of Plant Samples with Voucher Specimens or Source and EMBL/GenBank Accession Numbers of DNA Sequences Taxa Aextoxicaceae (AEX) Aextoxicon punctatum Ruiz & Pav. Aquifoliaceae (AQF) Ilex aquifolium L. Ilex pernyi Franchet Ilex ciliospinosa Loes. Ilex crenata Thunb. Nemopanthus mucronatus Druce Asteraceae (AST) Bellis perennis L. Brexiaceae (BRX) Brexia madagascarensis Thouars Buxaceae (BUX) Buxus sempervirens L. Celastraceae (CEL) Euonymus bungeanus Maxim. Euonymus maackii Komarov Siphonodon australe Benth. Cornaceae (COR) Cornus mas L. Helwingia japonica F. Dietr. Corynocarpaceae (CNC) Corynocarpus laevigatus Forst. Cunoniaceae (CNN) Weinmannia sylvicola Soland. Dichapetalaceae (DCH) Dichapetalum crassifolium Chod. Escalloniaceae (ESC) Roussea simplex Sm. Euphorbiaceae (EUP) Euphorbia esula L. Euphorbia dulcis L. Euphorbia characias L. Mercurialis annua L. Geissolomataceae (GSL) Geissoloma marginatum Juss. Goupiaceae (GOU) Goupia glabra Aubl. Hippocrateaceae (HPC) Hippocratea richardiana Cambess. Salacia pallescens Oliver Hydrangeaceae (HDR) Kirengeshoma palmata Yatabe
Voucher/source
Accession no.
Savolainen & Guisan, 403289 G
X83986
Savolainen iaq4 G Savolainen ipe3 G Bot. Gard. Geneva Nagamasu s.n. K Chase 119 NCU Savolainen nmul G
X69741 X69744 X69742 X91003 L01928 X69747
Bot. Gard. Geneva
X91000
Schwerdtfeger 25471 B
X83987
Haute-Savoie, France
X69729
Savolainen 0016 G
X69734
Savolainen ema6 G
X69738
Gadek & Fernando 21750 UNSW
X83996
Bot. Gard. Geneva Kew 1953-24705
X83988 X94941
Sample from P. Morat, P
X69731
Bot. Gard. Geneva
X69756
Abidjan, Ivory Cost
X69733
Mauritius Sugar Industry Res. Instit.
X83995
Savolainen 0010 G Savolainen 0018 G Bot. Gard. Geneva Savolainen 0019 G
X69737 X69736 X69735 X69745
Claremont, South Africa
X83990
Pre´vost 3031 CAY
X83991
Savolainen hri5 G
X69740
Van Der Laan 373 WAG
X69754
Bot. Gard. Geneva
X83993
TABLE 1—Continued Taxa Icacinaceae (ICC) Icacina mannii Oliver Lecythidaceae (LCY) Eschweilera simiorum Eyma Magnoliaceae (MAG) Magnolia liliflora Desr. Olacaceae (OLC) Heisteria parvifolia Sm. Phellinaceae (PLN) Phelline comosa Labill. Rhamnaceae (RHM) Rhamnus cathartica L. Colletia armata Miers Rosaceae (ROS) Rosa damascena Mill. Geum coccineum Smith cv. borisii Malus X domestica Borck. Salvadoraceae (SLV) Salvadora persica L. Saxifragaceae (SAX) Parnassia fimbriata Banks Stackhousiaceae Stackhousia minima Hook Theaceae (TEA) Camellia sinensis Kuntze
Voucher/source
Accession no.
Van Setten 460 WAG
X69743
Pre´vost CAY
X91001
Savolainen 0017 G
X69746
Abidjan, Ivory Cost
X83992
Savolainen pcol G
X69748
Savolainen 0011 G Savolainen 0012 G
X69752 X69730
Savolainen 0013 G Savolainen 0014 G
X69753 X69739
Horticulture Centre, Lullier
X69749
Sample from B. Verdcourt, K
X69755
Soltis & Soltis s.n. WS
X83989
Soltis & Soltis s.n. WS
L01939
Molloy s.n. CHR
X94940
Savolainen csi2 G
X69732
gel using Prep-A-Gene (Bio-Rad). Double-strand DNA was sequenced directly following the snap-cooling method of Kusukawa et al. (1990). Both strands were sequenced for 50–75% using the amplification primers and additional 7 (58CCCTACAACTCATGAATTAAG38), 10 (58CATCATTATTGTATACTCTTTCC38), and 11 (58GTAAATCCTAGATGTAAAA38) internal primers (but approximately 50 base pairs were not determined in Kirengeshoma, Weinmannia, and Aextoxicon; see Fig. 1). Because noncoding regions often show a high rate of indels which requires introduction of numerous gaps in the alignment, the following procedures were performed previously to cladistic analysis: an initial alignment was set up using PILEUP (Genetics Computer Group, GCG software, Version 7.3-AXP, 1993, Madison, WI) with gapweight 5 3 and lengthweight 5 0.1; then minor adjustments were made in order to align accurately the promoter sequences of the adjacent genes
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
that we know to be homologous (Manen et al., 1994a), to reach a 1307-site matrix; finally 646 sites were deleted because no satisfactory alignment was performed (see Fig. 1). PAUP 3.1.1 (Swofford, 1993) was used to search for the most parsimonious trees (heuristic search using 1000 random replicates). PAUP also served to calculate the consistency index (CI) and the retention index (RI) (Swofford, 1993) and to perform 100 bootstrap replicates to evaluate the strength of the nodes (Felsenstein, 1985). The jackknife procedure (Farris et al., 1996) was used to perform 1000 jackknife replicates using PAUP 4.0.0 (jackknife with 50% deletion, fast stepwiseaddition, retain groups with frequency . 63%, test version d41 kindly provided by D. Swofford). The A 1 T content of neighboring base for transitions and transversions was scored in terms of the number of As and Ts at the two sites (numbered 0, 0.5, 1, 1.5, and 2; 0.5 and 1.5 were scored when A 1 T content was conserved at only one of the sites as a result of neighboring substitution events; Morton, 1995). These calculations were made for 19 pairwise comparisons of closely related taxa (Table 2) for which the alignments were unambiguous to avoid spurious and multiple substitutions. We assume that the bias of scoring some single events several times through pairwise comparison does not alter the conclusions that we made under Discussion since it is distributed equally in the elements that we compared. RESULTS In the final DNA matrix which included 40 taxa and 661 sites (Fig. 1), 530 (80.2%) were variable and 391 TABLE 2 Transversion/Transition Ratio and A 1 T Contents of Neighboring Bases for 19 Pairwise Comparison (Euonymus/Siphonodon, Euonymus/Hippocratea, E. bungeanus/E. maackii, Rosa/Geum, Ilex/Phelline, Ilex/Nemopanthus, Phelline/Nemopanthus, Ilex/Helwingia, Brexia/Parnassia, Hippocratea/Parnassia, Hippocratea/Salacia, Salacia/Siphonodon, Hippocratea/Siphonodon, Dichapetalum/Euphorbia, Colletia/Rhamnus, Cornus/Kirengeshoma, Malus/Rosa, Eschweilera/Camellia, and Bellis/ Roussea) A 1 T Content
Tv
Ts
% Tv
Tv/Ts
0 0.5 1 1.5 2
10 16 84 19 118
30 19 105 30 103
25.0 45.7 44.4 38.8 53.4
0.33 0.84 0.80 0.63 1.14
Note. The proportion of transversions increases significantly when the A 1 T content of immediately neighboring bases increase: only 25% of the substitutions are transversions when A 1 T content 5 0 whereas 53.4% of the observed substitutions are transversions when both flanking nucleotides are A or T (x 2 5 13.57, P , 0.01).
147
(59.2%) were informative. The cladistic analysis of these characters resulted in 36 equally most parsimonious trees after 1000 replicates (length 1243 steps, CI 0.595, RI 0.655); the strict consensus is presented in Fig. 2. The order Celastrales appears highly polyphyletic (see Discussion and Fig. 2) and restricted here to Celastraceae s.l. (Euonymus and Siphonodon, plus Hippocratea, Salacia, and Brexia; bootstrap and jackknife values 100%). Stackhousia, Dichapetalum, and Goupia are sister to Euphorbiaceae (bootstrap value 100%, jackknife value 86%). Corynocarpus, Geissoloma, and Salvadora are included within Rosidae but their respective placements are not supported by bootstrap and jackknife values. Aquifoliaceae s.s. (Ilex-Nemopanthus) are sister to Helwingia (bootstrap and jackknife values 100%). Their sister group comprises dilleniids (Eschweilera and Camellia), Icacinaceae (Icacina), and the asterid group Bellis–Phelline–Roussea (supported by a jackknife value of 86%). Cornus and Kirengeshoma are sister to the latter clades. All of them represent the group of Asteridae sensu Olmstead et al. (1993) and are supported by a bootstrap value of 100% and a jackknife value of 96%. Aextoxicon is sister to Asteridae but this placement is only supported by the bootstrap value (100%). The results from scoring neighboring base composition and Tv/Ts are presented in Table 2. The proportion of transversions increases when the A 1 T content of immediately neighboring bases increases, as already shown for the chloroplast noncoding regions in rice and maize (Morton, 1995). Only 25% of the substitutions are transversions when both the 58 and the 38 flanking nucleotides are G or C, whereas 53.4% of the observed substitutions are transversions when both flanking nucleotides are A or T. This increase is significant; by testing as a 5 3 2 table, the x2 is 13.57 (P , 0.01). DISCUSSION In a previous molecular analysis of Celastrales, we showed that it was at least diphyletic, with Aquifoliaceae and Icacinaceae being separated from Celastraceae and Hippocrateaceae (Savolainen et al., 1994). In the more comprehensive analysis presented here, we show that the order Celastrales is polyphyletic and that it is composed of at least eight distinct lineages. For example Aextoxicaceae, which Thorne (1992) put in ‘‘Taxa Incertae Sedis,’’ are here basal to Asteridae, which is in agreement with unpublished studies using the rbcL and atpB genes (Savolainen and Chase). As another example, Cronquist (1981) suggested that the simple leaves and the stamens that alternate with the sepals indicate a close relationship between Corynocarpaceae and Rhamnales. He preferred, however, to include Corynocarpaceae in the Celastrales because of the development of staminodes and some wood anatomi-
FIG. 1. Aligned DNA matrix: the atpB–rbcL spacer was aligned for 40 taxa using the program PILEUP (GCG software, gapweight 5 3, lengthweight 5 0.1), and minor adjustments were made to align promoter sequences (Manen et al., 1994a). The data matrix is 1307 sites in length but only the 661 sites for which a satisfactory alignment was performed were kept for the analysis (conserved sites are indicated by an asterisk; deleted sites are as follows: 1–40 60–69 91–105 114–121 137–142 155–160 179–185 203–235 254–258 270–275 284–321 329–345 380–385 410–413 444–471 495–501 509–538 561–566 574–723 743–750 803–819 833–950 967–989 998–1000 1015–1025 1075–1083 1111–1120 1155–1161 1175–1178 1215–1219 1234–1237 1253–1257). 148
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
FIG. 1—Continued
149
150
SAVOLAINEN, SPICHIGER, AND MANEN
FIG. 1—Continued
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
FIG. 1—Continued
151
152
SAVOLAINEN, SPICHIGER, AND MANEN
FIG. 1—Continued
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
FIG. 1—Continued
153
154
SAVOLAINEN, SPICHIGER, AND MANEN
FIG. 2. Strict consensus tree of 36 equally parsimonious cladograms (length 1243 steps, CI 0.595, RI 0.655) resulting from an heuristic search using PAUP 3.1.1. (1000 random replicates) from 40 sequences of the atpB–rbcL spacer. Bootstrap (100 replicates) followed by jackknife (1000 replicates) values are indicated above the branches in percentages. Asterisks indicate taxa which were included in Celastrales, showing that this order appears highly polyphyletic (see text).
cal characters. Our analysis, which places Corynocarpus as sister to Rhamnaceae and Rosaceae, could agree with his initial hypothesis, but based on rbcL Corynocarpus is sister to Cucurbitaceae, Datiscaceae, and Begoniaceae (Chase, personal communication) for which we have no representatives here. In the last classification of Thorne (1992), Corynocarpus also is considered as ‘‘Taxa Incertae Sedis.’’ Our analyses agree with Thorne (1992) and Takhta-
jan (1980) concerning the taxonomic position of Dichapetalaceae. Indeed, these authors placed them in Euphorbiales because of palynological characteristics. Goupiaceae and Stackhousiaceae are also sister to Euphorbiaceae in our cladograms. Thus, our results do not support the views of Cronquist (1981), who included Goupia in Celastraceae, despite considering it as an aberrant genus because of its free styles and numerous ovules.
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA
Salvadoraceae are not related to Celastraceae based on our molecular data, but their close relationship with Heisteria may be due to undersampling. Indeed, based on rbcL sequences, Rodman et al. (1995) showed that Salvadora is well placed among a capparalean clade whose representatives produce ‘‘mustard oils,’’ but we have not included them in the present analysis. Once again, Salvadora was considered as ‘‘Taxa Incertae Sedis’’ by Thorne (1992). Similarly, the placement of Geissolomataceae based on the atpB–rbcL spacer analysis also may be due to undersampling. Based on rbcL, Geissolomataceae are sister to Crossosomataceae and Greyiaceae (Savolainen and Chase, unpublished results). Following the classification of Cronquist (1981, 1988), the Aquifoliaceae are generally considered close to Celastraceae. Prior to Cronquist, other botanists had considered the two families to be closely related based on their flower morphology which differs in that Aquifoliaceae do not have a nectary disk (De Candolle, 1813; Bentham and Hooker, 1862; Loesener 1901, 1908, 1942). The ovular morphology is also presented as an argument for the inclusion of Aquifoliaceae in Celastrales. Bentham and Hooker (1862) noted the similarity in the dorsal raphe and descendent placenta, whereas Loesener (1908) considered that the thick funiculus of Aquifoliaceae was homologous to the aril of Celastraceae. Pollen features also would indicate affinity between Celastraceae and Aquifoliaceae (Takhtajan 1980). Our molecular analysis does not support the traditional views, but instead places Aquifoliaceae in Asteridae sensu Olmstead et al. (1993) and Chase et al. (1993). In these latter publications of the wide-scale rbcL study, Ilex was sister to Asterales in Asteridae s.l. This placement of Aquifoliaceae in a clade containing mostly gamopetalous plants is supported because its petals are often connate into a tube and because of its unitegmic ovules. A similar hypothesis was proposed by Van Tieghem (1898), who placed Aquifoliaceae near Solanaceae because of the unitegmic ovule and the isomerous alterni-petals stamens. Based on pollen studies, Lobreau-Callen (1969, 1975, 1977) also placed Aquifoliaceae near Gentianales and Campanulales. Roussea simplex, which is the only species of the genus, native to Mauritius, also has connate petals. Our data place Phelline with free petals in the Asteridae s.l., suggesting that gamopetaly may have arisen several times in the asterids (Olmstead et al., 1993). In addition, the placement of Phelline in the Bellis clade instead of in the Ilex–Nemopanthus clade supports its familial status rather than its inclusion in Aquifoliaceae, as already discussed by Baas (1975), studying vegetative anatomy. This latter author also pointed out that even if Aquifoliaceae are often regarded as close to Celastraceae, they do not have many anatomical features in common (Baas, 1975). Aquifoliaceae (Ilex,
155
Nemopanthus, excl. Phelline) and Phellinaceae are thus definitely out of place in the order Celastrales. Icacinaceae were included in Celastrales by Cronquist (1981, 1988), in Theales by Thorne (1983), and in Cornales by Dahlgren (1983) and by Thorne (1992). Their unitegmic ovules and connate petals support their placement within asterids, as suggested by our molecular data. Because Icacinaceae, Aquifoliaceae, and Phellinaceae retain many primitive wood anatomical features, Baas (1975) suggested that they could constitute a natural assemblage of families. Our analysis agrees with this view since they are all included in asterids, although they do not form a monophyletic group. A broader study based on the rbcL and atpB genes shows that Icacinaceae are close to lamiids sensu Takhtajan (1980) whereas Phellinaceae would form a separate lineage with Roussea (Savolainen and Chase, unpublished results). Finally, Celastrales are restricted in our analysis to Celastraceae s.l. (including Hippocrateaceae and Brexia), sister to Parnassia (Saxifragaceae). This is in agreement with the rbcL analysis of Chase et al. (1993) and Morgan and Soltis (1993), who also resolved a clade comprising Euonymus (Celastraceae)–Brexia–Parnassia. Because our analysis places Hippocrateaceae (i.e., Salacia and Hippocratea) within Celastraceae (i.e., between Siphonodon and Euonymus), we do not support the familial status proposed by Cronquist (1981) for Hippocrateaceae. CONCLUSION Noncoding DNA sequences, such as chloroplast gene spacers or internal transcribed spacers of nuclear ribosomal genes, are often more variable than coding sequences and thus their use could be considered more appropriate at lower taxonomic levels (Manen et al., 1994b; Gielly and Taberlet, 1994; Smith and Klein, 1994). However, when used in distantly related taxa, these regions have often shown a rate of indels at least as high as the rate of substitutions, associated with short repeats (Clegg and Zurawski, 1992). Their alignment is thus difficult and requires introduction of numerous gaps (Zurawski et al., 1984; Golenberg et al., 1993). For these reasons, some authors prefer to use rapidly evolving genes such as matK (e.g., Johnson and Soltis, 1994) to infer phylogeny at a low taxonomic level, whereas others propose sophisticated methods to analyze indels in noncoding regions (e.g., Gatesy et al., 1993; Barriel, 1994). Golenberg et al. (1993) questioned the usefulness of the atpB–rbcL spacer used here, arguing that indels often occur at labile sites and may result in spurious homologies. This is obviously true for some indels, but an examination in which indels were coded as a character by shared length and position would indicate that
156
SAVOLAINEN, SPICHIGER, AND MANEN
more than 60% are autapomorphic and that those remaining are not more homoplastic than nucleotide substitutions (CIs and RIs did not differ by more than 0.02, data not shown). Gaps are, however, biased when using programs which estimate distances to generate initial pairwise alignments (Morton, 1995). To avoid this bias we have deleted approximately 50% of the sites, keeping for the analysis only those for which a satisfactory alignment was performed. These features would not, however, seriously affect the analysis since we obtained similar results after 1000 heuristic replicates using all sites (data not shown). If indel problems can be avoid by deleting these sites from the analysis, substitutions themselves are subject to bias. We have shown that neighboring bases influence the nature of the substitutions, with regions with a higher A 1 T content having a higher proportion of transversions as already reported for chloroplast regions (including the atpB–rbcL spacer) in two monocot species (Morton, 1995). This latter observation clearly violates the site independence which is often postulated in phylogenetic reconstructions, and it is just one illustration of the complexity of evolutionary processes in DNA sequences. Despite the lack of knowledge concerning the evolution of the noncoding region studied here, the phylogenetic information contained in these DNA sequences seems reliable enough to infer the correct phylogeny. Indeed, the results presented here are in agreement with analysis using the rbcL and atpB adjacent coding sequences (Chase et al., 1993; Savolainen and Chase, unpublished results) whereas our results disagree with the definitions of the order Celastrales as proposed by Bentham and Hooker (1862), Scholz (1964), Dahlgren (1983), Takhtajan (1980), Cronquist (1981, 1988), and Thorne (1992). ACKNOWLEDGMENTS We are especially grateful to institutions and persons who provided plant samples. We also thank A. Bruneau, M. W. Chase, P. Cue´noud, M. D. P. Martinez, C. Morton, G. Reeves, and C. Thebaud, as well as the Swiss National Foundation for Scientific Research, the City of Geneva, the Royal Botanic Gardens of Kew, and the Royal Society, which partially supported this work.
REFERENCES Barriel, V. (1994). Phyloge´nies mole´culaires et insertions-de´le´tions de nucle´otides. C. R. Acad. Sci. Paris 317: 693–701. Baas, P. (1975). Vegetative anatomy and the affinities of Aquifoliaceae, Shenostemon, Phelline, and Oncotheca. Blumea 22: 311–407. Bentham, C., and Hooker, J. D. (1862). ‘‘Genera Plantarum,’’ London. Candolle De, A. P. (1813). ‘‘The´orie e´le´mentaire de la botanique,’’ Paris. Chase, M. W., Soltis, D. E., Olmstead, R. G., Morgan, D., Les, D. H., Mishler, B. D., Duvall, M. R., Price, R. A., Hills, H. G., Qiu, Y.-L., Kron, K. A., Rettig, J. H., Conti, E., Palmer, J. D., Manhart, J. R.,
Sytsma, K. J., Michaels, H. J., Kress, W. J., Karol, K. G., Clark, W. D., Hedren, M., Gaut, B. S., Jansen, R. K., Kim, K.-J., Wimpee, C. F., Smith, J. F., Furnier, G. R., Strauss, S. H., Xiang, Q.-Y., Plunkett, G. M., Soltis, P. S., Swensen, S. M., Williams, S. E., Gadek, P. A., Quinn, C. J., Eguiarte, L. E., Golenberg, E., Learn Jr, G. H., Graham, S. W., Barrett, S. C., Dayanandan, S., and Albert, V. A. (1993). Phylogenetics of seed plants: An analysis of nucleotide sequences from the plastid gene rbcL. Ann. Missouri Bot. Gard. 80: 528–580. Clegg, M. T., and Zurawski, G. (1992). Chloroplast DNA and the study of plant phylogeny: Present status and future prospects. In ‘‘Molecular Systematics of Plants’’ (D. E. Soltis, P. S. Soltis, and J. Doyle, Eds.), Chapman & Hall, New York. Cronquist, A. (1981). ‘‘An integrated system of classification of flowering plants,’’ Columbia Univ. Press, New York. Cronquist, A. (1988). ‘‘The Evolution and Classification of Flowering Plants,’’ Allen Press, Lawrence, KS. Dahlgren, R. (1975). The distribution of characters within an angiosperm system. Bot. Notiser 128: 181–197. Dahlgren, R. (1983). General aspects of angiosperm evolution and macrosystematics. Nordic J. Bot 3: 119–149. Farris, J. S., Albert, V. A., Kallersjoj, M., Lipscomb, D., and Kluge, A. G. (1996). Parsimony jackknifing outperforms neighbourjoining. Cladistics, in press. Felsenstein, J. (1985). Confidence limits on phylogenetics: An approach using the bootstrap. Evolution 39: 783–791. Gatesy, J., DeSalle, R., and Wheeler, W. (1993). Alignment-ambiguous nucleotide sites and the exclusion of systematic data. Mol. Phylogenet. Evol. 2: 152–157. Gielly, L., and Taberlet, P. (1994). The use of chloroplast DNA to resolve plant phylogeny: Noncoding versus rbcL coding sequences. Mol. Biol. Evol. 11: 769–777. Golenberg, E. M., Clegg, M. T., Durbin, M. L., Doebley, J., and Pow Ma, D. (1993). Evolution of a noncoding region of the chloroplast genome. Mol. Phylogenet. Evol. 2: 52–64. Gustincich, S., Manfioletti, G., Del Sal, G., Schneider, C., and Carninci, P. (1991). A fast method for high-quality genomic DNA extraction from whole human blood. BioTechniques 11: 298–302. Johnson, L. A., and Soltis, D. E. (1994). matK DNA sequences and phylogenetic reconstruction in Saxifragaceae s. str. Syst. Bot. 19: 143–156. Kusakawa, N., Uemori, T., Asakada, K., and Kato, I. (1990). Rapid and reliable method protocol for direct sequencing of material amplified by polymerase chain reaction. BioTechniques 9: 66–72. Lobreau-Callen, D. (1969). Les limites de l’ ‘‘ordre’’ des Ce´lastrales d’apre`s le pollen. Pollen Spores 11: 499–555. Lobreau-Callen, D. (1975). ‘‘Le pollen des Ce´lastrales et groupes apparente´s,’’ The`se Doct. Sc. Nat., Univ. du Languedoc, A.O. au C.N.R.S., 8071, Montpellier. Lobreau-Callen, D. (1977). Nouvelle interpre´tation de l’ ‘‘ordre’’ des Ce´lastrales a` l’aide de la palynologie. C. R. Acad. Sci. Paris 284: 915–918. Loesener, T. (1901). Monographia Aquifoliacerum I. nova Acta Acad. Caes. Leop.-Carol. German Nat. Cur. 78. Loesener, T. (1908). Monographia Aquifoliacerum II. nova Acta Acad. Caes. Leop.-Carol. German Nat. Cur. 89. Loesener, T. (1942). Aquifoliaceae. In ‘‘Nat. Pflanzen-Fam. Aufl. 2., 20b’’ (Engler and Prantl., Eds.), pp. 36–86, Borntra¨ger, Berlin. Maddison, W. P., and Maddison, D. R. (1992). ‘‘MacClade: Analysis of Phylogeny and Character Evolution. Version 3.04,’’ Sinauer Associates, Sunderland, MA. Manen, J.-F., Savolainen, V., and Simon, P. (1994a). The atpB and
POLYPHYLETISM OF CELASTRALES DEDUCED FROM NONCODING DNA rbcL promoters in plastid DNAs of a wide dicot range. J. Mol. Evol. 38: 577–582. Manen, J.-F., Natali, A., and Ehrendorfer, F. (1994b). Phylogeny of Rubiaceae-Rubieae inferred from the sequence of a cpDNA intergene region. Plant Syst. Evol. 190: 195–211. Morgan, D. R., and Soltis, D. E. (1993). Phylogenetic relationships among members of Saxifragaceae sensu lato based on rbcL sequence data. Ann. Missouri Bot. Gard. 80: 631–660. Morton, B. R. (1995). Neighboring base composition and transversion/ transition bias in a comparison of rice and maize chloroplast noncoding regions. Proc. Natl. Acad. Sci. USA 92: 9717–9721. Olmstead, R. G., Bremer, B., Scott, K. M., and Palmer, J. D. (1993). A parsimony analysis of the Asteridae sensu lato based on rbcL sequences. Ann. Missouri Bot. Gard 80: 700–722. Rodman, J. E., Karol, K., Price, R., and Savolainen, V. (1995). Salvadoraceae are Capparalean, all but one of the mustard oil taxa form a monophyletic clade and Dahlgren was right. Abstract. Am. J. Bot. S82: 459. Savolainen, V., Manen, J.-F., Douzery, E., and Spichiger, R. (1994). Molecular phylogeny of families related to Celastrales based on rbcL 58 flanking sequences. Mol. Phylogenet. Evol. 3: 27–37. Scholz, A. (1964). Aquifoliaceae. In ‘‘A Engler’s Syllabus Der Pflanzenfamilien’’ (Melchior, Ed.), Borntra¨ger, Berlin. Smith, D. E., and Klein, A. S. (1994). Phylogenetic inferences on the
157
relationships of North American and European Picea species based on nuclear ribosomal 18S sequences and the internal transcribed spacer 1 region. Mol. Phylogenet. Evol. 3: 17–26. Spichiger, R., Savolainen, V., and Manen, J. F. (1993). Systematic affinities of Aquifoliaceae and Icacinaceae from molecular data analysis. Candollea 48: 459–464. Swofford, D. L. (1993). ‘‘PAUP: Phylogeny Analysis Using Parsimony, Version 3.1.1,’’ computer program distributed by the Smithsonian Institution. Takhtajan, A. (1980). Outline of the classification of flowering plants. Bot. Rev. 46: 225–359. Thorne, R. F. (1983). Proposed new realignments in the angiosperms. Nordic J. Bot. 3: 85–117. Thorne, R. F. (1992). Classification and geography of the flowering plants. Bot. Rev. 58: 225–348. Van Tieghem, P. (1898). Structure de quelques ovules et parti qu’ on peut tirer pour ame´liorer la classification. J. Bot. Morot. 13/14: 199–201. Webb, D. M., and Knapp, S. J. (1990). DNA extraction from previously recalcitrant plant genus. Plant Mol. Biol. 8: 180–185. Zurawski, G., Clegg, M. T., and Brown, A. H. D. (1984). The nature of nucleotide sequence divergence between barley and maize chloroplast DNA. Genetics 106: 735–749.