- Email: [email protected]
Prenatal diagnosis of Menkes disease by genetic analysis and copper measurement
Brain & Development 24 (2002) 715–718 www.elsevier.com/locate/braindev
Original article
Prenatal diagnosis of Menkes disease by genetic analysis and copper measurement q Yan-hong Gu a,b, Hiroko Kodama a,*, Emi Sato a, Daishi Mochizuki a, Yukishige Yanagawa a, Masaki Takayanagi c, Kodo Sato d, Atsushi Ogawa e, Hiroshi Ushijima b, Cheng-Chun Lee a b
a Department of Pediatrics, School of Medicine, Teikyo University, 2-11-1 Kaga, Itabashi-ku, Tokyo 173-8606, Japan Department of Developmental Medical Sciences, School of International Health, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan c Division of Metabolism, Chiba Children’s Hospital, Chiba, Japan d Department of Obstetrics and Gynecology, St. Luke’s International Hospital, Tokyo, Japan e Department of Pediatrics, Graduate School of Medicine, Chiba University, Chiba, Japan
Received 1 March 2002; received in revised form 3 June 2002; accepted 3 June 2002
Abstract Carrier detection for 12 women and prenatal diagnosis for six fetuses in Japanese families with a patient with Menkes disease (MNK) were performed by gene analysis and/or measurement of the copper concentration in cultured cells. Six out of eight mothers of MNK patients were carriers while two (25%) were not carriers. Two unrelated patients showed the same mutation (R986X): one patient’s mother was a carrier while the other was not. One male and three female fetuses did not have the same mutant allele as the respective MNK proband and have been healthy since birth. One female fetus had the same mutant allele as her affected brother. Gene analysis is very useful and reliable, although such examination is only indicated in families in which a mutation has been identified. In one family in which a mutation in ATP7A was not found, cultured amniocytes from a male fetus had a high copper concentration. Thus after his birth, the biochemical findings confirmed the presence of MNK and early treatment was started. As his early treatment with parenteral copper-histidine prevented the neurological disorders effectively, prenatal diagnosis is very important. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Prenatal diagnosis; Menkes disease; Carrier diagnosis; Copper transporting ATPase; Copper concentration
1. Introduction Menkes disease (MNK) is an X-linked recessive disorder characterized by neurodegeneration, connective tissue disorders and hair abnormalities. The prevalence rate of MNK is one in about 250,000 live births [1]. MNK is caused by a defect in a copper transporting ATPase (ATP7A), which transports copper from the cytosol to the Golgi apparatus in normal cells. In MNK-affected cells, copper accumulates in the cytosol and cannot be excreted. In patients with MNK, dietary copper accumulates in the intestine and is not absorbed, resulting in copper deficiency [1]. Copper accumulates and copper efflux is also reduced in cultured amniotic fluid cells, chorionic villi from affected fetuses, and cultured skin fibroblasts from patients [2–4]. However, q Contract grant sponsor: Ministry of Education, Science and Culture in Japan. Contract grant number: 07770607. * Corresponding author. Tel.: 181-3-3964-1211, ext. 1494; fax: 181-33579-8212. E-mail address: [email protected] (H. Kodama).
copper accumulation in cultured skin fibroblasts from carriers maybe positive or negative, and carriers usually show normal phenotype. Heterozygote females of MNK (carriers) exhibit no abnormal clinical features. They can be usually diagnosed based on an increased copper level in cultured fibroblasts. However, some carriers show no abnormalities, indicating that biochemical diagnosis is difficult for carriers. Currently, accepted treatment of MNK is parenteral administration of copper. This treatment has been reported to prevent neurological disturbance when treatment is initiated soon after birth. However, when the initiation of treatment is delayed, neurological disturbance cannot be prevented [1]. Thus, early diagnosis and treatment are very important for the management of MNK. Here, we describe the use of carrier and prenatal diagnostic tests for MNK involving ATP7A gene analysis and/or measurement of the copper concentration in cultured cells.
0387-7604/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0387-760 4(02)00093-1
716
Y.-h. Gu et al. / Brain & Development 24 (2002) 715–718
Table 1 New primers for the amplification of exons 6 and 12 Primer
Sequence (5 0 –3 0 )
Exon 6
ATTGTTTTTCTTATCAATGC 46 TTTTCTGGAAGTTTTATTA TCAGGGTAGGAAGCATATTA 55 TTGAAAGAACATACCTGTG
Forward Reverse Exon 12 Forward Reverse
Denaturation temperature
2. Materials and methods 2.1. Materials Carrier and/or prenatal diagnostic tests were performed in ten Japanese unrelated families, each including a MNK patient. All ten patients showed the typical clinical and laboratory findings of classical MNK. Mutations in the ATP7A gene were identified in nine patients, and the remaining patient was diagnosed on the basis of the absence of an increase in the serum copper level after the oral admin-
Fig. 1. Prenatal diagnosis for five fetuses in families 1, 2 and 9. The results of gene analysis of ATP7A are shown in brackets.
istration of copper and a high copper concentration in cultured fibroblasts [4,5]. Carrier detection was performed in 12 women in eight families (eight mothers of MNK patients and four aunts, Table 1). Prenatal diagnosis was performed in five fetuses by gene analysis and in one fetus by measurement of the copper concentration in cultured amniocytes (Figs. 1 and 2). Amniocytes, obtained by transabdominal amniocentesis during the 11–15th gestational weeks from fetuses 1, 3, 4, and 5, and during the 28th gestational week from fetus 6, were cultured in Chang’s medium. Chorionic villus was obtained from fetus 2 during the eighth gestational week. Written informed consent was obtained from the parents of all the patients and from the aunts for whom the gene analysis was performed. 2.2. Genetic analysis Genomic DNA was extracted from the blood of the 12 women, and from cultured amniocytes or chorionic villi, except in patient P1 [4]. In patient P1, genomic DNA was extracted from a small piece of dried navel cord using proteinase K and neutral phenol, because the patient had died 3 months previously when he was 3 years old. Polymerase chain reaction amplification and direct sequencing analysis were performed according to previously described methods [4]. The results were checked at least two or three times. Because exons 6 and 12 could not be amplified very well in some DNA samples, we designed two new pairs of primers for the amplification of exons 6 and 12. These
Fig. 2. Prenatal diagnosis in family 10. No gene mutation in ATP7A was identified in patient P10. The carrier status of the mother has not been examined. However, the copper concentration in cultured amniocytes from fetus 6 was significantly higher than that in a normal control.
Y.-h. Gu et al. / Brain & Development 24 (2002) 715–718
primers are shown in Table 1 and were created using the Oligo 5.0 Primer Analysis Program (National Biosciences, Inc., Plymouth, MN, USA). 2.3. Copper measurement in cultured cells The copper concentrations in cultured fibroblasts, amniocytes and chorionic cells were measured using an atomic absorption spectrophotometer (Hitachi Z-8100) according to a previously described method [4]. 3. Results and discussion 3.1. Determination of the carrier status by genetic analysis and/or measurement of the copper concentration in cultured fibroblasts Seven of the 12 women in whom the ATP7A gene was examined had the same mutation in an allele as the respective patient, indicating a positive carrier status (Table 2). In two of these women, the copper concentration in cultured fibroblasts was also examined. As shown in Table 2, the copper levels in the two women were significantly higher than normal, supporting their carrier status. Five of the women did not have any mutation in the ATP7A gene, indicating their negative carrier status. The copper concentration was also normal in cultured fibroblasts obtained from three women without a mutation.
717
Two out of eight mothers of MNK patients (25%) were not carriers in our study. Tu¨ mer et al. [6] also reported that 17 out of 61 mothers of MNK patients were not carriers. These findings indicate that 25–28% of MNK patients do not inherit the disorder from their mothers; new gene mutations occurred in these patients. In other X-linked disease including Duchenne muscular dystrophy (DMD) also, about one-third of patients are isolated cases with new gene mutations, in which case the mother is not a carrier [7]. These support our results. In addition, two unrelated patients, P6 in Family 6 and P7 in Family 7, exhibited the same mutation (R986X). However, the mother of case P6 was a carrier, while the mother of case P7 was not. These results imply that carrier detection should be performed in each family with a MNK patient. 3.2. Prenatal diagnosis Prenatal diagnosis of MNK has been performed using several methods: gene analysis, measurement of 64Cu accumulation in cultured amniocytes after incubation in a 64Cucontaining medium, and measurement of the copper concentration in chorionic villi by neutron activation analysis or atomic absorption spectrophotometry [2,3,8]. Among these methods, gene analysis is indicated when a proband’s mutation has been identified; this method seems to be the most reliable of the previously mentioned prenatal diagnostic
Table 2 Carrier detection for 12 women in families with a MNK patient a Proband
Carrier diagnosis
Family number Case Gene mutation
Mother or aunt Gene mutation
Cu in fibroblasts (ng/mg protein) b Basal medium
1
P1
R980X b,d
2 3
P2 P3
IVS9 1 5 g ! c c,e TTTCTTCTCTCTTCCTTAAACT gtaagtatgatagcttttgctc ! TTTctc in exon 22 and intron 22 b
4
P4
E529X b
5 6 7 8
P5 P6 P7 P8
4150 del G b,f R986X b,d R986X d C720R d
Status
Copper added medium
Mother Aunt Mother Mother
R980X/– R980X/– IVS9 1 5 g ! c/- d – del 38 nt/148
– – – 279
Carrier Carrier Carrier Carrier
Aunt 1 Aunt 2 Mother Aunt Mother Mother Mother Mother
-/-/E529X/-/del 4150 G/R986X/-/-/-
30 34 119 45 – – – –
Non-carrier Non-carrier Carrier Non-carrier Carrier Carrier Non-carrier Non-carrier
10 10 95 24 – – – –
a The copper concentration in normal females was 17 ^ 7 ng/mg protein in basal medium; 42 ^ 16 ng/mg protein in copper supplemented medium; n ¼ 10. Our data. The copper concentration in patients with MNK was 137 ^ 39 ng/mg protein in basal medium; 228 ^ 49 ng/mg protein in supplemented medium. b Ref. [4]. c Ref. [5]. d The mutations that changes a arginine (cysteine) at position 980, 986 (720) in ATP7A into a stop codon (arginine), is designated R980X, R986X (C720R). e A mutation substituting a C for the fifth nucleotide G in a splice donor site of intron 9 occurred. f A single nucleotide deletion is indicated by the term ‘del’ written after the nucleotide numbers deleted.
718
Y.-h. Gu et al. / Brain & Development 24 (2002) 715–718
tests [6,8,9]. We have performed prenatal diagnosis for MNK since about 10 years ago. When the fetus was determined to be female, prenatal diagnosis was performed only in the case whose family required it. A mutant allele was not found in four fetuses, indicating that the male fetus (fetus 2) was not a MNK patient and that the three female fetuses were not MNK carriers (Fig. 1). The non-carrier status of fetus 1 was confirmed by a normal copper concentration in cultured chorionic cells (normal range: 26 ^ 3 ng/mg protein, n ¼ 2). The four fetuses (fetuses 1, 2, 3, and 4) were born without difficulty and have been healthy since birth. One female fetus (fetus 5) in family 9 had the same mutant allele as her affected brother (P9), indicating that she is a carrier. Our results show that gene analysis is very useful and reliable, although such examination is only indicated in families in which a mutation has been identified. In cases where a mutation has not been identified in a proband with MNK, prenatal diagnosis is reported to be possible by means of a biochemical method, such as determination of the copper concentration or copper uptake [10]. Fig. 2 shows the results of prenatal diagnostic testing in family 10 by determination of the copper concentration in cultured amniocytes. Patient P10 in family 10 exhibited the typical clinical features and biochemical findings of classical MNK. However, a gene mutation could not be identified in any of the 23 exons of the ATP7A gene, the 5 0 upstream region, or part of the untranslated 3 0 region [4]. When the patient was diagnosed as having MNK on the basis of clinical and biochemical findings, his mother was already 28 weeks pregnant. Amniocytes were obtained and cultured, and the copper concentration in these cells was determined by atomic absorption spectrophotometry. The mean copper level in the cultured aminocytes was 31 ng/mg protein ðn ¼ 3Þ, which was significantly higher than the normal range of 10 ^ 3 ng/mg protein ðn ¼ 2Þ. Based on this, fetus 6 was suspected as having MNK and was delivered by Caesarean section during the 36th gestational week without trouble. After his birth, the diagnosis was confirmed by the lack of an increase in the serum copper level on the oral administration of copper, and subcutaneous copper-histidine therapy was therefore initiated at the age of 22 days. His neurological development has been normal so far, he is
presently aged 3 years. These results indicate that determination of the copper level in cultured amniocytes is also a useful method for prenatal diagnosis when a mutation has not been identified in a proband with MNK. Acknowledgements We would like to express our gratitude to Mrs Yoshiko Murata for her efforts to initiate this study. We thank the following doctors for providing samples and clinical data of the patients under their respective care: Drs Naoto Yamada and Mitsuhiro Kato. References [1] Kodama H, Murata Y, Kobayashi M. Clinical manifestations and treatment of Menkes disease and its variants. Pediatr Int 1999;41:423–429. [2] Horn N. Menkes’ X-linked disease: prenatal diagnosis and carrier detection. J Inherit Metab Dis 1983;6(Suppl 1):59–62. [3] Heydorn K, Damsgaard E, Horn N. Accumulated experience with prenatal diagnosis of Menkes disease by neutron activation analysis of chorionic villi specimens. Biol Trace Elem Res 1999;71–72:551– 561. [4] Gu YH, Kodama H, Murata Y, Mochizuki D, Yanagawa Y, Ushijima H, et al. ATP7A gene mutations in 16 patients with Menkes disease and a patient with occipital horn syndrome. Am J Med Genet 2001;99:217–222. [5] Ogawa A, Yamamoto S, Takayanagi M, Kogo T, Kanazawa M, Kohno Y. Identification of three novel mutations in the MNK gene in three unrelated Japanese patients with classical Menkes disease. J Hum Genet 1999;44:206–209. [6] Tu¨ mer Z, Møller LB, Horn N. Mutation spectrum of ATP7A, the gene defective in Menkes disease. Adv Exp Med Biol 1999;448:83–95. [7] Nussbaum RL, McInnes RR, Willard HF. Genetic variation in populations. In: Nussbaum RL, McInnes RR, Willard HF, editors. Thompson and Thompson genetics in medicine, 6th ed.. Philadelphia, PA: W.B. Saunders, 2001. pp. 95–105. [8] Das S, Whitney S, Taylor J, Chen E, Levinson B, Vulpe C, et al. Prenatal diagnosis of Menkes disease by mutation analysis. J Inher Metab Dis 1995;18:364–365. [9] Tu¨ mer Z, Tønnesen T, Bo¨ hmann J, Marg W, Horn N. First trimester prenatal diagnosis of Menkes disease by DNA analysis. J Med Genet 1994;31:615–617. [10] Tu¨ mer Z, Horn N. Menkes disease: recent advances and new aspects. J Med Genet 1997;34:265–274.
Original article
Prenatal diagnosis of Menkes disease by genetic analysis and copper measurement q Yan-hong Gu a,b, Hiroko Kodama a,*, Emi Sato a, Daishi Mochizuki a, Yukishige Yanagawa a, Masaki Takayanagi c, Kodo Sato d, Atsushi Ogawa e, Hiroshi Ushijima b, Cheng-Chun Lee a b
a Department of Pediatrics, School of Medicine, Teikyo University, 2-11-1 Kaga, Itabashi-ku, Tokyo 173-8606, Japan Department of Developmental Medical Sciences, School of International Health, Graduate School of Medicine, The University of Tokyo, Tokyo, Japan c Division of Metabolism, Chiba Children’s Hospital, Chiba, Japan d Department of Obstetrics and Gynecology, St. Luke’s International Hospital, Tokyo, Japan e Department of Pediatrics, Graduate School of Medicine, Chiba University, Chiba, Japan
Received 1 March 2002; received in revised form 3 June 2002; accepted 3 June 2002
Abstract Carrier detection for 12 women and prenatal diagnosis for six fetuses in Japanese families with a patient with Menkes disease (MNK) were performed by gene analysis and/or measurement of the copper concentration in cultured cells. Six out of eight mothers of MNK patients were carriers while two (25%) were not carriers. Two unrelated patients showed the same mutation (R986X): one patient’s mother was a carrier while the other was not. One male and three female fetuses did not have the same mutant allele as the respective MNK proband and have been healthy since birth. One female fetus had the same mutant allele as her affected brother. Gene analysis is very useful and reliable, although such examination is only indicated in families in which a mutation has been identified. In one family in which a mutation in ATP7A was not found, cultured amniocytes from a male fetus had a high copper concentration. Thus after his birth, the biochemical findings confirmed the presence of MNK and early treatment was started. As his early treatment with parenteral copper-histidine prevented the neurological disorders effectively, prenatal diagnosis is very important. q 2002 Elsevier Science B.V. All rights reserved. Keywords: Prenatal diagnosis; Menkes disease; Carrier diagnosis; Copper transporting ATPase; Copper concentration
1. Introduction Menkes disease (MNK) is an X-linked recessive disorder characterized by neurodegeneration, connective tissue disorders and hair abnormalities. The prevalence rate of MNK is one in about 250,000 live births [1]. MNK is caused by a defect in a copper transporting ATPase (ATP7A), which transports copper from the cytosol to the Golgi apparatus in normal cells. In MNK-affected cells, copper accumulates in the cytosol and cannot be excreted. In patients with MNK, dietary copper accumulates in the intestine and is not absorbed, resulting in copper deficiency [1]. Copper accumulates and copper efflux is also reduced in cultured amniotic fluid cells, chorionic villi from affected fetuses, and cultured skin fibroblasts from patients [2–4]. However, q Contract grant sponsor: Ministry of Education, Science and Culture in Japan. Contract grant number: 07770607. * Corresponding author. Tel.: 181-3-3964-1211, ext. 1494; fax: 181-33579-8212. E-mail address: [email protected] (H. Kodama).
copper accumulation in cultured skin fibroblasts from carriers maybe positive or negative, and carriers usually show normal phenotype. Heterozygote females of MNK (carriers) exhibit no abnormal clinical features. They can be usually diagnosed based on an increased copper level in cultured fibroblasts. However, some carriers show no abnormalities, indicating that biochemical diagnosis is difficult for carriers. Currently, accepted treatment of MNK is parenteral administration of copper. This treatment has been reported to prevent neurological disturbance when treatment is initiated soon after birth. However, when the initiation of treatment is delayed, neurological disturbance cannot be prevented [1]. Thus, early diagnosis and treatment are very important for the management of MNK. Here, we describe the use of carrier and prenatal diagnostic tests for MNK involving ATP7A gene analysis and/or measurement of the copper concentration in cultured cells.
0387-7604/02/$ - see front matter q 2002 Elsevier Science B.V. All rights reserved. PII: S 0387-760 4(02)00093-1
716
Y.-h. Gu et al. / Brain & Development 24 (2002) 715–718
Table 1 New primers for the amplification of exons 6 and 12 Primer
Sequence (5 0 –3 0 )
Exon 6
ATTGTTTTTCTTATCAATGC 46 TTTTCTGGAAGTTTTATTA TCAGGGTAGGAAGCATATTA 55 TTGAAAGAACATACCTGTG
Forward Reverse Exon 12 Forward Reverse
Denaturation temperature
2. Materials and methods 2.1. Materials Carrier and/or prenatal diagnostic tests were performed in ten Japanese unrelated families, each including a MNK patient. All ten patients showed the typical clinical and laboratory findings of classical MNK. Mutations in the ATP7A gene were identified in nine patients, and the remaining patient was diagnosed on the basis of the absence of an increase in the serum copper level after the oral admin-
Fig. 1. Prenatal diagnosis for five fetuses in families 1, 2 and 9. The results of gene analysis of ATP7A are shown in brackets.
istration of copper and a high copper concentration in cultured fibroblasts [4,5]. Carrier detection was performed in 12 women in eight families (eight mothers of MNK patients and four aunts, Table 1). Prenatal diagnosis was performed in five fetuses by gene analysis and in one fetus by measurement of the copper concentration in cultured amniocytes (Figs. 1 and 2). Amniocytes, obtained by transabdominal amniocentesis during the 11–15th gestational weeks from fetuses 1, 3, 4, and 5, and during the 28th gestational week from fetus 6, were cultured in Chang’s medium. Chorionic villus was obtained from fetus 2 during the eighth gestational week. Written informed consent was obtained from the parents of all the patients and from the aunts for whom the gene analysis was performed. 2.2. Genetic analysis Genomic DNA was extracted from the blood of the 12 women, and from cultured amniocytes or chorionic villi, except in patient P1 [4]. In patient P1, genomic DNA was extracted from a small piece of dried navel cord using proteinase K and neutral phenol, because the patient had died 3 months previously when he was 3 years old. Polymerase chain reaction amplification and direct sequencing analysis were performed according to previously described methods [4]. The results were checked at least two or three times. Because exons 6 and 12 could not be amplified very well in some DNA samples, we designed two new pairs of primers for the amplification of exons 6 and 12. These
Fig. 2. Prenatal diagnosis in family 10. No gene mutation in ATP7A was identified in patient P10. The carrier status of the mother has not been examined. However, the copper concentration in cultured amniocytes from fetus 6 was significantly higher than that in a normal control.
Y.-h. Gu et al. / Brain & Development 24 (2002) 715–718
primers are shown in Table 1 and were created using the Oligo 5.0 Primer Analysis Program (National Biosciences, Inc., Plymouth, MN, USA). 2.3. Copper measurement in cultured cells The copper concentrations in cultured fibroblasts, amniocytes and chorionic cells were measured using an atomic absorption spectrophotometer (Hitachi Z-8100) according to a previously described method [4]. 3. Results and discussion 3.1. Determination of the carrier status by genetic analysis and/or measurement of the copper concentration in cultured fibroblasts Seven of the 12 women in whom the ATP7A gene was examined had the same mutation in an allele as the respective patient, indicating a positive carrier status (Table 2). In two of these women, the copper concentration in cultured fibroblasts was also examined. As shown in Table 2, the copper levels in the two women were significantly higher than normal, supporting their carrier status. Five of the women did not have any mutation in the ATP7A gene, indicating their negative carrier status. The copper concentration was also normal in cultured fibroblasts obtained from three women without a mutation.
717
Two out of eight mothers of MNK patients (25%) were not carriers in our study. Tu¨ mer et al. [6] also reported that 17 out of 61 mothers of MNK patients were not carriers. These findings indicate that 25–28% of MNK patients do not inherit the disorder from their mothers; new gene mutations occurred in these patients. In other X-linked disease including Duchenne muscular dystrophy (DMD) also, about one-third of patients are isolated cases with new gene mutations, in which case the mother is not a carrier [7]. These support our results. In addition, two unrelated patients, P6 in Family 6 and P7 in Family 7, exhibited the same mutation (R986X). However, the mother of case P6 was a carrier, while the mother of case P7 was not. These results imply that carrier detection should be performed in each family with a MNK patient. 3.2. Prenatal diagnosis Prenatal diagnosis of MNK has been performed using several methods: gene analysis, measurement of 64Cu accumulation in cultured amniocytes after incubation in a 64Cucontaining medium, and measurement of the copper concentration in chorionic villi by neutron activation analysis or atomic absorption spectrophotometry [2,3,8]. Among these methods, gene analysis is indicated when a proband’s mutation has been identified; this method seems to be the most reliable of the previously mentioned prenatal diagnostic
Table 2 Carrier detection for 12 women in families with a MNK patient a Proband
Carrier diagnosis
Family number Case Gene mutation
Mother or aunt Gene mutation
Cu in fibroblasts (ng/mg protein) b Basal medium
1
P1
R980X b,d
2 3
P2 P3
IVS9 1 5 g ! c c,e TTTCTTCTCTCTTCCTTAAACT gtaagtatgatagcttttgctc ! TTTctc in exon 22 and intron 22 b
4
P4
E529X b
5 6 7 8
P5 P6 P7 P8
4150 del G b,f R986X b,d R986X d C720R d
Status
Copper added medium
Mother Aunt Mother Mother
R980X/– R980X/– IVS9 1 5 g ! c/- d – del 38 nt/148
– – – 279
Carrier Carrier Carrier Carrier
Aunt 1 Aunt 2 Mother Aunt Mother Mother Mother Mother
-/-/E529X/-/del 4150 G/R986X/-/-/-
30 34 119 45 – – – –
Non-carrier Non-carrier Carrier Non-carrier Carrier Carrier Non-carrier Non-carrier
10 10 95 24 – – – –
a The copper concentration in normal females was 17 ^ 7 ng/mg protein in basal medium; 42 ^ 16 ng/mg protein in copper supplemented medium; n ¼ 10. Our data. The copper concentration in patients with MNK was 137 ^ 39 ng/mg protein in basal medium; 228 ^ 49 ng/mg protein in supplemented medium. b Ref. [4]. c Ref. [5]. d The mutations that changes a arginine (cysteine) at position 980, 986 (720) in ATP7A into a stop codon (arginine), is designated R980X, R986X (C720R). e A mutation substituting a C for the fifth nucleotide G in a splice donor site of intron 9 occurred. f A single nucleotide deletion is indicated by the term ‘del’ written after the nucleotide numbers deleted.
718
Y.-h. Gu et al. / Brain & Development 24 (2002) 715–718
tests [6,8,9]. We have performed prenatal diagnosis for MNK since about 10 years ago. When the fetus was determined to be female, prenatal diagnosis was performed only in the case whose family required it. A mutant allele was not found in four fetuses, indicating that the male fetus (fetus 2) was not a MNK patient and that the three female fetuses were not MNK carriers (Fig. 1). The non-carrier status of fetus 1 was confirmed by a normal copper concentration in cultured chorionic cells (normal range: 26 ^ 3 ng/mg protein, n ¼ 2). The four fetuses (fetuses 1, 2, 3, and 4) were born without difficulty and have been healthy since birth. One female fetus (fetus 5) in family 9 had the same mutant allele as her affected brother (P9), indicating that she is a carrier. Our results show that gene analysis is very useful and reliable, although such examination is only indicated in families in which a mutation has been identified. In cases where a mutation has not been identified in a proband with MNK, prenatal diagnosis is reported to be possible by means of a biochemical method, such as determination of the copper concentration or copper uptake [10]. Fig. 2 shows the results of prenatal diagnostic testing in family 10 by determination of the copper concentration in cultured amniocytes. Patient P10 in family 10 exhibited the typical clinical features and biochemical findings of classical MNK. However, a gene mutation could not be identified in any of the 23 exons of the ATP7A gene, the 5 0 upstream region, or part of the untranslated 3 0 region [4]. When the patient was diagnosed as having MNK on the basis of clinical and biochemical findings, his mother was already 28 weeks pregnant. Amniocytes were obtained and cultured, and the copper concentration in these cells was determined by atomic absorption spectrophotometry. The mean copper level in the cultured aminocytes was 31 ng/mg protein ðn ¼ 3Þ, which was significantly higher than the normal range of 10 ^ 3 ng/mg protein ðn ¼ 2Þ. Based on this, fetus 6 was suspected as having MNK and was delivered by Caesarean section during the 36th gestational week without trouble. After his birth, the diagnosis was confirmed by the lack of an increase in the serum copper level on the oral administration of copper, and subcutaneous copper-histidine therapy was therefore initiated at the age of 22 days. His neurological development has been normal so far, he is
presently aged 3 years. These results indicate that determination of the copper level in cultured amniocytes is also a useful method for prenatal diagnosis when a mutation has not been identified in a proband with MNK. Acknowledgements We would like to express our gratitude to Mrs Yoshiko Murata for her efforts to initiate this study. We thank the following doctors for providing samples and clinical data of the patients under their respective care: Drs Naoto Yamada and Mitsuhiro Kato. References [1] Kodama H, Murata Y, Kobayashi M. Clinical manifestations and treatment of Menkes disease and its variants. Pediatr Int 1999;41:423–429. [2] Horn N. Menkes’ X-linked disease: prenatal diagnosis and carrier detection. J Inherit Metab Dis 1983;6(Suppl 1):59–62. [3] Heydorn K, Damsgaard E, Horn N. Accumulated experience with prenatal diagnosis of Menkes disease by neutron activation analysis of chorionic villi specimens. Biol Trace Elem Res 1999;71–72:551– 561. [4] Gu YH, Kodama H, Murata Y, Mochizuki D, Yanagawa Y, Ushijima H, et al. ATP7A gene mutations in 16 patients with Menkes disease and a patient with occipital horn syndrome. Am J Med Genet 2001;99:217–222. [5] Ogawa A, Yamamoto S, Takayanagi M, Kogo T, Kanazawa M, Kohno Y. Identification of three novel mutations in the MNK gene in three unrelated Japanese patients with classical Menkes disease. J Hum Genet 1999;44:206–209. [6] Tu¨ mer Z, Møller LB, Horn N. Mutation spectrum of ATP7A, the gene defective in Menkes disease. Adv Exp Med Biol 1999;448:83–95. [7] Nussbaum RL, McInnes RR, Willard HF. Genetic variation in populations. In: Nussbaum RL, McInnes RR, Willard HF, editors. Thompson and Thompson genetics in medicine, 6th ed.. Philadelphia, PA: W.B. Saunders, 2001. pp. 95–105. [8] Das S, Whitney S, Taylor J, Chen E, Levinson B, Vulpe C, et al. Prenatal diagnosis of Menkes disease by mutation analysis. J Inher Metab Dis 1995;18:364–365. [9] Tu¨ mer Z, Tønnesen T, Bo¨ hmann J, Marg W, Horn N. First trimester prenatal diagnosis of Menkes disease by DNA analysis. J Med Genet 1994;31:615–617. [10] Tu¨ mer Z, Horn N. Menkes disease: recent advances and new aspects. J Med Genet 1997;34:265–274.