- Email: [email protected]
Presence and expression of apelin and apelin receptor in bitch placenta
Theriogenology xxx (xxxx) xxx
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Presence and expression of apelin and apelin receptor in bitch placenta A. Troisi a, C. Dall’Aglio a, *, M. Maranesi a, R. Orlandi b, R. Speranza c, M. Zerani a, A. Polisca a di Perugia, Via San Costanzo 4, 06124, Perugia, Italy Dipartimento di Medicina Veterinaria, Universita Tyrus Clinica Veterinaria, Via Aldo Bartocci, 1G, 05100, Terni, Italy c Guadia di Finanza, Corso allevamento e addestramento cinofilo 46, Via Lungolago, 06061, Castiglione Del Lago, Italy a
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 July 2019 Received in revised form 15 November 2019 Accepted 16 November 2019 Available online xxx
Apelin is a potent inotropic agent causing endothelium-mediated vasodilation and is involved in vessel formation by interacting with a specific receptor. Its cardiovascular profile suggests a role in the regulation of gestational hemodynamic changes. The expression of apelin and its receptor has been reported in some portions of the reproductive tract of different mammalian species. As far as we know, there are no reports describing the expression of apelin and apelin receptor in bitch’s placenta. Therefore, the aim of this study was to investigate, for the first time, the presence and distribution of apelin and apelin receptor in bitch placenta by molecular biology and immunohistochemical techniques. Sixteen adult female half-breed bitches were used. The animals were divided into two groups based on the stage of pregnancy: group 1 (mid-gestation n ¼ 8) and group 2 (end gestation n ¼ 8). These bitches were subjected to ovariohysterectomy (group1) or non-conservative caesarean section (group 2). The immunohistochemical technique revealed the presence of positive immune reaction for apelin and apelin receptor in all the samples examined at 30 days and at the end of pregnancy. In particular, apelin and apelin receptor staining was evident in the cytoplasms of cytotrophoblasts and in epithelial cells of the maternal portion. Even if not included into the structure of the placenta, the uterine glands also exhibited a positive immune reaction for apelin and apelin receptor. The RT-PCR analysis showed the presence of transcripts for apelin and apelin receptor in all the placenta samples examined. On the basis of our results it was also possible to hypothesize a potential role of apelin in the control of local placenta blood flow during pregnancy development in bitches. © 2019 Elsevier Inc. All rights reserved.
Keywords: Apelin Apelin receptor Placenta Bitch Pregnancy
1. Introduction Apelin (APLN), a novel, multifunctional and bioactive peptide, is an adipokine that acts as the endogenous ligand for the orphan G protein-coupled receptor called APLNR [1]. It is derived from a 77amino acid precursor that could be cleaved into apelin-36 or shorter bioactive peptides such as apelin-13 and -17 [2]. Identified for the first time in bovine stomach extracts [1], apelin is mainly produced by adipose tissue under the regulation of nutritional status: its expression is reduced by fasting and restored by de-fasting, thus controlling energy metabolism [3].
di * Corresponding author. Dipartimento di Medicina Veterinaria, Universita Perugia, Via San Costanzo 4, 06124, Perugia, Italy. E-mail address: [email protected] (C. Dall’Aglio).
In mammals this bioactive peptide was also detected in several tissues and organs such as brain, heart, lung, kidney, gastrointestinal tract, retina, mammary glands [4e8], and reproductive tract [9]. As regards the reproductive apparatus, the presence and localization of APLN and APLNR have been reported in the uterus and ovary in different mammalian species [10e17]. The expression of the apelinergic system indicates that it may play roles in various physiological functions in the central nervous system (CNS) and in the peripheral organs. At the peripheral level, apelin is one of the most inotropic substance [18] and may modulate pulmonary function [10]. In the CNS, apelin induces effects consistent with regulation of body fluid homeostasis [19], stress responses [20], and cardiovascular function [21]. The cardiovascular system appears to be a privileged source of apelin because both apelin and its receptor are mostly present in
https://doi.org/10.1016/j.theriogenology.2019.11.016 0093-691X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
2
A. Troisi et al. / Theriogenology xxx (xxxx) xxx
the heart in large or small vessels endothelial cells [22]. In particular, it is involved in vessel formation [23,24]. Pregnancy is a state of important modifications of maternal hemodynamics and metabolism. Heart rate and plasma volume increase by 40% while systemic vascular resistance decrease by 25% [25]. In particular, the placenta is a tissue where vasculogenesis, blood pressure and blood flow are dramatically important to allow normal embryonic and foetal growth and development [26]. The hemodynamic changes occurring in the foetal-maternal unit have been described using Doppler ultrasonography in human and veterinary medicine [27e31]. Recently, Van Mieghem et al. [32] reported that in a gestational rat model apelin concentration in maternal plasma decreases by 50% in the last week of pregnancy, paralleling the physiological drop in blood pressure and increase in plasma volume. In human pregnancy, Van Mieghen et al. [33] showed that serum apelin levels decrease toward mid-gestation and then increase again in the third trimester. This pattern mimics the evolution of maternal blood pressure characterized by augmentation of peak systolic velocity and end diastolic velocity and reduction of resistive index and pulsatility index in human and other different species [27e31]. The apelinergic system has been well documented in human [24,33,34] and rat placental tissues [35] in physiological and pathological conditions. Its presence was also well documented in the mouse uterine endometrial lining tissue [36]. As far as we know, there are no studies on the APLN and APLNR in a dog’s placenta. Therefore, the aim of this study was to investigate, for the first time, the presence and immunohistochemical distribution of apelin and its receptor in the placenta at mid and end gestation of a bitch’s pregnancy through molecular biology and immunohistochemical techniques. 2. Material and methods 2.1. Animals Placental tissues were collected from 16 pregnant bitches of different breeds (five Boxers, three German Shepherds, eight mixed breeds), and age (2e5 years old) but with an average weight of 34.7 kg. The females were registered in the Teaching Hospital of Department of Veterinary Medicine, University of Perugia for ovario-hysterectomy or non-conservative caesarean section with the written consent of their owners. The animals were divided into two groups based on the stage of pregnancy: group 1 (mid-gestation n ¼ 8) and group 2 (end gestation n ¼ 8). These bitches were subjected to ovariohysterectomy (group1) or non-conservative caesarean section (group 2). 2.2. Ultrasound examination Pregnancy diagnosis was carried-out by ultrasonography (Esaote My Lab 30; Genova, Italy) using a microconvex probe of 5.5e7.5 MHz for both bidimensional and color Doppler ultrasound scanning. The gestational periods were calculated on the basis of the anamnesis data, day of ovulation, and by ultrasound biometric parameters [37]. 2.3. Surgical procedures The ovariohysterectomy was carried out under general anaesthesia using the following protocol: premedication with methadone 0,2-0,4 mg/kg IM (or IV) and metedomidine 1-5mcg/kg; induction with preoxygenation and propofol 4e6 mg/kg IV; maintenance through isoflurane, adjusting the vaporiser setting
according to anaesthetic depth; þ IV Ringer 10 ml/kg/h. Postoperative analgesia used buprenorphine 0,01-0,03 mg/kg IM. After three days of hospitalization, the bitches were returned to their owner. The non-conservative caesarean section were carried out under general anaesthesia using the following protocol: induction with preoxygenation and propofol 4e6 mg/kg IV; maintenance through isoflurane, adjusting the vaporiser setting according to anaesthetic depth; þ IV Ringer 10 ml/kg/h and, after removing the last puppy, methadone 0,2-0,4 mg/kg IV. Postoperative analgesia used buprenorphine 0,01-0,03 mg/kg IM. 2.4. Tissue collection and processing Upon ovariohysterectomy or caesarean section, placenta samples were promptly removed and thoroughly washed with saline. Within a few minutes, under stereoscopic magnification, tissue samples were quickly reduced and destined for subsequent examination. For the molecular biological studies, the samples were rinsed with RNase-free water and then frozen at 80 C for later evaluation of gene and protein expression. For the immunohistochemical analysis, other tissue samples of placenta were fixed by immersion in 4% (w/v) formaldehyde in PBS (pH 7.4) for 24 h at room temperature and subsequently processed following routine tissue preparation procedures [38]. 2.5. Reagents For immunohistochemical analysis (IHC), the rabbit polyclonal anti-APLN antibody (NBP2-31176) was from Novus Biologicals (Novus Biologicals, USA); the mouse monoclonal anti-APLNR antibody (sc-517300) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA); the normal goat serum (s-1000), the two secondary biotin-conjugated antibodies, goat anti-mouse (BA-9200 and goat anti-rabbit (BA-1000), as well as the ABC Kit and DAB were from Vector Laboratories (Vector Laboratories, Burlingame, CA, USA). Finally, the Eukitt (03989) was from Sigma-Aldrich. 2.6. Immunohistochemistry Five micrometer thick serial sections were collected on poly-Llysine-coated glass slides and processed for the immunohistochemical reaction, following antigen retrieval with a microwave oven and using 10 mM citric acid, pH 6.0, (three cycles, each lasting 5 min). All subsequent steps were carried out in a moist chamber at room temperature to prevent evaporation of the reagents. To avoid non-specific binding of the primary antibodies, after proper cooling the sections were pre-incubated for 30 min with the specific normal goat serum (1:10). Subsequently, serial sections were incubated overnight with anti-APLN rabbit polyclonal (1:100) and anti-APLNR mouse monoclonal (1:100) primary antibodies The next day, after washing in PBS, the sections were incubated with specific secondary biotin-conjugated antibodies, a goat anti-rabbit and a goat anti-mouse respectively (both 1:200), for 30 min and, after another washing in PBS, with the ABC KIT, again for 30 min. Finally, the tissue sections were rinsed in PBS and the reaction was developed using diaminobenzidine (DAB) as the chromogen. At the end of the immunoreaction, the sections were rinsed in PBS, counterstained with hematoxylin, dehydrated and mounted in Eukitt. Sections in which the primary antibodies were omitted were used as a control of unspecific staining. All tissue analyses were carried out on coded slides using a light microscope (Nikon Eclipse E800) connected to a digital camera (Dxm 1200 Nikon digital camera). For processing images, an image analysis system was used
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
A. Troisi et al. / Theriogenology xxx (xxxx) xxx
(Lucia, Laboratory Imaging Ltd.). The settings for image capture were standardized by subtracting the background signals obtained from the matched tissue sections which had not reacted with the primary antibodies and which were used as immunohistochemical controls [39]. Variations in the intensity of immunolabeling for APLN and APLNR were observed between different periods of pregnancy, probably reflecting the expression of the corresponding antigens. However, they were not quantified given the prevalently qualitative nature of the immunohistochemical technique. 2.7. Molecular biology 2.7.1. Reagents Deoxyribonuclease I (DNAase I Amp. Grade), Superscript III Reverse Transcriptase (Superscript III First-Strand Synthesis System), and DNA ladders were obtained from Life Technologies Italia (Monza, Monza Brianza, Italy). Reagents for isolation and purification of total RNA (TRIzol), Taq DNA polymerase (Platinum), RNAsefree tubes, water and deoxyNTPs, primers for APLN and APLNR, were also acquired from Life Technologies. NucleoSpin Gel and PCR cleanup were from Macherey-Nagel Inc (Bethlehem, PA, USA).
3
each) of sixteen different bitches as previously described [40]. Five micrograms of total RNA were reverse transcribed in 20 mL of Superscript III First-Strand Synthesis System using random hexamer according to the protocol provided by the manufacturer. Genomic DNA contamination was checked by developing the polymerase chain reaction without reverse transcriptase. The multiplex PCR amplification was performed as previously described [8,41] with the use of 1.0 mL of complementary DNA as a template for APLN and APLNR primers (Table 1). Cycling conditions consisted of an initial denaturizing cycle at 94C for 75 s, followed by 35 cycles for each target gene at 94C for 15 s, 60C for 30 s, 72C for 45 s, and a final extension step at 72C for 10 min. Within each experiment, the complete set of samples was processed in parallel in a single PCR, using aliquots of the same PCR master mix. The amplified PCR-generated products (18 mL of 25 mL total reaction volume) were analyzed by electrophoresis on 2% agarose gel using ethidium bromide staining. The amplified products, collected from agarose gel after electrophoresis, were purified with NucleoSpin Gel and PCR cleanup, and their identity confirmed by DNA sequencing with Sanger’s method.
3. Results 2.7.2. RNA extraction and RT-PCR Total RNA was extracted from the two parts of placenta (30 mg
Table 1 Primers of APLN and APLNR used for RTPCR. Gene APLN APLNR
F R F R
Primers
bp
CCTCCTGCAACTCTGGCTAC GTGGGAGACAAAGGGAATCA AGTCAGGTAGCATGACAGCAC AGCCTCAAGAAGGAAGGAAGAC
171 97
3.1. Immunohistochemistry The immunohistochemical technique revealed the presence of positive immune reaction (IR) for APLN and APLNR in all the samples examined of foetal and maternal placenta tested at 30 days and at the end of pregnancy. In particular, APLN staining was evident in the cytoplasm of cytotrophoblasts and syncitiotrophoblasts in the labirintic portion of the placenta (Fig. 1c, arrows) and in the cytoplasm of the epithelial cells of the maternal portion (Fig. 1b, arrow). The APLNR immunoreactions showed a similar pattern of
Fig. 1. APLN immunohistochemical aspects in the canine placenta and uterus: in a) immunopositivity is localized in the cytoplam of epithelial glandular cells (arrows); in b) immunopositivity is localized in the cytoplasm of epithelial lining cells (arrow); in c) immunopositivity is localized in some syncitiotrophoblasts of the placental labirintic portion (arrows).
Fig. 2. APLNR immunohistochemical aspects in the canine placenta and uterus: in a) immunopositivity is localized in the cytoplam of epithelial glandular cells (arrows); in b) immunopositivity is not localized in the cytoplasm of epithelial lining cells (arrow); in c) immunopositivity is localized in some syncitiotrophoblasts of the placental labirintic portion (arrows).
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
4
A. Troisi et al. / Theriogenology xxx (xxxx) xxx
Fig. 3. Gene expression of APLN (panel A) and APLNR mRNA (panel B) in maternal (MP) and foetal placenta (FP) of bitches. Representative agarose gel electrophoresis stained with ethidium bromide to verify matching between expected and obtained PCR products. For every PCR, a negative control (CTR-) were included, LD ¼ 100 bp DNA ladder.
distribution (Fig. 2c, arrows) even if the epithelial cells didn’t show a positive reaction (Fig. 2b, arrow). Moreover, even if not included into the structure of the placenta, the uterine glands also exhibited a positive IR for APLN and APLNR (Figs. 1a and 2a, arrows). Controls were always negative (see inserts in the figures). 3.2. Molecular biology The RT-PCR analysis showed the presence of transcripts for APLN and APLNR in all the samples examined of foetal and maternal placenta (Fig. 3). 4. Discussion The control of reproduction in mammalian species is regulated by hormonal interaction of the hypothalamic-pituitary-gonadal axis. New regulator hormones controlling reproduction called adipokines “adipose tissue-derived hormones” (adiponectin, resistin, leptin, visfatin, and apelin) are recently reported [42]. The complex APLN and APLNR controls organ maturation and energy homeostasis of the foetus. In fact, it is an important new stomach peptide with a potential physiological role in the gastrointestinal tract [43] and can regulate the glucose homeostasis if administered at low concentrations in an insulin-independent manner and at high concentrations in an insulin-dependent manner [44]. Furthermore, the complex APLN and APLNR are implicated in angiogenesis, placental vessels tone and subsequent maternal foetal exchange of oxygen and nutrients [45]. Moreover, during mammalian pregnancy, hemodynamic changes to support the increased vascular demand of uterus, placenta and foetus are necessary [33]. The adaption of endothelial cells to local flow modifications is a multifunctional process which leads to distinct modification of cell shape, subcellular distribution of structural proteins, and cellular function [46]. Therefore the endothelium is able to sense not only hormonal but also hemodynamic stimuli. It has been hypothesized that flow-induced signaling through APLNR is able to influence cell morphology and endothelial elasticity as well as cellular adhesion and spreading [46]. Apelin, together with its corresponding receptor, is also an inotropic potent agent causing endothelium-mediated vasodilatation and inducing endothelial
cellular proliferation and migration with consequent development of blood vessels [23]. The angiogenic properties of apelin allowed us to hypothesize its paracrine role during normal vascular development of the utero-placental unit [47]. In fact, a dysfunction of the apelinergic system contributes to the onset of pre-eclampsia via decreased angiogenic activity in human placental implantation [24,33,47]. Moreover, recent study clarified a shear-stress regulation of the apelinergic system in human endothelial cells and determined the particular relevance of APLNR for endothelial polarization [48] and mechanotransduction [49,50]. Therefore the complex APLN and APLNR plays a fundamental role during embryo-fetal and placental development. Our immunohistochemical and molecular biology study demonstrated, for the first time, the presence and distribution of APLN and APLNR in the cytoplasm of trofoblasts and in the epithelial cells of the maternal portion in bitch placenta at mid- and at end-gestation in accordance with what has been reported in humans [26,47,51]. For this reason we can say that the apelinergic system involves the same cells, presupposing an overlap of the functional meaning between the human and canine species. Further studies are in progress to verify if in the bitch, as well as in the human [26], there is a modulation of apelinergic system throughout pregnancy. Authors contributions Polisca, Orlandi, Speranza and Troisi: visited animals and collected samples. Dall’Aglio: carried out the immunohistochemical studies. Maranesi: carried out the molecular biology studies. Troisi, Zerani and Polisca: prepared the manuscript. All the authors participated in the revision of the manuscript and approved the final version. References [1] Tatemoto K, Hosoya M, Habata Y, Fujii R, Kakegawa T, Zou MX, Kawamata Y, Fukusumi S, Hinuma S, Kitada C, Kurokawa T, Onda H, Fujino M. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 1998;251:471e6. [2] Clarke KJ, Whitaker KW, Reyes TM. Diminished metabolic responses to centrally-administered apelin-13 in diet-induced obese rats fed a high-fat diet. J Neuroendocrinol 2009;21:83e9. €ldes G, Horkay F, Szokodi I, Vuolteenaho O, Ilves M, Lindstedt KA, [3] Fo €yra €npa €€ n B, Seres L, Skoumal R, Lako -Futo Z, deCha ^tel R, Ma a M, S arma th M. Circulating and car-diac levels of apelin, the novel ligand Ruskoaho H, To of the orphan receptor APJ, in patients with heart failure. BBRC (Biochem Biophys Res Commun) 2003;308:480e5. [4] Carpene C, Dray C, Attane C, Valet P, Portillo MP, Churruca I, Milagro FI, Castan-Laurell I. ExpandingRole for the apelin/APJ system in physiopathology. J Physiol Biochem 2007;63:359e73. [5] Medhurst AD, Jennings CA, Robbins MJ, Davis RP, Ellis C, Winborn KY, Lawrie KW, Hervieu G, Riley G, Bolaky JE, Herrity NC, Murdock P, Darker JG. Pharmacological and ImmunohistochemicalCharacterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162e1172ù. [6] O’Carroll AM, Selby TL, Palkovits M, Lolait SJ. Distribution of mRNA encoding B78/apj, the RatHomologue of the human APJ receptor, and its endogenous ligand apelin in brain and peripheral tissues. Biochim Biophys Acta Gene Struct Expr 2000;1492:72e80. [7] Falcao-Pires I, Ladeiras-Lopes R, Leite-Moreira AF. The apelinergic system: a promising therapeutic target. Expert Opin Ther Targets 2010;14:633e45. [8] Mercati F, Maranesi M, Dall’Aglio C, Petrucci L, Pasquariello R, Tardella FM, De Felice E, Scocco P. Apelin system in mammary gland of sheep reared inSeminatural pastures of the central apennines. Animals 2018 Nov28;8(12). [9] Kleinz MJ, Skepper JN, Davenport AP. Immunocytochemical localisation of the apelin receptor, APJ, to human cardiomyocytes, vascular smooth muscle and endothelial cells. Regul Pept 2005 Mar 30;126(3):233e40. [10] Kawamata Y, Habata Y, Fukusumi S, Hosoya M, Fujii R, Hinuma S, et al. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta Mol Cell Res 2001;23:162e71. [11] Habata Y, Fujii R, Hosoya M, Fukusumi S, Kawamata Y, Hinuma S, et al. Apelin, the natural ligand of the orphan receptor APJ, is abundantly secreted in the
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
A. Troisi et al. / Theriogenology xxx (xxxx) xxx colostrum. Biochim Biophys Acta 1999;13:25e35. [12] Shirasuna K, Shimizu T, Sayama K, Asahi T, Sasaki M, Berisha B, Schams D, Miyamoto A. Expression and localization of apelin and its receptor APJ in the bovine corpus luteum during the estrous cycle and prostaglandin F2alphainduced luteolysis. Reproduction 2008;135:519e525. [13] Shimizu T, Kosaka N, Murayama C, Tetsuka M, Miyamoto A. Apelin and APJ receptor expression in granulosa and theca cells during different stages of follicular development in the bovine ovary: involvement of apoptosis and hormonal regulation. Anim Reprod Sci 2009;116:28e37. [14] Schilffarth S, Antoni B, Schams D, Meyer HH, Berisha B. The expression of apelin and its receptor APJ during different physiological stages in the bovine ovary. Int J Biol Sci 2009;5:344e50. ska M, Dupont J, [15] Rak A, Drwal E, Rame C, Knapczyk-Stwora K, Słomczyn Gregoraszczuk EL. Expression of apelin and apelin receptor (APJ) in porcine ovarian follicles and in vitro effect of apelin on steroidogenesis and proliferation through APJ activation and different signaling pathways. Theriogenology 2017 Jul 1;96:126e35. [16] Pirino C, Maranesi M, Polisca A, Troisi A, Dall’Aglio C. The immunohistochemical presence and distribution of ghrelin, apelin and their receptors in dog ovaries. Microbiol Res 2017;8(1):28e30. https://doi.org/10.4081/ mr.2017.7177. [17] Mercati F, Maranesi M, Petrucci L, Scocco P, Pirino C, Acuti G, Dall’Aglio C. Apelin expression in the fallopian tubes of ewes subjected to different nutritional levels: preliminary results. Anat Histol Embryol 2018;47(S1):53. € ldes G, Voutilainen-Myllyla S, Ilves M, Tokola H. Apelin, [18] Szokodi I, Tavi P, Fo the novel endogenous ligand of the orphan receptor APJ, regulates cardiac contractility. Circ Res 2002;91:434e40. [19] De Mota N, Reaux-Le Goazigo A, El Messari S, Chartrel N, Roesch D, Dujardin C, et al. Apelin, a potent diuretic neuropeptide counteracting vasopressin actions through inhibition of vasopressin neuron activity and vasopressin release. Proc Natl AcadSci U S A 2004;101:10464e9. [20] O’Carroll A-M, Don AL, Lolait SJ. APJ receptor mRNA expression in the rat hypothalamic paraventricular nucleus: regulation by stress and glucocorticoids. J Neuroendocrinol 2003;15:1095e110. [21] Katugampola SD, Maguire JJ, Matthewson SR, Davenport AP. [(125)I]-(Pyr(1)) Apelin-13 is a novel radioligand for localizing the APJ orphan receptor in human and rat tissues with evidence for a vasoconstrictor role in man. Br J Pharmacol 2001;132:1255e60. [22] Lee DK, Cheng R, Nguyen T, Fan T, Kariyawasam AP, Liu Y, et al. Characterization of apelin, the ligand for the APJreceptor. J Neurochem 2000;74:34e41. [23] Cox CM1, D’Agostino SL, Miller MK, Heimark RL, Krieg PA. Apelin, the ligand for the endothelial G-protein-coupled receptor, APJ, is a potent angiogenic factor required for normal vascular development of the frog embryo. Dev Biol 2006 Aug 1;296(1):177e89. [24] Inuzuka H1, Nishizawa H, Inagaki A, Suzuki M, Ota S, Miyamura H, Miyazaki J, Sekiya T, Kurahashi H, Udagawa Y. Decreased expression of apelin in placentas from severe pre-eclampsia patients. Hypertens Pregnancy 2013 Nov;32(4):410e21. C, [25] Savu O, Jurcut¸ R, Gius¸c a S, van Mieghem T, Gussi I, Popescu BA, Ginghina Rademakers F, Deprest J, Voigt JU. Morphological and functional adaptation of the maternal heart during pregnancy. Circ. Cardiovasc Imaging 2012 May 1;5(3):289e97. [26] Cobellis L, De Falco M, Mastrogiacomo A, Giraldi D, Dattilo D, Scaffa C, Colacurci N, De Luca A. Modulation of apelin and APJ receptor in normal and preeclampsia-complicated placentas HistolHistopathol 2007 Jan;22(1):1e8. [27] Reuwer PJ, Nuyen WC, Beijer HJ, Heethaar RM, Haspels AA. BruinseHWFetoplacental circulatory competence. Eur J Obstet Gynecol Reprod Biol 1986 Jan;21(1):15e26. [28] Scotti L, Di Salvo P, Bocci F, Pieramati C, Polisca A. Doppler evaluation of maternal and foetal vessels during normal gestation in queen. Theriogenology 2008;69:1111e9. [29] Di Salvo P, Bocci F, Zelli R, Polisca A. Doppler evaluation of maternal and foetal vessels during normal gestation in the bitch. Res Vet Sci 2006;81:382e8. [30] Herzog K1, Bollwein H. Application of Doppler ultrasonography in cattle reproduction. Reprod Domest Anim 2007 Sep;42(Suppl 2):51e8. [31] Bollwein H, Mayer R, Stolla R. Transrectal Doppler sonography of uterine blood flow during early pregnancy in mares. Theriogenology 2003;60: 597e605. [32] Van Mieghem T, van Bree R, Van Herck E, Pijnenborg R, Deprest J, Verhaeghe J. Maternal apelin physiology during rat pregnancy: the role of the placenta. Placenta 2010 Aug;31(8):725e30. [33] Van Mieghem T, Doherty A, Baczyk D, Drewlo S, Baud D, Carvalho J, Kingdom J.
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
5
Apelin in normal pregnancy and pregnancies complicated by placental insufficiency. Reprod Sci 2016 Aug;23(8):1037e43. Telejko B, Kuzmicki M, Wawrusiewicz-Kurylonek N, Szamatowicz J, ski P, Nikolajuk A, Zonenberg A, Zwierz-Gugala D, Jelski W, Laudan Wilczynski J, Kretowski A, Gorska M. Plasma apelin levels and apelin/APJ mRNA expression in patients with gestational diabetes mellitus. Diabetes Res Clin Pract 2010 Feb;87(2):176e83. Wang C, Liu X, Kong D, Qin X, Li Y, Teng X, Huang X. Apelin as a novel drug for treating preeclampsia. Exp Ther Med 2017 Dec;14(6):5917e23. https:// doi.org/10.3892/etm.2017.5304.Epub.2017.Oct.13. Pope GR1, Roberts EM, Lolait SJ, O’Carroll AM. Central and peripheral apelin receptor distribution in the mouse: species differences with rat. Peptides 2012 Jan;33(1):139e48. https://doi.org/10.1016/j.peptides.2011.12.005. Epub 2011 Dec 16. Beccaglia M, Alonge S, Trovo C, Luvoni GC. Determination of gestational time and prediction of parturition in dogs and cats: an update. Reprod Domest Anim 2016 Sep;51(Suppl 1):12e7. Dall’Aglio C, Polisca A, Troisi A, Zelli R, Ceccarelli P. Immunohistochemistry localization of orexin A and orexin type 2 receptor-positive cells in the placenta of dogs. Acta Histochem 2014;116:989e92. Dall’Aglio C1, Polisca A, Boiti C, Ceccarelli P. Immunolocalization of leptin and its receptor in the placenta of cats. Acta Histochem 2012 Nov;114(7):719e22. https://doi.org/10.1016/j.acthis.2011.12.008. Epub 2012 Jan 20. Maranesi M, Parillo F, Leonardi L, Rebollar PG, Alonso B, Petrucci L, Gobbetti A, Boiti C, Arruda-Alencar J, Moura A, Zerani M. Expression of nerve growth factor and its receptors in the uterus of rabbits: functional involvement in prostaglandin synthesis. Domest Anim Endocrinol 2016 Jul;56:20e8. Maranesi M, Petrucci L, Leonardi L, Piro F, Rebollar PG, Mill an P, Cocci P, Vullo C, Parillo F, Moura A, Mariscal GG, Boiti C, Zerani M. New insights on a NGF-mediated pathway to induce ovulation in rabbits (Oryctolaguscuniculus). Biol Reprod 2018 May 1;98(5):634e43. zycka _ ska J, Dupont J, Rak A. Apelin in Kurowska P, Barbe A, Ro M, Chmielin reproductive physiology and pathology of different species: a critical review. Internet J Endocrinol 2018 Jun 6;2018:9170480. Wang G, Anini Y, Wei W, Qi X, AM OC, Mochizuki T, et al. Apelin, a new enteric peptide: localization in the gastrointestinal tract, ontogeny, and stimulation of gastric cell proliferation and of cholecystokinin secretion. Endocrinology 2004;145(3):1342e8. Mayeur S, Wattez JS, Lukaszewski MA, Lecoutre S, Butruille L, Drougard A, et al. Apelin controls fetal and neonatal glucose homeostasis and is altered bymaternal undernutrition. Diabetes 2016;65(3):554e60. D, Marousez L, Hanssens S, Knauf C, Breton C, Deruelle P, Lesage J. Eberle Elabela and Apelin actions in healthy and pathological pregnancies. Cytokine Growth Factor Rev 2019 Apr;46:45e53. https://doi.org/10.1016/ j.cytogfr.2019.03.003. Epub 2019 Mar 16. Strohbach A, Pennewitz M, Glaubitz M, Palankar R, Groß S, Lorenz F, Materzok I, Rong A3, Busch MC, Felix SB, Delcea M, Busch R. The apelin receptor influences biomechanical and morphological properties of endothelial cells. J Cell Physiol 2018 Aug;233(8):6250e61. https://doi.org/10.1002/ jcp.26496. Epub 2018 Feb 26. Yamaleyeva LM, Chappell MC, Brosnihan KB, Anton L, Caudell DL, Shi S, McGee C, Pirro N, Gallagher PE, Taylor RN, Merrill DC, Mertz HL. Downregulation of apelin in the human placental chorionic villi from preeclamptic pregnancies. Am J Physiol Endocrinol Metab 2015 Nov 15;309(10):E852e60. Kwon HB, Wang S, Helker CS, Rasouli SJ, Maischein HM, Offermanns S, Herzog W, Sainier DY. In vivo modulation of endothelial polarization by Apelin receptor signalling. Nat Commun 2016 Jun 1;7:11805. https://doi.org/ 10.1038/ncomms11805. Busch R, Strohbach A, Pennewitz M, Lorenz F, Bahls M, Busch MC, Felix SB. Regulation of the endothelial apelin/APJ system by hemodynamic fluid flow. Cell Signal 2015 Jul;27(7):1286e96. https://doi.org/10.1016/j.cellsig.2015.03.011. Epub 2015 Mar 24. Scimia MC, Hurtado C, Ray S, Metzler S, Wei K, Wang J, Woods CE, Purcell NH, Catalucci D, Akasaka T, Bueno OF, Vlasuk GP, Kaliman P, Bodmer R, Smith LH, Ashley E, Mercola M, Brown JH, Ruiz-Lozano P. APJ acts as a dual receptor in cardiac hypertrophy. Nature 2012 Aug 16;488(7411):394e8. https://doi.org/ 10.1038/nature11263. Furuya M, Okuda M, Usui H, Takenouchi T, Kami D, Nozawa A, Shozu M, Umezawa A, Takahashi T, Aoki I. Expression of angiotensin II receptor-like 1 in the placentas of pregnancy-induced hypertension. Int J Gynecol Pathol 2012 May;31(3):227e35.
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
Presence and expression of apelin and apelin receptor in bitch placenta A. Troisi a, C. Dall’Aglio a, *, M. Maranesi a, R. Orlandi b, R. Speranza c, M. Zerani a, A. Polisca a di Perugia, Via San Costanzo 4, 06124, Perugia, Italy Dipartimento di Medicina Veterinaria, Universita Tyrus Clinica Veterinaria, Via Aldo Bartocci, 1G, 05100, Terni, Italy c Guadia di Finanza, Corso allevamento e addestramento cinofilo 46, Via Lungolago, 06061, Castiglione Del Lago, Italy a
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 3 July 2019 Received in revised form 15 November 2019 Accepted 16 November 2019 Available online xxx
Apelin is a potent inotropic agent causing endothelium-mediated vasodilation and is involved in vessel formation by interacting with a specific receptor. Its cardiovascular profile suggests a role in the regulation of gestational hemodynamic changes. The expression of apelin and its receptor has been reported in some portions of the reproductive tract of different mammalian species. As far as we know, there are no reports describing the expression of apelin and apelin receptor in bitch’s placenta. Therefore, the aim of this study was to investigate, for the first time, the presence and distribution of apelin and apelin receptor in bitch placenta by molecular biology and immunohistochemical techniques. Sixteen adult female half-breed bitches were used. The animals were divided into two groups based on the stage of pregnancy: group 1 (mid-gestation n ¼ 8) and group 2 (end gestation n ¼ 8). These bitches were subjected to ovariohysterectomy (group1) or non-conservative caesarean section (group 2). The immunohistochemical technique revealed the presence of positive immune reaction for apelin and apelin receptor in all the samples examined at 30 days and at the end of pregnancy. In particular, apelin and apelin receptor staining was evident in the cytoplasms of cytotrophoblasts and in epithelial cells of the maternal portion. Even if not included into the structure of the placenta, the uterine glands also exhibited a positive immune reaction for apelin and apelin receptor. The RT-PCR analysis showed the presence of transcripts for apelin and apelin receptor in all the placenta samples examined. On the basis of our results it was also possible to hypothesize a potential role of apelin in the control of local placenta blood flow during pregnancy development in bitches. © 2019 Elsevier Inc. All rights reserved.
Keywords: Apelin Apelin receptor Placenta Bitch Pregnancy
1. Introduction Apelin (APLN), a novel, multifunctional and bioactive peptide, is an adipokine that acts as the endogenous ligand for the orphan G protein-coupled receptor called APLNR [1]. It is derived from a 77amino acid precursor that could be cleaved into apelin-36 or shorter bioactive peptides such as apelin-13 and -17 [2]. Identified for the first time in bovine stomach extracts [1], apelin is mainly produced by adipose tissue under the regulation of nutritional status: its expression is reduced by fasting and restored by de-fasting, thus controlling energy metabolism [3].
di * Corresponding author. Dipartimento di Medicina Veterinaria, Universita Perugia, Via San Costanzo 4, 06124, Perugia, Italy. E-mail address: [email protected] (C. Dall’Aglio).
In mammals this bioactive peptide was also detected in several tissues and organs such as brain, heart, lung, kidney, gastrointestinal tract, retina, mammary glands [4e8], and reproductive tract [9]. As regards the reproductive apparatus, the presence and localization of APLN and APLNR have been reported in the uterus and ovary in different mammalian species [10e17]. The expression of the apelinergic system indicates that it may play roles in various physiological functions in the central nervous system (CNS) and in the peripheral organs. At the peripheral level, apelin is one of the most inotropic substance [18] and may modulate pulmonary function [10]. In the CNS, apelin induces effects consistent with regulation of body fluid homeostasis [19], stress responses [20], and cardiovascular function [21]. The cardiovascular system appears to be a privileged source of apelin because both apelin and its receptor are mostly present in
https://doi.org/10.1016/j.theriogenology.2019.11.016 0093-691X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
2
A. Troisi et al. / Theriogenology xxx (xxxx) xxx
the heart in large or small vessels endothelial cells [22]. In particular, it is involved in vessel formation [23,24]. Pregnancy is a state of important modifications of maternal hemodynamics and metabolism. Heart rate and plasma volume increase by 40% while systemic vascular resistance decrease by 25% [25]. In particular, the placenta is a tissue where vasculogenesis, blood pressure and blood flow are dramatically important to allow normal embryonic and foetal growth and development [26]. The hemodynamic changes occurring in the foetal-maternal unit have been described using Doppler ultrasonography in human and veterinary medicine [27e31]. Recently, Van Mieghem et al. [32] reported that in a gestational rat model apelin concentration in maternal plasma decreases by 50% in the last week of pregnancy, paralleling the physiological drop in blood pressure and increase in plasma volume. In human pregnancy, Van Mieghen et al. [33] showed that serum apelin levels decrease toward mid-gestation and then increase again in the third trimester. This pattern mimics the evolution of maternal blood pressure characterized by augmentation of peak systolic velocity and end diastolic velocity and reduction of resistive index and pulsatility index in human and other different species [27e31]. The apelinergic system has been well documented in human [24,33,34] and rat placental tissues [35] in physiological and pathological conditions. Its presence was also well documented in the mouse uterine endometrial lining tissue [36]. As far as we know, there are no studies on the APLN and APLNR in a dog’s placenta. Therefore, the aim of this study was to investigate, for the first time, the presence and immunohistochemical distribution of apelin and its receptor in the placenta at mid and end gestation of a bitch’s pregnancy through molecular biology and immunohistochemical techniques. 2. Material and methods 2.1. Animals Placental tissues were collected from 16 pregnant bitches of different breeds (five Boxers, three German Shepherds, eight mixed breeds), and age (2e5 years old) but with an average weight of 34.7 kg. The females were registered in the Teaching Hospital of Department of Veterinary Medicine, University of Perugia for ovario-hysterectomy or non-conservative caesarean section with the written consent of their owners. The animals were divided into two groups based on the stage of pregnancy: group 1 (mid-gestation n ¼ 8) and group 2 (end gestation n ¼ 8). These bitches were subjected to ovariohysterectomy (group1) or non-conservative caesarean section (group 2). 2.2. Ultrasound examination Pregnancy diagnosis was carried-out by ultrasonography (Esaote My Lab 30; Genova, Italy) using a microconvex probe of 5.5e7.5 MHz for both bidimensional and color Doppler ultrasound scanning. The gestational periods were calculated on the basis of the anamnesis data, day of ovulation, and by ultrasound biometric parameters [37]. 2.3. Surgical procedures The ovariohysterectomy was carried out under general anaesthesia using the following protocol: premedication with methadone 0,2-0,4 mg/kg IM (or IV) and metedomidine 1-5mcg/kg; induction with preoxygenation and propofol 4e6 mg/kg IV; maintenance through isoflurane, adjusting the vaporiser setting
according to anaesthetic depth; þ IV Ringer 10 ml/kg/h. Postoperative analgesia used buprenorphine 0,01-0,03 mg/kg IM. After three days of hospitalization, the bitches were returned to their owner. The non-conservative caesarean section were carried out under general anaesthesia using the following protocol: induction with preoxygenation and propofol 4e6 mg/kg IV; maintenance through isoflurane, adjusting the vaporiser setting according to anaesthetic depth; þ IV Ringer 10 ml/kg/h and, after removing the last puppy, methadone 0,2-0,4 mg/kg IV. Postoperative analgesia used buprenorphine 0,01-0,03 mg/kg IM. 2.4. Tissue collection and processing Upon ovariohysterectomy or caesarean section, placenta samples were promptly removed and thoroughly washed with saline. Within a few minutes, under stereoscopic magnification, tissue samples were quickly reduced and destined for subsequent examination. For the molecular biological studies, the samples were rinsed with RNase-free water and then frozen at 80 C for later evaluation of gene and protein expression. For the immunohistochemical analysis, other tissue samples of placenta were fixed by immersion in 4% (w/v) formaldehyde in PBS (pH 7.4) for 24 h at room temperature and subsequently processed following routine tissue preparation procedures [38]. 2.5. Reagents For immunohistochemical analysis (IHC), the rabbit polyclonal anti-APLN antibody (NBP2-31176) was from Novus Biologicals (Novus Biologicals, USA); the mouse monoclonal anti-APLNR antibody (sc-517300) was from Santa Cruz Biotechnology (Santa Cruz, CA, USA); the normal goat serum (s-1000), the two secondary biotin-conjugated antibodies, goat anti-mouse (BA-9200 and goat anti-rabbit (BA-1000), as well as the ABC Kit and DAB were from Vector Laboratories (Vector Laboratories, Burlingame, CA, USA). Finally, the Eukitt (03989) was from Sigma-Aldrich. 2.6. Immunohistochemistry Five micrometer thick serial sections were collected on poly-Llysine-coated glass slides and processed for the immunohistochemical reaction, following antigen retrieval with a microwave oven and using 10 mM citric acid, pH 6.0, (three cycles, each lasting 5 min). All subsequent steps were carried out in a moist chamber at room temperature to prevent evaporation of the reagents. To avoid non-specific binding of the primary antibodies, after proper cooling the sections were pre-incubated for 30 min with the specific normal goat serum (1:10). Subsequently, serial sections were incubated overnight with anti-APLN rabbit polyclonal (1:100) and anti-APLNR mouse monoclonal (1:100) primary antibodies The next day, after washing in PBS, the sections were incubated with specific secondary biotin-conjugated antibodies, a goat anti-rabbit and a goat anti-mouse respectively (both 1:200), for 30 min and, after another washing in PBS, with the ABC KIT, again for 30 min. Finally, the tissue sections were rinsed in PBS and the reaction was developed using diaminobenzidine (DAB) as the chromogen. At the end of the immunoreaction, the sections were rinsed in PBS, counterstained with hematoxylin, dehydrated and mounted in Eukitt. Sections in which the primary antibodies were omitted were used as a control of unspecific staining. All tissue analyses were carried out on coded slides using a light microscope (Nikon Eclipse E800) connected to a digital camera (Dxm 1200 Nikon digital camera). For processing images, an image analysis system was used
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
A. Troisi et al. / Theriogenology xxx (xxxx) xxx
(Lucia, Laboratory Imaging Ltd.). The settings for image capture were standardized by subtracting the background signals obtained from the matched tissue sections which had not reacted with the primary antibodies and which were used as immunohistochemical controls [39]. Variations in the intensity of immunolabeling for APLN and APLNR were observed between different periods of pregnancy, probably reflecting the expression of the corresponding antigens. However, they were not quantified given the prevalently qualitative nature of the immunohistochemical technique. 2.7. Molecular biology 2.7.1. Reagents Deoxyribonuclease I (DNAase I Amp. Grade), Superscript III Reverse Transcriptase (Superscript III First-Strand Synthesis System), and DNA ladders were obtained from Life Technologies Italia (Monza, Monza Brianza, Italy). Reagents for isolation and purification of total RNA (TRIzol), Taq DNA polymerase (Platinum), RNAsefree tubes, water and deoxyNTPs, primers for APLN and APLNR, were also acquired from Life Technologies. NucleoSpin Gel and PCR cleanup were from Macherey-Nagel Inc (Bethlehem, PA, USA).
3
each) of sixteen different bitches as previously described [40]. Five micrograms of total RNA were reverse transcribed in 20 mL of Superscript III First-Strand Synthesis System using random hexamer according to the protocol provided by the manufacturer. Genomic DNA contamination was checked by developing the polymerase chain reaction without reverse transcriptase. The multiplex PCR amplification was performed as previously described [8,41] with the use of 1.0 mL of complementary DNA as a template for APLN and APLNR primers (Table 1). Cycling conditions consisted of an initial denaturizing cycle at 94C for 75 s, followed by 35 cycles for each target gene at 94C for 15 s, 60C for 30 s, 72C for 45 s, and a final extension step at 72C for 10 min. Within each experiment, the complete set of samples was processed in parallel in a single PCR, using aliquots of the same PCR master mix. The amplified PCR-generated products (18 mL of 25 mL total reaction volume) were analyzed by electrophoresis on 2% agarose gel using ethidium bromide staining. The amplified products, collected from agarose gel after electrophoresis, were purified with NucleoSpin Gel and PCR cleanup, and their identity confirmed by DNA sequencing with Sanger’s method.
3. Results 2.7.2. RNA extraction and RT-PCR Total RNA was extracted from the two parts of placenta (30 mg
Table 1 Primers of APLN and APLNR used for RTPCR. Gene APLN APLNR
F R F R
Primers
bp
CCTCCTGCAACTCTGGCTAC GTGGGAGACAAAGGGAATCA AGTCAGGTAGCATGACAGCAC AGCCTCAAGAAGGAAGGAAGAC
171 97
3.1. Immunohistochemistry The immunohistochemical technique revealed the presence of positive immune reaction (IR) for APLN and APLNR in all the samples examined of foetal and maternal placenta tested at 30 days and at the end of pregnancy. In particular, APLN staining was evident in the cytoplasm of cytotrophoblasts and syncitiotrophoblasts in the labirintic portion of the placenta (Fig. 1c, arrows) and in the cytoplasm of the epithelial cells of the maternal portion (Fig. 1b, arrow). The APLNR immunoreactions showed a similar pattern of
Fig. 1. APLN immunohistochemical aspects in the canine placenta and uterus: in a) immunopositivity is localized in the cytoplam of epithelial glandular cells (arrows); in b) immunopositivity is localized in the cytoplasm of epithelial lining cells (arrow); in c) immunopositivity is localized in some syncitiotrophoblasts of the placental labirintic portion (arrows).
Fig. 2. APLNR immunohistochemical aspects in the canine placenta and uterus: in a) immunopositivity is localized in the cytoplam of epithelial glandular cells (arrows); in b) immunopositivity is not localized in the cytoplasm of epithelial lining cells (arrow); in c) immunopositivity is localized in some syncitiotrophoblasts of the placental labirintic portion (arrows).
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
4
A. Troisi et al. / Theriogenology xxx (xxxx) xxx
Fig. 3. Gene expression of APLN (panel A) and APLNR mRNA (panel B) in maternal (MP) and foetal placenta (FP) of bitches. Representative agarose gel electrophoresis stained with ethidium bromide to verify matching between expected and obtained PCR products. For every PCR, a negative control (CTR-) were included, LD ¼ 100 bp DNA ladder.
distribution (Fig. 2c, arrows) even if the epithelial cells didn’t show a positive reaction (Fig. 2b, arrow). Moreover, even if not included into the structure of the placenta, the uterine glands also exhibited a positive IR for APLN and APLNR (Figs. 1a and 2a, arrows). Controls were always negative (see inserts in the figures). 3.2. Molecular biology The RT-PCR analysis showed the presence of transcripts for APLN and APLNR in all the samples examined of foetal and maternal placenta (Fig. 3). 4. Discussion The control of reproduction in mammalian species is regulated by hormonal interaction of the hypothalamic-pituitary-gonadal axis. New regulator hormones controlling reproduction called adipokines “adipose tissue-derived hormones” (adiponectin, resistin, leptin, visfatin, and apelin) are recently reported [42]. The complex APLN and APLNR controls organ maturation and energy homeostasis of the foetus. In fact, it is an important new stomach peptide with a potential physiological role in the gastrointestinal tract [43] and can regulate the glucose homeostasis if administered at low concentrations in an insulin-independent manner and at high concentrations in an insulin-dependent manner [44]. Furthermore, the complex APLN and APLNR are implicated in angiogenesis, placental vessels tone and subsequent maternal foetal exchange of oxygen and nutrients [45]. Moreover, during mammalian pregnancy, hemodynamic changes to support the increased vascular demand of uterus, placenta and foetus are necessary [33]. The adaption of endothelial cells to local flow modifications is a multifunctional process which leads to distinct modification of cell shape, subcellular distribution of structural proteins, and cellular function [46]. Therefore the endothelium is able to sense not only hormonal but also hemodynamic stimuli. It has been hypothesized that flow-induced signaling through APLNR is able to influence cell morphology and endothelial elasticity as well as cellular adhesion and spreading [46]. Apelin, together with its corresponding receptor, is also an inotropic potent agent causing endothelium-mediated vasodilatation and inducing endothelial
cellular proliferation and migration with consequent development of blood vessels [23]. The angiogenic properties of apelin allowed us to hypothesize its paracrine role during normal vascular development of the utero-placental unit [47]. In fact, a dysfunction of the apelinergic system contributes to the onset of pre-eclampsia via decreased angiogenic activity in human placental implantation [24,33,47]. Moreover, recent study clarified a shear-stress regulation of the apelinergic system in human endothelial cells and determined the particular relevance of APLNR for endothelial polarization [48] and mechanotransduction [49,50]. Therefore the complex APLN and APLNR plays a fundamental role during embryo-fetal and placental development. Our immunohistochemical and molecular biology study demonstrated, for the first time, the presence and distribution of APLN and APLNR in the cytoplasm of trofoblasts and in the epithelial cells of the maternal portion in bitch placenta at mid- and at end-gestation in accordance with what has been reported in humans [26,47,51]. For this reason we can say that the apelinergic system involves the same cells, presupposing an overlap of the functional meaning between the human and canine species. Further studies are in progress to verify if in the bitch, as well as in the human [26], there is a modulation of apelinergic system throughout pregnancy. Authors contributions Polisca, Orlandi, Speranza and Troisi: visited animals and collected samples. Dall’Aglio: carried out the immunohistochemical studies. Maranesi: carried out the molecular biology studies. Troisi, Zerani and Polisca: prepared the manuscript. All the authors participated in the revision of the manuscript and approved the final version. References [1] Tatemoto K, Hosoya M, Habata Y, Fujii R, Kakegawa T, Zou MX, Kawamata Y, Fukusumi S, Hinuma S, Kitada C, Kurokawa T, Onda H, Fujino M. Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem Biophys Res Commun 1998;251:471e6. [2] Clarke KJ, Whitaker KW, Reyes TM. Diminished metabolic responses to centrally-administered apelin-13 in diet-induced obese rats fed a high-fat diet. J Neuroendocrinol 2009;21:83e9. €ldes G, Horkay F, Szokodi I, Vuolteenaho O, Ilves M, Lindstedt KA, [3] Fo €yra €npa €€ n B, Seres L, Skoumal R, Lako -Futo Z, deCha ^tel R, Ma a M, S arma th M. Circulating and car-diac levels of apelin, the novel ligand Ruskoaho H, To of the orphan receptor APJ, in patients with heart failure. BBRC (Biochem Biophys Res Commun) 2003;308:480e5. [4] Carpene C, Dray C, Attane C, Valet P, Portillo MP, Churruca I, Milagro FI, Castan-Laurell I. ExpandingRole for the apelin/APJ system in physiopathology. J Physiol Biochem 2007;63:359e73. [5] Medhurst AD, Jennings CA, Robbins MJ, Davis RP, Ellis C, Winborn KY, Lawrie KW, Hervieu G, Riley G, Bolaky JE, Herrity NC, Murdock P, Darker JG. Pharmacological and ImmunohistochemicalCharacterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162e1172ù. [6] O’Carroll AM, Selby TL, Palkovits M, Lolait SJ. Distribution of mRNA encoding B78/apj, the RatHomologue of the human APJ receptor, and its endogenous ligand apelin in brain and peripheral tissues. Biochim Biophys Acta Gene Struct Expr 2000;1492:72e80. [7] Falcao-Pires I, Ladeiras-Lopes R, Leite-Moreira AF. The apelinergic system: a promising therapeutic target. Expert Opin Ther Targets 2010;14:633e45. [8] Mercati F, Maranesi M, Dall’Aglio C, Petrucci L, Pasquariello R, Tardella FM, De Felice E, Scocco P. Apelin system in mammary gland of sheep reared inSeminatural pastures of the central apennines. Animals 2018 Nov28;8(12). [9] Kleinz MJ, Skepper JN, Davenport AP. Immunocytochemical localisation of the apelin receptor, APJ, to human cardiomyocytes, vascular smooth muscle and endothelial cells. Regul Pept 2005 Mar 30;126(3):233e40. [10] Kawamata Y, Habata Y, Fukusumi S, Hosoya M, Fujii R, Hinuma S, et al. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta Mol Cell Res 2001;23:162e71. [11] Habata Y, Fujii R, Hosoya M, Fukusumi S, Kawamata Y, Hinuma S, et al. Apelin, the natural ligand of the orphan receptor APJ, is abundantly secreted in the
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016
A. Troisi et al. / Theriogenology xxx (xxxx) xxx colostrum. Biochim Biophys Acta 1999;13:25e35. [12] Shirasuna K, Shimizu T, Sayama K, Asahi T, Sasaki M, Berisha B, Schams D, Miyamoto A. Expression and localization of apelin and its receptor APJ in the bovine corpus luteum during the estrous cycle and prostaglandin F2alphainduced luteolysis. Reproduction 2008;135:519e525. [13] Shimizu T, Kosaka N, Murayama C, Tetsuka M, Miyamoto A. Apelin and APJ receptor expression in granulosa and theca cells during different stages of follicular development in the bovine ovary: involvement of apoptosis and hormonal regulation. Anim Reprod Sci 2009;116:28e37. [14] Schilffarth S, Antoni B, Schams D, Meyer HH, Berisha B. The expression of apelin and its receptor APJ during different physiological stages in the bovine ovary. Int J Biol Sci 2009;5:344e50. ska M, Dupont J, [15] Rak A, Drwal E, Rame C, Knapczyk-Stwora K, Słomczyn Gregoraszczuk EL. Expression of apelin and apelin receptor (APJ) in porcine ovarian follicles and in vitro effect of apelin on steroidogenesis and proliferation through APJ activation and different signaling pathways. Theriogenology 2017 Jul 1;96:126e35. [16] Pirino C, Maranesi M, Polisca A, Troisi A, Dall’Aglio C. The immunohistochemical presence and distribution of ghrelin, apelin and their receptors in dog ovaries. Microbiol Res 2017;8(1):28e30. https://doi.org/10.4081/ mr.2017.7177. [17] Mercati F, Maranesi M, Petrucci L, Scocco P, Pirino C, Acuti G, Dall’Aglio C. Apelin expression in the fallopian tubes of ewes subjected to different nutritional levels: preliminary results. Anat Histol Embryol 2018;47(S1):53. € ldes G, Voutilainen-Myllyla S, Ilves M, Tokola H. Apelin, [18] Szokodi I, Tavi P, Fo the novel endogenous ligand of the orphan receptor APJ, regulates cardiac contractility. Circ Res 2002;91:434e40. [19] De Mota N, Reaux-Le Goazigo A, El Messari S, Chartrel N, Roesch D, Dujardin C, et al. Apelin, a potent diuretic neuropeptide counteracting vasopressin actions through inhibition of vasopressin neuron activity and vasopressin release. Proc Natl AcadSci U S A 2004;101:10464e9. [20] O’Carroll A-M, Don AL, Lolait SJ. APJ receptor mRNA expression in the rat hypothalamic paraventricular nucleus: regulation by stress and glucocorticoids. J Neuroendocrinol 2003;15:1095e110. [21] Katugampola SD, Maguire JJ, Matthewson SR, Davenport AP. [(125)I]-(Pyr(1)) Apelin-13 is a novel radioligand for localizing the APJ orphan receptor in human and rat tissues with evidence for a vasoconstrictor role in man. Br J Pharmacol 2001;132:1255e60. [22] Lee DK, Cheng R, Nguyen T, Fan T, Kariyawasam AP, Liu Y, et al. Characterization of apelin, the ligand for the APJreceptor. J Neurochem 2000;74:34e41. [23] Cox CM1, D’Agostino SL, Miller MK, Heimark RL, Krieg PA. Apelin, the ligand for the endothelial G-protein-coupled receptor, APJ, is a potent angiogenic factor required for normal vascular development of the frog embryo. Dev Biol 2006 Aug 1;296(1):177e89. [24] Inuzuka H1, Nishizawa H, Inagaki A, Suzuki M, Ota S, Miyamura H, Miyazaki J, Sekiya T, Kurahashi H, Udagawa Y. Decreased expression of apelin in placentas from severe pre-eclampsia patients. Hypertens Pregnancy 2013 Nov;32(4):410e21. C, [25] Savu O, Jurcut¸ R, Gius¸c a S, van Mieghem T, Gussi I, Popescu BA, Ginghina Rademakers F, Deprest J, Voigt JU. Morphological and functional adaptation of the maternal heart during pregnancy. Circ. Cardiovasc Imaging 2012 May 1;5(3):289e97. [26] Cobellis L, De Falco M, Mastrogiacomo A, Giraldi D, Dattilo D, Scaffa C, Colacurci N, De Luca A. Modulation of apelin and APJ receptor in normal and preeclampsia-complicated placentas HistolHistopathol 2007 Jan;22(1):1e8. [27] Reuwer PJ, Nuyen WC, Beijer HJ, Heethaar RM, Haspels AA. BruinseHWFetoplacental circulatory competence. Eur J Obstet Gynecol Reprod Biol 1986 Jan;21(1):15e26. [28] Scotti L, Di Salvo P, Bocci F, Pieramati C, Polisca A. Doppler evaluation of maternal and foetal vessels during normal gestation in queen. Theriogenology 2008;69:1111e9. [29] Di Salvo P, Bocci F, Zelli R, Polisca A. Doppler evaluation of maternal and foetal vessels during normal gestation in the bitch. Res Vet Sci 2006;81:382e8. [30] Herzog K1, Bollwein H. Application of Doppler ultrasonography in cattle reproduction. Reprod Domest Anim 2007 Sep;42(Suppl 2):51e8. [31] Bollwein H, Mayer R, Stolla R. Transrectal Doppler sonography of uterine blood flow during early pregnancy in mares. Theriogenology 2003;60: 597e605. [32] Van Mieghem T, van Bree R, Van Herck E, Pijnenborg R, Deprest J, Verhaeghe J. Maternal apelin physiology during rat pregnancy: the role of the placenta. Placenta 2010 Aug;31(8):725e30. [33] Van Mieghem T, Doherty A, Baczyk D, Drewlo S, Baud D, Carvalho J, Kingdom J.
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
[49]
[50]
[51]
5
Apelin in normal pregnancy and pregnancies complicated by placental insufficiency. Reprod Sci 2016 Aug;23(8):1037e43. Telejko B, Kuzmicki M, Wawrusiewicz-Kurylonek N, Szamatowicz J, ski P, Nikolajuk A, Zonenberg A, Zwierz-Gugala D, Jelski W, Laudan Wilczynski J, Kretowski A, Gorska M. Plasma apelin levels and apelin/APJ mRNA expression in patients with gestational diabetes mellitus. Diabetes Res Clin Pract 2010 Feb;87(2):176e83. Wang C, Liu X, Kong D, Qin X, Li Y, Teng X, Huang X. Apelin as a novel drug for treating preeclampsia. Exp Ther Med 2017 Dec;14(6):5917e23. https:// doi.org/10.3892/etm.2017.5304.Epub.2017.Oct.13. Pope GR1, Roberts EM, Lolait SJ, O’Carroll AM. Central and peripheral apelin receptor distribution in the mouse: species differences with rat. Peptides 2012 Jan;33(1):139e48. https://doi.org/10.1016/j.peptides.2011.12.005. Epub 2011 Dec 16. Beccaglia M, Alonge S, Trovo C, Luvoni GC. Determination of gestational time and prediction of parturition in dogs and cats: an update. Reprod Domest Anim 2016 Sep;51(Suppl 1):12e7. Dall’Aglio C, Polisca A, Troisi A, Zelli R, Ceccarelli P. Immunohistochemistry localization of orexin A and orexin type 2 receptor-positive cells in the placenta of dogs. Acta Histochem 2014;116:989e92. Dall’Aglio C1, Polisca A, Boiti C, Ceccarelli P. Immunolocalization of leptin and its receptor in the placenta of cats. Acta Histochem 2012 Nov;114(7):719e22. https://doi.org/10.1016/j.acthis.2011.12.008. Epub 2012 Jan 20. Maranesi M, Parillo F, Leonardi L, Rebollar PG, Alonso B, Petrucci L, Gobbetti A, Boiti C, Arruda-Alencar J, Moura A, Zerani M. Expression of nerve growth factor and its receptors in the uterus of rabbits: functional involvement in prostaglandin synthesis. Domest Anim Endocrinol 2016 Jul;56:20e8. Maranesi M, Petrucci L, Leonardi L, Piro F, Rebollar PG, Mill an P, Cocci P, Vullo C, Parillo F, Moura A, Mariscal GG, Boiti C, Zerani M. New insights on a NGF-mediated pathway to induce ovulation in rabbits (Oryctolaguscuniculus). Biol Reprod 2018 May 1;98(5):634e43. zycka _ ska J, Dupont J, Rak A. Apelin in Kurowska P, Barbe A, Ro M, Chmielin reproductive physiology and pathology of different species: a critical review. Internet J Endocrinol 2018 Jun 6;2018:9170480. Wang G, Anini Y, Wei W, Qi X, AM OC, Mochizuki T, et al. Apelin, a new enteric peptide: localization in the gastrointestinal tract, ontogeny, and stimulation of gastric cell proliferation and of cholecystokinin secretion. Endocrinology 2004;145(3):1342e8. Mayeur S, Wattez JS, Lukaszewski MA, Lecoutre S, Butruille L, Drougard A, et al. Apelin controls fetal and neonatal glucose homeostasis and is altered bymaternal undernutrition. Diabetes 2016;65(3):554e60. D, Marousez L, Hanssens S, Knauf C, Breton C, Deruelle P, Lesage J. Eberle Elabela and Apelin actions in healthy and pathological pregnancies. Cytokine Growth Factor Rev 2019 Apr;46:45e53. https://doi.org/10.1016/ j.cytogfr.2019.03.003. Epub 2019 Mar 16. Strohbach A, Pennewitz M, Glaubitz M, Palankar R, Groß S, Lorenz F, Materzok I, Rong A3, Busch MC, Felix SB, Delcea M, Busch R. The apelin receptor influences biomechanical and morphological properties of endothelial cells. J Cell Physiol 2018 Aug;233(8):6250e61. https://doi.org/10.1002/ jcp.26496. Epub 2018 Feb 26. Yamaleyeva LM, Chappell MC, Brosnihan KB, Anton L, Caudell DL, Shi S, McGee C, Pirro N, Gallagher PE, Taylor RN, Merrill DC, Mertz HL. Downregulation of apelin in the human placental chorionic villi from preeclamptic pregnancies. Am J Physiol Endocrinol Metab 2015 Nov 15;309(10):E852e60. Kwon HB, Wang S, Helker CS, Rasouli SJ, Maischein HM, Offermanns S, Herzog W, Sainier DY. In vivo modulation of endothelial polarization by Apelin receptor signalling. Nat Commun 2016 Jun 1;7:11805. https://doi.org/ 10.1038/ncomms11805. Busch R, Strohbach A, Pennewitz M, Lorenz F, Bahls M, Busch MC, Felix SB. Regulation of the endothelial apelin/APJ system by hemodynamic fluid flow. Cell Signal 2015 Jul;27(7):1286e96. https://doi.org/10.1016/j.cellsig.2015.03.011. Epub 2015 Mar 24. Scimia MC, Hurtado C, Ray S, Metzler S, Wei K, Wang J, Woods CE, Purcell NH, Catalucci D, Akasaka T, Bueno OF, Vlasuk GP, Kaliman P, Bodmer R, Smith LH, Ashley E, Mercola M, Brown JH, Ruiz-Lozano P. APJ acts as a dual receptor in cardiac hypertrophy. Nature 2012 Aug 16;488(7411):394e8. https://doi.org/ 10.1038/nature11263. Furuya M, Okuda M, Usui H, Takenouchi T, Kami D, Nozawa A, Shozu M, Umezawa A, Takahashi T, Aoki I. Expression of angiotensin II receptor-like 1 in the placentas of pregnancy-induced hypertension. Int J Gynecol Pathol 2012 May;31(3):227e35.
Please cite this article as: Troisi A et al., Presence and expression of apelin and apelin receptor in bitch placenta, Theriogenology, https://doi.org/ 10.1016/j.theriogenology.2019.11.016