Prevalence, antibiotic resistance and RAPD typing of Campylobacter species isolated from ducks, their rearing and processing environments in Penang, Malaysia

International Journal of Food Microbiology 154 (2012) 197–205

Contents lists available at SciVerse ScienceDirect

International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro

Prevalence, antibiotic resistance and RAPD typing of Campylobacter species isolated from ducks, their rearing and processing environments in Penang, Malaysia Frederick Adzitey a, b, Gulam Rusul a,⁎, Nurul Huda a, Tristan Cogan c, Janet Corry c a b c

Universiti Sains Malaysia, School of Industrial Technology, Food Technology Division, 11800 Pulau Pinang, Malaysia University for Development Studies, Animal Science Department, Box TL 1882, Tamale, Ghana University of Bristol, School of Veterinary Sciences, Langford, Bristol, BS40 5DU, UK

a r t i c l e

i n f o

Article history: Received 26 September 2011 Received in revised form 4 January 2012 Accepted 7 January 2012 Available online 12 January 2012 Keywords: Antibiotics Campylobacter species Ducks Prevalence RAPD

a b s t r a c t We report for the first time on the prevalence, antibiotic resistance and RAPD types of Campylobacter species in ducks and duck related environmental samples in Malaysia. Samples were examined by enrichment in Bolton Broth followed by plating onto modified Charcoal Cefoperazone Deoxycholate agar (mCCDA) and/or plating directly onto mCCDA. A total of 643 samples were screened, and the prevalence of Campylobacter spp. in samples from different sources ranged from 0% to 85%. The method of isolation had a significant (P b 0.05) effect on the isolation rate. One hundred and sixteen Campylobacter isolates, comprising of 94 Campylobacter jejuni, 19 Campylobacter coli and three Campylobacter lari, were examined for their sensitivity to 13 antibiotics. Majority of the C. jejuni isolates were resistant to cephalothin (99%), tetracycline (96%), suphamethoxazole/trimethoprim (96%), and very few were resistant to gentamicin (5%), chloramphenicol (7%) and erythromycin (1%). All C. coli isolates were resistant to cephalothin, nalidixic acid, norfloxacin and tetracycline but susceptible to chloramphenicol, erythromycin and gentamicin. The three C. lari isolates were resistant to all the antibiotics tested except chloramphenicol and gentamicin (1/3 and 2/3 susceptible, respectively). Genetic diversity of Campylobacter isolates were determined using random amplification of polymorphic DNA (RAPD). C. jejuni and C. coli isolates belong to fifty-eight and twelve RAPD types, respectively. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The importance of Campylobacter as a foodborne pathogen is well recognized worldwide. Mead et al. (1999) estimated that Campylobacter species are the leading cause of foodborne illness compared with other foodborne pathogens. Campylobacter jejuni, and Campylobacter coli, have both been implicated in most foodborne cases (EFSA, 2005). Among Campylabacter spp., C. jejuni is the predominant cause of campylobacteriosis, which is responsible for 90% of the outbreaks, whereas C. coli only accounts for 5% of the outbreaks (EFSA, 2005). Gastroenteritis is the main syndrome caused by Campylobacters. Other complications include Reiter's and Guillain–Barré syndromes (Ang et al., 2001; Bereswill and Kist, 2003). Poultry and poultry products are major sources of Campylobacter infection in humans. Campylobacter spp. can be spread through cross contamination of ready-to-eat foods, direct hand-to-mouth transfer and to a lesser extent through the consumption of undercooked poultry meat (EFSA, 2005; Moore et al., 2005). Besides poultry, raw milk, dairy products, cattle, pigs, untreated water, and sewage have been reported as sources for Campylobacter

⁎ Corresponding author. Tel.: + 60 2 2103046 × 2216; fax: + 60 4 6573678. E-mail address: [email protected] (G. Rusul). 0168-1605/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2012.01.006

spp. (EFSA, 2005; Humphrey et al., 2007; Arun, 2008; Adzitey and Nurul, 2011). In Malaysia, the prevalence of Campylobacter spp. has been reported by Saleha (2002) in broiler chickens (46–93%) and Chai et al. (2009) in soil, poultry manure, irrigation water, and freshly harvested vegetables (0–57%). In a survey by Suzuki and Yamamoto (2009) in Japan, Campylobacters were not found in frozen chickens imported from Malaysia, but they were present in those imported from USA, China, Brazil and Thailand. Campylobacter spp. have been isolated from ducks in the UK (Ridsdale et al., 1998), USA (McCrea et al., 2006), Thailand (Boonmar et al., 2007) and Tanzania (Nonga and Muhairwa, 2010). Antibiotics are extensively used in animal feeds as growth promoters and for therapeutic purposes. The extensive uses of antibiotics have led to the emergence of antibiotic resistant strains of foodborne pathogens (Jimenez et al., 1994). Resistance of Campylobacter isolates from duck intestines to antibiotics such as ampicillin, streptomycin, tetracycline, erythromycin, gentamicin, ciprofloxacin and norfloxacin have been reported (Nonga and Muhairwa, 2010). It is also not recommended to treat human Campylobacter infections with antibiotics except in serious cases, for which fluoroquinlones are normally recommended with erythromycin as alternatives (Zhao et al., 2010). However, treatment with antibiotics can be difficult due to the steady increase in resistance of this pathogen to quinolones, fluoroquinolones and other

198

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

antimicrobial agents (Han et al., 2007; Ekkapobyotin et al., 2008; Qin et al., 2011). There are fewer reports on the prevalence of Campylobacter in ducks as compared with chicken, which might be due to the fact that ducks are reared much less extensively. However ducks are important food sources especially in Asia, and their association with foodborne pathogens cannot be ignored. Duck production plays a significant role in the agricultural economy of Malaysia, which is the third largest world producer of duck meat after China and France (FAO, 2009). In Malaysia duck meat output rose over 70%, from about 65,000 tonnes to 110,000 tonnes between 2000 and 2008, and current agriculture policy continues to encourage producers and processors to increase their production (FAO, 2009; Anonymous, 2011; Adzitey et al., in press). The duck industry provides employment for those involved in duck farming, processing and other forms of business directly or indirectly linked to ducks. Despite the high economic importance of the duck industry, published data on the occurrence and characteristics of Campylobacter spp. in ducks raised in Malaysia is rare. Therefore this study investigates the occurrence of Campylobacter spp. in ducks, their rearing and processing environments. Campylobacter isolates were speciated using multiplex PCR assay, examined for their resistance to antibiotics and genetic diversity using RAPD. 2. Materials and methods 2.1. Collection of samples Six hundred and forty three duck and environmental samples were collected from commercial duck farms and wet markets in Penang, Malaysia between September 2009 and January 2011. The samples taken at random from four different processors in the wet market consisted of 152 large intestines, 52 ceca, 15 floor, 15 table swabs, 15 transport crate swabs, 38 wash water samples (water used for washing carcasses after dressing) and 30 samples of carcass rinses. Samples taken from four different commercial farms consisted of 105 fecal, 75 cloacal swabs, 60 soil (taken randomly from different spots on the farm), 30 feed, 30 drinking water, 16 pond water and 10 egg shell swabs. The samples were transported in polystyrene boxes containing ice and analyzed immediately on reaching the laboratory. 2.2. Isolation and storage of Campylobacter species Isolation of Campylobacter spp. was carried out using enrichment and subsequent plating or by direct plating. Swabs (except for ceca or large intestine) were moistened with 0.1% Buffered Peptone Water (BPW, CM0009, Oxoid) just before swabbing. Carcass rinses were obtained by placing the carcass in a sterile plastic bag containing 500 ml of BPW and shaking for about 2 min. Swabs were directly streaked onto modified Charcoal Cefoperazone Deoxycholate agar (mCCDA, Cat. No. 1.00070.0500, Merck; supplemented with CCDA selective supplement, Cat. no. 1.00071.0001, Merck). Swabs were enriched in 10 ml Bolton Broth (BB, CM0983, Oxoid; supplemented with Bolton Broth Selective Supplement, SR0183E, Oxoid; and Laked Horse Blood, SR0048C, Oxoid). 10 g or 10 ml of feed, soil, drinking and pond water samples were enriched in 90 ml BB. 1 g of feces was enriched in 9 ml of BB. 100 ml of carcass rinses or wash water samples were pelleted by centrifuging (Kubota 6400) at 4472 ×g for 15 min at 4 °C. The pellet was resuspended in 9 ml of BB for enrichment. The cultures were incubated at 41.5 °C for 48 h in an anaerobic jar containing a gas mixture of 10% CO2, 5% O2 and 85% N2 and/or Anaerocult® C (Cat. no. 1.16275.0001, Merck, Germany). After 48 h incubation, 10 μl were streaked onto mCCDA plates and the plates were incubated at 41.5 °C for 48 h under microaerobic conditions. One to three presumptive Campylobacter colonies were picked from each mCCDA plate and purified on 7% Blood agar (prepared

using Columbia Blood Agar Base, CM0331, Oxoid, and supplemented with Defibrinated Horse Blood (DHB), SR0050, Oxoid) and/or mCCDA without supplement. Twenty presumptive Campylobacter isolates were identified to species level using the following phenotypic tests in order to distinguish between C. jejuni, C. coli and Campylobacter lari: Gram stain, oxidase (+), catalase (+), inability to grow aerobically at 25 °C, glucose utilization (−) and Dryspot Campylobacter Test (DR0150M, Oxoid, UK) and differentiated by hippurate hydrolysis and susceptibility to nalidixic acid (Na) and cephalothin (Cip). Campylobacter isolates were initially stored in 5% glycerol plus Brain Heart Infusion Broth (CM 0225, Oxoid, UK) at − 20 °C and later stored in CryoCare™ (KS70MI50, Key Scientific, USA) at −70 °C. 2.3. Template DNA preparation DNA templates were prepared using freshly grown Campylobacter colonies on blood agar, by adding a loopful to 500 μl sterile distilled water and boiled in a heater block at 100 °C for 10 min. Template DNA was stored at −20 °C until used for PCR reactions. 2.4. Identification of Campylobacter isolates using Multiplex Polymerase Chain Reaction (mPCR) Confirmation and speciation of all presumptive Campylobacter isolates (including those twenty previously speciated using phenotypic tests) was also done using multiplex PCR with C. jejuni NCTC 11168 and C. coli RM 2228 as control strains. The method of Wang et al. (2002) was used, with slight modifications. Primers used were designed to identify hipO genes in C. jejuni; glyA in C. coli, C. lari, and C. upsaliensis, and sapB2 in C. fetus subsp. fetus. The primer sequences used for the mPCR are presented in Table 1. The PCR mixture for one reaction (25 μl) consisted of 12.5 μl GoTaq mastermix (M5133, Promega, USA), 3 μl 25 mM MgCl2, 5.5 μl nuclease free water, 2 μl template DNA and 2 μl primer mix (10 μM concentration). Amplification of DNA was performed with 30 cycles of the following: denaturing at 95 °C for 30 s, annealing at 59 °C for 30 s and extension at 72 °C for 30 s, with a final extension time of 72 °C for 7 min in a Peltier Thermal Cycler. 15 μl aliquots of the PCR products were separated using agarose gel electrophoresis (2% agarose containing 1 μg/ml ethidium bromide). The gel was run for 80 min at 90 V and visualized on an ultra violet transilluminator (UVP BioDoc-It™ Imaging System, Cambridge, UK). Band positions were determined visually and compared to a molecular weight marker (Hyperladder II, Bioline, London, UK). 2.5. Preparation of unidentified Campylobacter isolates for sequencing Campylobacter isolates that could not be identified by mPCR were identified by sequencing of 16S rRNA, according to the method of Inglis and Cohen (2004). The primers used were UNI27 F (5-AGA GTT TGA TCC TGG CTC AG-3) and UNI1492 R (5-TAC GG(C/T) TAC CTT GTT ACG ACT-3). Each reaction mixture (25 μl) consisted of primers (2 μl of 10 μM concentration), GoTaq mastermix (12.5 μl) (M5133, Promega, USA), 25 mM MgCl2 (2.5 μl), nuclease free water (5 μl) and DNA template (5 μl). Temperature cycling was an initial denaturation at 95 °C for 15 min, followed by 30 cycles at 94 °C for 30 s, 58 °C for 1 min, and 72 °C for 2 min; terminating at 72 °C for 10 min. The PCR products were purified using QIAquick PCR Kit according to the manufacturers' instructions. Purified PCR products were sent to Eurofins (MWG Operon sequencing service www.eurofinsdna.com) for sequencing. The sequence data were compared to reference collections using the blastn-nucleotide collection tool available at http://blast.ncbi.nlm.nih.gov/Blast.cgi.

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

199

Table 1 Primer sequences used in the multiplex PCR assay and expected sizes of the products. Source: Wang et al. (2002). Primer

Size (in bp)

Sequence (5′–3′)

GenBank accession no.

Target isolate

Target gene

Gene location (bp)

CJF CJR CCF CCR CLF CLR CUF CUR CFF CFR

323

ACTTCTTTATTGCTTGCTGC GCCACAACAAGTAAAGAAGC GTAAAACCAAAGCTTATCGTG TCCAGCAATGTGTGCAATG TAGAGAGATAGCAAAAGAGA TACACATAATAATCCCACCC AATTGAAACTCTTGCTATCC TCATACATTTTACCCGAGCT GCAAATATAAATGTAAGCGGAGAG TGCAGCGGCCCCACCTAT

Z36940

C. jejuni

C. jejuni hipO

AF136494

C. coli

C. coli glyA

AF136495

C. lari

C. lari glyA

AF136496

C. upsaliensis

C. upsaliensis glyA

AF048699

C. fetus

C. fetus sapB2

1662–1681 1984–1965 337–357 462–444 318–337 568–549 63–82 266–247 2509–2532 2943–2926

126 251 204 435

2.6. Genotyping of Campylobacter species by Random Amplification of Polymorphic Deoxyribonucleic Acid (RAPD) DNA templates prepared as described above (Section 2.3) were also used for RAPD according to the method of Ertas et al. (2004). The PCR was carried out using Peltier Thermal Cycler and the total volume of reaction mixture was 25 μl consisting of 2.5 μl template DNA, 12.5 μl GoTaq mastermix (M5133, Promega, USA), 2.5 μl 25 mM MgCl2, 0.5 μl OPA-11(forward and reverse primer; FLA1 5′ATG GGA TTT CGT ATT AAC AC-3′, FLA2 5′-CTG TAG TAA TCT TAA AAC ATT TTG-3′) and 7 μl nuclease free water. Amplification was obtained after 50 cycles with the following parameters: denaturation at 94 °C for 1 min, annealing at 37 °C for 1 min and extension at 72 °C for 1 min; with a final extension time of 72 °C for 10 min. 15 μl aliquots of the PCR products were separated using agarose gel electrophoresis (1.5% agarose containing 1 μg/ml ethidium bromide). The gel was run for 2 h at 90 V and visualized on an ultra violet transilluminator (UVP BioDoc-It™ Imaging System, Cambridge, UK). Band positions were analyzed visually and compared to a molecular weight marker (Hyperladder I, Bioline, London, UK). Band positions were defined as presence of DNA band (a score ‘1’) and absence of DNA band (a score ‘0’). These scores were entered in NTedit to obtain a data matrix and then inserted in NTSYSpc Version 2.2 computer software for the construction of dendogram based on simple matching coefficient and UPGMA (Unweighted Pair-Group Arithmetic Average Clutering) cluster analysis to determine the relatedness of the Campylobacter isolates.

2011; Adzitey et al., in press). The multiple antibiotic resistance (MAR) index of each strain was calculated and interpreted according to the method described by Krumperman (1983) using the formula: a/b, where ‘a’ represents the number of antibiotics to which a particular isolates was resistant and ‘b’ the total number of antibiotics tested. 2.8. Statistical analysis Chi-Square test for goodness of fit was used to determine the differences between the isolation methods (Adzitey et al., in press; Suresh et al., 2011). Chi-Square (χ2) was defined as: χ 2 = (o − e)2 / e where o is the observed result, e is the expected result and the data obtained were interpreted using Chi-Square distribution table at 5% significant level (Fisher and Yates, 1963). 3. Results and discussion 3.1. Distribution of Campylobacter species in ducks, duck rearing and processing environments The numbers of various types of duck and duck-related samples positive for Campylobacter spp. are shown in Table 2. Campylobacter spp. were not isolated from duck feces, carcass rinses, table, transport crates,

Table 2 Distribution of Campylobacter species in ducks, duck rearing and processing environments. No. tested

a No. (%) positive

b No. (% ) C. jejuni

c No. (%) C. coli

d No. (%) C. lari

Taken on farm: Cloacal swab Feces Soil Drinking water Feed Pond water Egg shell swab

75 105 60 30 30 16 10

5 (7) 0 0 0 0 0 0

4 (80) 0 0 0 0 0 0

1 (20) 0 0 0 0 0 0

0 0 0 0 0 0 0

Taken in wet market: Floor swab Intestinal content Wash water Carcass rinse Table swab Transport crate swab e Cecal contents e Intestinal contents Total

15 102 38 30 15 15 52 50 643

3 (20) 14 (14) 2 (5) 0 0 0 44 (85) 31 (62) 99

1 (33) 10 (71) 1 (50) 0 0 0 38 (86) 21 (68) 75

2 (67) 4 (29) 1 (50) 0 0 0 3 (7) 10 (32) 21

0 0 0 0 0 0 3 (7) 0 3

2.7. Antimicrobial susceptibility of Campylobacter species

Samples tested

The disk diffusion method of Bauer et al. (1966) was used to determine the antibiotic resistance of 116 Campylobacter isolates against the following antimicrobial agents; ampicillin (Amp) 10 μg; chloramphenicol (C) 30 μg; nalidixic acid (Na) 30 μg; streptomycin (S) 10 μg; tetracycline (Te) 30 μg; ceftriaxone (Cro) 30 μg; cephalothin (Kf) 30 μg; erythromycin (E) 15 μg; suphamethoxazole/trimethoprim (Sxt) 22 μg; gentamicin (Cn) 10 μg; ciprofloxacin (Cip) 5 μg; cefotaxime (Ctx) 30 μg; and norfloxacin (Nor) 10 μg. The disks were purchased from Oxoid, UK. Well separated colonies (3–4) cultured on blood agar (at 41.5 °C, for 48 h) were picked with a swab and were suspended in 5 ml 0.1% BPW (CM0009, Oxoid). The turbity of the suspension was adjusted to 5 McFarland using sterile 0.1% BPW. One hundred microliters of the suspension was spread plated onto Mueller Hinton agar (CM0337, Oxoid) supplemented with 5% DHB using a cotton swab. Three or four antimicrobial disks were placed on the surface of the agar plate far enough apart to avoid overlapping of inhibition zones. The plates were incubated at 41.5 °C for 48 h in a microaerobic atmosphere and the results were interpreted as sensitive, intermediate, or resistant according to Clinical and Laboratory Standards Institute guidelines (CLSI, 2006). Escherichia coli was used as control in the antimicrobial susceptibility test (Rahimi and Ameri,

a

No.: number of samples positive for Campylobacter spp. No.: number of samples positive for C. jejuni. No.: number of samples positive for C. coli. d No.: number of samples positive for C. lari. e Were isolated by direct plating. All other samples were isolated by enrichment followed by plating. b c

200

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

Fig. 1. Multiplex PCR products for identification of Campylobacter isolates. Lane 1: hyper ladder Bioline II; lane 2: Salmonella Typhimurium, negative control; lane 3: Empty, negative control; lane 4: C. jejuni NCTC, positive control, 323-bp fragment; lane 5: C. coli RM2228, positive control, 126-bp fragment; lanes 6 to 19 C. jejuni isolates from ducks and duckrelated samples, 323-bp fragment; lanes 20 to 25 C. coli isolates from ducks and duck-related samples, 126-bp fragment.

soil, feed, drinking water, pond water or egg shells obtained from commercial duck farms and wet markets. Campylobacter spp. were isolated from cloacal swabs (5/75), large intestinal contents (14/102), wash water (2/38) and floor swabs (3/15) (Table 2). The prevalence of Campylobacter spp. in the duck samples was much lower than that in chicken as reported by other researchers. For example, Jørgensen et al. (2002) and Kramer et al. (2000) have reported the prevalence of Campylobacter in chicken to be 83% and 83.3%, respectively. We postulate that the low recovery of Campylobacter spp. might be due to the method of isolation. In a subsequent study, we examined 52 and 50 cecal and large intestinal contents swabs, respectively, which were directly plated on mCCDA plates (Table 2). In this study we observed that 85% and 62% of the cecal and large intestinal contents, respectively, were positive for Campylobacter spp. The large number of cecal and intestinal samples positive for Campylobacter spp. by direct plating indicates that ducks are probably the primary reservoirs of Campylobacter spp. The absence or low recovery of Campylobacter spp. from most of the samples examined by enrichment and subsequent plating could be due to the fact that Campylobacter spp. survive poorly in soil, feed, water and surfaces exposed to high oxygen tension, sunlight and dry environments or due to the method of isolation (enrichment and plating). Jasson et al. (2009) reported that the use of sodium cefoperazone in both Bolton broth (BB) and mCCDA plates favors the overgrowth of C. jejuni by high numbers of extended-spectrum-beta-

lactamase (ESBL) producing E. coli. In our study mCCDA plates from BB were always overgrown by non-Campylobacter spp. some of which were confirmed to be E. coli. Additionally, the hot Malaysian climate which can lead to high temperatures, longer exposure to sunlight, and high humidity may contribute to lower survival and contamination rate especially in the environment. EFSA (2005) confirmed that persistence of Campylobacter in the environment and water depends on temperature and light. A total of 138 Campylobacter isolates made up of 113 C. jejuni, 22 C. coli and 3 C. lari isolates were obtained during sampling (data not shown). From this, all isolates (20 isolates) stored in 5% glycerol plus Brain Heart Infusion Broth at − 20 °C were not recovered. Two isolates from 118 isolates stored in CryoCare™ at −70 °C, were not recovered. Thus 22 Campylobacter isolates (19 C. jejuni and 3 C. coli) were lost during storage and 116 isolates were available for antibiotic resistance test. From Table 2, three floor swabs were positive for Campylobacter spp. (2 C. coli and 1 C. jejuni) and could suggest that C. coli survive better on floors than C. jejuni. It is not common to isolate C. lari from ducks, as C. lari is rare in domestic poultry and more common in sea birds (Tresierra-Ayala et al., 1994; Hatch, 1996; Waldenstrom et al., 2002; Leotta et al., 2006). Ducks may have acquired C. lari from wild birds found around the farming areas sampled and/or ducks in our study area are potential primary source of C. lari. Though C. lari infection in humans is rare, its ability to cause

Table 3 Resistance of Campylobacter isolates from ducks and duck related samples against various antibiotics. C. jejuni (n = 94)

C. coli (n = 19)

Antimicrobial

α

No. Ib

No. Sc

α

Ampicillin (Amp) 10 μg Cefotaxime (Ctx) 30 μg Ceftriaxone (Cro) 30 μg Cephalothin (Kf) 30 μg Chloramphenicol (C) 30 μg Ciprofloxacin (Cip) 5 μg Erythromycin (E) 15 μg Gentamicin (Cn) 10 μg Nalidixic acid (Na) 30 μg Norfloxacin (Nor) 10 μg Streptomycin (S) 10 μg Suphamethoxazole/trimethoprim (Sxt) 22 μg Tetracycline (Te) 30 μg

76 (81) 19 (20) 48 (51) 93 (99) 7 (7) 71 (76) 1 (1) 5 (5) 79 (84) 75 (80) 47 (50) 90 (96) 90 (96)

5 49 34 0 3 3 10 0 0 1 3 0 0

13 26 12 1 84 20 83 89 15 18 44 4 4

4 (21) 1 (5) 13 (68) 19 (100) 0 (0) 5 (26) 0 (0) 0 (0) 19 (100) 19 (100) 1 (5) 5 (26) 19 (100)

No. (%) Ra

No. (%) Ra

C. lari (n = 3) No. Ib

No. Sc

α

No. Ib

No. Sc

6 6 6 0 0 4 0 0 0 0 0 0 0

9 12 0 0 19 10 19 19 0 0 18 14 0

3 (100) 3 (100) 3 (100) 3 (100) 2 (67) 3 (100) 3 (100) 1 (33) 3 (100) 3 (100) 3 (100) 3 (100) 3 (100)

0 0 0 0 0 0 0 0 0 0 0 0 0

0 0 0 0 1 0 0 2 0 0 0 0 0

No. (%) Ra

Ra: resistant; Ib: intermediate resistance; Sc: susceptible; αNo: number of resistant strains; No. I: number of intermediate strains; No. S: number of susceptible strains.

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

gastroenteritis should not be ignored. In England and Wales, it was responsible for 0.11% reported cases of Campylobacter enteritis between 2000 and 2002 (CDSC, 2003). 3.2. Identification of presumptive Campylobacter isolates using mPCR Presumptive Campylobacter isolates were confirmed and speciated using a modified mPCR assay. Three Campylobacter spp. (C. jejuni, C. coli and C. lari) were identified. Amplification and separation of DNA from Campylobacter isolates yielded bands of 323 bp and 126 bp for C. jejuni and C. coli, respectively (Fig. 1). Although the mPCR method used was also designed to identify C. lari, it was unable

Table 4 Antibiotic resistance profile and multiple antibiotic resistance index of Campylobacter species from ducks and duck related samples. Campylobacter species

Antibiotic resistant profilea

No. of isolates

MAR index

C. jejuni

AmpCtxCroKfCCfNaNorSSxtTe CtxKfCCipECnNaNorSSxtTe AmpCtxCroKfCfNaNorSSxtTe AmpCroKfCCfNaNorSSxtTe AmpCroKfCCipNaNorSSxtTe AmpCtxCroKfCipNaNorSSxtTe AmpCroKfCfNaNorSSxtTe AmpCroKfCipNaNorSSxtTe AmpCroKfCfCnNaNorSxtTe AmpCtxCroKfCfNaNorSxtTe AmpCroKfCCfNaNorSxtTe AmpCtxCroKfNaNorSSxtTe AmpCroKfCipNaNorSxtTe AmpKfCfNaNorSSxtTe AmpCroKfCfNaNorSxtTe AmpKfCfCnNaNorSxtTe AmpCtxKfCfNaNorSxtTe AmpCroKfCfNaSSxtTe AmpCtxCroKfCfNaNorSxt AmpKfCipNaNorSSxtTe CroKfCfNaNorSSxtTe AmpKfCfNaNorSxtTe AmpKfCipNaNorSxtTe AmpCroKfNaNorSxtTe AmpCroKfCfNorSxtTe AmpCroKfNaSSxtTe KfCCipNaNorSxtTe CroKfCfNaNorSxtTe AmpKfNaSSxtTe KfNaNorSSxtTe AmpCroKfSxtTe AmpKfSSxtTe AmpCroCipNaNor CroKfNaNorTe KfCfSSxtTe KfCnNaSxtTe KfSSxtTe AmpKfCNa Kf AmpCtxCroKfCipNaNorSSxt CroKfCipNaNorSxtTe AmpCroKfNaNorSxtTe AmpKfCipENaNorTe CroKfCipNaNorTe CroKfNaNorSxtTe CroKfNaNorTe AmpKfNaNorTe KfNaNorSxtTe KfNaNorTe AmpCtxCroKfCCipECnNaNorSSxtTe AmpCtxCroKfCCipENaNorSSxtTe AmpCtxCroKfCipENaNorSSxtTe

1 1 1 1 1 1 12 7 2 1 1 1 5 3 2 1 1 1 1 1 1 12 9 3 1 1 1 1 1 1 1 2 1 1 1 1 9 1 1 1 2 1 1 1 1 7 1 1 3 1 1 1

0.85 0.85 0.77 0.77 0.77 0.77 0.69 0.69 0.69 0.69 0.69 0.69 0.62 0.62 0.62 0.62 0.62 0.62 0.62 0.62 0.62 0.54 0.54 0.54 0.54 0.54 0.54 0.54 0.46 0.46 0.38 0.38 0.38 0.38 0.38 0.38 0.31 0.31 0.08 0.69 0.54 0.54 0.54 0.46 0.46 0.38 0.38 0.38 0.31 1.00 0.92 0.85

C. coli

C. lari

a Ampicillin (Amp) 10 μg; chloramphenicol (C) 30 μg; nalidixic acid (Na) 30 μg; streptomycin (S) 10 μg; tetracycline (Te) 30 μg; ceftriaxone (Cro) 30 μg; cephalothin (Kf) 30 μg; erythromycin (E) 15 μg; suphamethoxazole/trimethoprim (Sxt) 22 μg; gentamicin (Cn) 10 μg; ciprofloxacin (Cip) 5 μg; cefotaxime (Ctx) 30 μg; norfloxacin (Nor) 10 μg.

201

to identify this species, which was identified after sequencing. Though the mPCR assay has been used widely on samples from the UK and North America, to our knowledge it is the first time that it has been used on samples from Malaysia. It is possible that the sequence of the primer binding site for one or both of the primers in our C. lari isolates was different to that in the C. lari samples that the PCR has been validated with. This suggests that further modification of this PCR may be necessary for its use in new geographical locations. Other factors such as purity or DNA purification method, primer design, annealing temperature and restriction enzymes used affect the performance of PCR methods (Wassenaar and Newell, 2000). The finding that some PCR assays do not speciate all Campylobacter isolates is consistent with a study by Sallam (2006), who reported that 339 out of 341 Campylobacter strains were speciated by PCR. Five samples (all from cecal swabs) were found to contain two species (C. jejuni and C. coli) suggesting either a mixed infection or cross contamination from contact with fecal matter from other ducks. 3.3. Comparison of results of speciation using phenotypic or genotypic methods Campylobacter jejuni isolates are hippurate positive, mostly susceptible to Na but resistant to Cip; C. coli isolates are hippurate negative, susceptible to Na but resistant to Cip; and C. lari isolates are hippurate negative, but resistant to Na and Cip (Hunt et al., 1998). Only 20 isolates were tested using phenotypic tests, all were identified as C. jejuni, and these results were confirmed by mPCR. However, it is known that C. jejuni strains can be mistakenly identified as C. coli if they do not express their hippurase gene (Miller et al., 2010; Adzitey and Corry, 2011). In addition, the increasing antibiotic resistance of Campylobacter spp. makes their speciation based on susceptibility to nalidixic acid and cephalothin impractical. All the C. coli isolates tested in this study were resistant to nalidixic acid (see below). This makes distinguishing C. coli from C. lari unreliable. 3.4. Antimicrobial susceptibility The antimicrobial susceptibility of 94 C. jejuni, 19 C. coli and 3 C. lari strains were determined against 13 antimicrobial agents, and the results are presented in Table 3. The three C. lari strains were resistant to all the antibiotics tested except that one was susceptible to

C1 C2 C19 C14 C15 C17 C18 C10 C11 C12 C13 C5 C6 C7 C8 C16 C3 C4 C9 0.69

0.77

0.84

0.92

1.00

Coefficient Fig. 2. Cluster analysis of RAPD profiles of C. coli isolates from ducks and duck related samples obtained using OPA-11 primer.

202

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

chloramphenicol and two to gentamicin. All the C. coli strains were susceptible to chloramphenicol, erythromycin and gentamicin but resistant to cephalothin, nalidixic acid norfloxacin and tetracycline. Almost all the C. jejuni strains were resistant to cephalothin (99%),

suphamethoxazole/trimethoprim (96%), tetracycline (96%), nalidixic acid (84%), ampicillin (81%) and norfloxacin (80%), but susceptible to gentamicin (95%), chloramphenicol (89%) and erythromycin (88%). Overall, 9% of C. jejuni (108/1222) and C. coli (22/247) strains J1 J9 J4.1 J42 J46.1 J2 J58 J8 J35 J36 J47.2 J32 J31 J20.1 J13 J27.1 J44 J55 J53.1 J53.3 J5.1 J7.1 J43 J43.1 J43.2 J50.2 J26.1 J17.1 J38 J50 J53 J4 J20 J39 J33 J34 J41 J47.1 J54 J60 J9.2 J56 J50.1 J12 J45.1 J7 J45 J46 J47 J10 J26 J23 J23.1 J27 J21 J59 J52 J40 J22 J24 J24.1 J15.1 J2.1 J9.1 J51 J57 J15.2 J16.1 J6.1 J5 J14 J15 J16 J16.2 J17 J17.2 J28 J49 J29 J61 J6 J48 J18 J8.2 J18.1 J37 J25 J30 J11 J7.2 J19 J39.1 J19.1 J3

0.82

0.86

0.91 Coefficient

0.95

1.00

Fig. 3. Cluster analysis of RAPD profiles of C. jejuni isolates from ducks and duck related samples obtained using OPA-11 primer.

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

exhibited intermediate resistance, while it was naught for the C. lari strains. Furthermore, 92%, 57% and 43% of C. lari, C. jejuni and C. coli strains, respectively were resistance to the antibiotics tested. Antibiotics used for treating humans infected with campylobacteriosis are mainly macrolides (erythromycin, clarithromycin, or azithromycin) and fluoroquinolones (ciprofloxacin, levofloxacin, gatifloxacin, or moxifloxacin) (Clark, 2011). Our studies indicated that C. coli and most C. jejuni isolates were susceptible to erythromycin which could be used for treating patients in Malaysia infected with these pathogens instead of ciprofloxacin. Gentamicin and chloramphenicol could be used for strains resistant to erythromycin.

Table 5 RAPD results of C. jejuni isolates obtained from large intestines and ceca samples. RAPD type

Code

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58

J1, J4.1v J42⁎, J2r, J8s, J36 J47.2b J32 J31 J20.1c J13, J44, J53.1d, J5.1e, J43f, J50.2g J26.1o, J38 J50g, J4⁎,v, J39j J33, J41⁎, J54 J60, J50.1g J12, J7m J45x J46a, J10 J26o J23p, J27k J21, J52 J40 J22 J24⁎,q, J15.1h J2.1r, J51, J15.2h J16.1i, J5e J14, J17n, J28, J29 J61 J6u, J18l, J37 J25, J11⁎, J19t J39.1j, J3

Source (s) J9w J46.1a J58 J35⁎

J27.1k J55 J53.3d J7.1m J43.1f,

J43.2f

J17.1n J53d J20c J34 J47.1b J9.2w,

J56

J45.1x

J47b

J23.1p J59

J24.1q J9.1⁎,w J57 J6.1u J15h, J17.2n J49

J48 J8.2s, J30 J7.2m J19.1t

J16i,

J18.1l

J16.2i

Ceca Large intestines Large intestines, ceca Ceca Ceca, large intestines Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Large intestines, ceca Ceca Large intestines Large intestines, ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Large intestines Ceca Large intestines Large intestines Large intestines Large intestines Large intestines, ceca Ceca Ceca, large intestines Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Ceca Large intestines Large intestines Large intestines Large intestines, ceca Ceca Ceca Large intestines

All isolates with the same superscript denote isolates from the same sample (plate). ⁎ Isolated from large intestine.

203

Our results are comparable to other studies. In the USA, Gupta et al. (2004) reported that 16, 2 and 0.3% isolates of C. jejuni isolated from Campylobacteriosis patients were resistant to ciprofloxacin, erythromycin and chloramphenicol, respectively. They also reported that 30, 8 and 5% of C. coli strains were resistant to ciprofloxacin, erythromycin and chloramphenicol, respectively. We found that the number of C. jejuni isolates resistant to ciprofloxacin (76%) was much higher compared to those reported by Gupta et al. (2004). In our study, 26% of C. coli isolates were resistant to ciprofloxacin, whereas Gupta et al. (2004), reported that 30% of the isolates were resistant to ciprofloxacin. In the UK, Little et al. (2008) reported that C. jejuni strains isolated from ducks were susceptible to ciprofloxacin, erythromycin, chloramphenicol and gentamicin. They also observed that 55 and 36% of C. coli were resistant to ciprofloxacin and erythromycin, respectively. The incidence of antibiotic resistance to erythromycin among C. jejuni isolates isolated from different sources as reported by Gupta et al. (2004) and Little et al. (2008) is similar to our findings. Resistance of Campylobacter spp. to antibiotics in a particular study may vary according to the type of sample examined (Gupta et al., 2004; Little et al., 2008; Zhao et al., 2010). This hampers effective comparison of antibiotic resistance among different samples and countries. The antimicrobial resistance profile and MAR index of the Campylobacter isolates are shown in Table 4. The 94 C. jejuni strains exhibited 39 different antibiogram patterns. The majority of the C. jejuni strains (28 isolates) were resistant to seven antibiotics (MAR index of 0.54) with the resistant pattern AmpKfCfNaNorSxtTe (12 isolates) dominating the group. Twenty-four isolates were resistant to nine antibiotics (MAR index of 0.69) with 12 showing the pattern AmpCroKfCfNaNorSSxtTe. The 19 C. coli strains showed 10 different resistance patterns. The majority (9 C. coli isolates) were resistant to five antibiotics (MAR index of 0.38) and seven of the isolates shared the same antibiogram, CroKfNaNorTe. Each of the three C. lari isolates exhibited a different antibiogram pattern, showing very high resistance to 13, 12 and 11 antibiotics. The resistant pattern AmpCroKfNaNorSxtTe was shared by three C. jejuni and one C. coli strains while CroKfNaNorTe was common to one C. jejuni and seven C. coli strains. The occurrence of relatively high multidrug resistance to most of the antibiotics examined is a concern, because it makes severe infections more difficult to treat with antibiotics, and reflects the extent to which these antimicrobial agents are used in Malaysia. It is not clear whether this is due to their use in the duck industry or for the treatment of humans, other animals or for other farming purposes such as improved feed conversion. 3.5. Genotyping of Campylobacter species by RAPD The results of the RAPD typing of Campylobacter isolates are shown in Figs. 2 and 3, and Tables 5 and 6. The 94 C. jejuni strains produced 58 RAPD types, while the 19 C. coli strains produced 12 RAPD types. RAPD analysis also revealed high heterogeneity among the C. lari isolates. Cluster analysis indicated the presence of similar and Table 6 RAPD results of C. coli isolates obtained from large intestines and ceca samples. RAPD type

Code

1 2 3 4 5 6 7 8 9 10 11 12

C1 C19 C14 C15 C17 C10 C11 C5 C7 C8 C3 C9

Source (s) C2

C18 C12 C6 C16 C4

C13

Large Large Large Ceca Ceca Large Large Large Large Ceca Large Large

intestines intestines intestines

intestines Intestines Intestines intestines intestines intestines

204

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205

different clones among Campylobacter spp. isolated from the large intestines and ceca contents of ducks. C. coli strains belonging to RAPD type 7 (C11, C12 and C13); C. jejuni strains belonging to RAPD type 25 (J9.2, J56 and J60), and RAPD type 46 (J14, J15, and J16) (Tables 5 and 6; Figs. 2 and 3) isolated from the same source (but different ceca and/or intestine) were genetically similar. C. jejuni strains belonging RAPD type 2 (J4.1) and RAPD type 20 (J4); RAPD type 3 (J46.1) and RAPD type 30 (J46); and RAPD type 7 (J47.2) and RAPD type 23 (J47.1) (Tables 5 and 6; Figs. 2 and 3) were isolated from the same source (and also the same ceca and/or intestine) but were genetically diverse. We were informed by duck processers at the wet-markets that the ducks were obtained from different farms. Nonetheless our RAPD results proved that samples originated from flocks of the same and different origin. Wassenaar and Newell (2000) in their review reported that, Campylobacter strains that belong to the same serotype are not always similar genetically and that most C. jejuni–C. coli serotypes comprise heterogeneous genotypes. Strains belonging to different serotypes can be genetically related (Wassenaar and Newell, 2000). RAPD has been shown to be one of the most discriminating methods for typing Campylobacter isolates (Madden et al., 1998; Nielsen et al., 2000). Nielsen et al. (2000) compared six typing methods for their ability to discriminate among Campylobacter spp. and found PFGE and RAPD to be the best followed by RiboPrinting and fla-RFLP, with serotyping and fla-DGGE typing being the least discriminatory. These authors also reported that PFGE and RAPD produced 50 and 56 distinct profiles, respectively, among the 80 Campylobacter strains examined. Madden et al. (1998) using RAPD and PCR-RFLP for typing Campylobacter obtained 18 and 9 distinct types, respectively. In conclusion, the occurrence of Campylobacter spp. in the duck and duck related samples ranged from 0% to 85% and was largely influence by the isolation method. C. jejuni accounted for 82% of the total isolates and the rest were C. coli (16%) and C. lari (2%). The isolation of Campylobacter spp. from cecal, intestinal and cloacal samples confirmed that ducks in our study area are potential reservoir for this foodborne pathogen. More than one species of Campylobacter can be found in the same sample if one to three colonies per plate were examined. Campylobacter spp. from ducks were resistant to most of the antibiotics tested. RAPD analysis of C. jejuni and C. coli produced 58 and 12 distinct band patterns, respectively. The RAPD provided a rapid and relatively reliable method for typing Campylobacter isolates with good discriminatory power. This work provides a baseline study on the occurrence, antibiotic resistance and RAPD types of Campylobacters in ducks and duck related samples in Penang, Malaysia. Acknowledgments The first author is grateful to IPS-USM, Dr. Janet Corry, Dr. Tristan Cogan, Dr. Louisa Rees and Dr. Lisa Williams for their financial support, advice and contributions toward running this project. This project was supported by grants from the Postgraduate Research Grant Scheme (1001/PTEK1ND/843007) of the Universiti Sains Malaysia. References Adzitey, F., Corry, J.E.L., 2011. A comparison between hippurate hydrolysis and multiplex PCR for differentiating C. coli and C. jejuni. Tropical Life Sciences Research 22, 57–64. Adzitey, F., Nurul, H., 2011. Campylobacter in poultry: incidences and possible control measures. Research Journal of Microbiology 6, 182–192. Adzitey, F., Rusul, G., Huda, N., in press. Prevalence and antibiotic resistance of Salmonella serovars in ducks, duck rearing and processing environments in Penang, Malaysia. Food Research International. doi: 10.1016/j.foodres.2011.02.051. Ang, C.W., De Klerk, M.A., Endtz, H.P., Jacobs, B.C., Laman, J.D., Van der Meche, F.G., Van Doorn, P.A., 2001. Guillain–barre syndrome and Miller Fisher syndrome-associated Campylobacter jejuni lipopolysaccharides induce anti-GM1 and anti-GQ1b antibodies in rabbits. Infection and Immunity 69, 2462–2469.

Anonymous, 2011. Asia dominates world waterfowl production. Available at: http://www. thepoultrysite.com/articles/1633/asia-dominates-world-waterfowl-production [accessed 18 February 2010]. Arun, K.B., 2008. Foodborne Microbial Pathogens: Mechanisms and Pathogenesis Campylobacter and Arcobacter. Springer Publisher, New York, pp. 217–226. Bauer, A.W., Kirby, W.M.M., Sherris, J.C., Turk, M., 1966. Antibiotic susceptibility testing by a standardized single disc method. American Journal of Clinical Pathology 45, 493–496. Bereswill, S., Kist, M., 2003. Recent developments in Campylobacter pathogenesis. Current Opinion in Infectious Diseases 16, 487–491. Boonmar, S., Yingsakmongkon, S., Songserm, T., Hanhaboon, P., Passadurak, W., 2007. Detection of Campylobacter in duck using standard culture method and multiplex polymerase chain reaction. The Southeast Asian Journal of Tropical Medicine and Public Health 38, 728–731. Chai, L.C., Ghazali, F.M., Bakar, F.A., Lee, H.Y., Suhaimi, L.R.A., Talib, S.A., Nakaguchi, Y., Nishibuchi, M., Radu, S., 2009. Occurrence of thermophilic Campylobacter spp. contamination on vegetable farms in Malaysia. Journal of Microbiology and Biotechnology 19, 1415–1420. Clark, M., 2011. Treatment for Campylobacter infection. Available at http://www.aboutcampylobacter.com/campylobacter_treatment [accessed 23 August 2010]. Clinical and Laboratory Standards Institute (CLSI), 2006. Methods for Antimicrobial Dilution and Disk Susceptibility Testing of Infrequently Isolated or Fastidious Bacteria; Approved Guideline (M45-A). Clinical and Laboratory Standards Institute, Wayne, PA. Communicable Disease Surveillance Centre (CDSC), 2003. Sentinel surveillance of Campylobacter in England and Wales. Communicable Disease Report Weekly 13, 7–9. Ekkapobyotin, C., Padungtod, P., Chuanchuen, R., 2008. Antimicrobial resistance of Campylobacter coli isolates from swine. International Journal of Food Microbiology 128, 325–328. Ertas, H.B., Çetinkaya, B., Muz, A., Öngor, H., 2004. Genotyping of broiler-originated Campylobacter jejuni and Campylobacter coli isolates using fla typing and random amplified polymorphic DNA method. International Journal of Food Microbiology 94, 203–209. European Food Safety Authority (EFSA), 2005. Scientific report of the Scientific Panel on Biological Hazards on the request from the Commission related to Campylobacter in animals and foodstuffs. Annex to the EFSA Journal 173, 1–105. Fisher, R.A., Yates, F., 1963. Statistical Tables for Biological Agricultural and Medical Research, 6th ed. Oliver and Boyd, Edinburgh, p. 47. Table IV, Available at: http://digital.library.adelaide.edu.au/dspace/bitstream/2440/10701/1/stat_tab. pdf. [accessed 7 July 2010]. Food and Agriculture Organisation (FAO), 2009. FAOSTAT on main producer country of duck meat in 2007. Available at: http://faostat.fao.org/site/569/DesktopDefault. aspx?PageID=569#ancor [accessed 9 July 2011]. Gupta, A., Nelson, J.M., Barrett, T.J., Tauxe, R.V., Rossiter, S.P., Friedman, C.R., Joyce, K.W., Smith, K.E., Jones, T.F., Hawkin, M.A., Shiferaw, B., Beebe, J.L., Vugia, D.J., RabatskyEhr, T., Benson, J.A., Root, T.P., Angulo, F.J., 2004. Antimicrobial resistance among Campylobacter strains in the United States, 1997–2001. Emerging Infectious Diseases 10, 1102–1109. Han, K., Jang, S.S., Choo, E., Heu, S., Ryu, S., 2007. Prevalence, genetic diversity, and antibiotic resistance patterns of Campylobacter jejuni from retail raw chickens in Korea. International Journal of Food Microbiology 114, 50–59. Hatch, J.J., 1996. Threats to public health from gulls (Laridae). International Journal of Environmental Health Research 6, 5–16. Humphrey, T., O'Brien, S., Madsen, M., 2007. Campylobacters as zoonotic pathogens: a food production perspective. International Journal of Food Microbiology 117, 237–257. Hunt, J.M., Abeyta, C., Tran, T., 1998. Bacteriological Analytical Manual, 8th Edn. AOAC International, Gaithersburg. Inglis, G.D., Cohen, A.C., 2004. Influence of antimicrobial agents on the spoilage of a meat-based entomophage diet. Journal of Economic Entomology 97, 235–250. Jasson, V., Sampers, I., Botteldoorn, N., Lopez-Galvez, F., Baert, L., Denayer, S., Rajkovic, A., Habib, I., De Zutter, L., Debevere, J., Uyttendaele, M., 2009. Characterization of Escherichia coli from raw poultry in Belgium and impact on the detection of Campylobacter jejuni using Bolton broth. International Journal of Food Microbiology 135, 248–253. Jimenez, A., Velazquez, J.B., Rodrıguez, J., Tinajas, A., Villa, T.G., 1994. Prevalence of fluoroquinolone resistance in clinical strains of Campylobacter jejuni isolated in Spain. Journal of Antimicrobial Chemotherapy 33, 188–190. Jørgensen, F., Bailey, R., Williams, P.S., Henderson, P., Wareing, D.R., Bolton, F.J., Frost, J.A., Ward, L., Humphrey, T.J., 2002. Prevalence and numbers of Salmonella and Campylobacter spp. on raw, whole chickens in relation to sampling methods. International Journal of Food Microbiology 76, 151–164. Kramer, J.M., Frost, J.A., Bolton, F.J., Wareing, D.R., 2000. Campylobacter contamination of raw meat and poultry at retail sale: identification of multiple types and comparison with isolates from human infection. Journal of Food Protection 63, 1654–1659. Krumperman, P.H., 1983. Multiple antibiotic resistance indexing of Escherichia coli to identify high-risk sources of fecal contamination of food. Applied and Environmental Microbiology 46, 165–170. Leotta, G.A., Vigo, G.B., Giacoboni, G., 2006. Isolation of Campylobacter lari from seabirds in Hope Bay, Antarctica. Polish Polar Research 27, 303–308. Little, C.L., Richardson, J.F., Owen, R.J., de Pinna, E., Threlfall, E.J., 2008. Prevalence, characterisation and antimicrobial resistance of Campylobacter and Salmonella in raw poultry meat in the UK, 2003–2005. International Journal of Environmental Health Research 18, 403–414. Madden, R.H., Moran, L., Scates, P., 1998. Frequency of occurrence of Campylobacter spp. in red meats and poultry in Northern Ireland and their subsequent subtyping using polymerase chain reaction-restriction fragment length polymorphism and

F. Adzitey et al. / International Journal of Food Microbiology 154 (2012) 197–205 the random amplified polymorphic DNA method. Journal of Applied Microbiology 84, 703–708. McCrea, B.A., Tonooka, K.H., Van Worth, C., Boggs, C.L., Atwill, E.R., Schrader, J.S., 2006. Prevalence of Campylobacter and Salmonella species on farm, after transport, and at processing in specialty market poultry. Poultry Science 85, 136–143. Mead, P.S., Slutsker, L., Dietz, V., McCaig, L.F., Bresee, J.S., Shapiro, C., Griffin, P.M., Tauxe, R.V., 1999. Food-related illness and death in the United States. Emerging Infectious Diseases 5, 607–625. Miller, R.S., Miller, W.G., Behringer, M., Hariharan, H., Matthew, V., Oyarzabal, O.A., 2010. DNA identification and characterization of Campylobacter jejuni and Campylobacter coli isolated from caecal samples of chickens in Grenada. Journal of Applied Microbiology 108, 1041–1049. Moore, J.E., Corcoran, D., Dooley, J.S.G., Fanning, S., Lucey, B., Matsuda, M., McDowell, D.A., Mégraud, F., Millar, B.C., O'Mahony, R., O'Riordan, L., O'Rourke, M., Rao, J.R., Rooney, P.J., Sails, A., Whyte, P., 2005. Review article, Campylobacter. Veterinary Research 36, 351–382. Nielsen, E.M., Engberg, J., Fussing, V., Petersen, L., Brogren, C.H., On, S.L.W., 2000. Evaluation of phenotypic and genotypic methods for subtyping Campylobacter jejuni isolates from humans, poultry, and cattle. Journal of Clinical Microbiology 38, 3800–3810. Nonga, H.E., Muhairwa, A.P., 2010. Prevalence and antibiotic susceptibility of thermophilic Campylobacter isolates from free range domestic duck (Cairina moschata) in Morogoro Municipality, Tanzania. Tropical Animal Health and Production 42, 165–172. Qin, S.S., Wu, C.M., Wang, Y., Jeon, B., Shen, Z.Q., Wanga, Y., Zhang, Q., Shen, J.Z., 2011. Antimicrobial resistance in Campylobacter coli isolated from pigs in two provinces of China. International Journal of Food Microbiology 146, 94–98. Rahimi, E., Ameri, M., 2011. Antimicrobial resistance patterns of Campylobacter spp. isolated from raw chicken, turkey, quail, partridge, and ostrich meat in Iran. Food Control 22, 1165–1170.

205

Ridsdale, J.A., Atabay, H.I., Corry, J.E.L., 1998. Prevalence of Campylobacters and Arcobacters in ducks at the abattoir. Journal of Applied Microbiology 85, 567–573. Saleha, A.A., 2002. Isolation and characterization of Campylobacter jejuni from broiler chickens in Malaysia. International Journal of Poultry Science 1, 94–97. Sallam, K.I., 2006. Prevalence of Campylobacter in chicken and chicken by-products retailed in Sapporo areas, Hokkaido, Japan. Food Control 18, 1113–1120. Suresh, T., Hatha, A.A.M., Harsha, H.T., Lakshmanaperumalsamy, P., 2011. Prevalence and distribution of Salmonellaserotypes in marketed broiler chickens and processing environment in Coimbatore city of southern India. Food Research International 44, 823–825. Suzuki, H., Yamamoto, S., 2009. Campylobacter contamination in retail poultry meats and by-products in Japan: a literature survey. Food Control 20, 531–537. Tresierra-Ayala, A., Bendayan, M.E., Bernuy, A., Pereyra, G., Fernandez, H., 1994. Chicken as potential contamination source of Campylobacter lari in Iquitos, Peru. Reviews of Institute Medicine Trop Sao Paulo 36, 497–499. Waldenstrom, J., Broman, T., Carlsson, I., Hasselquist, D., Achterberg, R.P., Wagenaar, J.A., Olsen, B., 2002. Prevalence of Campylobacter jejuni, Campylobacter lari, and Campylobacter coli in Different Ecological Guilds and Taxa of Migrating Birds. Applied and Environmental Microbiology 68, 5911–5917. Wang, G., Clark, C.G., Taylor, T.M., Pucknell, C., Barton, C., Price, L., Woodward, D.L., Rodgers, F.G., 2002. Colony multiplex PCR assay for identification and differentiation of Campylobacter jejuni, C. coli, C. lari, C. upsaliensis, and C. fetus subsp. fetus. Journal of Clinical Microbiology 40, 4744–4747. Wassenaar, T.M., Newell, D.G., 2000. Genotyping of Campylobacter spp. — a minireview. Applied and Environmental Microbiology 66, 1–9. Zhao, S., Young, S.R., Tong, E., Abbott, J.W., Womack, N., Friedman, S.L., McDermott, P.F., 2010. Antimicrobial resistance of Campylobacter isolates from retail meat in the United States between 2002 and 2007. Applied and Environmental Microbiology 76, 7949–7956.