Production of human calcitonin in Escherichia coli from multimeric fusion protein

JOURNALOF FERMENTATIONAND BIOENGINEERING Vol. 82, No. 2, 140-144. 1996

Production

of Human Calcitonin in Escherichia coli from Multimeric Fusion Protein HIROKAZU

Sankyo Co. Ltd., Pharmacology

ISHIKAWA*

AND

HIDETSUNE

TAMAOKI

and Molecular Biology Research Laboratories, Shinagawa-ku, Tokyo 140, Japan

2-58 Hiromachi I-chome,

Received 25 March 199UAccepted 17 May 1996

A vector system for obtaining high yields of human calcitonin (LCT) in Escherichia coli was designed. Multiple copies of a synthetic gene encoding hCT-Leu, which is a substrate for C-terminal amidation by carboxypeptidase Y (CPaseY), were linked and fused to the 1acZ gene. Each copy of the hCT-Leu gene was flanked by arginine codons to create sites for cleavage by clostoripain. The resultant multimeric hCT fusion protein upon treatment with clostoripain was converted to monomers of hCT precursor containing a carboxy-terminal arginine residue (hCT-Leu-Arg). The hCT-Leu-Arg was digested with carboxypeptidase B (CPaseB), amidated with CPaseY and thus converted to the mature hCT. In this way, we obtained the mature recombinant hCT. [Key words:

human calcitonin, multimeric fusion protein]

(leu, met, rel, F-, i-) was used for the expression of the multimeric fusion protein. The plasmid pUC18 was purchased from TOYOBO Inc. Synthesis and cloning of hCT-Leu gene A doublestranded DNA fragment incorporating linkers as depicted in Fig. 1 was assembled from six overlapping oligonucleotides which were synthesized on an Applied Biosynthesis model 380B DNA synthesizer and purified by electrophoresis on a preparative sequencing gel. The 5’ ends of all oligonucleotides except 1 and 6 in Fig. 1 were phosphorylated with T4 polynucleotide kinase. Annealing was carried out by mixing each oligonucleotide in 100 mM Tris-HCl and 10mM MgC12, at pH 7.5 and heating to lOO”C, then cooling slowly to room temperature. After ligation, the correct product was purified from a 6% polyacrylamide gel, and inserted between the BamHI and SafI sites of pUC18 to create pUCa1 1 (Fig. 2). The synthetic coding sequence for hCT-Leu was verified by dideoxy sequence analysis. Protein purification E. coli YA21, harboring pUCa1 6, was cultured for 8 h at 37°C in 2~ YT (16g Bacto-tryptone, log yeast extract, and 5 g NaCl per liter) containing ampicillin (50 ug/ml). A portion of the culture was diluted 1 : 200 with fresh medium. After 16 h incubation at 37”C, the cells were harvested by centrifugation, suspended in sonication buffer, TES buffer (20 mM Tris-HCi, pH 7.6, 200mM NaCl, 10mM EDTA), and subjected to sonic disruption. The sonicated material was then centrifuged and the pellet was washed with TES buffer containing 0.5% Triton X-100 and was solubilized with 20mM Tris-HCl, pH 7.6, containing 8 M urea. The multimeric fusion protein was quantitatively analyzed using the densitometric scanning method.

Calcitonin (CT) is a 32 amino acid polypeptide secreted by the C cells, which are located in the thyroid (1, 2) and ultimobranchial glands of mammals and lower vertebrates, respectively. It is a powerful and specific inhibitor of bone resorption (3-5) and has been proven to be very effective in the treatment of various diseases, such as Paget’s disease, osteoporosis imperfect, postmenopausal osteoporosis, and bone metastases (6). CT exhibits low species specificity, and this has made it possible to use animal CTs (salmon, eel, and porcine) for treatment of various diseases in human. The species variations of these CT structures, however accrue to a variation in activity and thus sometimes results in antibody formation (7, 8) and occurrence of the “escape phenomenon” (9, 10) upon repeated administration. Production of small peptides such as CT in bacteria tends to be difficult mainly because of rapid degradation of the peptides by proteolytic enzymes in the host bacteria (11, 12). To prevent this problem, the recombinant peptides have often been produced as fusion proteins. In fact, human CT (hCT) has been expressed in Escherichia coli as a fusion protein (13, 14). However, the major disadvantage of this approach for large-scale production is that the desired product constitutes only a small portion of the fusion protein. To overcome this problem, a new vector system, in which a desired peptide is expressed as a multimeric fusion protein, was designed (15). Using this system, the Val* variant of hCT was expressed in E. coli (16) and Saccharomyces cerevisiae (17). In this paper, we report on the synthesis and cloning of tandemly repeated coding sequences for natural hCT, the stable expression of these sequences in E. coli, enzymatic cleavage of the fusion protein and purification of mature hCT.

High-pressure MATERIALS

AND

liquid chromatography

(HPLC)

analysis

HPLC analysis and purification steps for all peptides were carried out using a Shimadzu gradient HPLC system. Detection was performed by measuring absorbance at 225 nm. Separation was carried out using a TSK gel ODS-120T column (4.6 x’250 mm, Tosoh, Tokyo). Samples, which were cleaved by clostoripain and digested with carboxypeptidase B, were analyzed using a binary gradient system consisting of solvent A (0.1% TFA) and

METHODS

Restriction enzymes were Enzymes and chemicals purchased from TOYOBO Inc., Osaka. Clostoripain and carboxypeptidase B were obtained from Sigma, USA. Bacterial strains and plasmids E. coli strain YA21 * Corresponding author. 140

PRODUCTIONOFHUMANCALCITONIN

VOL. 82, 1996

solvent B (acetonitrile containing 0.1% TFA). The elution was carried out with a linear gradient from 20 to 30% of solvent B over 5 min and then from 30 to 50% of the same solvent over 20min at a flow rate of 1 ml/min. Samples which were amidated with carboxypeptidase Y were separated using a TSK gel ODS-120T column (7.8 x 300 mm, Tosoh). Reverse-phase HPLC was performed with a gradient system consisting of solvent A (10 mM ammonium bicarbonate) and solvent B (acetonitrile). The elution was carried out with a binary gradient from 10 to 55% of solvent B over 56min at a flow rate of 2.5 ml/min. The purified multimeric Cleavage by clostoripain fusion protein was diluted 1 : 1 with 20mM Ca(NO& to a final urea concentration of 4 M and /3-mercaptoethanol was added to a final concentration of 1.5% vol/vol. The multimeric fusion protein was digested with clostoripain at 37°C at 0.25 U/mg protein for 120min. The purified S-sulfonated Amidation of hCT-Leu hCT-Leu was lyophilized and resuspended in 50% DMSO, and ammonium solution (pH 9.3) was added to a final concentration of 6.9 M. To this solution CPaseY was added. The reaction was carried out at 50°C for 30 min (18). RESULTS The structure Construction of multiple-copy gene of the synthetic coding sequence for the hCT-Leu is shown in Fig. 1. The choice of codons for hCT-Leu was based on those codons occurring most frequently in the genome of E. coli. The 99 bp core sequence which specifies hCT-Leu is bounded by linker sequences at its 5’ and 3’ ends. The 5’ flanking region contains a BamHI sticky end. In addition, an arginine codon is located immediately adjacent to the N-terminal cysteine codon of a hCT-Leu coding sequence. Similarly, the 3’ flanking region contains an arginine codon which is located immediately downstream of the hCT-Leu coding sequence in addition to a BgflI recognition sequence, a translation termination codon, and a SalI sticky end. The two argi-

4

141

nine residues bracketing hCT-Leu were designed as sites for specific cleavage by clostoripain. This design allows the generation of a multimeric hCT fusion protein, expressed as a tandemly repeated coding sequence which can be converted to hCT-Leu-Arg by clostoripain. The synthetic sequence shown in Fig. 1 was assembled from six overlapping oligonucleotides and inserted between the BamHI and SaZI sites of the expression vector, pUC18, resulting in formation of the plasmid pUCa1 1 as shown in Fig. 2. Figure 2 also shows the strategy for construction of the tandemly repeated coding sequence. This involved cutting pUCa1 1 at the BgnI and SalI sites located adjacent to the termination codon, and inserting a second copy of the synthetic fragment described above. The plasmid containing two tandemly linked copies of the hCT-Leu coding sequence was designated pUCa1 2, as shown in Fig. 2. By ligating the BamHI and BgAI sites, both cleavage sites were eliminated. Next, pUCa1 2 was cut at the BgflI and Sal1 sites and two tandemly linked copies of hCT-Leu, which were obtained by cleavage of pUCa1 2 at the BamHI and SalI sites, were inserted. The plasmid containing four tandemly linked copies of the hCT-Leu coding sequence was named pUCa1 4 and is shown schematically in Fig. 2. By repeating this process, various plasmids, containing six (pUCa1 6), eight (pUCa1 8), twelve (pUCa1 12), and sixteen (pUCa1 16) copies of the hCT-Leu coding sequence were constructed. ExExpression of multimeric hCT fusion protein pression of the fusion protein, which was fused with the first 11 amino acid residues of f-galactosidase and a 3 amino acid residue linker, was induced in E. coli YA21. The products from pUCa1 1 and pUCa1 2 were not detected by SDS-PAGE analysis (Fig. 3). However, the production of the fusion protein was significantly enhanced when the number of hCT-Leu coding sequences was increased, although a definite decrease was seen in the case of twelve copies of hCT-Leu. The fusion proteins expressed using pUCa1 4, pUCa1 6 and pUCa1 8 had molecular weights of approximately 18,000, 26,000 and 32,000 Da, respectively. These molecular weights were approximated from the number of coding se-

I

GATCCGCC;TTGCGGTAATCTGTCTAC~~GCATGCTCCGCC GCGCAACGCCA~AGACAGATGAACGTACGACCCGTGAATGTGGGTCCTGAAG~TGTTWAG 4

2 ysGlyAsnLeuSerThrCysMetLeuG~yThrTyrThrGlnAspPheAsnLysPhe

EgZII

SOZI w

5 CACACC~TCCCGCAGACTGCAATCGGCGT~-GGAGCACCGCTGCGTGC~~GW~ GTCTGGMGGGCCTCTGACGGCCGCAACCTCGTGGCGACG~C~~AGACA~~G~ 6' HisThrPheProGlnThrAloIIeGl,yValGlyAl,aProLeu

rgAbAspLeu***

FIG. 1. Synthetic coding sequence for hCT-Leu. The sequence was designed to contain of hCT-Leu as well as linker sequences for cloning and construction of the tandemly repeated hCT-Leu was created by ligation of six oligonucleotides (l-6).

the sequence coding for the 32 amino acid residues coding sequence. The synthetic coding sequence for

142

ISHIKAWA

J. FERMENT.BIOENG.,

AND TAMAOKI

94K 67K

.

43K

30K

Ir

20K .

BamHl-WI -m 1 BglllFSall

Ba

I

BgS

I

FIG. 2. Construction of plasmids carrying multiple-copies of the coding sequence for hCT-Leu. The synthetic coding sequence for hCT-Leu was cloned between the BamHl and Bglll sites of plasmid pUC18 to create pUCa1 1. The synthetic coding sequence for hCT-Leu was inserted into pUCa1 1 between BumHI and Sal1 sites to create pUCa12. The hCT coding region was further expanded by insertion of BamHl-Sal1 fragment containing coding sequences for hCT-Leu from pUCaI 2 into the BamHl and S&I sites of pUCa12 to create pUCal4. The solid boxes represent coding sequences for hCT-Leu and open boxes represent linker peptide sequences.

quences for hCT-Leu in each plasmid. We confirmed that these proteins were multimeric hCT-Leu fusion proteins by western blotting using anti-hCT antibody (data not shown). The optimum expression level was obtained at six copies, pUCa1 6, as shown in Table 1. Therefore, pUCa1 6 was used for further study. Cells harboring pUCa1 Cleavage of fusion protein 6 were grown and the culture was centrifuged. The cells were homogenized in TES buffer and the insoluble fusion protein was isolated by centrifugation. Then the fusion protein was resuspended in 20 mM Tris-HCl (pH 7.5) containing 8 M urea. In this solution, fusion protein constituted at least 35% of the protein stained with Coomassie Brilliant Blue-R. The fusion protein was cleaved into monomers by clostoripain, an enzyme which specifically cleaves at the C-terminal side of an arginine residue (19), and thus hCT-Leu-Arg was obtained. As shown in Fig. 4, two major peaks were detect-

FIG. 3. SDS-polyacrylamide gel electrophoresis of multimeric hCT fusion proteins. Cells harboring pUCa1 1 to 16 were grown, I .O ml of the culture was centrifuged, and the cells resuspended in 100 ~1 sample buffer were boiled for 5 min. Twenty ill of lysate was fractionated on a 12’4 SDS-polyacrylamide gel and stained with Coomassie Brilliant Blue-R. The solid triangles indicate the positions of the multimeric fusion proteins.

ed in the reverse-phase high-pressure liquid chromatograph of the reaction mixture of clostoripain digestion, and the amino acid sequences of these two major peaks were determined. The peak (II) and peak (I) were attributed to hCT-Leu-Arg and hCT-Leu-Arg-Ala-AspPro-Arg, respectively. The latter residue was linker peptide linked to the C-terminal of the hCT-Leu-Arg. The size of this peak (I) decreased upon prolonged clostoripain treatment. The products (hCT-Leu-Arg) were then S-sulfonated to prevent disulfide bond formation. The S-sulfonated hCT-Leu-Arg (S-hCT-Leu-Arg) was purified by reverse-phase HPLC and the yield obtained was about 35%. Amidation of S-hCT-Leu-Arg and obtaining of mature hCT Initially, S-hCT-Leu-Arg was converted to S-hCT-Leu, which is a substrate for amidation catalyzed by carboxypeptidase Y (CPaseY). We used the enzyme carboxypeptidase B (CPaseB) which catalyzes the hydrolysis of the peptide bonds of C-terminal basic amino acids (20). The obtained products (S-hCT-Leu) were purified using reverse-phase HPLC and in turn amidated with CPaseY. The reaction mixtures were subjected to the reverse-phase HPLC and the fraction containing amidated S-hCT was collected. In this step, the yield was about 40,Od. Finally, S-hCT was desulfonated and hCT was purified by reverse-phase HPLC. We confirmed that the peptide was mature hCT by amino acid composition TABLE 1. Production of hCT-Leu in E. co/i strains harboring plasmids with tandemly repeated coding sequences in 100 ml cultures Plasmid pUCa14 pUCa16 pUCal8

ODGO” 4.818 5.214 4.794

Inclusion body (mg) 8.2 10.0 8.8

Fusion protein (mg)

(mg)

2.23 4.78 3.35

1.88 4.03 2.82

hCT-Leu-Arg fmg/OD& 0.39 0.77 0.59

PRODUCTION

VOL. 82. 1996

dation enzyme

P

(D

N

‘D

R

T

%

min

FIG. 4. Reverse-phase high-pressure liquid chromatography of the fusion protein cleaved by clostoripain. The sample in which fusion protein was cleaved by incubation with clostoripain for 120 min was applied on a reverse-phase Cl8 column in 20% CH3CN containing 0.1% TFA. Elution was uerformed as described in the Materials and Methods section. _

analysis and amino acid sequencing. We obtained 0.5 mg mature hCT from 100 ml culture.

about

enzyme

was

cloned

OF HUMAN

and

CALCITONIN

obtained

143

as recombinant

(22, 23). However, in the present work, we used carboxypeptidase Y (CPaseY) for amidation instead of the peptidylglycine a-amidation enzyme. CPaseY catalyzes the transpeptidation at the C-terminal residue of a peptide in the presence of suitable nucleophiles, is useful enzyme for amidation, and is easily obtained from S. cerevisiae. When the peptidylglycine n-amidation enzyme is used for C-terminal amidation, the amino acid residue next to proline is glycine. However, when CPaseY is used for this reaction, leucine is the best amino acid residue next to proline (18). When a recombinant peptide is expressed as a fusion protein, the cleavage efficiency is an important factor. In this study, we used clostoripain for this reaction. This enzyme cleaves only at the C-terminal side of an arginine residue and is this very useful for obtaining hCT precursors from the multimeric protein, because hCT does not contain any arginine residues. A noteworthy finding however was that the efficiency of this reaction was not very high, and thus use of other methods for obtaining the hCT precursor more efficiently is necessary. In this paper, we have described the production of human calcitonin in E. coli from a multimeric fusion protein. Such a method is considered useful for high-level expression of a small peptide such as hCT. ACKNOWLEDGMENTS We would like to thank Ms. Junko Kawaguchi Abiko for the analysis of amino acid sequences Nagaoka for the technical assistance.

and Ms. Kazumi and Ms. Nobumi

DISCUSSION In this work, we constructed several expression plasmids, pUCa1 1, pUCa1 2, pUCa1 4, pUCa1 6, pUCa1 8, pUCa1 12, and pUCa1 16. We tried to detect the products from pUCa1 1 and pUCa1 2 under various gel conditions (data not shown), but could not. The products from pUCa1 1 and pUCa1 2 were of low molecular weight. We speculated that they were degraded by proteolytic enzymes in the host bacteria more easily than the products from the other plasmids. On the other hand, the production level of the fusion protein was reduced when the number of hCT-Leu coding sequences was more than eight. These findings are consistent with ones reported elsewhere (15, 16). This reduction of the production level might be due to instability of the mRNA or of the expression plasmids in E. coli during culture. In previous studies, we produced hCT as a fusion protein with chloramphenicol acetyl transferase (CAT). The molecular weight of this fusion protein was about 32 kDa and the molecular weight ratio of hCT on this fusion protein (CAT-hCT) was about 14%. In this work however, we have described the production of hCT as a multimeric fusion protein. The molecular weight of this multimeric fusion protein was about 26 kDa and the molecular weight ratio of hCT on this multimeric fusion protein was about 779:. The productivities of CAT-hCT and the multimeric fusion protein were nearly equal in E. cofi (data not shown). From this result it was inferred that the productivity of hCT as multimeric fusion protein is 5 times greater than that of hCT as CAT-hCT. Calcitonin (CT) carries a proline-amide at the C-terminus, and thus imparts an important role in terms of its biological activity (21). Recently, a peptidylglycine a-ami-

REFERENCES 1. Busolati, G. and Pearse, A. G. E.: Immunofluorescent localization of calcitonin in the “C” cells of pig and dog. J. Endocrinol., 37, 205-209 (1967). 2. Steaveson, J. C. and Evans, I. M. A.: Pharmacology and therapeutic use of calcitonin. Drugs, 21, 257-272 (1981). A. G. F.: Direct humoral control 3. Copp, D. H. and Davidson, of parathyroid function in the dog. Proc. Sot. Exp. Biol. Med., 107, 342-344 (1961). E. C., Cheney, B.A., Davidson, 4. Copp, D. H., Cameron, A. G. F., and Henze, K. G.: Evidence for calcitonin. A new hormone from the parathyroid that lowers blood calcium. Endocrinology, 70, 638-649 (1962). 5. Austin, L. A. and Heath, H.: Physiology and pathophysiology. N. Eng. J. Med., 304, 269-278 (1981). in 6. McDermott, M. T. and Kidd, G. S.: The role of calcitonin the development and treatment of osteoporosis. Endocri. Rev., 8, 377-390 (1987). I. Hosking, D. J., Denton, L. B., Cadge, B., and Martin, T. J.: Functional significance of antibody formation after long-term salmon calcitonin therapy. Clin. Endocrinol., 10, 243-252 (1979). 8. Singer, F. R., Aldred, J. C., Neer, R. M., Krane, S. M., Potts, J. T., and Block, K. J.: An evaluation of antibodies and clinical resistance to salmon calcitonin. .I. Clin. Invest., 51, 23312332 (1972). 9. Ohie, J. F. and Cooper, C. W.: Loss of calcemic effects of calcitonin and parathyroid hormone infused continuously into rats using the Alzet osmotic miniclamp. J. Pharmacol. Exp. Ther., 209, 422-428 (1979). IO. Au, W. Y. W.: Calcitonin treatment of hypercalcemia due to parathvroid carcinoma. Arch. Intern. Med.. 135. 1594-1597 (1975). II. Rabbani, S. A., Yasuda, T., Bennet, H. P. J., Sung, W. L., Zahab, D. M., Tam, C. S., Goltzmao, D., and Heady, G. N.: Recombinant human parathyroid hormone synthesized in

144

ISHIKAWA

AND TAMAOKI

Escherichia coli. J. Biol. Chem., 263, 1307-1313 (1988). 12. Parsell, A. D. and Sauer, R. T.: The structural stability of a protein is an important determinant of its proteolytic susceptibility in Escherichia coli. J. Biol. Chem., 264, 7590-7595 (1984). 13. Ivanov, I., Gigova, L., and Jay, E.: Chemical synthesis and expression in l?. coli of a human VaP-calcitonin gene by fusion to a svnthetic human interferon-r gene. FEBS Lett.. 210. 56-60 _ (1987).

14. Tajima, M., Iida, T., Kaminuma, T., Yanagai, M., and Fukushima, S.: High-level synthesis in Escherichio co/i of recombinant human calcitonin: collagenase cleavage of the fusion protein and peptidylglycine n-amidation. J. Ferment. Bioeng., 72, 362-367 (1991). 15. Shen, S. H.: Multiple joined genes prevent product degradation in Escherichia coli. Proc. Natl. Acad. Sci. USA, 81, 4627-4631 (1984). 16. Gigova, L., Wisbart, P., Uscheva, A., Ivanova, M., Bardarov, S., Jay, E., and Ivanov, I.: Expression of repetitive human calcitonin genes in Escherichia co/i. Biotech. Appl. Biochem., 11, 401-412 (1989). 17. Mironova, R., Philipova, D., Marekov, L., Venkov, P., and Ivanov, I.: Secretion of oligomeric Va18-human calcitonin by Succharomyces cerevisiae. FEMS Micro. Lett., 83, 23-28

J. FERMENT.BIOENG., (1991). H., Kawaguchi, J., and Satoh, K.: C-terminal amida18 Tamaoki, tion of synthetic model substrates of human calcitonin by carboxypeptidase Y. Ann. Rep. Sankyo Res. Labo., 38, 73-79 (1986). M. M. and William, F. H.: Clostoripain. Methods 19 William, Enzymol., 19, 635-642 (1970). B (porcine pancreas). Methods 20 Fork, J. E.: Carboxypeptidase Enzymol., 19, 504-508 (1970). 21 Rittel, W., Maier, R., Brugger, M., Kamber, B., Riniker, B., and Sieber, P.: Structure-activity relationship of human calcitonin. III. Biological activity of synthetic analogues with shortened or terminally modified peptide chain. Experientia, 32, 246-248 (1976). 22 Iwasaki, Y., Kawahara, T., Shimoi, H., GhisaIba, O., Kangawa, Y.: Purification and cDNA K., Matsuo, H., and Nishihara, cloning of Xenopus laevis skin peptidylhydroxyglycine N-C lyase, catalyzing the second reaction of C-terminal tr-amidation. Eur. J. Chem., 201, 551-559 (1991). 23 Suzuki, K., Shimoi, H., Iwasaki, Y., Kawahara, T., Matsuura, Y., and Nishihara, Y.: Elucidation of amidating reaction mechanism by frog amidating enzyme, peptidylglycine cthydroxylating monooxygenase, expressed in insect cell culture. EMBO J., 9, 4259-4265 (1990).