Prolyl hydroxylase inhibition protects the kidneys from ischemia via upregulation of glycogen storage

Journal Pre-proof Prolyl hydroxylase inhibition protects the kidneys from ischemia via upregulation of glycogen storage Marie Ito, Ph. D., M.D., Tetsuhiro Tanaka, Ph. D., M.D., Taisuke Ishii, M.D, Takeshi Wakashima, Kenji Fukui, Masaomi Nangaku, Ph. D., M.D. PII:

S0085-2538(19)31113-5

DOI:

https://doi.org/10.1016/j.kint.2019.10.020

Reference:

KINT 1849

To appear in:

Kidney International

Received Date: 26 April 2019 Revised Date:

3 October 2019

Accepted Date: 10 October 2019

Please cite this article as: Ito M, Tanaka T, Ishii T, Wakashima T, Fukui K, Nangaku M, Prolyl hydroxylase inhibition protects the kidneys from ischemia via upregulation of glycogen storage, Kidney International (2019), doi: https://doi.org/10.1016/j.kint.2019.10.020. This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Copyright © 2019, Published by Elsevier, Inc., on behalf of the International Society of Nephrology.

Prolyl hydroxylase inhibition protects the kidneys from ischemia via upregulation of glycogen storage.

PHD2

PGM1 GYS1 GB1

Ischemia reperfusion injury

Glycogen GSH

ROS scavenging Protection

HIF1 ATP

Ito et al, 2019

Energy supply

CONCLUSION: PHD inhibition increases glycogen storage and protects the kidneys from ischemia reperfusion injury.

[QUERY TO AUTHOR: title and abstract rewritten by Editorial Office – not subject to change]

Prolyl hydroxylase inhibition protects the kidneys from ischemia via upregulation of glycogen storage. Marie Ito1 Ph. D., M.D., Tetsuhiro Tanaka1 Ph. D., M.D., Taisuke Ishii1 M.D, Takeshi Wakashima1,2, Kenji Fukui2, Masaomi Nangaku1 Ph. D., M.D. 1.

Division of Nephrology and Endocrinology, the University of Tokyo Graduate School of Medicine, Tokyo, Japan.

2.

Biological and Pharmacological Laboratories, Central Pharmaceutical Research Institute, Japan Tobacco Inc., Osaka, Japan.

Corresponding Authors: Masaomi Nangaku, Division of Nephrology and Endocrinology, the University of Tokyo Graduate School of Medicine, 7-3-1 Hongo, Bunkyo
ku, Tokyo 113-8655, Japan. Tel: +81 3 5800 9736 Fax: +81 3 5800 9807 E-mail: [email protected] Tetsuhiro Tanaka, Division of Nephrology and Endocrinology, the University of Tokyo

Graduate School of Medicine, 7-3-1 Hongo, Bunkyo
ku, Tokyo 113-8655, Japan. Tel: +81 3 3815 5411 Fax: +81 3 5800 9826 E-mail: [email protected] Running headline: The mechanism of HIF-induced protection against ischemic kidney injury Funding Information: The study was supported by the Grant-in-Aid for Scientific Research (B,C) from Japan Society for the Promotion of Science 18H02824 (M.N.) and 17K09688 (T.T.), the Grant-in-Aid for Scientific Research on Innovative Areas 26111003 (M.N.) and Biological and Pharmacological Research Laboratories, Central Pharmaceutical Research Institute, Japan Tobacco Inc. Word count of text: 4759 words

2

Abstract Hypoxia-inducible factor (HIF) mediates protection via hypoxic preconditioning in both, in vitro and in vivo ischemia models. However, the underlying mechanism remains largely unknown. Prolyl hydroxylase domain proteins serve as the main HIF regulator via hydroxylation of HIFα leading to its degradation. At present, prolyl hydroxylase inhibitors including enarodustat are under clinical trials for the treatment of renal anemia. In an in vitro model of ischemia produced by oxygen-glucose deprivation of renal proximal tubule cells in culture, enarodustat treatment and siRNA knockdown of prolyl hydroxylase 2, but not of prolyl hydroxylase 1 or prolyl hydroxylase 3, significantly increased the cell viability and reduced the levels of reactive oxygen species. These effects were offset by the simultaneous knockdown of HIF1α. In another in vitro ischemia model induced by the blockade of oxidative phosphorylation with rotenone/antimycin A, enarodustat-enhanced glycogen storage prolonged glycolysis and delayed ATP depletion. Although autophagy is another possible mechanism of prolyl hydroxylase inhibition-induced cytoprotection, gene knockout of a key autophagy associated protein, Atg5, did not affect the protection. Enarodustat increased the expression of several enzymes involved in glycogen synthesis, including phosphoglucomutase 1, glycogen synthase 1, and 1,4-α glucan branching enzyme. Increased glycogen served as substrate for ATP and NADP production and augmented reduction of glutathione. Inhibition of glycogen synthase 1 and glutathione reductase nullified enarodustat's protective effect. Enarodustat also protected the kidneys in a rat ischemia reperfusion injury model and the protection was partially abrogated by inhibiting glycogenolysis. Thus, prolyl hydroxylase inhibition protects the kidney from ischemia via upregulation of glycogen synthesis. Keywords: AKI, ischemia reperfusion injury, HIF, PHD inhibitor, glycogen

Translational Statement In this study, we demonstrated the PHD inhibition-induced protection against ischemia

3

was mediated by increased glycogen storage in the kidneys via upregulation of genes involved in glycogen synthesis by HIF1 for the first time. This discovery could lead to better understanding of the role of HIF and to wider application of PHD inhibitors to a preventive therapy of AKI.

Introduction Acute kidney injury (AKI) has considerable clinical implications owing to its high incidence rate and mortality1. Despite significant advances in the field of medicine, limited progress has been made with respect to the strategies for AKI prevention or treatment. Renal ischemia reperfusion injury (IRI) is a leading cause of AKI that is associated with several clinical conditions, including transplantation and major cardiac surgeries, and is accompanied by decreased perfusion to the kidneys2. Renal tubules are an important target for IRI and are especially vulnerable to decrease in perfusion and subsequent hypoxia3. Recently, hypoxia-inducible factor (HIF) has gained considerable attention as a master regulator that orchestrates the response to hypoxia4, 5, 6. HIF, as transcriptional activators, comprises two subunits, HIF1α or HIF2α and constitutive HIFβ. HIFα is continuously produced and degraded in normoxia, and 4

this reaction is mainly regulated by prolyl hydroxylase domain-containing enzymes (PHD). PHD hydroxylates the proline residues of HIFα and directs them to the von Hippel Lindau (VHL) ubiquitin E3 ligase, resulting in ubiquitin-proteasome mediated degradation. PHDs have three isoforms, PHD1, PHD2, and PHD3. In the renal tubular cells, PHD2 primarily regulates HIF degradation7. PHD utilizes oxygen as a substrate in the hydroxylation; therefore, the decrease in oxygen tension inactivates PHD. In hypoxia, PHD cannot hydroxylate HIFα leading to its accumulation, formation of HIF complex with HIFβ, and translocation to the nucleus wherein the HIF heterodimer binds to hypoxia response element (HRE). Thus, HIF controls the transcription of a wide range of genes implicated in hypoxia response. Erythropoietin is one of the major targets of HIF2, and currently, phase II/III clinical trials are ongoing on PHD inhibitors for the treatment of renal anemia; PHD inhibitors have recently been clinically approved in China4,

8, 9

. Enarodustat (JTZ-951) is a

pan-PHD inhibitor with IC50; around 0.1 umol/L for PHD1, PHD2, and PHD3, respectively5,

10,

11

. In addition to its application in the replacement of

erythropoietin-stimulating agents (ESAs), HIF activation strategy is expected to protect organs from injury; moreover, some reports have demonstrated the protective effect of 5

HIF12, 13, 14 or hypoxia-preconditioning15. However, others indicate the possible role of HIF in the deterioration of fibrosis16, and the influence of HIF in the prevention or treatment of kidney diseases remains controversial.

Glycogen is an important substrate for ATP production, especially when the cells are deprived of glucose, and oxidative phosphorylation is suppressed in a setting, such as oxygen deprivation or ischemia. Hypoxia preconditioning protects the neoplastic cells from hypoxia along with glucose deprivation via the upregulation of the glycogen synthesis pathway and glycogen storage17,

18, 19

. Hepatic cells, muscle cells, and

periosterial cells also demonstrated enhancement in glycogen storage with hypoxia preconditioning20, 21. Glycogen storage in the kidneys is considerably smaller than that in the liver22 and is expected to have limited, if any, roles in the maintenance of plasma glucose like the liver, and the only mechanism for plasma glucose maintenance in the kidneys is gluconeogenesis23. However, the possibility of stored glycogen being used for the cell itself in severe energy depletion such as ischemia, has not been explored. In this study, we aimed to investigate the cytoprotective effect of PHD inhibitor and 6

the role of glycogen storage in a kidney ischemia model in vitro and explore the perspective of PHD inhibition as a preventive therapy for AKI.

Results PHD inhibition protects the cells and reduces ROS in OGD, an in vitro ischemia model As an in vitro kidney ischemia model, HK2, a renal proximal tubular cell line, and RPTEC, primary normal human proximal epithelial cells, were exposed to glucose- and serum-free medium simultaneously with 0.1% oxygen, an insult called OGD. In order to investigate the effect of PHD inhibitor, the cells were pretreated with vehicle or enarodustat for 24 h. With enarodustat pretreatment, the number of HK2 cells that survived 16-h-OGD was larger, and the proportion of apoptotic cells was smaller than that with vehicle pretreatment (Figure 1A, 1B). The proportion of reactive oxygen species (ROS)-positive cells was significantly decreased with enarodustat pretreatment in the HK2 cells (Figure 1C). In RPTECs, the number of surviving cells was slightly larger with enarodustat pretreatment than that with vehicle pretreatment, and the proportion of ROS positive cells was significantly decreased with enarodustat 7

pretreatment (Figure 2A, 2B). In order to assess whether genetic PHD inhibition confers similar protection, the knockdown of each isoform of PHD (PHD1, PHD2, or PHD3) by siRNA was conducted. PHD2 knockdown produced a result similar to that with enarodustat (Figure 1E, 1F). Considering that PHD2 mainly regulates HIF, we then assessed whether the cytoprotective effect of PHD inhibition was mediated by HIF via siRNA (Figure 3A). With HIF1 knockdown, the protective effect of enarodustat on cell viability and ROS reduction was abrogated. In contrast, HIF2 knockdown did not cancel out the protective effect of enarodustat (Figure 3B, 3C).

PHD inhibition upregulates the glycolytic pathway in OGD To investigate the underlying mechanism of PHD inhibition-induced cytoprotection, microarray analysis of 3 groups of HK2 cells (sham: 24 h vehicle pretreatment + 16 h in normal medium, ctrl: 24 h vehicle pretreatment + 16 h OGD, enarodustat: 24 h enarodustat pretreatment+ 16 h OGD). Total 423 probes were significantly upregulated in the ctrl group than in the sham group and were downregulated in the enarodustat group than in the ctrl group. Total 228 probes were significantly downregulated in the ctrl compared to that in the sham group and were upregulated in the enarodustat group 8

compared to that in the ctrl group. Pathway enrichment analysis revealed genes involved in DNA repair and Gαq pathway among the former group (upregulated in the ctrl/sham and downregulated in the enarodustat/ctrl) and genes involved in glucose metabolism, including the glycolysis pathway and HIF1α transcription factor network in the latter group (downregulated in the ctrl/sham and upregulated in the enarodustat/ctrl) (Figure 4). We focused on the glycolysis pathway that was related to 6 of the top 10 pathways. Since glucose was depleted from the medium, glycogen attracted our attention as the only substrate for glycolysis.

PHD inhibitor enhances glycogenesis, NADPH, and GSH reduction We quantified the level of mRNAs involved in glycogen synthesis after 24-h pretreatment with vehicle or enarodustat. Phosphoglucomutase (PGM1), UDP-glucose pyrophosphorylase (UGP2), glycogen synthase 1 (GYS1), and branching enzyme (GBE1) are involved in glycogen synthesis20. All mRNA levels except UGP2 were upregulated with enarodustat pretreatment (Figure 5A), and HIF1 mainly mediated the upregulation (Figure 5B). Subsequently, the glycogen storage in HK2 cells was increased with enarodustat pretreatment, while almost all the glycogen was consumed 9

with 5-h OGD in the ctrl group. About 30% of glycogen remained in the cells pretreated with enarodustat (Figure 5C). Although the difference was smaller, a similarly significant difference was observed in RPTECs (Figure 5D). In addition to glucose, glycogen produces glucose-6-phosphate, a substrate of the pentose phosphate pathway (PPP)17. NADPH is generated in PPP and regenerates reduced glutathione (GSH). GSH is used to scavenge H2O2 by glutathione peroxidase (GPX). The ratio of NADP/NADPH and GSSG/GSH decreased with enarodustat pretreatment (Figure 5E, 5F).

PHD inhibition-induced glycogen storage protects cells from rotenone and antimycin A exposure, another in vitro ischemia model In order to demonstrate that glycolysis is upregulated, we used the flux analyzer that can measure the rate of glycolysis and oxidative phosphorylation in live cells24. However, cells packed in an anoxic bag cannot undergo the assay. In order to overcome this limitation, we conceived a model that mimics the energy status of OGD. Simultaneously with glucose deprivation in the medium, we inhibited oxidative phosphorylation via rotenone and antimycin A, inhibitors of complex I and IV, respectively, instead of 10

anoxia. We first confirmed that rotenone and antimycin A exposure produces results similar to that with OGD (Figure 6A, 6B). Thereafter, we measured the rate of glycolysis that could be interpreted as the ATP production rate because the other pathway of ATP production, oxidative phosphorylation, was completely blocked. The decrease in the glycolytic rate or ATP production rate was more gradual in the enarodustat-treated cells, compatible with the larger glycogen reserve (Figure 6C). This was also confirmed by GYS1 knockdown, which completely abolished the surge in glycolytic rate with or without enarodustat (Figure S1).

Autophagy has no contribution in PHD inhibition-induced cytoprotection or ROS reduction in OGD Autophagy, a pathway that degrades and recycles macromolecules and damaged organelles, is another mechanism of supplying fuel to the starved cells or reducing ROS25. Some studies have reported that HIF upregulated autophagy26, 27. However, the regulation of autophagy by hypoxia seems cell type- and context- dependent28. In order to investigate the role of autophagy in PHD inhibition-induced cytoprotection, we generated Atg5-KO HK2 cells using CRISPER-Cas9 system and confirmed that the 11

conversion of LC3-II from LC3-I was successfully abolished in the Atg5-KO HK2 cells (Figure 7A). The increase in cell number or reduction in ROS positive cells was unaffected by Atg5-KO, and we concluded that autophagy was not implicated in this protection (Figure 7B, 7C).

Inhibition of glycogenesis and glycogenolysis abrogates the cytoprotective effect of PHD inhibition To establish the causative role of glycogenesis in PHD inhibition-induced cytoprotection in in vitro ischemia model, we inhibited glycogen degradation using 2-DG. 2-DG is generally used as a hexokinase inhibitor; however, it also inhibits phosphoglucomutase and phosphoglucose isomerase, leading to interference in glycogen usage29. 2-DG was added to the glucose- or serum-free medium after pretreatment with vehicle or enarodustat for 24 h, and the cells underwent 16-h OGD. 2-DG abrogated the cytoprotection by enarodustat in respect of cell number retention and ROS reduction (Figure 8A, 8B). We also inhibited GYS1 using siRNA transfection. siRNA knockdown for GYS1 was specific against other genes involved in glycogen synthesis (PGM1, UGP2 and GB1) and representative genes on the glycolytic pathway 12

(LDHA, PDK1 and PKM) (Figure S2). GYS1 knockdown also abrogated the cytoprotection by enarodustat (Figure 8C-8E), whereas GB1 knockdown did not (Figure S3).

Inhibition of glutathione reductase abrogates cytoprotective effect of PHD inhibition To elucidate the role of NADPH and GSH generation from glycogen in amelioration of cell death and ROS reduction, we blocked glutathione reductase (GR), which translocates electron from NADPH to GSH. We added 2-AAPA, a GR inhibitor30, 31, to the glucose- or serum-free medium after the pretreatment with vehicle or enarodustat for 24 hours and the cells underwent 16-h OGD. 2-AAPA abolished the cell number retention and ROS reduction induced by enarodustat (Figure 9A, 9B). This result indicates that increased oxidative stress in addition to ATP depletion causes cell death.

Pretreatment with PHD inhibitor upregulates glycogenesis and protects the kidneys from ischemia Finally, we conducted an in vivo experiment to examine whether PHD inhibition exerts 13

renoprotection in ischemia/reperfusion via increased glycogen storage. We could observe the accumulation of HIF1 in the nuclei of proximal tubular cells and the upregulation of GYS1 in enarodustat-pretreated kidneys (Figure 10A, B). The sum of glycogen storage and glucose was increased with enarodustat pretreatment (Figure 10C); however, the glycogen storage itself did not alter significantly (Figure 10D). Next, we used N-methyl-1-deoxynojirimycin (MOR-14) to block glycogenolysis to investigate the role of stored glycogen. Without the addition of MOR-14, plasma creatinine levels 48 hours after the operation were significantly decreased in enarodustat-pretreated rats (Figure 10E). HE staining, TUNEL staining also confirmed amelioration of injury (Figure 10F). With the addition of MOR-14, the protection by enarodustat was abrogated in respect of plasma creatinine levels, tubulointerstitial damage and apoptosis, indicating that glycogenolysis played a protective role in IRI injury in vivo (Figure 10E-H).

Discussion Ischemic/hypoxic preconditioning is “a stressful but non-damaging stimulus that confers protection against a subsequent harmful ischemic insult”32. Thus far, this result 14

has been reported across several cell types, tissues, and species33, 34, 35. HIF mediates ischemic/hypoxic preconditioning by regulating the transcription of several types of genes. Although certain single target genes, such as EPO36, vascular cell adhesion molecule 1 (VCAM1)37, and superoxide dismutase38, may provide some protection, multiple target genes work in synergy to activate several protective pathways. Metabolic reprogramming is one of the salient pathways for achieving hypoxia tolerance. It is well known that HIF1 shifts cellular metabolism from oxidative phosphorylation to glycolysis39, 40, 41, 42, 43. In cases of extreme oxygen deprivation like OGD, oxidative phosphorylation cannot operate. Thus, we focused on the substrate of glycolysis. In this study, we propose enhanced glycogen storage as a novel mechanism of protection with PHD inhibition against renal ischemic injury (Figure 11). With the upregulation of genes involved in glycogen synthesis, HIF1 increases glycogen storage. Glycogen provides ATP and antioxidants when it enters the glycolysis pathway and the PPP. These pathways are especially important when oxidative phosphorylation, a main source of ATP under normal circumstances, is blocked and glucose is deprived. In RPTEC, the increase in glycogen storage induced by enarodustat was smaller, and the cytoprotective effect of enarodustat was weaker than that in HK2 cells. This could 15

indirectly support the link between glycogen storage and cytoprotection of enarodustat. The significance of increased glycogen storage on cell survival has already been demonstrated in cancer cells including hepatocarcinoma cells, muscle cells, and periosterial cells17, 18, 19, 20, 21. The liver and muscle contain substantial glycogen storage for the distinctive purposes of blood sugar maintenance and exercise, respectively. Although the kidneys store a relatively small amount of glycogen22, this may be sufficient for each cell to protect itself from ischemia. Although the glycogen amount itself was not increased with 4-day pretreatment of enarodustat, the upregulation of GYS1 could be observed as early as 2 days after the commencement of enarodustat. The reason why we could not demonstrate the increase in glycogen may be attributable to the unstable quality of glycogen that is susceptive to degradation. Microwave fixation is preferred to freezing with liquid nitrogen for glycogen measurement; however, this technique is currently only used for the brain and heart, considering animal welfare. N-methyl-1-deoxynojirimycin (MOR-14) is an α1, 6-glucosidase inhibitor, which blocks glycogenolysis. Although we could not confirm whether MOR-14 effectively inhibited glycogen usage during ischemia in our model because the tubular cells in outer 16

stripe of outer medulla underwent cell death and were not apt for glycogen measurement after IRI, MOR-14 inhibited approximately 70% of α1,6-glucosidase activity and decreased glycogen consumption in rabbits’ hearts44. Enarodustat-induced renoprotection against IRI in rats had the tendency to be abrogated with the inhibition of glycogenolysis, which indicated the beneficial role of glycogen storage in the protection of PHD inhibition against renal ischemia/reperfusion injury. Autophagy is one of the adaptive pathways to hypoxia induced by HIF26, 27. Under hypoxia selective autophagy for mitochondria, mitophagy is triggered by HIF1 and decreases ROS production26. Under starvation, autophagy recycles organelle and macromolecules to produce nutrients25. However, in our OGD model, autophagy failed to play a role in cytoprotection. This may be attributable to the difference in protocols, such as the timing of HIF stabilization or the oxygen concentration, because under complete inhibition of oxidative phosphorylation in anoxia, amino acids from autophagy are unable to produce ATP. To the best of our knowledge, this is the first study to investigate the role of glycogen in PHD inhibitor-induced protection from IRI in the kidneys. In fact, the role of glycogen under IRI in other organs has been investigated. Some reports have indicated that 17

enhanced glycolysis could be harmful because of lactate accumulation and acidosis44. In the kidneys, the benefit of upregulated glycolysis was only indirectly suggested in the protective role of poly(ADP-ribose) polymerase-1 (PARP-1) knockout45. It has been indicated

that

PARP-1

knockout

ameliorated

the

inhibition

of

glyceraldehyde-3-phosphate dehydrogenase (GADPH) and subsequently upregulated anaerobic respiration, thus protecting the proximal tubules against IRI. In our study, although we were unable to establish the causative role of glycogen storage in PHD inhibition-induced renoprotection against IRI in vivo, PHD inhibition amplified the amount of glycolysis substrate and ameliorated IRI. The kidneys play a crucial role in metabolizing lactate, only second to the liver. This could possibly offset the detrimental impact of lactate accumulation, and the benefit of ATP or antioxidant production might outweigh the harm of lactate accumulation from enhanced glycolysis. Our study has several limitations especially in in vivo part. We could not demonstrate the increase in the amount of glycogen stored in the kidneys probably due to the instability of glycogen. As mentioned above, on glycogen measurement in vivo, it is optimal to fix tissues immediately with microwave, which could only be applied to the brain and heart on ethical grounds. We conducted inhibitory experiments using MOR-14, 18

but as we discussed earlier, we could not confirm the inhibition in glycogen usage in our own model. We also could not validate the specificity of MOR-14. Moreover, PHD inhibition has pleiotropic actions and its protective effect against kidney IRI could be multifactorial. While glycogen storage is likely to contribute to the PHD inhibition-induced renoprotecton, how much of the protection it accounts for could only be elucidated with experiments using genetic models, which is a subject of future investigation. PHD inhibitors, including enarodustat, are currently the subject of clinical trials for renal anemia in several countries and have already clinically applied in China. This study supported the role of PHD inhibitors as a preventive therapy of AKI in the clinical setting for cases of major surgery or transplantation.

Methods Cell culture HK2, an immortalized human renal proximal tubular cell line, was cultured in Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 Ham (Sigma-Aldrich, St Louis, MO, USA) supplemented with 10% fetal bovine serum (FBS). Primary normal 19

human renal proximal tubule epithelial cells (RPTECs) (Lonza, Valais, Switzerland) were cultured in Renalife medium (Lifeline Cell Technology, Walkersville, MD, USA). Cells were plated in 10-cm dishes or 6-well plates before the experiment and exposed to 10 uM enarodustat (Japan Tobacco Inc., Osaka, Japan) or dimethyl sulfoxide (DMSO) (Wako Pure Chemicals, Osaka, Japan) for the indicated duration. We applied 10 uM enarodustat because Hep3B cells produce similar amount of EPO with hypoxic stimulation with 10 uM enarodustat. As oxygen-glucose deprivation (OGD), the medium was changed to DMEM/Ham's F-12 (No Glucose) with L-glutamine and sodium pyruvate (Nacalai Tesque, Kyoto, Japan) without FBS, and the cells were put in an anoxic bag with Anaero Pack (Mitsubishi Gas Chemical Co. Inc., Tokyo, Japan) for the indicated duration. For rotenone/antimycin A exposure, 0.5 uM rotenone/antimycin A (Agilent Technologies, Santa Clara, CA, USA) was added to the glucose- and serum-free medium simultaneously with medium change. For inhibition experiences, 50 mM 2-deoxy-D-glucose (2-DG) or 2.5 µM 2-AAPA hydrate (Sigma-Aldrich) was added to the serum- or glucose-free medium just before the cells were put in the anoxic bags.

20

Animals Seven-week-old male Sprague-Dawley rats (CLEA Japan Inc., Tokyo, Japan) were used in this study. All the rats were maintained under standardized conditions (25°C, 50% humidity, 12-h light/dark cycle) with food and water available ad libitum. Enarodustat or vehicle was administered by oral gavage at a dose of 10 mg/kg from 3 days before the operation to the day of the operation. The rats underwent right nephrectomy and left kidney artery clamping for 45 min on a homeothermic table of 37

followed by

reperfusion under anesthesia with medetomidine hydrochloride, midazolam, and butorphanol tartrate via intraperitoneal injection. For the inhibition of glycogen utilization, 50 mg/kg N-methyl-1-deoxynojirimycin (MOR-14) resolved in normal saline was administered intravenously 10 minutes before clamping. Blood was obtained by tail vein puncture at 0 and 24 h after the operation or via cardiac puncture at sacrifice, and plasma creatinine was evaluated. The rats were sacrificed 48 h after the operation (vehicle n = 6, enarodustat n = 6, vehicle + MOR-14 n = 4, enarodustat + MOR-14 n = 5), and the kidneys were removed snap-frozen in liquid nitrogen for further evaluation. Sham-operated

rats

were anesthetized with

the same composition through

intraperitoneal injection and only underwent laparotomy (n = 4). 21

All the protocols for the animal experiments were approved by the Ethical Committee on Animal Experiments of the University of Tokyo (P18-044), and all animal experiments were conducted as per the guidelines established by the Committee on Ethical Animal Care and Use at the University of Tokyo.

Atg5 knockout cell Atg5

was

knocked

out

in

HK2

cells

using

the

CRISPR-Cas9

system.

pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid #42230, Cambridge, MA, USA)46. Atg5 target sgRNAs were applied from the precedent article47 and ligated into pX330 plasmid as per the procedures of the Zhang lab (http://www.genome-engineering.org/crispr). Sequences are listed in Table 1. HK2 cells were co-transfected with these plasmids and a zeocin resistant plasmid that facilitates selection with zeocin (400 µg/mL). Single-cell cloning was performed, and each colony exposed to amino acid depletion was analyzed with Western blotting for LC3 conversion. Cells without LC3 conversion with amino acid depletion were selected as Atg5 knockout cells.

22

siRNA transfection We used commercial siRNAs against the following targets; human HIF1α (HSS104774, HSS104775), HIF2α (HSS176568, HSS176569), PHD1 (HSS150806, HSS150807), PHD2

(HSS123076,

HSS182578),

PHD3

(HSS132641,

HSS174177),

GYS1

(HSS179129, HSS179130), PGM1 (HSS107905, HSS107906), GB1 (HSS104017, HSS104019) and a negative control siRNA (Cat. 12935112, all from Invitrogen, Carlsbad, CA, USA). These siRNAs were introduced into the HK2 cells using Lipofectamine RNAiMAX (Thermo Fisher Scientific, Rockford, IL, USA) as per the manufacturer’s instructions. Cells underwent OGD or rotenone/antimycin A exposure 48 h after transfection.

Analysis of cell count and viability, apoptosis, and ROS Cells were plated in 6-well plates, exposed to OGD or rotenone/antimycin A, harvested, and analyzed with the Muse cell analyzer (Millipore Sigma, Burlington, MA, USA) using a Muse count and viability kit, Annexin V staining, the Dead Cell Assay kit, and oxidative stress kit as per the manufacturer's instructions.

23

Glycogen, NADPH, and GSH assays The tissue or intracellular levels of glycogen were measured using the Glycogen Assay Kit II (Colorimetric) (ab169558, abcam, Cambridge, MA, USA) as per the manufacturer’s instructions. The intracellular levels of NADPH and total NADP as well as GSH and total glutathione were measured using the NADP/NADPH Quantification Colorimetric Kit (K347-100, BioVision, Mountain View, CA, USA) and the GSSG/GSH Quantification Kit (Dojindo Molecular Technologies Inc., Kumamoto, Japan) respectively, as per the manufacturer’s instructions.

Microarray analyses A microarray analysis of 3 groups (sham: 24-h DMSO pretreatment + 16 h in normal medium, ctrl: 24-h DMSO pretreatment + 16-h OGD, enarodustat: 24-h enarodustat pretreatment+ 16-h OGD, n = 3 for each group) of HK2 cells was conducted. Total cellular RNA was isolated using the GenElute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich). One hundred nanogram of total RNA was labeled using Low Input Quick Amp Labeling Kit (Agilent Technologies) and then hybridized to SurePrint G3 Human GE Microarray 8 × 60 K Ver 3.0 (Agilent Technologies). All the microarray 24

experiments were performed by DNA Chip Research Inc. (Tokyo, Japan). Raw data were processed with the R package limma in a bioconductor for background correction and data normalization using the quantile normalization method. The normalized data were statistically analyzed with the R package limma, employing a linear model fit and an empirical Bayes method. Genes with a false discovery rate < 0.0001 were considered significant. Differentially expressed genes (DEGs) were determined as significant genes that increased with the ctrl than the sham treatment and decreased with enarodustat than with ctrl treatment or that decreased with ctrl than with sham treatment and increased with enarodustat than with ctrl treatment. DEGs were used as an input for pathway enrichment analysis of Broad MSigDB - Canonical Pathways through BaseSpace Correlation Engine (Illumina, San Diego, CA, USA). Raw and normalized microarray data have been deposited in the NCBI Gene Expression Omnibus as series GSE130144.

Real-time quantitative PCR Cell RNA was isolated with RNAiso Plus (Takara Bio Inc., Shiga, Japan) and reverse transcribed using PrimeScript RT master mix (Takara Bio Inc.). PCR was performed on a CFX96 cycler CFX96 System (Bio-Rad Laboratories Inc., Hercules, CA, USA) with 25

THUNDERBIRD SYBR QPS-201 (Toyobo Co. Ltd., Osaka, Japan). The data were calibrated to the β-actin value. The primers are described in Table 1.

Glycolytic rate assay An XF96 extracellular flux analyzer (Agilent Technologies) was used to measure the glycolytic rate of live cells. 8.0 × 103 HK2 cells were seeded onto each well of an XF96 cell culture microplate and preincubated with 10 µM DMSO or enarodustat for 24 h in DMEM/F12 supplemented with 10% FBS. One hour before the assay, the medium was changed to a glucose free-XF base medium without phenol red (2.5 mM glutamine, 0.5 mM pyruvate, and 5.0 mM HEPES were added, and the pH was adjusted to 7.4 with 1 N NaOH). The glycolytic proton efflux rate (glycolytic PER) was assessed as per the manufacturer's instructions. Then, 0.5 uM rotenone/antimycin A was injected to each well during the assay.

Immunohistochemistry Formalin-fixed

paraffin-embedded

tissues

were

sectioned

at

3

µm

for

immunohistochemistry. Rabbit polyclonal anti-HIF1α antibody (1/2500, Cayman 26

Chemical Company. Ann Arbor, MI, USA) was used as the primary antibody. CSA II, biotin-free catalyzed amplification system (DAKO, Santa Clara, CA, USA) was employed and CSA II Rabbit Link (DAKO, Santa Clara, CA, USA) was used as the second antibody.

Histological evaluation The left kidneys were fixed with formalin, embedded in paraffin, and sectioned at 3 µm for HE staining. Fifteen fields of ×200 magnification including both cortex and outer stripe of outer medulla were randomly selected. Tubular injury in terms of tubular epithelial injury and debris accumulation was graded with a semi quantitative score from 0 to 4+: 0, denotes no abnormalities; 1+, changes affecting <25% of the sample; 2+, changes affecting 25 to 50% of the sample; 3+, changes affecting 50 to 75% of the sample; and 4+, changes affecting >75% of the sample. All evaluations were performed in a blinded manner and the average score was calculated. Formalin-fixed paraffin-embedded 10-µm sections were used for evaluating apoptosis with TdT In Situ Apoptosis Detection Kit-TACS Blue Label (4811-30-K, R

D systems, Minneapolis,

MN, USA) as per the manufacturer’s instructions. Fifteen fields of ×200 magnification 27

including both cortex and outer stripe of outer medulla were randomly selected and the number of TUNEL-positive cells of each field was counted.

Statistical analyses All the data are reported as mean ± standard error of mean and as individual values in the dot plots. The 2 groups were compared using independent sample t-test and multiple groups were compared using analysis of variance with the post hoc Bonferroni tests for pair-wise comparisons. For analyses of TUNEL positive cells and tubular injury scores, the Kruskal-Wallis test was used. A P value < 0.05 was considered statistically significant for all tests. JMP 13® software (SAS Institute Inc., Cary, NC, USA) was used for data analyses.

Disclosure The study was supported by the Grant-in-Aid for Scientific Research (B,C) from Japan Society for the Promotion of Science 18H02824 (M.N.) and 17K09688 (T.T.), the Grant-in-Aid for Scientific Research on Innovative Areas 26111003 (M.N.) and Biological and Pharmacological Research Laboratories, Central Pharmaceutical 28

Research Institute, Japan Tobacco Inc. M.N. has received honoraria, advisory fees, or research

funding

from

Kyowa-Hakko-Kirin,

Astellas,

GSK,

Daiichi-Sankyo,

Mitsubishi-Tanabe, JT, Boehringer Ingelheim, AstraZeneca, Chugai, Torii, Ono, Takeda, MSD, Otsuka and Dainippon-Sumitomo.

Supplementary Material Supplemental figure legends Table S1. Primers used in the supplemental experiments. Figure S1. GYS1 knock down abrogates the increase in glycolytic PER ratio by enarodustat. Glycolytic PER ratio of siNC or GYS1-knocked down HK2 cells pretreated with 10 uM DMSO or enarodustat for 24 h. *p < 0.05 siNC + enarodustat vs. siNC + DMSO group, #p < 0.05 siGYS1 + DMSO/enarodustat vs. siNC + DMSO group, $p < 0.05 siGYS1 + enarodustat vs. siNC + DMSO group, n = 10 in each group. Figure S2. siGYS1 transfection specifically decreases the level of GYS1 mRNA among those of glycogen synthesis-related enzymes. mRNA levels of glycogenesis- and glycogenolysis-related genes of GYS1-knocked 29

down HK2 cells. *p < 0.05 vs. siNC group, n = 3 in each group. Figure S3. PGM1 KD but not GB1 KD abrogates the cytoprotective effect of PHD inhibition. (A) The knockdown efficiency of siRNA for PGM1. *p < 0.05 vs. siNC group, n = 3 in each group. (B, C) Relative cell count and ROS level of GYS1-knocked down HK2 cells after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. siNC + DMSO group, #p < 0.05 vs. siNC + enarodustat group, n = 3 in each group. (D) The knockdown efficiency of siRNA for GB1. *p < 0.05 vs. siNC group, n = 3 in each group. (E, F) Relative cell count and ROS level of GYS1-knocked down HK2 cells after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. siNC + DMSO group, n = 3 in each group. Figure S4. GYS1 is also upregulated in the kidneys 28 and 52 hours after enarodustat administration. (A) mRNA levels of glycogenesis-related genes of the kidneys 28 h after the initiation of vehicle or enarodustat administration. *p < 0.05 vs. vehicle group, n = 3 in each group. (B) mRNA levels of glycogenesis-related genes of the kidneys 52 h after the 30

initiation of vehicle or enarodustat administration. n = 3 in each group. Figure S5. 2-DG does not affect the renoprotection by enarodustat against ischemia. (A) Representative HE- and TUNEL-stained pictures near arcuate veins of the sham, vehicle, or enarodustat-pretreated left kidneys. x200. (B) Plasma creatinine levels at 0, 24, and 48 h after ischemia. *p < 0.01 vs. vehicle group, n = 6 in each group except for the sham group (n = 4).

Supplementary Methods Inhibitory experiments with 2-DG in vivo For the inhibition of glycogen utilization, 500 mg/kg 2-DG resolved in normal saline was administered into the abdominal cavity at the time of laparotomy (vehicle n = 6, enarodustat n = 6, vehicle + 2-DG n = 6, enarodustat + 2-DG n = 6). All the other procedures are the same as described in the Animal section.

Supplementary information is available at Kidney International’s website.

31

Reference 1.

Chertow GM, Burdick E, Honour M, Bonventre J V, Bates DW. Acute Kidney

Injury, Mortality, Length of Stay, and Costs in Hospitalized Patients. J Am Soc Nephrol. 2005;16:3365-3370. 2.

Lameire NH, Bagga A, Cruz D, et al. Acute kidney injury: an increasing global

concern. Lancet. 2013;382:170-179. 3.

Heyman SN, Rosenberger C, Rosen S. Experimental ischemia–reperfusion:

biases and myths—the proximal vs. distal hypoxic tubular injury debate revisited. Kidney Int. 2010;77:9-16. 4.

Semenza GL. Oxygen sensing, hypoxia-inducible factors, and disease

pathophysiology. Annu Rev Pathol. 2014;9:47-71. 5.

Maxwell PH, Eckardt K-U. HIF prolyl hydroxylase inhibitors for the treatment

of renal anaemia and beyond. Nat Rev Nephrol. 2015;12:157-168. 6.

Nangaku M. Chronic hypoxia and tubulointerstitial injury: a final common

pathway to end-stage renal failure. J Am Soc Nephrol. 2006;17:17-25. 7.

Schödel J, Klanke B, Weidemann A, et al. HIF-Prolyl Hydroxylases in the Rat

Kidney. Am J Pathol. 2009;174:1663-1674. 32

8.

Sugahara M, Tanaka T, Nangaku M. Prolyl hydroxylase domain inhibitors as a

novel therapeutic approach against anemia in chronic kidney disease. Kidney Int. 2017;92:306-312. 9.

Hasegawa S, Tanaka T, Nangaku M. Hypoxia-inducible factor stabilizers for

treating anemia of chronic kidney disease. Curr Opin Nephrol Hypertens. 2018;27:331-338. 10.

Ogoshi Y, Matsui T, Mitani I, et al. Discovery of JTZ-951: A HIF Prolyl

Hydroxylase Inhibitor for the Treatment of Renal Anemia. ACS Med Chem Lett. 2017;8:1320-1325. 11.

Akizawa T, Nangaku M, Yamaguchi T, et al. A Placebo-Controlled,

Randomized Trial of Enarodustat in Patients with Chronic Kidney Disease Followed by Long-Term Trial. Am J Nephrol. 2019;49:165-174. 12.

Bernhardt WM, Câmpean V, Kany S, et al. Preconditional activation of

hypoxia-inducible factors ameliorates ischemic acute renal failure. J Am Soc Nephrol. 2006;17:1970-1978. 13.

Hill P, Shukla D, Tran MGB, et al. Inhibition of hypoxia inducible factor

hydroxylases protects against renal ischemia-reperfusion injury. J Am Soc Nephrol. 33

2008;19:39-46. 14.

Kapitsinou PP, Jaffe J, Michael M, et al. Preischemic targeting of HIF prolyl

hydroxylation inhibits fibrosis associated with acute kidney injury. Am J Physiol Physiol. 2012;302:F1172-F1179. 15.

Shizukuda Y, Mallet RT, Lee SC, Downey HF. Hypoxic preconditioning of

ischaemic

canine

myocardium.

Cardiovasc

Res.

1992;26:534-542.

http://www.ncbi.nlm.nih.gov/pubmed/1446323. Accessed August 23, 2018. 16.

Higgins DF, Kimura K, Bernhardt WM, et al. Hypoxia promotes fibrogenesis

in vivo via HIF-1 stimulation of epithelial-to-mesenchymal transition. J Clin Invest. 2007;117:3810-3820. 17.

Favaro E, Bensaad K, Chong MG, et al. Glucose Utilization via Glycogen

Phosphorylase Sustains Proliferation and Prevents Premature Senescence in Cancer Cells. Cell Metab. 2012;16:751-764. 18.

Pelletier J, Bellot G, Gounon P, Lacas-Gervais S, Pouysségur J, Mazure NM.

Glycogen Synthesis is Induced in Hypoxia by the Hypoxia-Inducible Factor and Promotes Cancer Cell Survival. Front Oncol. 2012;2:18. 19. 34

Shen G-M, Zhang F-L, Liu X-L, Zhang J-W. Hypoxia-inducible factor

1-mediated regulation of PPP1R3C promotes glycogen accumulation in human MCF-7 cells under hypoxia. FEBS Lett. 2010;584:4366-4372. 20.

Pescador N, Villar D, Cifuentes D, et al. Hypoxia Promotes Glycogen

Accumulation through Hypoxia Inducible Factor (HIF)-Mediated Induction of Glycogen Synthase 1. Tora L, ed. PLoS One. 2010;5:e9644. 21. Redox

Stegen S, van Gastel N, Eelen G, et al. HIF-1α Promotes Glutamine-Mediated Homeostasis

and

Glycogen-Dependent

Bioenergetics

to

Support

Postimplantation Bone Cell Survival. Cell Metab. 2016;23:265-279. 22.

Khandelwal RL, Zinman SM, Knull HR. The effect of streptozotocin-induced

diabetes on glycogen metabolism in rat kidney and its relationship to the liver system. Arch Biochem Biophys. 1979;197:310-316. 23.

Alsahli M, Gerich JE. Renal glucose metabolism in normal physiological

conditions and in diabetes. Diabetes Res Clin Pract. 2017;133:1-9. 24.

Li N, Yi F, Sundy CM, et al. Expression and actions of HIF

prolyl-4-hydroxylase in the rat kidneys. Am J Physiol Physiol. 2007;292:F207-F216. 25.

Mizushima N, Komatsu M. Autophagy: renovation of cells and tissues. Cell.

2011;147:728-741. 35

26.

Zhang H, Bosch-Marce M, Shimoda LA, et al. Mitochondrial Autophagy Is an

HIF-1-dependent Adaptive Metabolic Response to Hypoxia. J Biol Chem. 2008;283:10892-10903. 27.

Bellot G, Garcia-Medina R, Gounon P, et al. Hypoxia-Induced Autophagy Is

Mediated through Hypoxia-Inducible Factor Induction of BNIP3 and BNIP3L via Their BH3 Domains. Mol Cell Biol. 2009;29:2570-2581. 28.

Lenoir O, Tharaux P-L, Huber TB. Autophagy in kidney disease and aging:

lessons from rodent models. Kidney Int. 2016. 29.

Urakami K, Zangiacomi V, Yamaguchi K, Kusuhara M. Impact of

2-deoxy-D-glucose on the target metabolome profile of a human endometrial cancer cell line. Biomed Res. 2013;34:221-229. http://www.ncbi.nlm.nih.gov/pubmed/24190234. Accessed August 24, 2018. 30.

Zhao Y, Seefeldt T, Chen W, et al. Effects of glutathione reductase inhibition on

cellular thiol redox state and related systems. Arch Biochem Biophys. 2009;485:56-62. 31.

Sadhu SS, Callegari E, Zhao Y, Guan X, Seefeldt T. Evaluation of a

dithiocarbamate derivative as an inhibitor of human glutaredoxin-1. J Enzyme Inhib Med Chem. 2013;28:456-462. 36

32.

Fraisl P, Aragonés J, Carmeliet P. Inhibition of oxygen sensors as a therapeutic

strategy for ischaemic and

inflammatory disease.

Nat

Rev Drug Discov.

2009;8:139-152. 33.

Kapitsinou PP, Haase VH. Molecular mechanisms of ischemic preconditioning

in the kidney. Am J Physiol Physiol. 2015;309:F821-F834. 34.

Eckle T, Kohler D,

Lehmann R, El Kasmi KC, Eltzschig HK.

Hypoxia-Inducible Factor-1 Is Central to Cardioprotection: A New Paradigm for Ischemic Preconditioning. Circulation. 2008;118:166-175. 35.

Liu X, Sheng R, Qin Z. The neuroprotective mechanism of brain ischemic

preconditioning. Acta Pharmacol Sin. 2009;30:1071-1080. 36.

Bahlmann FH, Song R, Boehm SM, et al. Low-Dose Therapy With the

Long-Acting Erythropoietin Analogue Darbepoetin Alpha Persistently Activates Endothelial

Akt

and

Attenuates

Progressive

Organ

Failure.

Circulation.

2004;110:1006-1012. 37.

Kapitsinou PP, Sano H, Michael M, et al. Endothelial HIF-2 mediates

protection

and

recovery

2014;124:2396-2409. 37

from

ischemic

kidney

injury.

J

Clin

Invest.

38.

Kojima I, Tanaka T, Inagi R, et al. Protective Role of Hypoxia-Inducible

Factor-2 against Ischemic Damage and Oxidative Stress in the Kidney. J Am Soc Nephrol. 2007;18:1218-1226. 39.

Seagroves TN, Ryan HE, Lu H, et al. Transcription Factor HIF-1 Is a

Necessary Mediator of the Pasteur Effect in Mammalian Cells. Mol Cell Biol. 2001;21:3436-3444. 40.

Fukuda R, Zhang H, Kim J, Shimoda L, Dang C V., Semenza GL. HIF-1

Regulates Cytochrome Oxidase Subunits to Optimize Efficiency of Respiration in Hypoxic Cells. Cell. 2007;129:111-122. 41.

Kim J, Tchernyshyov I, Semenza GL, Dang C V. HIF-1-mediated expression of

pyruvate dehydrogenase kinase: A metabolic switch required for cellular adaptation to hypoxia. Cell Metab. 2006;3:177-185. 42.

Papandreou I, Cairns RA, Fontana L, Lim AL, Denko NC. HIF-1 mediates

adaptation to hypoxia by actively downregulating mitochondrial oxygen consumption. Cell Metab. 2006;3:187-197. 43.

Le A, Cooper CR, Gouw AM, et al. Inhibition of lactate dehydrogenase A

induces oxidative stress and inhibits tumor progression. Proc Natl Acad Sci U S A. 38

2010;107:2037-2042. 44.

Arai M, Minatoguchi S, Takemura G, et al. N-methyl-1-deoxynojirimycin

(MOR-14), an alpha-glucosidase inhibitor, markedly reduced infarct size in rabbit hearts. Circulation. 1998;97:1290-1297. 45.

Devalaraja-Narashimha K, Padanilam BJ. PARP-1 inhibits glycolysis in

ischemic kidneys. J Am Soc Nephrol. 2009;20:95-103. 46.

Cong L, Ran FA, Cox D, et al. Multiplex Genome Engineering Using

CRISPR/Cas Systems. Science (80- ). 2013;339:819-823. 47.

O’Prey J, Sakamaki J, Baudot AD, et al. Application of CRISPR/Cas9 to

Autophagy Research. In: Methods in Enzymology. Vol 588. ; 2017:79-108.

39

Acknowledgement The authors thank Kahoru Amitani (The University of Tokyo) for technical support. The study was supported by the Grant-in-Aid for Scientific Research (B, C) from Japan Society for the Promotion of Science 18H02824 (M.N.) and 17K09688 (T.T.), the Grant-in-Aid for Scientific Research on Innovative Areas 26111003 (M.N.). Enarodustat was kindly provided by Biological and Pharmacological Laboratories, Central Pharmaceutical Research Institute, Japan Tobacco Inc., Osaka, Japan.

40

Figure legends Table 1. Primers used in this study. Figure 1. PHD inhibition protects HK2 cells and reduces ROS in OGD model. (A) Representative MUSE analysis of the cell count of HK2 cells and the relative cell count of HK2 after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.01 vs. DMSO group, n = 6 in each group. (B) Representative MUSE analysis of Annexin V and dead cells of HK2 cells and percentages of apoptotic cell of HK2 after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.01 vs. DMSO group, n = 3 in each group. (C) Representative MUSE analysis of cell oxidative stress of HK2 cells and percentages of ROS positive cell after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.01 vs. DMSO group, n = 6 in each group. (D) The knockdown efficiency of siRNA for PHD1, PHD2, and PHD 3. *p < 0.05 vs. siNC group, n = 3 in each group. (E, F) Relative cell count and ROS level of PHD-knocked down HK2 cells after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.01 vs. siNC group, n = 41

3 in each group. Figure 2. PHD inhibitor protects RPTECs and reduces ROS in OGD model. (A) Representative MUSE analysis of the cell count and relative cell count as well as viability of RPTEC after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 48 h. *p < 0.05 vs. DMSO group, n = 3 in each group. (B) Representative MUSE analysis of cell oxidative stress of RPTEC and percentages of ROS positive cell of RPTEC after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 48 h. *p < 0.05 vs. DMSO group, n = 3 in each group. Figure 3. HIF mediates the cytoprotective effect of PHD inhibitor. (A) The knockdown efficiency of siRNA for HIF1 and HIF2. *p < 0.05 vs. siNC group, n = 3 in each group. (B) Relative cell count of HIF-knocked down HK2 cells after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. n = 4 in each group. (C) ROS level of HIF knockdown after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. n = 3 in each group.*p < 0.05 vs. siNC + DMSO group, #p < 0.05 vs. siNC + enarodustat group. 42

Figure 4. The top ten MsigDB-Canonical pathways that are prominently modulated via OGD and enarodustat pretreatment. Figure 5. Enarodustat increases glycogenesis and downstream cytoprotective products. (A) mRNA levels of glycogenesis- and glycogenolysis-related genes in HK2 cells after 10 uM DMSO or enarodustat exposure for 24 h. *p < 0.05 vs. DMSO group. (B) mRNA levels of glycogenesis- and glycogenolysis-related genes of HIF-knocked down HK2 cells after 10 uM DMSO or enarodustat exposure for 24 h. *p < 0.05 vs. siNC + DMSO group, #p < 0.05 vs. siNC + enarodustat group, n = 3 in each group. (C) glycogen level of HK2 cells after 0.1% O2 exposure for 0–5 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO group, n = 3 in each group. (D) glycogen level of RPTEC after 0.1% O2 exposure for 0–5 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 54 h. *p < 0.05 vs. DMSO group, n = 3 in each group. (E) NADP+/NADPH of HK2 cells after 0.1% O2 exposure for 12 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO/normoxia group, # p < 0.05 vs. DMSO/anoxia group, n = 3 in each group. (F) GSSG/GSH of HK2 cells after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or 43

enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO/normoxia group, #p < 0.05 vs. DMSO/anoxia group, n = 3 in each group. Figure 6. Enarodustat-induced glycogen storage protects cells against rotenone and antimycin A exposure, a mimic of the OGD model. (A) Representative MUSE analysis of the cell count of HK2 cells and percentages of cell viability after rotenone and antimycin A exposure for 8 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.01 vs. DMSO group, n = 3 in each group. (B) Representative MUSE analysis of cell oxidative stress of HK2 cells and percentages of ROS positive cell after rotenone and antimycin A exposure for 8 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.01 vs. DMSO group, n = 3 in each group. (C) Glycolytic PER ratio of HK2 cells pretreated with 10 uM DMSO or enarodustat for 24 h. *p < 0.05 vs. DMSO group, n = 5 in each group. Figure 7. Autophagy has no role in PHD inhibition-induced cytoprotection or ROS reduction in OGD. (A) Western blotting for LC3 conversion in wild type and Atg5 knockout HK2 cells. N: normal medium, AA-: amino acids-depleted medium. Figure 7. (B, C) Relative cell 44

count and ROS level of Atg5 knocked out HK2 cells after 0.1% O2 exposure with or without 50 mM 2DG for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO group, #p < 0.05 vs. Atg5 KO + DMSO group, n = 3 in each group. Figure 8. Inhibition of glycogenesis or glycogenolysis abrogates the cytoprotective effect of PHD inhibition. (A, B) Relative cell count and ROS level of HK2 cells after 0.1% O2 exposure with or without 50 mM 2DG for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO group, n = 3 in each group. (C) The knockdown efficiency of siRNA for GYS1. *p < 0.05 vs. siNC group, n = 3 in each group. (D, E) Relative cell count and ROS level of GYS1-knocked down HK2 cells after 0.1% O2 exposure for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO group, n = 3 in each group. Figure 9. Inhibition of GSH reduction abrogates the cytoprotective effect of PHD inhibition. (A, B) Relative cell count and ROS level of HK2 cells after 0.1% O2 exposure with or 45

without 2.5 uM 2-AAPA for 16 h in glucose- and serum-free medium with 10 uM DMSO or enarodustat pretreatment for 24 h. *p < 0.05 vs. DMSO group, #p < 0.05 vs. DMSO + 2-AAPA group, n = 3 in each group. Figure 10. PHD inhibition upregulates glycogenesis and protects the kidneys from ischemia. (A) Representative pictures of HIF1 immunohistochemistry. x200 (B) mRNA levels of glycogenesis-related genes of the kidneys 76 h after the initiation of vehicle or enarodustat administration. *p < 0.05 vs. vehicle group, n = 3 in each group. (C) Glycogen + glucose level in the removed right kidneys after 4 days of vehicle or enarodustat administration. *p < 0.05 vs. vehicle group, n = 6 in the vehicle group, n = 5 in the enarodustat group due to one intraoperative death. (D) Glycogen level in the removed right kidneys after 4 days of vehicle or enarodustat administration. *p < 0.05 vs. vehicle group, n = 6 in the vehicle group, n = 5 in the enarodustat group due to one intraoperative death. (E) Plasma creatinine levels at 0, 24, and 48 h after ischemia. *p < 0.01 vs. vehicle group, n = 6 in the vehicle and enarodustat groups, n=5 in the vehicle + MOR-14 group and n = 4 in the enarodustat + MOR-14 and sham group. (F) Representative HE- and TUNEL-stained pictures near arcuate veins of the left kidneys 46

in each group. x200. (G) Tubular injury score of each group. (H) Number of TUNEL positive cells per field of each group. Figure 11. PHD inhibition increases cell survival via glycogenesis. HIF enhances glycogen storage.℃ Glycogen produces NADPH that reduces GSSG into GSH, and ROS is scavenged by GSH. GPX: glutathione peroxidase, GR: glutathione reductase, OXPHOS: oxidative phosphorylation, PPP: pentose phosphate pathway, ROS: reactive oxygen species, TCA cycle: tricarboxylic acid cycle

47

Table 1

Gene

Use

Species

PGM1

RT-PCR

human

UGP2

GYS1

GB1

ATG5#1

ATG5#2

RT-PCR

RT-PCR

RT-PCR

gRNA

gRNA

human

human

human

human

human

Primers used in the study.

Sequence forward

AGCATTCCGTATTTCCAGCAG

reverse

GCCAGTTGGGGTCTCATACAAA

forward

CAGAGACCTCCAGAAGATTCG

reverse

GTTCAACACAGAAGATATGTTATCAGG

forward

CTGCAAGTTCCTGGCACAGA

reverse

TTGTAGAAGTCCACGGCACC

forward

GAAGACTGGAACATGGGCGA

reverse

TATCCCCAACCAATGCCTGA

forward

CACCGAACTTGTTTCACGCTATATC

reverse

AAACGATATAGCGTGAAACAAGTTC

forward

CACCGAAGAGTAAGTTATTTGACGT

reverse

AAACACGTCAAATAACTTACTCTTC