Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish

Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427– 439 www.elsevier.com/locate/jsbmb

Promoter characteristics of two cyp19 genes differentially expressed in the brain and ovary of teleost fish Anna Tchoudakova, Mitsuyo Kishida, Elizabeth Wood, Gloria V. Callard * Department of Biology, Boston Uni6ersity, 5 Cummington Street, Boston, MA 02215, USA Received 23 January 2001; accepted 25 July 2001

Abstract Teleost fish are characterized by exceptionally high levels of neural estrogen biosynthesis when compared with the brains of other vertebrates or to the ovaries of the same fish. Two P450arom mRNAs which derive from separate gene loci (cyp19a and cyp19b) are differentially expressed in brain (b  a) and ovary (a b) and have a different developmental program (b a) and estrogen upregulation (b only). A polymerase chain reaction (PCR)-based genomic walking strategy was used to isolate the 5%-flanking regions of the goldfish (Carassius auratus) cyp19 genes. Sequence analysis of the cyp19b gene 1.8 kb upstream of the transcription start site revealed a TATA box at nucleotide (nt) −30, two estrogen responsive elements (EREs; nt −351 and − 211) and a consensus binding site (NBRE) for nerve growth factor inducible-B protein (NGFI-B/Nur77) at − 286, which includes another ERE half-site. Also present were a sequence at nt −399 (CCCTCCT) required for neural specificity of the zebrafish GATA-2 gene, and 16 copies of an SRY/SOX binding motif. The 5%-flanking region ( 1.0 kb) of the cyp19a gene had TATA (nt − 48) and CAAT (nt − 71) boxes, a steroidogenic factor-1 (SF-1) binding site (nt −265), eight copies of the SRY/SOX motif, and two copies of a recognition site for binding the arylhydrocarbon receptor (AhR)/AhR nuclear translocator factor (ARNT) heterodimer. Both genes had elements previously identified in the brain specific exon I promoter of the mouse aromatase gene. Cyp19a- and -b/luciferase constructs showed basal promoter activity in aromatase-expressing rodent pituitary (GH3) cells, but differences (a b) did not reflect expression in fish pituitary in vivo (b  a), implying a lack of appropriate cell factors. Consistent with the onset of cyp19b expression in zebrafish embryos, microinjection of a green fluorescent protein (GFP) reporter plasmid into fertilized eggs revealed labeling in neural tissues at 30 – 48 h post-fertilization (hpf), most prominently in retinal ganglion cells (RGC) and axon-like projections to the optic tectum. Expression of a cyp19a/GFP reporter was not detectable up to 72 hpf. Tandem analysis of cyp19a and cyp19b promoters in living zebrafish embryos can be a useful approach for identifying cis-elements and cellular factors involved in the correct tissue-specific, spatial, temporal and estrogen regulated expression of aromatase genes during CNS and gonadal development. © 2001 Published by Elsevier Science Ltd. Keywords: Aromatase; Cyp19 ; Promoters; Brain; Ovary; Fish

1. Introduction It is well-established that estrogen has permanent, organizing effects on CNS development [1]. Although initial focus was on the perinatal period of brain sex differentiation and brain areas involved in reproduction and sex behavior, accumulating evidence points to a wider role for estrogen as a general neurotrophic factor in many different brain regions and life stages [2–5]. * Corresponding author. Tel.: + 1-617-353-8980; fax: +1-617-3532923. E-mail address: [email protected] (G.V. Callard).

Because access of circulating estrogen to target sites within the CNS may be limited by high levels of plasma estrogen binding protein or neural estrogen metabolizing or conjugating enzymes, the levels of estrogen required to activate certain neural responses are dependent on aromatization of androgen to estrogen in the brain itself (neuroestrogen). The ability of the brain to synthesize estrogen, and the importance of neuroestrogen in mediating androgen actions, is an ancient and evolutionarily conserved characteristic of vertebrates at all phylogenetic levels [6,7]. Whereas in mammals, brain aromatase (P450arom) activity is highest during the embryonic and neonatal period, and concen-

0960-0760/01/$ - see front matter © 2001 Published by Elsevier Science Ltd. PII: S0960-0760(01)00120-0

428

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

trated mainly in the preoptic area/hypothalamus (POA/ HTH), levels in corresponding areas in non-mammals are generally higher, even in adults, and activity is widely distributed throughout the CNS. Of all vertebrates investigated, teleost fish are exceptional in having the highest measured levels of P450arom enzyme and mRNA [8]. This feature has been technically advantageous for regulation and localization studies, and has generated novel insights. For example, identification of aromatase enzyme activity and immunolabeled cells and fibers in the goldfish retina and in specific neural and fiber layers of the optic tectum suggests that neuroestrogen has a regulatory function in the visual system [9,10]. Although published micrographs of aromatase immunolabeling in the brain of adult rats show only a few weakly labeled neurons in the lateral geniculate nucleus and visual cortex [11], possible involvement of neuroestrogen in visual processes in mammals may be more of a quantitative than a species difference. Interestingly, the visual system of teleost fish retains a remarkable potential for neurogenesis, synaptogenesis and functional neuroregeneration throughout life, properties that are generally limited to the embryonic and neonatal period in mammals. In humans, a single-copy cyp19 gene with multiple promoters and first exons is responsible for the tissuespecific expression and multifactorial regulation of a single P450arom enzyme protein [12]. By contrast, fish have at least two cyp19 genes with subdivided expression domains. In both goldfish [13,14] and zebrafish [15], cyp19b encodes the P450aromB isoform in the brain, retina and pituitary, tissues which express exceptionally high enzyme and mRNA levels, whereas cyp19a encodes the P450aromA isoform in the ovary, a tissue with only one-tenth of the aromatase activity of brain and correspondingly low levels of mRNA. Although Northern analysis is consistent with exclusive neural and non-neural expression of P450aromB and A-isoforms, respectively, reverse transcription-polymerase chain reaction (RT-PCR) analysis reveals a degree of overlapping expression. Superimposed on high constitutive levels of P450aromB mRNA and enzyme activity in the adult goldfish brain are \ 5-fold seasonal variations with a peak at spawning [14,16]. Cyclic changes can be mimicked in reproductively inactive or gonadectomized fish by treatment with estrogen or aromatizable androgen, whereas a non-aromatizable androgen (5a-dihydrotestosterone, DHT) is ineffective and an aromatase inhibitor (ATD) decreases expression [14]. We infer from these results that the product of aromatization (estrogen) is part of an autoregulatory positive feedback loop that drives ever-increasing levels of neural aromatase expression, and may be a component of the seasonal gonadotropin surge and spawning. Studies in zebrafish embryos show that the mechanisms responsible for high neural aromatase expression and

estrogen upregulation in adult goldfish are already in place from the earliest stages of development. Transcription of both cyp19 genes is first detected between 12 and 24 h post-fertilization (hpf), but P450aromB mRNA accumulates more rapidly and to higher relative levels than P450aromA during the subsequent embryonic and larval periods [15]. Moreover, addition of estradiol to embryo medium selectively advances and elevates accumulation of P450aromB (but not P450aromA) mRNA and the fold increase is similar to that in adult fish (2- to 5-fold) [15,17]. These results imply independent regulatory mechanisms and unique functions of cyp19 genes during major morphogenetic and differentiative events. We report here the cloning and structural characterization of the 5%-flanking regions of the two identified goldfish cyp19 genes. Additionally, using cyp19b and cyp19a promoters fused upstream from luciferase or green fluorescent protein (GFP) reporters, we have tested their basal transcriptional activities after transient transfection in rodent pituitary GH3 cells or microinjection into fertilized zebrafish eggs.

2. Materials and methods

2.1. Reagents Tissue culture reagents were obtained from Gibco/ BRL Life Technologies (Grand Island, NY). GH3 cells (derived from a rat pituitary somatotropin secreting tumor) were purchased from the American Type Culture Collection (Rockville, MD). All general reagents were purchased from Sigma Chemical Co. (St. Louis, MO), Fisher Scientific (Houston, TX), and Promega (Madison, WI). Custom oligonucleotides were purchased from Ransom Hill Bioscience, Inc. (Ramona, CA). DNA restriction and modifying enzymes, pGEMT Easy, pGL3-basic, pGL2-control, pRL-TK, and the Dual-Luciferase Reporter Assay System were acquired from Promega. pEGFP-1 vector was from Clontech (Palo Alto, CA). pBluescript and pBluescript II SK (− ) vectors were purchased from Stratagene (La Jolla, CA). 32P-radiolabeled nucleotides were from DuPont/ New England Nuclear Corp. (Boston, MA).

2.2. PCR cloning of goldfish cyp19 promoter sequences Goldfish were purchased from Grassyfork Fisheries (Martinsville, IN). Genomic DNA was isolated from 1 g of brain tissue (five fish) using the Stratagene DNA Extraction Kit. Cloning of the genomic sequences was done with the Universal GenomeWalker Kit (Clontech) according to the manufacturer’s protocol. Briefly, aliquots of genomic DNA (2.5 mg) were digested to produce blunt ends with 80 units of each of the follow-

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

ing restriction endonucleases, DraI; EcoRV; PvuII; ScaI; and StuI. Digested DNA aliquots were ligated separately to the GenomeWalker adaptor. Adaptor-ligated genomic DNA fragments were subjected to a primary PCR amplification with the outer adaptor primer (AP1) and an outer, gene-specific primer (GSP1). Aliquots (1 ml) of the 50-times diluted primary PCR reactions were used in the secondary PCR amplification with the nested adaptor primer (AP2) and a nested gene-specific primer (GSP2). Primers GSP-1A (5%CTGTTATGGGCTCCTTGCATCAGAAG3%) and GSP-2A (5%CAAGATGCACCTGCTTCATTCC3%), and primers GSP-1B (5%ACCTTGTGCACCTCTTTAGATCTGCATCCGCTTCA3%) and GSP-2B (5%GTGCTGTTCAGTAGCTCAGACTTGTCGTTTACATG3%) were designed using sequences of the 5%-ends of goldfish P450aromA and P450aromB cDNAs, respectively [13,14]. During primary PCR, DNA was subjected to seven cycles (94 °C, 25 s; 72 °C, 3 min) and 32 cycles (94 °C, 25 s; 67 °C, 3 min) followed by 7 min of final extension at 72 °C in a Perkin– Elmer DNA Thermal Cycler 480 (Perkin– Elmer Cetus, Norwalk, CT). Secondary PCR had the same parameters except amplification was allowed to proceed for 5 and 20 cycles. Advantage Tth Polymerase Mix (Clontech) was used for the PCR. Major PCR bands (A1 – A3, B1, and B2) were isolated from 1.5% agarose/ethidium bromide (EtBr) gels using the Geneclean III kit (BIO 101 Inc., Vista, CA), cloned into a T– A type pGEM-T Easy vector, and subjected to the dideoxynucleotide sequencing method using Sequenase (US Biochemical Corp., Cleveland, OH). Complete sequences were obtained using Sp6 and T7 vector primers followed by extension with synthetic nucleotides. Sequence analysis was performed using the WI Package Version 9.0, Genetics Computer Group (GCG), Madison, WI. Homology searches were carried out using Basic Blast version 2.0 (http://www.ncbi.nlm.nih.gov/BLAST/). Potential binding sites for transcription factors were identified using the Transcription Factor Database [18], Mat Inspector V2.2 (http://www.transfac.gbf.de/TRANSFAC/) [19], and by inspection for DNA sequences reported in other neuron specific and cyp19 genes.

2.3. Plasmid constructs The pLUC-B1 reporter plasmid was constructed by cloning of the ( − 1784/ +52) EcoRI fragment of the pGEM-B1 (treated with Klenow enzyme to form blunt ends) into the SmaI site of the pGL3-basic vector (pGL3-basic is a luciferase reporter vector without promoter and enhancer). The pLUC-A1 and pLUC-A3 plasmids were constructed as follows. The EcoRI/ HindIII fragments from the pGEM-A1 (−921/ − 5) and pGEM-A3 ( − 610/ −5) clones were inserted into pBluescript vector (Stratagene) digested with the same

429

restriction enzymes as above. The SacI/HindIII fragments of the latter plasmids were cloned into the pGL3basic vector utilizing SacI and HindIII sites. The sequence of each plasmid was verified by sequencing analysis. All plasmids used for transfections were purified on Qiagen ion exchange columns (Qiagen Inc., Valencia, CA). The pGL2-control luciferase reporter vector, which contains the SV40 promoter and enhancer, was used as a positive control. The GFP reporters were constructed as follows. For the putative brain promoter, the SacI/XhoI fragment of the pLUCB1 was first subcloned into pBluescript vector and then, using SacI and ApaI sites, was cloned into pEGFP-1 immediately upstream of the GFP-open reading frame (pGFP-B1). For the putative ovarian promoter, the SacI/HindIII fragment of the pLUC-A1 reporter plasmid was cloned directly into the pEGFP-1 vector (pGFP-A1).

2.4. Primer extension analysis Primer extension analysis of P450aromB mRNA was done as described by Boorstein and Craig [20]. Eight pmoles of 32P-end-labeled GSP-1B primer, located : 50 bp downstream from the 5% end of goldfish brainderived P450aromB cDNA, and 25 mg of total brain RNA or 50 mg of total ovarian RNA (negative control) were used. The reaction was performed in 1X RT buffer at 42 °C for 30 min. The primer-extended products were extracted with phenol–chloroform, precipitated with 2.5 vol ethanol and resuspended in formamide gel loading buffer. The products were analyzed on a 6% polyacrylamide gel containing 7 M urea and visualized by autoradiography. The same methods with P450aromA-specific primers and 50 mg total or 1–3 mg poly(A+ ) RNA from goldfish ovary did not succeed in identifying the transcription start site of the cyp19a gene.

2.5. Transcriptional analysis in GH3 cells GH3 cells were maintained in F-12K medium with 15% horse serum, 2.5% fetal calf serum, 100 U/ml penicillin, and 100 mg/ml of streptomycin. Cells were transfected using LipofectAMINE reagent according to the manufacturer’s protocol (Gibco/BRL). Briefly, cells were plated onto 12-well plates to 60–70% confluency and fed 24 h later. After an additional 24–48 h, transfection was carried out for 5 h at 37 °C in a final volume of 1 ml F-12K serum-free medium containing 12 mg LipofectAMINE and 1 mg of reporter plasmid DNA, together with 30 ng of pRL-TK plasmid as an internal control (pRL-TK contains the herpes simplex virus thymidine kinase promoter region upstream of Renilla luciferase). After transfection, 1 ml of F-12K

430

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

medium containing twice the normal concentration of serum was added and cells were incubated for a further 24 h. Then, cells were rinsed twice with PBS and lysed. Luciferase and Renilla luciferase activity of the cell lysates were measured using the Dual Luciferase Assay System and a Monolight 2010 Luminometer instrument (Analytical Luminescence Laboratory, Ann Arbor, MI). Luciferase activity was normalized for transfection efficiency using Renilla luciferase activity determined in the same cell lysate. The pGL-2 luciferase reporter vector, which contains the SV40 promoter and enhancer, was used as a positive control. Duplicate transfections were performed for each promoter construct and each experiment was performed two or three times.

2.6. Transcriptional analysis in zebrafish embryos Zebrafish were purchased from Ekk Will Waterlife Resources (Gibsonton, FL), and embryos obtained by natural spawning. Maintenance of breeders, the spawning protocol, collection of fertilized eggs and embryo culture were based on procedures of Westerfield [21] as previously described [15]. Embryos at the one to four cell stage (B 1.5 hpf) were microinjected with  4 nl of GFP reporter plasmid DNA (100 ng/ml 0.1 M KCl) using a disposable mTip (10 mm diameter) fitted to a Nanoliter Injector (World Precision Instruments, Sarasota, FL) as previously described [21]. Embryos were allowed to develop at 28.5 °C in embryo medium, which was replaced daily, and screened at intervals up to 72 hpf initially using an inverted epifluorescence microscope (Olympus IMT2, Melville, NY) with 20EY475-W22 excitation and IMT2-DMB dichroic mirror units. For detailed examination, fluorescent embryos were immobilized using 0.02% phenoxyethanol (Sigma), or fixed in 4% para-formaldehyde in phosphate buffered saline, and then positioned in 0.2% agarose in an optical chamber for viewing. They were examined under an Olympus Fluoview IX70 confocal microscope system with 488 nm excitation and 510– 550 nm bandpass filters. Serial optical sections were taken at 4 mm (10× objective, UPlanF1 10X-NA=0.3) or  2 mm intervals (20× objective, UPlanF1 20X-NA 0.5) and examined individually and as composite stacks of various sizes using the Fluoview software. Fig. 5 showing pseudocolored fluorescent images of GFP expressing cells and fibers in fixed embryos was generated using Fluoview, Image J and Adobe Photoshop software.

3. Results

3.1. Cloning and sequence analysis of the 5 %-flanking regions of the goldfish cyp19a and cyp19b genes To isolate the 5%-flanking regions of the cyp19 genes,

a PCR-based genomic walking strategy was applied using the Universal GenomeWalker Kit and gene-specific primers GSP-1B, GSP-2B and GSP-1A, GSP-2A. Two major bands, B1 ( : 1.9 kb) and B2 ( :0.85 kb), were obtained from the PvuII and ScaI libraries with the brain-derived GSP-B primers (Fig. 1), and three major PCR products, A1 (: 1.0 kb), A2 (: 0.7 kb), and A3 (:0.7 kb), were identified in the DraI and EcoRV libraries using the GSP-A primers (Fig. 2). Fig. 1 shows the sequence of the 5%-flanking regions of the cyp19b gene. Clone B1 was : 1000 bp longer than clone B2 but shared 93% identity with B2 in the region of overlap. Sequence analysis of clone B1 revealed a consensus TATA sequence at position −30 relative to the transcription start site, which was determined by primer-extension analysis (Fig. 3). Two estrogen response elements (EREs) were located at nt − 351 and − 280 and a consensus nerve growth factor inducible-B (NGFI-B/Nur77) binding site (NBRE), which includes another ERE half-site, was found at − 280. A DNA motif identical to one required for neuronal expression of the zebrafish GATA-2 gene (CCCTCCT) [22] was found 399 bp upstream of the transcription start site. Overlapping the TATA box at nt − 25 was an inverted CAAT box (ATTGG) that is similarly positioned in the Xenopus GATA-2 promoter where it is required for correct developmental programming after activation by a maternally derived factor [23]. Comparison of the 5%-flanking regions of the goldfish cyp19b with other cyp19 gene species revealed low overall percent sequence identities, in a range of 30%, and failed to detect a 55 bp sequence conserved upstream of brain specific exons of the mouse [24], human [25] and zebra finch [26] aromatase genes. However, a 28 bp sequence at nt −1724 in clone B1 had 71% identity when aligned with a sequence at −233 of the zebra finch brain specific exon 1a [26]. Also present in the goldfish B1 clone were core sequences found in transcriptionally active regions of the murine brain-specific exon I promoter, Arom-Aa region (TTAAT); Arom-Ab region (CCCCT) [24]. Sixteen copies of an element known to bind members of the SRY/SOX family of HMG-box transcription factors were identified in the B1 clone (six in inverted form, iSRY/SOX, see Fig. 1). Of the sites identified in cyp19b, eleven sequences were indicative of SRY binding exclusively and five had potential for either SRY or SOX binding. An overlapping series of two or three SRY or SRY/SOX elements were positioned, respectively, 545 and 144 bp upstream of transcription initiation. As compared with clone B1, the shorter B2 clone had several substitutions and insertions but agreed in most respects with potential binding elements, with three notable exceptions, a consensus C/EBP motif previously identified in the Arom B region of the mouse exon I promoter [24] at nt − 555 in an insertion of the

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

431

Fig. 1. Sequence alignment of the 5%-flanking regions of the goldfish cyp19b gene (clones B1 and B2). Gaps are indicated by dots. The locations of potential binding sites for specific transcription factors are shown in bold, and include two EREs and an NGFI-B/Nur77 protein binding site (NBRE) which contains an additional ERE half-site. A DNA motif reported to be essential for neuronal-specificity of the zebrafish GATA-2 gene (CCCTCCT, bold) has an overlapping inverted form of an ETS-like core motif (TCCT, underlined). Sequences found to be enhancers in the brain specific exon 1 promoter of mouse cyp19 (Aa, Ab, B), and potential binding sites for SRY and/or SOX and their inverted forms (iSRY/iSOX) are labeled and/or underlined (see Section 3). The TATA sequence (bold) and overlapping inverted CAAT box (ATTGG, underlined) reported to be essential for developmental programming of the GATA-2 gene in Xenopus are indicated. A 28 bp sequence with 71% identity to a region in the putative brain promoter of zebra finch is indicated by filled circles. The major transcription start site is shown by a right arrow. The 5%-end of the P450aromB cDNA is italicized.

432

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

B2 clone; an additional iSRY/iSOX motif in the same insertion; and two additional SRY motifs at nt −524 and −208. Sequence comparison of cyp19a clones demonstrated that all three shared regions of identity interrupted by areas that differed. Multiple sequence alignment (Fig.

2) indicates a long gap in the 5%-half of sequences A2 and A3 and short gaps in all sequences. Using the local homology algorithm of Smith and Waterman [27], the calculated percent identities indicated that clone A1 shared 91 and 85% identity with clones A2 and A3, respectively, and the three were virtually identical

Fig. 2. Sequence alignment of the 5%-flanking regions of the goldfish cyp19a gene(s) (clones A1 – A3). Gaps were introduced to improve alignment and are represented by dashes. Boxed sequences show regions of high sequence similarity among clones. The sequence of the 5%-end of the ovarian P450aromA cDNA is italicized. The putative translation initiation codon is shown with double underlining. The TATA and CAAT box sequences, and SF-1 binding site is shown in bold. Potential binding sites for the AhR/AhR nuclear translocation factor (ARNT) heterodimer and other DNA sequences of interest are labeled and underlined (see legend to Fig. 1 and Section 3). Numbering is relative to the 5%-most end of the ovary-derived P450aromA cDNA (italics).

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

within the 260-bp region immediately upstream of the 5%-end of the P450aromA cDNA. Although primer extension analysis did not succeed in identifying the transcription start site (possibly due to low mRNA abundance), two of the 5%-RACE clones derived from ovarian mRNA were identical (three others terminated prematurely). Thus, we have taken the beginning of the P450aromA cDNA as the putative transcription start site for numbering nucleotides in Fig. 2. Consensus sequences for TATA and CAAT boxes were localized 48 and 71 bp upstream from the beginning of the P450aromA cDNA in clones A1 and A2, but clone A3 lacked a consensus CAAT box due to a C– G substitu-

433

tion at position − 71. In addition, a consensus steroidogenic factor-1 (SF-1) sequence was found at position − 265 in clones A1 and A2, whereas clone A3 did not have this motif because of a deletion in this region. Although the A-clones lacked the ERE, NBRE and GATA-2 gene neuron-specific sequences which were present in the B-clones, core sequences identified in enhancer regions of the mouse brain-specific exon I promoter [24] were found as single or multiple copies in one or another of the A-clones but were not consistently found in all clones, Arom-Aa (TTAAT); AromAb (CCCCT); Arom-B (C/EBP). Also, the three A clones had four to eight copies of the SRY or SRY/ SOX motifs. A unique feature of the cyp19a promoter region was one or two copies of a recognition site for binding of the arylhydrocarbon receptor (AhR)/AhR nuclear translocator (ARNT) heterodimer.

3.2. Transcriptional acti6ity of the 5 %-flanking regions of goldfish cyp19 genes in rat pituitary GH3 cells

Fig. 3. Determination of the transcription initiation sites of the goldfish cyp19b gene. Total RNA from ovary (50 mg, lane 2) and brain (25 mg, lane 3) was used with the 32P-end-labeled GSP-1B primer. No RNA was added to control reactions (lane 1). The four lanes on the right show DNA sequencing —reaction products used as size markers. Three extended products were identified. The longest and most abundant product corresponded to an A residue located 13 bp upstream of the 5%-end of the brain derived P450aromB mRNA (arrowhead), whereas the other products corresponded to C and T residues 12 and ten residues, respectively, upstream of the 5%-end of the P450aromB cDNA [14].

Fig. 4. Basal transcriptional activity of the goldfish cyp19a and cyp19b promoters in rat pituitary GH3 cells. Cells were cotransfected with 1 mg of a luciferase reporter plasmid and 30 ng of the pRL-TK plasmid (internal standard) using LipofectAMINE reagent. Twentyfour hour after transfection, luciferase reporter activity of the cell extracts was determined and expressed as a ratio of the activity of the internal standard. The pGL2-C plasmid, bearing an SV40 promoter and enhancer, was used as a positive control. Data shown are the means of duplicate determinations and are representative of one or two independent experiments.

To study the basal transcriptional activity of the goldfish cyp19 promoters, the 5%-flanking regions were fused upstream of a luciferase reporter gene. Because both P450aromA and P450aromB mRNA are expressed in fish pituitary [13], a commonly used rat pituitary GH3 cell line was used as host cell despite much lower endogenous aromatase activity than fish pituitary [28]. As shown in Fig. 4, the positive control (pGL2-C) and all cyp19 reporter constructs exhibited transcriptional activity; however, pLUC-A1 was 8fold more active than pLUC-A3 and pLUC-B1.

3.3. Transcriptional acti6ity of the 5 %-flanking regions of goldfish cyp19 genes in zebrafish Living zebrafish embryos were used to assess transcriptional activity of GFP reporter constructs after microinjection into fertilized eggs. As compared with primary cell cultures or cell lines, this system has the advantage that reporter constructs can be tested simultaneously in all cell types of a whole vertebrate [22,29– 31]. The 5%-flanking regions were first subcloned into an EGFP reporter plasmid, and then microinjected into one to four cell stage embryos. Of approximately 100 fertilized eggs injected with pGFP-B1, 43 embryos survived and six of these exhibited fluorescence in cells of the forebrain and midbrain at 30 hpf as previously described [32]. At 48 hpf in lateral aspect (Fig. 5A, B, F and G), prominent labeling was seen as a complete or incomplete single or double halo surrounding the lens (L), and fibers or fiber clusters (arrows) extended from the center to the periphery of the optic cup. This labeling corresponded to the position of retinal ganglion cells (RGC), which are the first retinal neurons to differentiate and are immediately proximal to and en-

434 A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

Fig. 5. GFP expression in the 48 hpf zebrafish embryo injected with a cyp19b/GFP reporter plasmid. All micrographs are confocal composite images generated from a series of 4 mm optical sections of the head region of representative whole mounted specimens: plasmid injected (fish c G1, A– E; fish cG3, F– J); uninjected (fish c C1, K–O). Views shown are right lateral (A, F, K), left lateral (B, G, L), transverse (C, H, M, dorsal up), ventral (D, I, N), and dorsal (E, J, O). DI, diencephalon; FB, forebrain; HB, hindbrain; L, lens; LE, left eye; OT, optic tectum; RE, right eye; RGC, retinal ganglion cells; OV, otic vesicle; TEL, telencephalon; Y, yolk sac; single arrows, RGC projections within optic cup; double arrows, optic nerve/tract; arrowheads, projections to OT; asterisks, other labeled cells and fibers. Size bar = 100 mm (panel O). Pseudocolor fluorescence intensity bar (panel M) shows increasing fluorescence from green to red.

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

compass the medial aspect of the lens at this stage [33]. Inspection of individual images showed that the bright fluorescence in the center of the lens in Fig. 5B is due to RGC on its inner (medial) surface. Note that the thickest axonal clusters within the optic cup are ventral to the lens in the approximate position of the choroid fissure (Fig. 5B and F), and continue outside the posterior boundary of the optic cup as the optic nerve or tract (Fig. 5D and I; double arrows). In transverse and dorsal aspects, GFP expression was localized in RGC and processes and in fiber tracts of the telencephalon (TEL), consistent with the known trajectory of RGC projections to the optic tecta (OT) at 48 hpf [34]. Additional GFP-labeling (asterisks) was seen in cells or fibers dorsal to the optic cup (Fig. 5A, C and E); immediately ventral to the otic vesicle (OV; Fig. 5F and G); and in the dorsomedial region between the OT and hindbrain (HB; Fig. 5J). In a given fish, GFP expression was bilateral but not always of the same intensity (compare Fig. 5A and B, F and G). Likewise, although the pattern of labeling was similar in all GFP-expressing fish, the intensity of labeling varied between specimens. Autofluorescence was prominent in the yolk (Y) of plasmid injected and uninjected fish, and was sometimes sufficient to outline structures in controls (Fig. 5K – O). No GFP fluorescence was detected outside the CNS of fish injected with the cyp19b driven reporter (not shown). Of 100 fertilized eggs injected with pGFPA1, approximately 50 embryos survived but none displayed fluorescence up to 72 hpf, which may be due to a lower level of expression than the cyp19b gene product [15] or to the later organization of the gonad as compared with the brain and retina [21,35].

4. Discussion We report here the sequence characteristics and transcriptional activity of the promoter regions of the goldfish cyp19a and cyp19b genes. The isolated sequences show little identity between cyp19a and cyp19b genes. This confirms and extends results of cDNA, Southern blot and RT-PCR analysis of different tissues, which imply separate and unique promoters and regulatory mechanisms [13], and reinforces the conclusion that the two goldfish cyp19 loci arose by a duplication event early in evolutionary time. The similarity of the sequence and organization of the two cyp19b clones, together with our earlier study showing that the P450aromB cDNA probe detects only a single band on Southern blots [13], suggests there is only one cypl9b gene locus with allelic variability. By contrast, our finding that the three cyp19a clones have 10 –15% substitutions, and several large insertions/deletions, is consistent with the presence of multiple bands on Southern blots [13], and further indicates two or

435

more genes of the cyp19a type. Goldfish have twice the number of chromosomes of other cyprinid fishes, and both functional and non-functional allelic variants and duplicate gene loci are known for other goldfish gene families [36,37]. These are thought to be a consequence of an early genome duplication event in actinopterygian fish, and a second more recent tetraploidization of the goldfish lineage [36,37]. Primer extension analysis using brain RNA revealed a major transcription start site in the cyp19b gene 30 nt downstream of a TATA box, and two additional bands that could be due to allelic polymorphism. Most identified cyp19 promoters contain TATA boxes and a single transcription start site [12], but multiple sites were also found in the medaka fish cyp19 (ovary) gene [38]. A search for potential regulatory elements in the cyp19b gene promoter region revealed an ERE at nt −349 identical to the perfect palindrome in the Xenopus lae6is vitellogenin A2 gene [39]. Downstream of this ERE were a consensus NGFI-B/Nur77 binding site (NBRE) containing an ERE half-site and a second, variant ERE. Because neural aromatase activity and P450aromB mRNA are upregulated by estrogen in adult goldfish brain and zebrafish embryos (see Section 1), it is tempting to speculate that estrogen directly controls neural aromatase expression via the ERE’s in the cyp19b promoter. However, we cannot exclude the possibility that cyp19b expression can be modulated post-transcriptionally or indirectly by estrogen acting through other factors. Estrogen receptor (ER) binding activity and cDNAs of the ERa or ERb subtypes have been characterized in the brain of several fish species, including the goldfish [40], but P450arom- and ER-immunoreactivity have not yet been colocalized in the same cells, a necessary requirement for direct interaction of estrogen-ER complexes on the cypl9b promoter. As in fish, estrogen increases aromatase activity and mRNA in the avian brain [41], but no ERE’s were found within a 356 bp region upstream of the predominant brain exon 1a of the zebra finch [26]. Although upregulation of aromatase activity and mRNA in the adult mammalian brain is mediated primarily by androgen, estrogen treatment of perinatal rats induces a permanent increase in aromatizing potential [42,43]. A potential androgen responsive element was reported in the human brain-specific promoter region, but this element is not conserved in the mouse, nor has an ERE been recognized in either species [24,25]. Thus, androgen and estrogen effects on neural aromatase expression in mammalian brain must take place through other cells or transcription factors. The presence of a putative binding site for NGFI-B/ Nur77 (NBRE) in the goldfish cyp19b promoter region distinguishes it from its mammalian and avian counterparts and from the goldfish cyp19a gene. NGFI-B/ Nur77 is an orphan nuclear receptor belonging to the

436

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

Nor/Nurr1 subfamily and the first receptor shown to bind the NBRE as a monomer [44]. It can also form heterodimers with RXR and confer 9-cis-retinoic aciddependent transcription to reporter constructs containing the NBRE [45,46]. The NGFI-B/Nur77 gene was first identified as an immediate early gene product induced by NGF in PC12 cells [47]. It is predominantly expressed in brain, thymus, adrenal, and muscle in the adult rat [47] and has been implicated in neuronal differentiation [48], neuroendocrine regulation of adrenocortical functions [49], and T-cell apoptosis [50]. An NBRE present in the cyp21 gene mediates upregulation of 21-hydroxylase expression [51]. Together with reports that estrogen increases steady state mRNA levels of NGF and NGF receptors (TrkA/p53) in rodent brain [52,53], the presence of both NBRE and ERE motifs in the goldfish cyp19b promoter reinforces the view that neurotrophin and neuroestrogen pathways are convergent in the vertebrate CNS. Another element with possible involvement in neural expression of the goldfish cyp19b promoter is a DNA motif (CCCTCCT) upstream of the NBRE in the two B clones. This motif overlaps an inverted form of the core sequence of an ETS-like recognition site, which is functionally important in several neural genes, and identical to a motif required for neuronal expression of the zebrafish GATA-2 promoter [22]. Although the three elements identified as transcriptional enhancers within the proximal promoter of mouse exon I [24] are present in the goldfish cyp19b gene as well, it is unlikely that these DNA sequences per se can account for neuralspecific expression because they are also present in the goldfish cyp19a gene. Likewise, both goldfish cyp19 genes have multiple SRY and SRY/SOX binding sites. A single copy of an SRY-like motif has been described in the 5%-flanking regions of the brain- and ovary-specific exons in the zebra finch [26]. SRY is generally viewed as the testis-determining gene, but transcripts of SRY and other members of the HMG box-containing SOX subfamily of transcription factors are not limited to the gonadal ridge or early embryogenesis [54]. A number of SOX genes have been characterized in fish, and transcripts have a tissue distribution similar to aromatase (i.e. gonad, pituitary, brain) [55,56]. One of these (SOX-19) is expressed in the presumptive nervous system of gastrula stage zebrafish embryos (5– 10 hpf) [55], a timing that precedes the onset of cyp19b transcription at 12–24 hpf [15]. The idea that cyp19 is downstream of SRY in the sex-determining pathway was first proposed by Haqq [57]. Although functional competence of SRY binding sites in the fish aromatase genes is still untested, regulation of aromatase expression by SOX-type transcription factors in neural and gonadal tissues of embryonic and adult fish is consistent with experiments implicating estrogen in processes of gonadal sex determination, sex differentiation, and sex reversal in fish species [58].

The promoter regions of the goldfish cyp19a gene(s) differ in other respects from cyp19b. In addition to a TATA box, a putative CAAT box is located just upstream of the 5%-terminus, and an SF-1 binding site is present at about nt −250 in two of the three A clones. SF-1 is an important cis-element for expression of several steroidogenic enzymes in the gonads and adrenals [51,59], and has been implicated in the control of cAMP-induced P450arom expression in the human and rat ovary [60,61]. An SF-1 binding site is also seen in the 5%-flanking region of the zebra finch ovary specific exon [26], and in the medaka fish (ovary) gene, where it interacts in vitro with medaka SF-1 protein [38,62] and is thought to mediate gonadotropin-induced increases in aromatase during follicle maturation [63,64]. Similar to NGFI-B/Nur77, the SF-1 protein binds a hexanucleotide containing an ERE half-site, but requires a distinct nucleotide sequence 5% to the half-site [44]. Although lacking in promoter regions controlling brain aromatase expression in goldfish and zebra finch, a SF-1 site has been reported in the promoter involved in brain expression of the human aromatase gene [25]. Paradoxically, SF-1 null mice continue to have P450arom-expressing cells in the medial preopticoamygdaloid region [65]. Another distinguishing feature of the cyp19a promoter region when compared with cyp19b, is the presence of two recognition sequences for AhR/ARNT heterodimer binding. Xenobiotic response elements (XRE) have been identified in cytochrome P450 genes expressed in liver, where they regulate constitutive and toxin-inducible transcription [66]. A potential XRE in an aromatase gene promoter has not previously been described, but is consistent with reports that dioxin decreases aromatase mRNA in rat granulosa cells [67] and that environmental pollutants disrupt steroidogenesis and other reproductive parameters in natural fish populations [68]. Although the endogenous ligand and role of the AhR in normal ovarian physiology is not yet defined, AhR protein is abundant in murine granulosa cells and oocytes, and AhR null mice have a 2-fold higher number of primordial follicles [69]. Tandem analysis of the 5%-flanking regions of the two goldfish cyp19 genes leaves unresolved the molecular mechanism of high neural expression. There are at least two reports of ectopic aromatase expression or overexpression, one involving the skin of Sebright chickens [70], and a second, the mammary glands of BALB/c D2 mice [71]. In both cases, retroviral promoters were identified within the aromatase gene, but no sequences corresponding to known retroviral promoters were found in the present study. Moreover, when tested in transient transfection assays in GH3 cells, luciferase activity of the goldfish cyp19 -A1 genomic clone was much higher than the B1 clone, whereas in fish pituitary in vivo P450aromB mRNA is more than ten times

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

higher than P450aromA [13]. The lower activity of the cyp19 -A3 clone, as compared with A1, could be due to a deletion involving the putative SF-1 element, a substitution in the CAAT box, and several large upstream deletions. Although rodent GH3 cells are competent to express fish pituitary genes [29], and are similar to rodent hypothalamus in their level of endogenous aromatase activity, they have only one-tenth the activity of fish pituitary [28]. Our results suggest that high transcriptional activity is not intrinsic to the cyp19 gene promoter, and that rodent GH3 cells are lacking in the tissue-specific factors that activate high levels of expression in goldfish pituitary. This conclusion is reinforced by evidence showing that the cyp19 -B1 genomic clone has transcriptional activity in a suitable assay system. Microinjection of reporter constructs into fertilized zebrafish eggs has proven to be a useful method for identifying tissue-specific and developmentally programmed cis-elements and regulatory factors, especially for neural genes that require a normal three-dimensional cellular environment [22]. If the interval between mRNA and protein synthesis is taken into account, the onset of cyp19b driven GFP fluorescence in 30 hpf embryos, and the increase in number of labeled cells between 30 and 48 hpf, agrees with RT-PCR analysis showing that transcription of the endogenous cyp19b gene begins 12–24 hpf and increases 11-fold 24– 48 hpf [15]. Moreover, GFP labeling of embryonic RGC and axon-like projections to the optic tectum is consistent with immunolocalization of P450arom protein in the retina, optic nerve and tectum of adult goldfish [9,10]. Focus on the visual system, a phenotypically identified and experimentally accessible neural pathway, will enable us in future studies to address a possible role for cyp19b gene expression in neurogenesis, axonogenesis, and pathand target-finding in embryos, and as a component of the neuroplasticity and neuroregenerative potential of adult fish.

Acknowledgements This research was supported by grants from the National Science Foundation (IBN96-05053) and the National Institutes of Health (NIEHS P42 ES07381). A. Tchoudakova and E. Wood were supported by NIH predoctoral fellowships (2T32 HD073897). The authors are grateful to David Miller, NIEHS, for his invaluable guidance in confocal microscopy. The sequences reported here have been entered in GenBank with accession numbers AF324893, AF324894, AF324895, AF324896 and AF324897 for clones B1, B2, A1–A3, respectively.

437

References [1] N.J. Maclusky, F. Naftolin, Sexual differentiation of the central nervous system, Science 211 (4488) (1981) 1294 – 1302. [2] B.S. McEwen, Steroid hormone effects on brain: novel insights connecting cellular and molecular features on brain cells to behavior, Methods Neurosci. 22 (1994) 525 – 542. [3] C.S. Woolley, Estrogen-mediated structural and functional synaptic plasticity in the female rat hippocampus, Horm. Behav. 34 (1998) 140 – 148. [4] S.E. Shaywitz, B.A. Shaywitz, K.R. Pugh, R.K. Fulbright, P. Skudlarski, W.E. Mencl, R.T. Constable, F. Naftolin, S.F. Palter, K.E. Marchione, L. Katz, D.P. Shankweiler, J.M. Fletcher, C. Lacadie, M. Keltz, J.C. Gore, Effect of estrogen on brain activation patterns in postmenopausal women during working memory tasks, J. Am. Med. Assoc. 281 (13) (1999) 1197 –1202. [5] R.B. Gibbs, Impairment of basal forebrain cholinergic neurons associated with aging and long-term loss of ovarian function, Exp. Neurol. 151 (2) (1998) 289 – 302. [6] G. Callard, Androgen and estrogen actions in the vertebrate brain, Am. Zool. 23 (1983) 607 – 620. [7] G. Callard, Aromatization in brain and pituitary: an evolutionary perspective, in: F.M. Celotti, F. Naftolin (Eds.), Neuroendocrine Structures, Raven Press, New York, 1993, pp. 79 –102. [8] M. Pasmanik, G.V. Callard, Aromatase and 5 a-reductase in the teleost brain, spinal cord, and pituitary gland, Gen. Comp. Endocrinol. 60 (2) (1985) 244 – 251. [9] D. Gelinas, G.V. Callard, Immunocytochemical and biochemical evidence for aromatase in neurons of the retina, optic tectum and retinotectal pathways in goldfish, J. Neuroendocrinol. 5 (6) (1993) 635 – 641. [10] D. Gelinas, G.V. Callard, Immunolocalization of aromataseand androgen receptor-positive neurons in the goldfish brain, Gen. Comp. Endocrinol. 106 (2) (1997) 155 – 168. [11] M.K. Sanghera, E.R. Simpson, M.J. McPhaul, G. Kozlowski, A.J. Conley, E.D. Lephart, Immunocytochemical distribution of aromatase cytochrome P450 in the rat brain using peptide-generated polyclonal antibodies, Endocrinology 129 (6) (1991) 2834 – 2844. [12] E.R. Simpson, Y. Zhao, V.R. Agarwal, M.D. Michael, S.E. Bulun, M.M. Hinshelwood, S. Graham-Lorence, T. Sun, C.R. Fisher, K. Qin, C.R. Mendelson, Aromatase expression in health and disease, Recent Prog. Horm. Res. 52 (1997) 185 – 213. [13] A. Tchoudakova, G.V. Callard, Identification of multiple CYP19 genes encoding different cytochrome P450 aromatase isozymes in brain and ovary, Endocrinology 139 (4) (1998) 2179 – 2189. [14] D. Gelinas, G.A. Pitoc, G.V. Callard, Isolation of a goldfish brain cytochrome P450 aromatase cDNA: mRNA expression during the seasonal cycle and after steroid treatment, Mol. Cell. Endocrinol. 138 (1 – 2) (1998) 81 – 93. [15] M. Kishida, G.V. Callard, Distinct cytochrome P450 aromatase isoforms in zebrafish (Danio rerio) brain and ovary are differentially programmed and estrogen regulated during early development, Endocrinology 142 (2001) 740 – 750. [16] M. Pasmanik, G.V. Callard, Changes in brain aromatase and 5 a-reductase activities correlate significantly with seasonal reproductive cycles in goldfish (Carassius auratus), Endocrinology 122 (4) (1988) 1349 – 1356. [17] M. Kishida, M. McLellan, J.A. Miranda, G.V. Callard, Estrogen and xenoestrogens upregulate the brain aromatase isoform (P450aromB) and perturb markers of early development in zebrafish (Danio rerio), Comp. Biochem. Physiol. 129 (2001) 261 – 268. [18] D. Ghosh, A relational database of transcription factors, Nucleic Acids Res. 18 (7) (1990) 1749 – 1756.

438

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439

[19] E. Wingender, X. Chen, R. Hehl, H. Karas, I. Liebich, V. Matys, T. Meinhardt, M. Pruss, I. Reuter, F. Schacherer, TRANSFAC: an integrated system for gene expression regulation, Nucleic Acids Res. 28 (1) (2000) 316 – 319. [20] W.R. Boorstein, E.A. Craig, Primer extension analysis of RNA, Methods Enzymol. 180 (1989) 347 –369. [21] M. Westerfield, The Zebrafish Book: A guide for the Laboratory Use of Zebrafish (Danio rerio), University of Oregon Press, Eugene, OR, 1995. [22] A. Meng, H. Tang, B. Ong, M. Farrell, S. Lin, Promoter analysis in living zebrafish embryos identifies a cis-acting motif required for neuronal expression of GATA-2, Proc. Natl. Acad. Sci. USA 94 (1997) 6267 –6272. [23] R.L. Orford, C. Robinson, J.M. Haydon, R.K. Patient, M.J. Guille, The maternal CCAAT box transcription factor which controls GATA-2 expression is novel and developmentally regulated and contains a double-stranded-RNA-binding subunit, Mol. Cell. Biol. 18 (9) (1998) 5557 –5566. [24] S. Honda, N. Harada, S. Abe-Dohmae, Y. Takagi, Identification of cis-acting elements in the proximal promoter region for brain-specific exon 1 of the mouse aromatase gene, Brain Res. Mol. Brain Res. 66 (1 –2) (1999) 122 – 132. [25] S. Honda, N. Harada, Y. Takagi, Novel exon 1 of the aromatase gene specific for aromatase transcripts in human brain, Biochem. Biophys. Res. Commun. 198 (3) (1994) 1153 – 1160. [26] B. Ramachandran, B.A. Schlinger, A.P. Arnold, A.T. Campagnoni, Zebra finch aromatase gene expression is regulated in the brain through an alternate promoter, Gene 240 (1) (1999) 209 – 216. [27] T.F. Smith, M.S. Waterman, Identification of common molecular subsequences, J. Mol. Biol. 147 (1) (1981) 195 –197. [28] G.V. Callard, Z. Petro, A.H. Tashjian Jr, Identification of aromatase activity in rodent pituitary cell strains, Endocrinology 113 (1) (1983) 152 – 158. [29] F. Argenton, S. Vianello, S. Bernardini, P. Jacquemin, J. Martial, A. Belayew, L. Colombo, M. Bortolussi, The transcriptional regulation of the growth hormone gene is conserved in vertebrate evolution, Biochem. Biophys. Res. Commun. 192 (3) (1993) 1360 – 1366. [30] S. Lin, S. Yang, N. Hopkins, LacZ expression in germline transgenic zebrafish can be detected in living embryos, Dev. Biol. 161 (1) (1994) 77 – 83. [31] M. Westerfield, J. Wegner, B.G. Jegalian, E.M. Derobertis, A.W. Puschel, Specific activation of mammalian Hox promoters in mosaic transgenic zebrafish, Genes Dev. 6 (4) (1992) 591 – 598. [32] M. Kishida, A. Tchoudakova, D. Miller, G. Callard, Analysis of the goldfish (Carassius auratus) aromatase (P450arom) gene promoters by green fluorescent protein (gfp) expression in living zebrafish (Danio rerio) embryos, Bull. Mount Desert Island Biol. Lab. 38 (1999) 37 – 38. [33] E.A. Schmitt, J.E. Dowling, Early retinal development in the zebrafish, Danio rerio: light and electron microscopic analyses, J. Comp. Neurol. 404 (4) (1999) 515 –536. [34] J.D. Burrill, S.S. Easter Jr, The first retinal axons and their microenvironment in zebrafish: cryptic pioneers and the pretract, J. Neurosci. 15 (4) (1995) 2935 –2947. [35] C. Yoon, K. Kawakami, N. Hopkins, Zebrafish vasa homologue RNA is localized to the cleavage planes of 2- and 4-cell-stage embryos and is expressed in the primordial germ cells, Development 124 (16) (1997) 3157 –3165. [36] S. Ohno, Evolution by Gene Duplication, Springer, Berlin/New York, 1970, pp. 59 –88. [37] C. Risinger, D. Larhammar, Multiple loci for synapse protein SNAP-25 in the tetraploid goldfish, Proc. Natl. Acad. Sci. USA 90 (22) (1993) 10598 –10602. [38] M. Tanaka, S. Fukada, M. Matsuyama, Y. Nagahama, Structure and promoter analysis of the cytochrome P-450 aromatase

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48] [49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

gene of the teleost fish, medaka (Oryzias latipes), J. Biochem. (Tokyo) 117 (4) (1995) 719 – 725. L. Klein-Hitpass, G.U. Ryffel, E. Heitlinger, A.C. Cato, A 13 bp palindrome is a functional estrogen responsive element and interacts specifically with estrogen receptor, Nucleic Acids Res. 16 (2) (1988) 647 – 663. A. Tchoudakova, S.M. Pathak, G.V. Callard, Molecular cloning of an estrogen receptor b-subtype from the goldfish, Carassius auratus, Gen. Comp. Endocrinol. 113 (1999) 1 – 13. J. Balthazart, R. Stoop, A. Foidart, N. Harada, Synergistic control by androgens and estrogens of aromatase in the quail brain, Neuroreport 5 (14) (1994) 1729 – 1732. S.E. Abdelgadir, J.A. Resko, S.R. Ojeda, E.D. Lephart, M.J. McPhaul, C.E. Roselli, Androgens regulate aromatase cytochrome P450 messenger ribonucleic acid in rat brain, Endocrinology 135 (1) (1994) 395 – 401. C.E. Roselli, S.A. Klosterman, Sexual differentiation of aromatase activity in the rat brain: effects of perinatal steroid exposure, Endocrinology 139 (7) (1998) 3193 – 3201. T.E. Wilson, T.J. Fahrner, J. Milbrandt, The orphan receptors NGFI-B and steroidogenic factor 1 establish monomer binding as a third paradigm of nuclear receptor – DNA interaction, Mol. Cell. Biol. 13 (9) (1993) 5794 – 5804. D.J. Mangelsdorf, C. Thummel, M. Beato, P. Herrlich, G. Schutz, K. Umesono, B. Blumberg, P. Kastner, M. Mark, P. Chambon, et al., The nuclear receptor superfamily: the second decade, Cell 83 (6) (1995) 835 – 839. B.M. Forman, K. Umesono, J. Chen, R.M. Evans, Unique response pathways are established by allosteric interactions among nuclear hormone receptors, Cell 81 (4) (1995) 541 –550. M.A. Watson, J. Milbrandt, Expression of the nerve growth factor-regulated NGFI-A and NGFI-B genes in the developing rat, Development 110 (1) (1990) 173 – 183. J. Milbrandt, Nerve growth factor induces a gene homologous to the glucocorticoid receptor gene, Neuron 1 (3) (1988) 183 –188. I.J. Davis, L.F. Lau, Endocrine and neurogenic regulation of the orphan nuclear receptors Nur77 and Nurr-1 in the adrenal glands, Mol. Cell. Biol. 14 (5) (1994) 3469 – 3483. Z.G. Liu, S.W. Smith, K.A. McLaughlin, L.M. Schwartz, B.A. Osborne, Apoptotic signals delivered through the T-cell receptor of a T-cell hybrid require the immediate-early gene Nur77, Nature 367 (6460) (1994) 281 – 284. T.E. Wilson, A.R. Mouw, C.A. Weaver, J. Milbrandt, K.L. Parker, The orphan nuclear receptor NGFI-B regulates expression of the gene encoding steroid 21-hydroxylase, Mol. Cell. Biol. 13 (2) (1993) 861 – 868. F.J. Liuzzi, S.A. Scoville, S.M. Bufton, Effects of short-term estrogen replacement on trkA mRNA levels in axotomized dorsal root ganglion neurons, Exp. Neurol. 159 (2) (1999) 433 –440. H.E. Lara, G.A. Dissen, V. Leyton, A. Paredes, H. Fuenzalida, J.L. Fiedler, S.R. Ojeda, An increased intraovarian synthesis of nerve growth factor and its low affinity receptor is a principal component of steroid-induced polycystic ovary in the rat, Endocrinology 141 (3) (2000) 1059 – 1072. A. Mayer, G. Mosler, W. Just, C. Pilgrim, I. Reisert, Developmental profile of Sry transcripts in mouse brain, Neurogenetics 3 (1) (2000) 25 – 30. S. Vriz, C. Joly, H. Boulekbache, H. Condamine, Zygotic expression of the zebrafish Sox-19, an HMG box-containing gene, suggests an involvement in central nervous system development, Brain Res. Mol. Brain Res. 40 (2) (1996) 221 – 228. M. Ito, M. Ishikawa, S. Suzuki, N. Takamatsu, T. Shiba, A rainbow trout SRY-type gene expressed in pituitary glands, FEBS Lett. 377 (1) (1995) 37 – 40. C.M. Haqq, C.Y. King, P.K. Donahoe, M.A. Weiss, SRY recognizes conserved DNA sites in sex-specific promoters, Proc. Natl. Acad. Sci. USA 90 (3) (1993) 1097 – 1101.

A. Tchoudako6a et al. / Journal of Steroid Biochemistry & Molecular Biology 78 (2001) 427–439 [58] T. Kitano, K. Takamune, Y. Nagahama, S.I. Abe, Aromatase inhibitor and 17-a-methyltestosterone cause sex-reversal from genetical females to phenotypic males and suppression of P450 aromatase gene expression in Japanese flounder (Paralichthys oli6aceus), Mol. Reprod. Dev. 56 (1) (2000) 1 –5. [59] K. Morohashi, S. Honda, Y. Inomata, H. Handa, T. Omura, A common trans-acting factor, Ad4-binding protein, to the promoters of steroidogenic P-450s, J. Biol. Chem. 267 (25) (1992) 17913 – 17919. [60] J.P. Lynch, D.S. Lala, J.J. Peluso, W. Luo, K.L. Parker, B.A. White, Steroidogenic factor 1, an orphan nuclear receptor, regulates the expression of the rat aromatase gene in gonadal tissues, Mol. Endocrinol. 7 (6) (1993) 776 – 786. [61] M.D. Michael, M.W. Kilgore, K. Morohashi, E.R. Simpson, Ad4BP/SF-1 regulates cyclic AMP-induced transcription from the proximal promoter (PII) of the human aromatase P450 (CYP19) gene in the ovary, J. Biol. Chem. 270 (22) (1995) 13561 – 13566. [62] M. Watanabe, M. Tanaka, D. Kobayashi, Y. Yoshiura, Y. Oba, Y. Nagahama, Medaka (Oryzias latipes) FTZ-F1 potentially regulates the transcription of P-450 aromatase in ovarian follicles: cDNA cloning and functional characterization, Mol. Cell. Endocrinol. 149 (1 – 2) (1999) 221 –228. [63] N. Sakai, T. Iwamatsu, K. Yamauchi, Y. Nagahama, Development of the steroidogenic capacity of medaka (Oryzias latipes) ovarian follicles during vitellogenesis and oocyte maturation, Gen. Comp. Endocrinol. 66 (3) (1987) 333 –342. [64] S. Fukada, M. Tanaka, M. Matsuyama, D. Kobayashi, Y. Nagahama, Isolation, characterization, and expression of cDNAs encoding the medaka (Oryzias latipes) ovarian follicle cytochrome P-450 aromatase, Mol. Reprod. Dev. 45 (3) (1996) 285 –290. [65] K. Shinoda, H. Lei, H. Yoshii, M. Nomura, M. Nagano, H. Shiba, H. Sasaki, Y. Osawa, Y. Ninomiya, O. Niwa, et al., Developmen-

[66]

[67]

[68]

[69]

[70]

[71]

439

tal defects of the ventromedial hypothalamic nucleus and pituitary gonadotroph in the Ftz-F1 disrupted mice, Dev. Dyn. 204 (1) (1995) 22 – 29. J. Hapgood, S. Cuthill, P. Soderkvist, A. Wilhelmsson, I. Pongratz, R.H. Tukey, E.F. Johnson, J.A. Gustafsson, L. Poellinger, Liver cells contain constitutive DNase I-hypersensitive sites at the xenobiotic response elements 1 and 2 (XRE1 and -2) of the rat cytochrome P-450IA1 gene and a constitutive, nuclear XRE-binding factor that is distinct from the dioxin receptor, Mol. Cell. Biol. 11 (9) (1991) 4314 – 4323. A.K. Dasmahapatra, B.A. Wimpee, A.L. Trewin, C.F. Wimpee, J.K. Ghorai, R.J. Hutz, Demonstration of 2,3,7,8-tetrachlorodibenzo-p-dioxin attenuation of P450 steroidogenic enzyme mRNAs in rat granulosa cell in vitro by competitive reverse transcriptase-polymerase chain reaction assay, Mol. Cell. Endocrinol. 164 (1 – 2) (2000) 5 – 18. K.R. Munkittrick, M.E. McMaster, L.H. McCarthy, M.R. Servos, G.J. Van Der Kraak, An overview of recent studies on the potential of pulp-mill effluents to alter reproductive parameters in fish, J. Toxicol. Environ. Health 1 (4) (1998) 347 – 371. R. Robles, Y. Morita, K.K. Mann, G.I. Perez, S. Yang, T. Matikainen, D.H. Sherr, J.L. Tilly, The aryl hydrocarbon receptor, a basic helix-loop-helix transcription factor of the PAS gene family, is required for normal ovarian germ cell dynamics in the mouse, Endocrinology 141 (1) (2000) 450 – 453. M.J. McPhaul, M.A. Herbst, H. Matsumine, M. Young, E.D. Lephart, Diverse mechanisms of control of aromatase gene expression, J. Steroid Biochem. Mol. Biol. 44 (4 – 6) (1993) 341 – 346. V.R. Durgam, R.R. Tekmal, The nature and expression of int-5, a novel MMTV integration locus gene in carcinogen-induced mammary tumors, Cancer Lett. 87 (2) (1994) 179 – 186.