- Email: [email protected]
Prophylactic effect of physical exercise on Aβ1-40-induced depressive-like behavior and gut dysfunction in mice
Behavioural Brain Research 393 (2020) 112791
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Prophylactic effect of physical exercise on Aβ1-40-induced depressive-like behavior and gut dysfunction in mice
T
Julia M. Rosaa, Francis L. Pazinia, Anderson Camargoa, Ingrid A.V. Wolina, Gislaine Olescowiczb, Livia B. Eslabãoc, Oscar Bruna Romeroc, Elisa C. Winkelmann-Duarted, Ana Lúcia S. Rodriguesa,* a
Department of Biochemistry, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040-900, Brazil Department of Pharmacology, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040-900, Brazil c Department of Microbiology, Immunology and Parasitology, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040900, Brazil d Department of Morphological Sciences, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040-900, Brazil b
A R T I C LE I N FO
A B S T R A C T
Keywords: Alzheimer’s disease Amyloid β1-40 peptide Intestine Microbiota Physical exercise
Alzheimer's disease (AD) is a prevalent neurodegenerative disease that is highly comorbid with depression. Gut dysfunction has been proposed as a possible risk factor for both clinical conditions. In the present study, we investigated the ability of treadmill exercise for 4 weeks (5 days/week, 40 min/day) to counteract amyloid β1-40 peptide (Aβ1-40)-induced depressive-like behavior, alterations in morphological parameters of the duodenum, and the abundance of Firmicutes and Bacteroidetes phyla. Aβ1-40 administration (400 pmol/mouse, i.c.v.) increased immobility time in the tail suspension test (TST) and reduced time spent sniffing in the female urine sniffing test (FUST), indicating behavioral despair and impairment in reward-seeking behavior. These behavioral alterations, indicative of depressive-like behavior, were accompanied by reduced villus width in the duodenum. Moreover, photomicrographs obtained by transmission electron microscopy revealed abnormal epithelial microvilli in the duodenum from sedentary Aβ1-40-exposed mice, characterized by shorter microvilli and heterogeneity in the length of these structures that exhibit a disordered packing. Regarding the ultrastructure of Paneth cells, Aβ1-40 administration caused a reduction in the secretory granule diameter, as well as an enlarged peripheral halo. These animals also presented reduced Firmicutes and increased Bacteroidetes abundance, and increased Bacteroidetes/Firmicutes ratio. Most of the alterations observed in Aβ1-40-exposed mice were prevented by the practice of physical exercise. Altogether the results provide evidence of the prophylactic effect of physical exercise on Aβ1-40-induced depressive-like behavior and gut dysfunction in mice, suggesting that physical exercise could be useful for preventing depression associated with AD.
1. Introduction Alzheimer's disease (AD) is the most common form of dementia in elderly individuals and is the leading cause of disability in late life [1]. In addition, AD patients may exhibit depressive symptoms [2]. A metaanalysis study reported that depression is present in approximately 40 %–50 % of AD cases, resulting in increased institutionalization and mortality [3,4]. Although the major hallmark of AD is the presence of extracellular amyloid plaques in the brain, formed mainly from the amyloid-β (Aβ) peptide, several peripheral and systemic abnormalities could be associated with AD development. One aspect of particular interest is the crosstalk between the gut and central nervous system (CNS), and that dysfunction in microbiota-gut-brain axis may underlie
⁎
both AD and depression pathogenesis [5–7]. Therefore, the regulation of gut commensal microbiome that plays an essential role in protecting against infections, shaping and regulating immune responses, and maintaining host immune homeostasis [8] could be a promising therapy for both AD and depression [6]. Remarkably, current major challenges in depression associated with AD include the lack of effective treatments and few preventive strategies. Physical exercise has been proposed as a non-pharmacological strategy for both AD [9,10] and depression [11]. We have recently reported the prophylactic effect of treadmill physical exercise on Aβ140-induced depressive-like behavior in mice, an effect associated with modulation of hippocampal BDNF, mTOR signaling, and promotion of cell proliferation and survival of newly generated cells in the
Corresponding author. E-mail address: [email protected] (A.L. S. Rodrigues).
https://doi.org/10.1016/j.bbr.2020.112791 Received 20 December 2019; Received in revised form 23 June 2020; Accepted 23 June 2020 Available online 26 June 2020 0166-4328/ © 2020 Elsevier B.V. All rights reserved.
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
hippocampal dentate gyrus [12]. Of note, emerging evidence has indicated that adult hippocampal neurogenesis may be influenced by microbiome [13]. In addition, physical exercise has been reported to modify the composition of gut microbiota in humans and rodents [14,15]. Considering this background, the present study investigated the possible beneficial effects of physical exercise on alterations induced by the administration of Aβ1-40 on: a) behavioral parameters related to depression assessed in the tail suspension test (TST) and female urine sniffing test (FUST); b) morphological parameters assessed by Hematoxylin and Eosin (H&E) staining and by transmission electron microscopy in the duodenum; c) enrichment of bacteria from Firmicutes and Bacteroidetes phyla in the fecal content.
(Fig. 1). Animals in the exercised groups were subjected to a 4-week period of treadmill exercise consisting of 5 running sessions per week (Monday to Friday) on a treadmill apparatus (Insight®, Ribeirão Preto, SP, Brazil). Each running session lasted 40 min/day. The treadmill speed was progressively increased by 2 m/min/week, starting at 6 m/ min at the beginning of the protocol. Treadmill running was scheduled between 1 p.m. and 3 p.m. Mice in the control (sedentary) groups were placed on a locked treadmill for the same period of time [12]. 2.4. Tail suspension test (TST) The duration of immobility in the TST was registered according to the method described by Steru et al. (1985) [20]. Mice were suspended by the tail with adhesive tape 50 cm from the floor and the immobility time was recorded in a 6-min session by an observer blind to the experimental groups. Mice were considered immobile only when they hung passively and completely motionless.
2. Materials and methods 2.1. Animals
2.5. Open field test
Male Swiss mice (30–40 g, 45–55 days) were housed in groups of 10 animals per plastic cage (41 × 34 × 16 cm) under controlled temperature (21 ± 1 °C) and humidity (50 ± 20 %) with a 12:12 h light/ dark cycle (lights on at 7:00 a.m.). Mice were allowed free access to standard laboratory food and tap water, and to adapt to the laboratory for at least 1 week before the onset of the experimental protocol. All manipulations were carried out between 1 p.m. and 5 p.m., with each animal used only once. All procedures were performed in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and were approved by the Ethics Committee of the Institution. All efforts were made to minimize animal suffering and to reduce the number of animals used in the experiments.
In order to rule out the interference of alterations in overall locomotor activity in the TST, mice were evaluated in the open-field test as previously described [12]. Mice were individually placed in a wooden box (40 × 60 × 50 cm) with the floor divided into 12 equal rectangles. The number of crossings was recorded during a 6-min period. 2.6. Female urine sniffing test (FUST) In the FUST paradigm, reward-seeking behavior was evaluated. One hour before the test, mice were habituated to a sterile cotton-tipped applicator inserted into their home cage. The test had three phases: a) one exposure (3 min) to the cotton tip dipped in water; b) an interval of 45 min during which no cotton tip was presented to the animal; and c) one exposure (3 min) to a cotton tip applicator infused with fresh urine collected from females of the same strain in estrus, during which sniffing duration was measured [21].
2.2. Drugs and treatment Aβ1-40 (Sigma Chemical Company, St Louis, MO, USA) was dissolved in sterile phosphate-buffered saline (PBS; pH 7.4) and incubated at 37 °C for four days to induce aggregation. Aβ1-40 (3 μl) was administered by intracerebroventricular (i.c.v.) route at a dose previously reported to be effective to induce depressive-like behavior (400 pmol per mouse) [12,16]. Mice were lightly anesthetized with isoflurane (2.5 %; Abbot Laboratórios do Brasil Ltda., Rio de Janeiro, RJ, Brazil) before i.c.v. administrations, which were carried out using a freehand method described previously [17]. and standardized by our group [12,16,18]. Briefly, a 0.4 mm external diameter hypodermic needle attached to a cannula linked to a 25 μl Hamilton syringe was inserted perpendicularly through the skull of each mouse. Aβ1-40 or vehicle (PBS) was injected directly into the left lateral ventricle, at the following coordinates from bregma: anterioposterior (AP) 0.1 mm; mediolateral (ML) 1 mm; and dorsoventral (DV) 3 mm. Aβ1-40 and vehicle were administered ten days before behavioral tests [12,16,19]. After i.c.v. injections, mice underwent 48 h of interval before proceeding the treadmill running protocol.
2.7. Hematoxylin and eosin (H&E) staining Mice were anesthetized with pentobarbital (50 mg/kg, i.p.) and transcardially perfused with 0.9 % sodium chloride (NaCl) followed by 4% paraformaldehyde (PFA). The duodenum was dissected and approximately 5 cm segment was collected, fixed in 4% paraformaldehyde, and embedded in paraffin. Sections (5 μm) were cut from the paraffin blocks using a Leica RM2255 rotary microtome (Leica Biosystems Nussloch, Heidelberger Straße, Germany). Sections were then stained with hematoxylin and eosin (H&E) using the Leica ST5010 Autostainer XL (Leica Biosystems Nussloch, Heidelberger Straße, Germany) blotting system with standard protocols. Slides were mounted using a synthetic resin (Entellan; Merck, Germany). The analyses were performed on images from the Axion Scan slide scanner (ZEISS International, Oberkochen, Germany). The height and width of 5 villi were measured per each segment. Goblet cells were counted in 5 villi and Paneth cells were counted in 5 crypts. The crypt depth was measured from the crypt-villus junction to the base in 5 samples.
2.3. Physical exercise protocol Animals were randomly assigned into four groups: 1- sedentary; 2treadmill exercise; 3- sedentary/Aβ1-40; 4- treadmill exercise/Aβ1-40
Fig. 1. Experimental timeline. For all experiments, mice in the exercise groups were submitted to 4 weeks of treadmill running (5 days/week, 40 min/day). Eighteen days following the onset of the exercise protocol mice received i.c.v. injections of either Aβ1-40 peptide (400 pmol) or vehicle. Twenty-four hours after the last day of exercise, mice were submitted to behavioral testing (TST, FUST and OFT) and subsequently sacrificed by transcardial perfusion for intestine dissection and feces collection for histological and quantitative real-time PCR (RT-qPCR) microbiological analyses of fecal content. 2
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
2.8. Transmission electron microscopy of Paneth cells After transcardial perfusion, a duodenal segment (2 cm) was taken from two mice per group. The duodenal segments were fixed for 24 h in 2.5 % glutaraldehyde in 0.1 M phosphate-buffered saline (PBS) pH 7.4 and post-fixed for 1 h in 2% osmium tetroxide solution in phosphate buffer pH 7.4 (1:1). Samples were washed with PBS followed by water (10 min each wash). Subsequently, samples were dehydrated in graded acetone series and then embedded in Spurr's resin (EMS, Hatfield, PA, USA). Ultrathin sections (70 nm) were made in an ultramicrotome (Leica, Reicheit Ultracut S, Vienna, Austria) and contrasted using uranyl acetate and lead citrate. The photomicrographs were made in a transmission electron microscope JEM 1011 (JEOL, Tokyo, Japan) at 80 kV. 2.9. Fecal sample collection, DNA extraction, and quantitative real-time PCR Fecal samples were collected from the colon into sterile tubes, which were immediately snap-frozen in liquid nitrogen and subsequently transferred to −80 °C prior to DNA extraction. The fecal sampling was carried out immediately after the behavioral tests. Microbial genomic DNA was extracted from each fecal sample using a FastDNA™ Spin Kit (MP Biomedicals, Santa Ana, CA, USA) according to the manufacturer’s recommendation. Amplification conditions were 50 °C for 2 min, 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s and 60 °C for 90 s. The primers used were designed with Primer Express software version 3.0 (Applied Biosystems, USA): Total bacteria: forward (ACTCCTACGGGAGGCAGCAG) and reverse (ATTACCGCGGCTCTGG) primers; Firmicutes: forward (GCAGTAGGGAATCTTCCG) and reverse ( ATTACCGCGGCTGCTGG) primers; Bacteroidetes: forward (GTACTGA GACACGGACCA) and reverse (ATTACCGCGGCTCTGG) primers (Invitrogen, USA). Quantitative real-time PCR assays of 16S ribosomal RNA (rRNA) gene were performed by using the method of Fierer et al. [22]. Results were analyzed by the software Sequence Detection Systems (SDS) version 2.4 software (Applied Biosystems, CA, USA). Primer efficiency was tested using the standard curve method. 2.10. Statistical analyses The Kolmogorov–Smirnov test was used to assess data normality and Levene’s test for analysis of homogeneity of variances. Data are normally distributed and have equal variances (data not shown). Data are presented as mean ± standard error of the mean (SEM). Differences among experimental groups were determined by two-way analysis of variance (ANOVA) followed by Duncan’s multiple range post hoc test, when appropriate. A value of p < 0.05 was considered statistically significant.
Fig. 2. Effects of treadmill running on Aβ1-40-induced depressive-like behavior as assessed in the TST and FUST. Effects of Aβ1-40 administration and/or physical exercise on immobility time (A) in the TST, time spent sniffing in FUST paradigm (B) and on the number of crossings in the OFT (C) (n = 8 animals/ group). Bars represent mean + S.E.M. **p < 0.01 as compared with vehicletreated group; ##p < 0.01 as compared with sedentary Aβ1-40-exposed group; @@ p < 0.01 between Aβ1-40-treated mice compared with their vehicle-treated counterparts (i.e., significant main effect of Aβ1-40 administration); $$ p < 0.01 as compared with sedentary mice (i.e., significant main effect of exercise). Twoway ANOVA followed by Duncan’s multiple range test.
3. Results 3.1. Effect of treadmill exercise and/or Aβ1-40 administration in the TST and FUST Fig. 2A shows that exposure to Aβ1-40 significantly increased immobility time in the TST as compared to vehicle administration. Moreover, the treadmill running (4 weeks, 40 min/day) reduced the immobility time in the TST both in vehicle- and Aβ1-40-treated mice (Aβ1–40 treatment: F1,24 = 30.55, p < 0.01; exercise: F1,24 = 122.97, p < 0.01; Aβ1-40 administration x exercise: F1,24 = 12.82, p < 0.01). Fig. 2B shows the effects of treadmill exercise (4 weeks, 40 min/day) and/or Aβ1-40 peptide administration in the FUST. A two-way ANOVA revealed a significant main effect for Aβ1-40 peptide administration (F1,24 = 46.53, p < 0.01) in the FUST, with Aβ1-40-exposed mice showing a significant reduction in the time spent sniffing (p < 0.01). Likewise, two-way ANOVA revealed a significant main effect for
treadmill exercise (F1,24 = 210.87, p < 0.01), with mice subjected to exercise protocol presenting an increase in the time spent sniffing in the FUST (p < 0.01). However, two-way ANOVA revealed no significant differences for Aβ1-40 administration x treadmill exercise interaction (F1,24 = 1.47, p=0.23) in the FUST. As indicated in Fig. 2C, administration of Aβ1-40 and/or exercise had no significant effect on overall locomotor activity in the OFT (Aβ1-40 treatment: F1,24 = 0.01, p=0.97]; exercise: F1,24 = 1.71, p=0.20; Aβ1-40 administration exercise: F1,24 = 3
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Fig. 3. Effects of treadmill running and Aβ1-40 administration on morphological parameters of duodenum. Representative images of H&E staining of duodenum (A), villus length (B), villus width (C), number of goblet cells/villus (D) number of Paneth cell/crypt (E) and crypt depth (F). (n = 5 animals/group). Bars represent mean + S.E.M. **p < 0.01 as compared with vehicle-treated group; ##p < 0.01 as compared with sedentary Aβ1-40-exposed group. @ p < 0.05 and @@ p < 0.01 between Aβ1-40-treated mice compared with their vehicle-treated counterparts (i.e., significant main effect of Aβ1-40 administration); $$ p < 0.01 as compared with sedentary mice (i.e., significant main effect of exercise). Two-way ANOVA followed by Duncan’s multiple range test. Arrows show duodenal crypt and circle shows a goblet cell. Images were taken with a magnification of either 20× (scale bar =100 μm) or 40× (scale bar =50 μm; inset).
2.33, p=0.14).
administration on morphological parameters of duodenum assessed by H&E staining. A two-way ANOVA revealed a significant main effect for treadmill exercise (F1,16 = 56.68, p < 0.01) in the villous height (Fig. 3B), with mice subjected to exercise protocol showing higher villous height when compared to sedentary mice regardless of the administration with vehicle or Aβ1-40 (p < 0.01). However, two-way
3.2. Effect of treadmill exercise and/or Aβ1-40 administration on morphological parameters of the duodenum Fig. 3 depicts the effects of treadmill exercise and Aβ1-40 4
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Furthermore, exercised mice not exposed to Aβ1-40 also presented an enlarged peripheral halo, as compared to the sedentary group.
ANOVA revealed no significant differences for Aβ1-40 administration (F1,16 = 0.78, p=0.36) and Aβ1-40 administration x exercise interaction (F1,16 = 5.43, p=0.05) in the villous height. Regarding of villus width (Fig. 3C), a two-way ANOVA revealed a significant main effect for Aβ140 administration (F1,16 = 15.10, p < 0.01), with mice exposed to Aβ140 showing a reduction in the villus width when compared with vehicletreated mice (p < 0.01). Moreover, a significant main effect of treadmill exercise (F1,16 = 66.04, p < 0.01) was observed, with exercised mice presenting wider villus when compared to sedentary groups (p < 0.01). However, two-way ANOVA revealed no significant differences for Aβ140 administration x treadmill exercise interaction (F1,16 = 1.81, p = 0.19) in the villus width. Additionally, two-way ANOVA indicated a main effect for Aβ1-40 peptide administration (F1,16 = 5.49, p < 0.05) in the number of goblet cells (Fig. 3D), with Aβ1-40 -induced mice showing a reduction in the number of goblet cells when compared with vehicle-treated mice (p < 0.05). A significant main effect of treadmill exercise (F1,16 = 43.85, p < 0.01) was also observed, with mice subjected to treadmill running protocol presenting an increase in the number of goblet cells when compared with sedentary groups regardless of the administration with vehicle or Aβ1-40 (p < 0.01). However, two-way ANOVA revealed no significant differences for Aβ1-40 administration x treadmill exercise interaction (F1,16 = 0.08, p = 0.77). Fig. 3E indicates that mice subjected to the physical exercise protocol presented a higher number of Paneth cells/crypt in comparison with the control group (p < 0.01). Aβ1-40 administration showed a trend (p = 0.09) to decrease the number of these cells as compared to the control group. Conversely, Aβ1-40-exposed mice subjected to physical exercise presented a higher number of Paneth cells as compared to Aβ1-40-sedentary mice (Aβ1-40 administration: F1,16 = 0.07, p = 0.79; exercise: F1,16 = 191.86, p < 0.01; Aβ1-40 administration x exercise: F1,16 = 5.10, p < 0.05). Concerning the crypt depth (Fig. 3F), two-way ANOVA revealed a significant main effect of Aβ1-40 administration (F1,16 = 5.40, p < 0.05), with mice exposed to Aβ1-40 administration showing a decrease in the crypt depth when compared with vehicle-treated mice (p < 0.05). A significant main effect of treadmill exercise (F1,16 = 18.17, p < 0.01) was also observed, with exercised mice presenting an increase in the crypt depth when compared with sedentary groups (p < 0.01). However, two-way ANOVA indicated no significant differences for Aβ1-40 administration x exercise interaction (F1,16 = 0.09, p = 0.76) in the crypt depth.
3.5. Effect of treadmill exercise and/or Aβ1-40 administration in the enrichment of bacteria from Firmicutes and Bacteroidetes phyla Fig. 6A shows no differences in the total number of bacteria regardless of the treatments (Aβ1-40 administration: F1,15 = 0.18, p=0.67; exercise: F1,15 = 0.22, p=0.64; Aβ1-40 administration x exercise: F1,15 = 0.43, p=0.52). Concerning the abundance of Firmicutes phylum (Fig. 6B), two-way ANOVA revealed a significant main effect of Aβ1-40 administration (F1,16 = 5.86, p < 0.05), with mice exposed to Aβ1-40 administration showing a reduction in the abundance of Firmicutes phylum when compared with vehicle-treated mice (p < 0.05). A significant main effect of treadmill exercise (F1,16 = 46.16, p < 0.01) was also observed, with exercised mice presenting an increase in the abundance of Firmicutes phylum when compared with sedentary groups (p < 0.01). However, two-way ANOVA indicated no significant differences for Aβ1-40 administration x treadmill exercise interaction (F1,16 = 0.77, p= 0.39). In addition, Fig. 6C shows increased Bacteroidetes abundance in the group of animals exposed to Aβ1-40 administration, an effect prevented by physical exercise (Aβ1-40 administration: F1,12 = 10.45, p < 0.01; exercise: F1,12 = 18.72, p < 0.01; Aβ1-40 administration x exercise: F1,12 = 9.80, p < 0.01). Finally, Fig. 6D shows that Aβ1-40 administration increased Bacteroidetes/Firmicutes ratio, whereas physical exercise prevented this alteration (Aβ1-40 administration: F1,12 = 13.61, p < 0.01; exercise: F1,12 = 15.35, p < 0.01; Aβ140 administration x exercise: F1,12 = 13.46, p < 0.01). 4. Discussion In the present study, we showed that Aβ1–40 induced a depressivelike behavior, as demonstrated by an increase in the immobility time in mice subjected to the TST, one of the most used predictive tests to screen depression-like behaviors. Importantly, this result is in agreement with previous studies that used similar protocols of Aβ1–40 administration [12,16,23]. Moreover, the decreased time spent sniffing urine from female in estrus cycle in FUST observed in Aβ1–40-exposed mice is suggestive of anhedonic-like behavior, since it has been reported that mice found a cotton-tipped applicator dipped in female urine in estrus cycle more rewarding than one dipped in water [21]. Nonetheless, it is important to mention that deficits in olfactory processing are a common feature in the early stages of Alzheimer's disease in humans [24] and animal models of AD [25]. However, the behavioral tests used to measure olfactory discrimination are based on the fact that mice prefer places with their own odor (familiar compartments) instead of places with unfamiliar odors as well as the absence of odors related to sexual stimulation [25,26]. According to the assumption that FUST is a behavioral paradigm based on the interest in pheromones odors from the opposite sex as a sexual incentive stimulus [21], this effect triggered by Aβ1–40 is likely related to the rewardseeking behavioral modulation, although we cannot rule out that Aβ1–40 administration could affect the olfactory function of mice, an issue that needs to be addressed in future studies. Interestingly, treadmill exercise for 4 weeks was able to increase time spent sniffing regardless of the exposure of mice to Aβ1–40 or vehicle, suggesting that exercised mice present a hedonic-like behavior. These results also indicate a beneficial role of physical exercise even for mice that underwent a functional deterioration due to Aβ1–40. Our results are supported by previous studies showing the ability of physical exercise in abrogating the anhedonic-like behavior induced by olfactory bulbectomy [27], dexamethasone [28], and maternal separation [29] rodent models of depression. Considering that recent literature has linked several facets of gut health with depression and AD [30–32], multiple parameters indicative of gut function were also analyzed. The small intestine is where most of
3.3. Effect of treadmill exercise and/or Aβ1-40 administration on microvilli morphology of duodenum assessed by transmission electron microscopy Fig. 4 illustrates photomicrographs obtained by transmission electron microscopy of a transverse section of the duodenum epithelium of mice subjected to Aβ1-40 administration and/or physical exercise. Regarding microvilli morphology, visible differences in length of these structures can be observed between the groups, with exercised mice presenting apparently higher microvilli length than the other groups. It is possible to observe abnormal epithelial microvilli obtained from sedentary Aβ1-40-exposed mice, characterized by shorter microvilli and heterogeneity in the length of these structures that exhibit a disordered packing. 3.4. Effect of treadmill exercise and/or Aβ1-40 administration on Paneth cell morphology in the duodenum assessed by transmission electron microscopy Fig. 5 shows photomicrographs obtained by transmission electron microscopy of Paneth cells from the duodenum of mice subjected to Aβ1-40 administration and/or physical exercise. These cells contain large secretory granules with a dense core surrounded by a pale halo. It is possible to observe that Aβ1-40 administration caused a reduction in the secretory granule diameter, as well as an enlarged peripheral halo, an ultrastructural alteration not observed in the photomicrographs obtained from exercised mice exposed to Aβ1-40 administration. 5
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Fig. 4. Photomicrographs obtained by transmission electron microscopy of a transverse section of duodenum epithelium of mice subjected to Aβ1-40 administration and/or physical exercise. A- sedentary; B- treadmill exercise; Csedentary/Aβ1-40; D- treadmill exercise/Aβ1-40. Arrows show microvilli. Images were taken with a magnification of 15,000 × (scale bar =1 μm).
regardless of the administration with vehicle or Aβ1–40. Importantly, goblet cells produce mucins that are highly glycosylated proteins which constitute a significant part of the intestinal epithelial protection by forming a dense mucus layer. This layer maintains surface hydration and reduces mechanical stress, besides limiting access of larger-molecular-weight toxins to the mucosa and preventing gut bacteria from penetrating through the intestinal epithelial barrier [35,36]. Therefore, the higher number of these cells induced by physical exercise could contribute to intestinal homeostasis. Another parameter evaluated herein was the number of Paneth cells, which are epithelial cells of the small intestine located at the
the products of the macronutrient hydrolysis are absorbed by enterocytes. These cells possess numerous microvilli which increase the surface area available for absorption [33]. Here, we showed that treadmill exercise increased duodenum villus length regardless of whether the animals were exposed to Aβ1–40. Similarly, swimming exercise was able to increase the length of villi in the jejunum of rats [34]. In addition, treadmill exercise increased villus width regardless of having received Aβ1–40. A similar pattern of protection by physical exercise was shown in the photomicrographs of microvilli in the border of enterocytes in the duodenum epithelium. Treadmill running also increased the number of goblet cells per villus in the duodenum
Fig. 5. Photomicrographs obtained by transmission electron microscopy of Paneth cells in the duodenum of mice subjected to Aβ1-40 administration and/or physical exercise. A - sedentary; B- treadmill exercise; C- sedentary/ Aβ1-40; D- treadmill exercise/Aβ1-40. SG = secretory granules; ER = endoplasmic reticulum. Images were taken with a magnification of 5000 x (scale bar =2 μm).
6
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Fig. 6. Effects of Aβ1-40 administration and/or treadmill running on total bacteria (A), Firmicutes abundance (B), Bacteroidetes abundance (C) and Bacteroidetes/ Firmicutes ratio (D) obtained by quantitative real-time PCR (n = 3-5 animals/group). Bars represent mean + S.E.M. **p < 0.01 as compared with vehicle-treated group; ##p < 0.01 as compared with sedentary Aβ1-40-exposed group; @ p < 0.05 between Aβ1-40-treated mice compared with their vehicle-treated counterparts (i.e., significant main effect of Aβ1-40 administration); $$ p < 0.01 as compared with sedentary mice (i.e., significant main effect of exercise). Two-way ANOVA followed by Duncan’s multiple range test.
and requires future studies. Several studies highlight Paneth cell contribution for the establishment of appropriate colonization with commensal microbiota [37,46]. Indeed, gut microbiota plays an important role in the bidirectional communication between the gut and the CNS [47]. In human adults, the phyla Bacteroidetes and Firmicutes are generally dominant in the gut, with other phyla comprising 10 % or less of the microbiome [14]. Aβ1–40-exposed mice had a decrease in Firmicutes in their fecal content. Accordingly, decreased Firmicutes was observed in fecal samples of Aβ precursor protein (APP) transgenic mouse model (model of AD) [48], in mice subjected to chronic restraint stress (an animal model of depression) [49], in AD individuals [32] as well as in patients with depression [47]. Here, we show that treadmill exercise protocol robustly increased the Firmicutes abundance regardless of the administration with vehicle or Aβ1-40. This result agrees with higher Firmicutes abundance observed after 4-weeks treadmill exercise training in obese rats [50] and in mice subjected to 6-weeks treadmill running [51]. Moreover, higher Firmicutes abundance was found in elite rugby players as compared with non-athlete healthy subjects [52]. Increased abundance of phylum Bacteroidetes was also observed in Aβ1-40-exposed mice. In line with this result, AD patients were reported to have a higher abundance of Bacteroidetes in the fecal microbiota as compared with healthy individuals [32]. Similarly, an increase in Bacteroidetes was reported in patients with major depressive disorder [53] and mice subjected to chronic restraint stress [54]. Although treadmill physical exercise did not alter this parameter in sedentary mice, it was capable of preventing Aβ1-40-induced increase on Bacteroidetes abundance. Although we did not detect any significant difference between sedentary and exercised mice concerning the abundance of Bacteroidetes phylum, it is important to mention that effect size i.e. the difference of means/SEM is far from being negligible. Noteworthy,
bottom of the intestinal crypts. These cells produce enteric antimicrobial peptides such as alpha-defensins that play an important role in small intestine innate immunity [37,38]. The higher number of these cells observed in exercised mice could be related to better functioning of the intestinal defense mechanisms in these animals. Reinforcing this assumption, photomicrographs show that physical exercise was able to counteract the reduction in the diameter of secretory granules per crypt in Paneth cells induced by Aβ1–40 administration. The chronic administration of probiotics to mice was reported to increase these cells at the base of the intestine crypt and increased number of granules per crypt [39]. Probiotics have been recognized as a novel strategy to counteract depressive-like behavior in mice [40,41] besides being useful for the management of depression in humans [42]. Therefore, it is tempting to speculate that the increase in Paneth cell numbers may have contributed to the antidepressant-like effect of physical exercise. This assumption is supported by the ability of treadmill running in increasing the crypt depth, a region in which Paneth cells are positioned alongside the multipotent stem cells. Importantly, dysfunction in crypt homeostasis may compromise Paneth cell function [37,38]. As previously demonstrated in mice [43,44], the photomicrographs obtained by transmission electron microscopy show that mouse Panethcell granules present a central core and peripheral halo. The core is composed of a polysaccharide-protein complex, whereas the halo is composed of acid mucopolysaccharide [45]. Here, photomicrographs show that Aβ1-40-exposed mice presented reduced secretory granule diameter and higher halo size, ultrastructural alterations not observed in Aβ1-40-exercised mice, suggesting that physical exercise exerts a protective effect against the morphological alterations caused by Aβ1-40 in these parameters. However, it is intriguing to observe that treadmill running per se increased the halo size when compared with the vehicletreated sedentary group. The explanation for this result is still obscure 7
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Aβ1-40 consistently increased the Bacteroidetes/Firmicutes ratio, an effect completely prevented by physical exercise. Literature data regarding the influence of physical exercise on Bacteroidetes abundance has provided divergent results. Although some studies showed an absence of alteration on the abundance of this phylum or in Bacteroidetes/Firmicutes ratio in rats subject to wheel running [55] or in mice subjected to running wheel or treadmill running [56], others demonstrated an increase [57] or reduction [58] in the Bacteroidetes abundance following the practice of physical exercise in mice. Altogether, the results are suggestive that Aβ1-40 administration in mice causes alterations in microbiota composition that resembles those observed in individuals with AD and depression. The protective effect of treadmill physical exercise against these Aβ1-40-induced impairments could, at least in part, account for its ability to prevent the depressivelike behavior elicited by this AD model. Collectively, the results suggest a pivotal role of the gut-brain axis to depression/AD and the protective effect of treadmill running on this comorbidity. However, additional studies are necessary to characterize the genera of bacteria affected by these interventions.
2014.165. [9] S.P. Cass, Alzheimer’s disease and exercise: a literature review, Curr. Sports Med. Rep. 1 (2017) 19–22, https://doi.org/10.1249/JSR.0000000000000332. [10] T. Paillard, Y. Rolland, P. de Souto Barreto, Protective effects of physical exercise in Alzheimer’s disease and Parkinson’s disease: a narrative review, J. Clin. Neurol. 3 (2015) 212–219, https://doi.org/10.3988/jcn.2015.11.3.212. [11] R. Stanton, P. Reaburn, Exercise and the treatment of depression: a review of the exercise program variables, J. Sci. Med. Sport 2 (2014) 177–182, https://doi.org/ 10.1016/j.jsams.2013.03.010. [12] J.M. Rosa, F.L. Pazini, G. Olescowicz, A. Camargo, M. Moretti, J. Gil-Mohapel, A.L.S. Rodrigues, Prophylactic effect of physical exercise on Abeta1-40-induced depressive-like behavior: role of BDNF, mTOR signaling, cell proliferation and survival in the hippocampus, Prog. Neuropsychopharmacol. Biol. Psychiatry 94 (2019) e109646, , https://doi.org/10.1016/j.pnpbp.2019. [13] E.S. Ogbonnaya, G. Clarke, F. Shanahan, T.G. Dinan, J.F. Cryan, O.F. O’Leary, Adult hippocampal neurogenesis is regulated by the microbiome, Biol. Psychiatry 4 (2015) 7–9, https://doi.org/10.1016/j.biopsych.2014. [14] A. Dalton, C. Mermier, M. Zuhl, Exercise influence on the microbiome-gut-brain axis, Gut Microbes 31 (2019) 1–14, https://doi.org/10.1080/19490976.2018. [15] V. Monda, I. Villano, A. Messina, A. Valenzano, T. Esposito, F. Moscatelli, A. Viggiano, G. Cibelli, S. Chieffi, M. Monda, G. Messina, Exercise modifies the gut microbiota with positive health effects, Oxid. Med. Cell. Longev. (2017) e3831972, , https://doi.org/10.1155/2017/3831972. [16] J.M. Rosa, F.L. Pazini, M.P. Cunha, A.R.S. Colla, L.M. Manosso, G. Mancini, A.C.G. Souza, A.F. de Bem, R.D. Prediger, A.L.S. Rodrigues, Antidepressant effects of creatine on amyloid beta1-40-treated mice: the role of GSK-3beta/Nrf2 pathway, Prog. Neuropsychopharmacol. Biol. Psychiatry 86 (2018) 270–278, https://doi.org/ 10.1016/j.pnpbp.2018.05.001. [17] S.E. Laursen, J.K. Belknap, Intracerebroventricular injections in mice. Some methodological refinements, J. Pharmacol. Methods 4 (1986) 355–357, https://doi.org/ 10.1016/0160-5402(86)90038-0. [18] S.C. Barauna, M.P. Kaster, B.T. Heckert, K.S. do Nascimento, F.M. Rossi, E.H. Teixeira B.S. Cavada, A.L.S. Rodrigues, R.B. Leal, Antidepressant-like effect of lectin from Canavalia brasiliensis (ConBr) administered centrally in mice, Pharmacol. Biochem. Behav. 1 (2006) 160–169, https://doi.org/10.1016/j.pbb.2006.07.030. [19] F. Ludka, M.P. Cunha, T. Dal-Cim, L.B. Binder, L.C. Constantino, C.M. Massari, W.C. Martins, A.L.S. Rodrigues, C.I. Tasca, Atorvastatin protects from Abeta1-40Induced cell damage and depressive-like behavior via ProBDNF cleavage, Mol. Neurobiol. 8 (2017) 6163–6173, https://doi.org/10.1007/s12035-016-0134-6. [20] L. Steru, R. Chermat, B. Thierry, P. Simon, The tail suspension test: a new method for screening antidepressants in mice, Psychopharmacology 3 (1985) 367–370, https://doi.org/10.1007/bf00428203. [21] O. Malkesman, M.L. Scattoni, D. Paredes, T. Tragon, B. Pearson, G. Shaltiel, G. Chen, J.N. Crawley, H.K. Manji, The female urine sniffing test: a novel approach for assessing reward-seeking behavior in rodents, Biol. Psychiatry 9 (2010) 864–871, https://doi.org/10.1016/j.biopsych.2009.10.018. [22] N. Fierer, J.A. Jackson, R. Vilgalys, R.B. Jackson, Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assays, Appl. Environ. Microbiol. 71 (2005) 4117–4120, https://doi.org/10.1128/AEM.71.7. 4117-4120.2005. [23] A.C. Guerra de Souza, C.L. Gonçalves, V. de Souza, J.M. Hartwig, M. Farina, R.D. Prediger, Agmatine attenuates depressive-like behavior and hippocampal oxidative stress following amyloid beta (Abeta1-40) administration in mice, Behav. Brain Res. 353 (2018) 51–56, https://doi.org/10.1016/j.bbr.2018.06.032. [24] C. Murphy, Olfactory and other sensory impairments in Alzheimer disease, Nat. Rev. Neurol. 15 (2018) 11–24, https://doi.org/10.1038/s41582-018-0097-5. [25] A. Raj, S. Dey, D.U. Maheshwari, S.N. Manjula1, S.V. Madhunapantula, M. Ali, Evaluating the olfactory dysfunction and cognitive deficits induced by intracerebroventricular injection of Amyloid beta (1–42) in female C57BL/6 mice, J. Appl. Pharm. Sci. 9 (2019) 24–34, https://doi.org/10.7324/JAPS.2019.91004. [26] V.V. Santos, R. Stark, D. Rial, H.B. Silva, J.A. Bayliss, M.B. Lemus, J.S. Davies, R.A. Cunha, R.D. Prediger, Z.B. Andrews, Acyl ghrelin improves cognition, synaptic plasticity deficits and neuroinflammation following amyloid β (Aβ1-40) administration in mice, J. Neuroendocrinol. 29 (2017) 1–11, https://doi.org/10.1111/jne. 12476. [27] M.S. Shin, S.S. Park, J.M. Lee, T.W. Kim, Y.P. Kim, Treadmill exercise improves depression-like symptoms by enhancing serotonergic function through upregulation of 5-HT1A expression in the olfactory bulbectomized rats, J. Exerc. Rehabil. 13 (2017) 36–42, https://doi.org/10.12965/jer.1734918.459. [28] W. L, Y. Xu, J. Lu, Y. Zhang, H. Sheng, X. Ni, Swimming exercise ameliorates depression-like behaviors induced by prenatal exposure to glucocorticoids in rats, Neurosci. Lett. 524 (2012) 119–123, https://doi.org/10.1016/j.neulet.2012.07. 011. [29] M. Sadeghi, M. Peeri, M.J. Hosseini, Adolescent voluntary exercise attenuated hippocampal innate immunity responses and depressive-like behaviors following maternal separation stress in male rats, Physiol. Behav. 163 (2016) 177–183, https://doi.org/10.1016/j.physbeh.2016.05.017. [30] S. Liang, X. Wu, X. Hu, T. Wang, F. Jin, Recognizing depression from the microbiota−Gut−Brain Axis, Int. J. Mol. Sci. 19 (2018) e1592, https://doi.org/10. 3390/ijms19061592. [31] D. Serra, L.M. Almeida, T.C.P. Dinis, The impact of chronic intestinal inflammation on brain disorders: the microbiota-gut-Brain Axis, Mol. Neurobiol. 56 (2019) (2019) 6941–6951, https://doi.org/10.1007/s12035-019-1572-8. [32] N.M. Vogt, R.L. Kerby, K.A. Dill-McFarland, S.J. Harding, A.P. Merluzzi, S.C. Johnson, C.M. Carlsson, S. Asthana, S. Zetterberg, H. Blennow, K. Bendlin, B.B. Rey, Gut microbiome alterations in Alzheimer’s disease, Sci. Rep. 7 (2017)
Author statement The authors declare that no financial support or compensation has been received from any individual or corporate entity over the past three years for research or professional service and there are no personal financial holdings that could be perceived as constituting a potential conflict of interest. Declaration of Competing Interest The authors declare that they have no conflicts of interest to disclose. Acknowledgments This study was supported by grants from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Brazil # 310113/ 2017-2, 150082/2018-5, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brazil. ALSR is the recipient of a CNPq Research Productivity Fellowship. Authors thank Laboratório Multiusuário de Estudos em Biologia (LAMEB) for support and the staff of the Central Laboratory of Electron Microscopy (LCME), Federal University of Santa Catarina, Florianópolis, Santa Catarina, Brazil for the use of the transmission electron microscope. References [1] C.A. Lane, J. Hardy, J.M. Schott, Alzheimer’s disease, Eur. J. Neurol. 25 (2018) 59–70, https://doi.org/10.1111/ene.13439. [2] C.P.C. Galts, L.E.B. Bettio, D.C. Jewett, C.C. Yang, P.S. Brocardo, A.L.S. Rodrigues, J.S. Thacker, J. Gil-Mohapel, Depression in neurodegenerative diseases: common mechanisms and current treatment options, Neurosci. Biobehav. Rev. 102 (2019) 56–84, https://doi.org/10.1016/j.neubiorev.2019.04.002. [3] S. Chi, J.T. Yu, M.S. Tan, L. Tan, Depression in Alzheimer’s disease: epidemiology, mechanisms, and management, J. Alzheimers Dis. 42 (2014) 739–755, https://doi. org/10.3233/JAD-140324. [4] Q.F. Zhao, L. Tan, H.F. Wang, T. Jiang, M.S. Tan, L. Tan, W. Xu, J.Q. Li, J. Wang, T.J. Lai, J.T. Yu, The prevalence of neuropsychiatric symptoms in Alzheimer’s disease: systematic review and meta-analysis, J. Affect. Disord. 15 (2016) 264–271, https://doi.org/10.1016/j.jad.2016.04.054. [5] M.C. Cenit, Y. Sanz, P. Codoner-Franch, Influence of gut microbiota on neuropsychiatric disorders, World J. Gastroenterol. 14 (2017) 5486–5498, https://doi. org/10.3748/wjg.v23.i30.5486. [6] S.G. Cheung, A.R. Goldenthal, A.C. Uhlemann, J.J. Mann, J.M. Miller, M.E. Sublette, Systematic review of gut microbiota and major depression, Front. Psychiatry 10 (2019) e34, https://doi.org/10.3389/fpsyt.2019.00034. [7] E.M.M. Quigley, Microbiota-brain-Gut Axis and neurodegenerative diseases, Curr. Neurol. Neurosci. Rep. 17 (2017) 1–9, https://doi.org/10.1007/s11910-0170802-6. [8] H. Zhang, J.B.Sparks S.V. Karyala, R. Settlage, X.M. Luo, Host adaptive immunity alters gut microbiota, ISME J. 3 (2015) 770–781, https://doi.org/10.1038/ismej.
8
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
[48] T. Harach, N. Marungruang, N. Duthilleul, V. Cheatham, K.D. Mc Coy, G. Frisoni, J.J. Neher, F. Fåk, M. Jucker, T. Lasser, T. Bolmont, Reduction of Abeta amyloid pathology in APPPS1 transgenic mice in the absence of gut microbiota, Sci. Rep. 7 (2017) e41802, https://doi.org/10.1038/srep46856. [49] X. Guo, J. Li, R. Tang, G. Zhang, H. Zeng, R.J. Wood, Z. Liu, High fat diet alters gut microbiota and the expression of paneth cell-antimicrobial peptides preceding changes of circulating inflammatory cytokines, Mediators Inflamm. (2017) e9474896, https://doi.org/10.1155/2017/9474896. [50] B.A. Petriz, A.P. Castro, J.A. Almeida, C.P. Gomes, G.R. Fernandes, R.H. Kruger, R.W. Pereira, O.L. Franco, Exercise induction of gut microbiota modifications in obese, non-obese and hypertensive rats, BMC Genomics 15 (2014) e511, https:// doi.org/10.1186/1471-2164-15-511. [51] J.E. Lambert, J.P. Myslicki, M.R. Bomhof, D.D. Belke, J. Shearer, R.A. Reimer, Exercise training modifies gut microbiota in normal and diabetic mice, Appl. Physiol. Nutr. Metab. 7 (2015) 749–752, https://doi.org/10.1139/apnm-20140452. [52] S.F. Clarke, E.F. Murphy, O. O’Sullivan, A.J. Lucey, M. Humphreys, A. Hogan, P. Hayes, M. O’Reilly, I.B. Jeffery, R. Wood-Martin, D.M. Kerins, E. Quigley, R.P. Ross, P.W. O’Toole, M.G. Molloy, E. Falvey, F. Shanahan, P.D. Cotter, Exercise and associated dietary extremes impact on gut microbial diversity, Gut. 63 (2014) 1913–1920, https://doi.org/10.1136/gutjnl-2013-306541. [53] H. Jiang, Z. Ling, Y. Zhang, H. Mao, Z. Ma, Y. Yin, W. Wang, W. Tang, Z. Tan, J. Shi, L. Li, B. Ruan, Altered fecal microbiota composition in patients with major depressive disorder, Brain Behav. Immun. 48 (2015) 186–194, https://doi.org/10. 1016/j.bbi.2015.03.016. [54] Y. Guo, J. Xie, X. Li, Y. Yuan, L. Zhang, W. Hu, H. Luo, H. Yu, R. Zhang, Antidepressant effects of rosemary extracts associate with anti-inflammatory effect and rebalance of gut microbiota, Front. Pharmacol. 9 (2018) e1126, https://doi. org/10.3389/fphar.2018.01126. [55] T.W. Liu, Y.M. Park, H.D. Holscher, J. Padilla, R.J. Scroggins, R. Welly, S.L. Britton, L.G. Koch, V.J. Vieira-Potter, K.S. Swanson, Physical activity differentially affects the cecal microbiota of ovariectomized female rats selectively bred for high and low aerobic capacity, PLoS One 8 (2015) e0136150, https://doi.org/10.1371/journal. pone.0136150. [56] J.M. Allen, M.E. Berg Miller, B.D. Pence, K. Whitlock, V. Nehra, H.R. Gaskins, B.A. White, J.D. Fryer, J.A. Woods, Voluntary and forced exercise differentially alters the gut microbiome in C57BL/6J mice, J. Appl. Physiol. 118 (2015) 1059–1066, https://doi.org/10.1152/japplphysiol.01077.2014. [57] C.C. Evans, K.J. LePard, J.W. Kwak, M.C. Stancukas, S. Laskowski, J. Dougherty, L. Moulton, A. Glawe, Y. Wang, V. Leone, D.A. Antonopoulos, D. Smith, E.B. Chang, M.J. Ciancio, Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity, PLoS One 3 (2014) e92193, https:// doi.org/10.1371/journal.pone.0092193. [58] S.S. Kang, P.R. Jeraldo, A. Kurti, M.E. Miller, M.D. Cook, K. Whitlock, N. Goldenfeld, J.A. Woods, B.A. White, N. Chia, J.D. Fryer, Diet and exercise orthogonally alter the gut microbiome and reveal independent associations with anxiety and cognition, Mol. Neurodegener. 9 (2014) e36, https://doi.org/10.1186/ 1750-1326-9-36.
e13537, , https://doi.org/10.1038/s41598-017-13601-y. [33] J.M. DeSesso, C.F. Jacobson, Anatomical and physiological parameters affecting gastrointestinal absorption in humans and rats, Food Chem. Toxicol. 39 (2001) 209–228, https://doi.org/10.1016/s0278-6915(00)00136-8. [34] J.R. Gomes, J.R. Freitas, S. Grassiolli, Effects of physical exercise on the intestinal mucosa of rats submitted to a hypothalamic obesity condition, Anat Rec (Hoboken) 299 (2016) 1389–1396, https://doi.org/10.1002/ar.23453. [35] J.M. Allaire, V. Morampudi, S.M. Crowley, M. Stahl, H. Yu, K. Bhullar, L.A. Knodler, B. Bressler, K. Jacobson, B.A. Vallance, Frontline defenders: goblet cell mediators dictate host-microbe interactions in the intestinal tract during health and disease, Am. J. Physiol. Gastrointest. Liver Physiol. 314 (2018) 360–377, https://doi.org/ 10.1152/ajpgi.00181.2017. [36] Y.S. Kim, S.B. Ho, Intestinal goblet cells and mucins in health and disease: recent insights and progress, Curr. Gastroenterol. Rep. 5 (2010) 319–330, https://doi.org/ 10.1007/s11894-010-0131-0132. [37] N. Gassler, Paneth cells in intestinal physiology and pathophysiology, World J. Gastrointest. Pathophysiol. 4 (2017) 150–160, https://doi.org/10.4291/wjgp.v8.i4. 150. [38] H.C. Clevers, C.L. Bevins, Paneth cells: maestros of the small intestinal crypts, Annu. Rev. Physiol. 75 (2013) 289–311, https://doi.org/10.1146/annurev-physiol030212-183744. [39] S.I. Cazorla, C. Maldonado-Galdeano, R. Weill, J. De Paula, G.D.V. Perdigon, Oral administration of probiotics increases Paneth cells and intestinal antimicrobial activity, Front. Microbiol. 9 (2018) e736, https://doi.org/10.3389/fmicb.2018. 00736. [40] J. Sun, F. Wang, X. Hu, C. Yang, H. Xu, Y. Yao, J. Liu, Clostridium butyricum attenuates chronic unpredictable mild stress-induced depressive-like behavior in mice via the gut-brain Axis, J. Agric. Food Chem. 31 (2018) 8415–8421, https://doi.org/ 10.1021/acs.jafc.8b02462. [41] A. Slyepchenko, A.F. Carvalho, D.S. Cha, S. Kasper, R.S. McIntyre, Gut emotions mechanisms of action of probiotics as novel therapeutic targets for depression and anxiety disorders, CNS Neurol. Disord. Drug Targets 10 (2014) 1770–1786, https:// doi.org/10.2174/1871527313666141130205242. [42] R. Huang, K. Wang, J. Hu, Effect of probiotics on depression: a systematic review and meta-analysis of randomized controlled trials, Nutrients 8 (2016) e483, https:// doi.org/10.3390/nu8080483. [43] Y. Satoh, M. Yamano, M. Matsuda, K. Ono, Ultrastructure of Paneth cells in the intestine of various mammals, J. Electron Microsc. Tech. 1 (1990) 69–80, https:// doi.org/10.1002/jemt.1060160109. [44] W.D. Troughton, J.S. Trier, Paneth and goblet cell renewal in mouse duodenal crypts, J. Cell Biol. 41 (1969) 251–268, https://doi.org/10.1083/jcb.41.1.251. [45] J.C. Hampton, Effects of fixation on the morphology of Paneth cell granules, Stain Technol. 40 (1965) 283–291, https://doi.org/10.3109/10520296509116428. [46] D.A. Elphick, Y.R. Mahida, Paneth cells: their role in innate immunity and inflammatory disease, Gut. 54 (2005) 1802–1809, https://doi.org/10.1136/gut.2005. 068601. [47] T.T. Huang, J.B. Lai, Y.L. Du, Y. Xu, L.M. Ruan, S.H. Hu, Current understanding of gut microbiota in mood disorders: an update of human studies, Front. Genet. 10 (2019) e98, https://doi.org/10.3389/fgene.2019.00098.
9
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Research report
Prophylactic effect of physical exercise on Aβ1-40-induced depressive-like behavior and gut dysfunction in mice
T
Julia M. Rosaa, Francis L. Pazinia, Anderson Camargoa, Ingrid A.V. Wolina, Gislaine Olescowiczb, Livia B. Eslabãoc, Oscar Bruna Romeroc, Elisa C. Winkelmann-Duarted, Ana Lúcia S. Rodriguesa,* a
Department of Biochemistry, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040-900, Brazil Department of Pharmacology, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040-900, Brazil c Department of Microbiology, Immunology and Parasitology, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040900, Brazil d Department of Morphological Sciences, Center of Biological Sciences, Universidade Federal de Santa Catarina, Florianópolis, Santa Catarina 88040-900, Brazil b
A R T I C LE I N FO
A B S T R A C T
Keywords: Alzheimer’s disease Amyloid β1-40 peptide Intestine Microbiota Physical exercise
Alzheimer's disease (AD) is a prevalent neurodegenerative disease that is highly comorbid with depression. Gut dysfunction has been proposed as a possible risk factor for both clinical conditions. In the present study, we investigated the ability of treadmill exercise for 4 weeks (5 days/week, 40 min/day) to counteract amyloid β1-40 peptide (Aβ1-40)-induced depressive-like behavior, alterations in morphological parameters of the duodenum, and the abundance of Firmicutes and Bacteroidetes phyla. Aβ1-40 administration (400 pmol/mouse, i.c.v.) increased immobility time in the tail suspension test (TST) and reduced time spent sniffing in the female urine sniffing test (FUST), indicating behavioral despair and impairment in reward-seeking behavior. These behavioral alterations, indicative of depressive-like behavior, were accompanied by reduced villus width in the duodenum. Moreover, photomicrographs obtained by transmission electron microscopy revealed abnormal epithelial microvilli in the duodenum from sedentary Aβ1-40-exposed mice, characterized by shorter microvilli and heterogeneity in the length of these structures that exhibit a disordered packing. Regarding the ultrastructure of Paneth cells, Aβ1-40 administration caused a reduction in the secretory granule diameter, as well as an enlarged peripheral halo. These animals also presented reduced Firmicutes and increased Bacteroidetes abundance, and increased Bacteroidetes/Firmicutes ratio. Most of the alterations observed in Aβ1-40-exposed mice were prevented by the practice of physical exercise. Altogether the results provide evidence of the prophylactic effect of physical exercise on Aβ1-40-induced depressive-like behavior and gut dysfunction in mice, suggesting that physical exercise could be useful for preventing depression associated with AD.
1. Introduction Alzheimer's disease (AD) is the most common form of dementia in elderly individuals and is the leading cause of disability in late life [1]. In addition, AD patients may exhibit depressive symptoms [2]. A metaanalysis study reported that depression is present in approximately 40 %–50 % of AD cases, resulting in increased institutionalization and mortality [3,4]. Although the major hallmark of AD is the presence of extracellular amyloid plaques in the brain, formed mainly from the amyloid-β (Aβ) peptide, several peripheral and systemic abnormalities could be associated with AD development. One aspect of particular interest is the crosstalk between the gut and central nervous system (CNS), and that dysfunction in microbiota-gut-brain axis may underlie
⁎
both AD and depression pathogenesis [5–7]. Therefore, the regulation of gut commensal microbiome that plays an essential role in protecting against infections, shaping and regulating immune responses, and maintaining host immune homeostasis [8] could be a promising therapy for both AD and depression [6]. Remarkably, current major challenges in depression associated with AD include the lack of effective treatments and few preventive strategies. Physical exercise has been proposed as a non-pharmacological strategy for both AD [9,10] and depression [11]. We have recently reported the prophylactic effect of treadmill physical exercise on Aβ140-induced depressive-like behavior in mice, an effect associated with modulation of hippocampal BDNF, mTOR signaling, and promotion of cell proliferation and survival of newly generated cells in the
Corresponding author. E-mail address: [email protected] (A.L. S. Rodrigues).
https://doi.org/10.1016/j.bbr.2020.112791 Received 20 December 2019; Received in revised form 23 June 2020; Accepted 23 June 2020 Available online 26 June 2020 0166-4328/ © 2020 Elsevier B.V. All rights reserved.
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
hippocampal dentate gyrus [12]. Of note, emerging evidence has indicated that adult hippocampal neurogenesis may be influenced by microbiome [13]. In addition, physical exercise has been reported to modify the composition of gut microbiota in humans and rodents [14,15]. Considering this background, the present study investigated the possible beneficial effects of physical exercise on alterations induced by the administration of Aβ1-40 on: a) behavioral parameters related to depression assessed in the tail suspension test (TST) and female urine sniffing test (FUST); b) morphological parameters assessed by Hematoxylin and Eosin (H&E) staining and by transmission electron microscopy in the duodenum; c) enrichment of bacteria from Firmicutes and Bacteroidetes phyla in the fecal content.
(Fig. 1). Animals in the exercised groups were subjected to a 4-week period of treadmill exercise consisting of 5 running sessions per week (Monday to Friday) on a treadmill apparatus (Insight®, Ribeirão Preto, SP, Brazil). Each running session lasted 40 min/day. The treadmill speed was progressively increased by 2 m/min/week, starting at 6 m/ min at the beginning of the protocol. Treadmill running was scheduled between 1 p.m. and 3 p.m. Mice in the control (sedentary) groups were placed on a locked treadmill for the same period of time [12]. 2.4. Tail suspension test (TST) The duration of immobility in the TST was registered according to the method described by Steru et al. (1985) [20]. Mice were suspended by the tail with adhesive tape 50 cm from the floor and the immobility time was recorded in a 6-min session by an observer blind to the experimental groups. Mice were considered immobile only when they hung passively and completely motionless.
2. Materials and methods 2.1. Animals
2.5. Open field test
Male Swiss mice (30–40 g, 45–55 days) were housed in groups of 10 animals per plastic cage (41 × 34 × 16 cm) under controlled temperature (21 ± 1 °C) and humidity (50 ± 20 %) with a 12:12 h light/ dark cycle (lights on at 7:00 a.m.). Mice were allowed free access to standard laboratory food and tap water, and to adapt to the laboratory for at least 1 week before the onset of the experimental protocol. All manipulations were carried out between 1 p.m. and 5 p.m., with each animal used only once. All procedures were performed in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and were approved by the Ethics Committee of the Institution. All efforts were made to minimize animal suffering and to reduce the number of animals used in the experiments.
In order to rule out the interference of alterations in overall locomotor activity in the TST, mice were evaluated in the open-field test as previously described [12]. Mice were individually placed in a wooden box (40 × 60 × 50 cm) with the floor divided into 12 equal rectangles. The number of crossings was recorded during a 6-min period. 2.6. Female urine sniffing test (FUST) In the FUST paradigm, reward-seeking behavior was evaluated. One hour before the test, mice were habituated to a sterile cotton-tipped applicator inserted into their home cage. The test had three phases: a) one exposure (3 min) to the cotton tip dipped in water; b) an interval of 45 min during which no cotton tip was presented to the animal; and c) one exposure (3 min) to a cotton tip applicator infused with fresh urine collected from females of the same strain in estrus, during which sniffing duration was measured [21].
2.2. Drugs and treatment Aβ1-40 (Sigma Chemical Company, St Louis, MO, USA) was dissolved in sterile phosphate-buffered saline (PBS; pH 7.4) and incubated at 37 °C for four days to induce aggregation. Aβ1-40 (3 μl) was administered by intracerebroventricular (i.c.v.) route at a dose previously reported to be effective to induce depressive-like behavior (400 pmol per mouse) [12,16]. Mice were lightly anesthetized with isoflurane (2.5 %; Abbot Laboratórios do Brasil Ltda., Rio de Janeiro, RJ, Brazil) before i.c.v. administrations, which were carried out using a freehand method described previously [17]. and standardized by our group [12,16,18]. Briefly, a 0.4 mm external diameter hypodermic needle attached to a cannula linked to a 25 μl Hamilton syringe was inserted perpendicularly through the skull of each mouse. Aβ1-40 or vehicle (PBS) was injected directly into the left lateral ventricle, at the following coordinates from bregma: anterioposterior (AP) 0.1 mm; mediolateral (ML) 1 mm; and dorsoventral (DV) 3 mm. Aβ1-40 and vehicle were administered ten days before behavioral tests [12,16,19]. After i.c.v. injections, mice underwent 48 h of interval before proceeding the treadmill running protocol.
2.7. Hematoxylin and eosin (H&E) staining Mice were anesthetized with pentobarbital (50 mg/kg, i.p.) and transcardially perfused with 0.9 % sodium chloride (NaCl) followed by 4% paraformaldehyde (PFA). The duodenum was dissected and approximately 5 cm segment was collected, fixed in 4% paraformaldehyde, and embedded in paraffin. Sections (5 μm) were cut from the paraffin blocks using a Leica RM2255 rotary microtome (Leica Biosystems Nussloch, Heidelberger Straße, Germany). Sections were then stained with hematoxylin and eosin (H&E) using the Leica ST5010 Autostainer XL (Leica Biosystems Nussloch, Heidelberger Straße, Germany) blotting system with standard protocols. Slides were mounted using a synthetic resin (Entellan; Merck, Germany). The analyses were performed on images from the Axion Scan slide scanner (ZEISS International, Oberkochen, Germany). The height and width of 5 villi were measured per each segment. Goblet cells were counted in 5 villi and Paneth cells were counted in 5 crypts. The crypt depth was measured from the crypt-villus junction to the base in 5 samples.
2.3. Physical exercise protocol Animals were randomly assigned into four groups: 1- sedentary; 2treadmill exercise; 3- sedentary/Aβ1-40; 4- treadmill exercise/Aβ1-40
Fig. 1. Experimental timeline. For all experiments, mice in the exercise groups were submitted to 4 weeks of treadmill running (5 days/week, 40 min/day). Eighteen days following the onset of the exercise protocol mice received i.c.v. injections of either Aβ1-40 peptide (400 pmol) or vehicle. Twenty-four hours after the last day of exercise, mice were submitted to behavioral testing (TST, FUST and OFT) and subsequently sacrificed by transcardial perfusion for intestine dissection and feces collection for histological and quantitative real-time PCR (RT-qPCR) microbiological analyses of fecal content. 2
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
2.8. Transmission electron microscopy of Paneth cells After transcardial perfusion, a duodenal segment (2 cm) was taken from two mice per group. The duodenal segments were fixed for 24 h in 2.5 % glutaraldehyde in 0.1 M phosphate-buffered saline (PBS) pH 7.4 and post-fixed for 1 h in 2% osmium tetroxide solution in phosphate buffer pH 7.4 (1:1). Samples were washed with PBS followed by water (10 min each wash). Subsequently, samples were dehydrated in graded acetone series and then embedded in Spurr's resin (EMS, Hatfield, PA, USA). Ultrathin sections (70 nm) were made in an ultramicrotome (Leica, Reicheit Ultracut S, Vienna, Austria) and contrasted using uranyl acetate and lead citrate. The photomicrographs were made in a transmission electron microscope JEM 1011 (JEOL, Tokyo, Japan) at 80 kV. 2.9. Fecal sample collection, DNA extraction, and quantitative real-time PCR Fecal samples were collected from the colon into sterile tubes, which were immediately snap-frozen in liquid nitrogen and subsequently transferred to −80 °C prior to DNA extraction. The fecal sampling was carried out immediately after the behavioral tests. Microbial genomic DNA was extracted from each fecal sample using a FastDNA™ Spin Kit (MP Biomedicals, Santa Ana, CA, USA) according to the manufacturer’s recommendation. Amplification conditions were 50 °C for 2 min, 95 °C for 10 min followed by 40 cycles of 95 °C for 30 s and 60 °C for 90 s. The primers used were designed with Primer Express software version 3.0 (Applied Biosystems, USA): Total bacteria: forward (ACTCCTACGGGAGGCAGCAG) and reverse (ATTACCGCGGCTCTGG) primers; Firmicutes: forward (GCAGTAGGGAATCTTCCG) and reverse ( ATTACCGCGGCTGCTGG) primers; Bacteroidetes: forward (GTACTGA GACACGGACCA) and reverse (ATTACCGCGGCTCTGG) primers (Invitrogen, USA). Quantitative real-time PCR assays of 16S ribosomal RNA (rRNA) gene were performed by using the method of Fierer et al. [22]. Results were analyzed by the software Sequence Detection Systems (SDS) version 2.4 software (Applied Biosystems, CA, USA). Primer efficiency was tested using the standard curve method. 2.10. Statistical analyses The Kolmogorov–Smirnov test was used to assess data normality and Levene’s test for analysis of homogeneity of variances. Data are normally distributed and have equal variances (data not shown). Data are presented as mean ± standard error of the mean (SEM). Differences among experimental groups were determined by two-way analysis of variance (ANOVA) followed by Duncan’s multiple range post hoc test, when appropriate. A value of p < 0.05 was considered statistically significant.
Fig. 2. Effects of treadmill running on Aβ1-40-induced depressive-like behavior as assessed in the TST and FUST. Effects of Aβ1-40 administration and/or physical exercise on immobility time (A) in the TST, time spent sniffing in FUST paradigm (B) and on the number of crossings in the OFT (C) (n = 8 animals/ group). Bars represent mean + S.E.M. **p < 0.01 as compared with vehicletreated group; ##p < 0.01 as compared with sedentary Aβ1-40-exposed group; @@ p < 0.01 between Aβ1-40-treated mice compared with their vehicle-treated counterparts (i.e., significant main effect of Aβ1-40 administration); $$ p < 0.01 as compared with sedentary mice (i.e., significant main effect of exercise). Twoway ANOVA followed by Duncan’s multiple range test.
3. Results 3.1. Effect of treadmill exercise and/or Aβ1-40 administration in the TST and FUST Fig. 2A shows that exposure to Aβ1-40 significantly increased immobility time in the TST as compared to vehicle administration. Moreover, the treadmill running (4 weeks, 40 min/day) reduced the immobility time in the TST both in vehicle- and Aβ1-40-treated mice (Aβ1–40 treatment: F1,24 = 30.55, p < 0.01; exercise: F1,24 = 122.97, p < 0.01; Aβ1-40 administration x exercise: F1,24 = 12.82, p < 0.01). Fig. 2B shows the effects of treadmill exercise (4 weeks, 40 min/day) and/or Aβ1-40 peptide administration in the FUST. A two-way ANOVA revealed a significant main effect for Aβ1-40 peptide administration (F1,24 = 46.53, p < 0.01) in the FUST, with Aβ1-40-exposed mice showing a significant reduction in the time spent sniffing (p < 0.01). Likewise, two-way ANOVA revealed a significant main effect for
treadmill exercise (F1,24 = 210.87, p < 0.01), with mice subjected to exercise protocol presenting an increase in the time spent sniffing in the FUST (p < 0.01). However, two-way ANOVA revealed no significant differences for Aβ1-40 administration x treadmill exercise interaction (F1,24 = 1.47, p=0.23) in the FUST. As indicated in Fig. 2C, administration of Aβ1-40 and/or exercise had no significant effect on overall locomotor activity in the OFT (Aβ1-40 treatment: F1,24 = 0.01, p=0.97]; exercise: F1,24 = 1.71, p=0.20; Aβ1-40 administration exercise: F1,24 = 3
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Fig. 3. Effects of treadmill running and Aβ1-40 administration on morphological parameters of duodenum. Representative images of H&E staining of duodenum (A), villus length (B), villus width (C), number of goblet cells/villus (D) number of Paneth cell/crypt (E) and crypt depth (F). (n = 5 animals/group). Bars represent mean + S.E.M. **p < 0.01 as compared with vehicle-treated group; ##p < 0.01 as compared with sedentary Aβ1-40-exposed group. @ p < 0.05 and @@ p < 0.01 between Aβ1-40-treated mice compared with their vehicle-treated counterparts (i.e., significant main effect of Aβ1-40 administration); $$ p < 0.01 as compared with sedentary mice (i.e., significant main effect of exercise). Two-way ANOVA followed by Duncan’s multiple range test. Arrows show duodenal crypt and circle shows a goblet cell. Images were taken with a magnification of either 20× (scale bar =100 μm) or 40× (scale bar =50 μm; inset).
2.33, p=0.14).
administration on morphological parameters of duodenum assessed by H&E staining. A two-way ANOVA revealed a significant main effect for treadmill exercise (F1,16 = 56.68, p < 0.01) in the villous height (Fig. 3B), with mice subjected to exercise protocol showing higher villous height when compared to sedentary mice regardless of the administration with vehicle or Aβ1-40 (p < 0.01). However, two-way
3.2. Effect of treadmill exercise and/or Aβ1-40 administration on morphological parameters of the duodenum Fig. 3 depicts the effects of treadmill exercise and Aβ1-40 4
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Furthermore, exercised mice not exposed to Aβ1-40 also presented an enlarged peripheral halo, as compared to the sedentary group.
ANOVA revealed no significant differences for Aβ1-40 administration (F1,16 = 0.78, p=0.36) and Aβ1-40 administration x exercise interaction (F1,16 = 5.43, p=0.05) in the villous height. Regarding of villus width (Fig. 3C), a two-way ANOVA revealed a significant main effect for Aβ140 administration (F1,16 = 15.10, p < 0.01), with mice exposed to Aβ140 showing a reduction in the villus width when compared with vehicletreated mice (p < 0.01). Moreover, a significant main effect of treadmill exercise (F1,16 = 66.04, p < 0.01) was observed, with exercised mice presenting wider villus when compared to sedentary groups (p < 0.01). However, two-way ANOVA revealed no significant differences for Aβ140 administration x treadmill exercise interaction (F1,16 = 1.81, p = 0.19) in the villus width. Additionally, two-way ANOVA indicated a main effect for Aβ1-40 peptide administration (F1,16 = 5.49, p < 0.05) in the number of goblet cells (Fig. 3D), with Aβ1-40 -induced mice showing a reduction in the number of goblet cells when compared with vehicle-treated mice (p < 0.05). A significant main effect of treadmill exercise (F1,16 = 43.85, p < 0.01) was also observed, with mice subjected to treadmill running protocol presenting an increase in the number of goblet cells when compared with sedentary groups regardless of the administration with vehicle or Aβ1-40 (p < 0.01). However, two-way ANOVA revealed no significant differences for Aβ1-40 administration x treadmill exercise interaction (F1,16 = 0.08, p = 0.77). Fig. 3E indicates that mice subjected to the physical exercise protocol presented a higher number of Paneth cells/crypt in comparison with the control group (p < 0.01). Aβ1-40 administration showed a trend (p = 0.09) to decrease the number of these cells as compared to the control group. Conversely, Aβ1-40-exposed mice subjected to physical exercise presented a higher number of Paneth cells as compared to Aβ1-40-sedentary mice (Aβ1-40 administration: F1,16 = 0.07, p = 0.79; exercise: F1,16 = 191.86, p < 0.01; Aβ1-40 administration x exercise: F1,16 = 5.10, p < 0.05). Concerning the crypt depth (Fig. 3F), two-way ANOVA revealed a significant main effect of Aβ1-40 administration (F1,16 = 5.40, p < 0.05), with mice exposed to Aβ1-40 administration showing a decrease in the crypt depth when compared with vehicle-treated mice (p < 0.05). A significant main effect of treadmill exercise (F1,16 = 18.17, p < 0.01) was also observed, with exercised mice presenting an increase in the crypt depth when compared with sedentary groups (p < 0.01). However, two-way ANOVA indicated no significant differences for Aβ1-40 administration x exercise interaction (F1,16 = 0.09, p = 0.76) in the crypt depth.
3.5. Effect of treadmill exercise and/or Aβ1-40 administration in the enrichment of bacteria from Firmicutes and Bacteroidetes phyla Fig. 6A shows no differences in the total number of bacteria regardless of the treatments (Aβ1-40 administration: F1,15 = 0.18, p=0.67; exercise: F1,15 = 0.22, p=0.64; Aβ1-40 administration x exercise: F1,15 = 0.43, p=0.52). Concerning the abundance of Firmicutes phylum (Fig. 6B), two-way ANOVA revealed a significant main effect of Aβ1-40 administration (F1,16 = 5.86, p < 0.05), with mice exposed to Aβ1-40 administration showing a reduction in the abundance of Firmicutes phylum when compared with vehicle-treated mice (p < 0.05). A significant main effect of treadmill exercise (F1,16 = 46.16, p < 0.01) was also observed, with exercised mice presenting an increase in the abundance of Firmicutes phylum when compared with sedentary groups (p < 0.01). However, two-way ANOVA indicated no significant differences for Aβ1-40 administration x treadmill exercise interaction (F1,16 = 0.77, p= 0.39). In addition, Fig. 6C shows increased Bacteroidetes abundance in the group of animals exposed to Aβ1-40 administration, an effect prevented by physical exercise (Aβ1-40 administration: F1,12 = 10.45, p < 0.01; exercise: F1,12 = 18.72, p < 0.01; Aβ1-40 administration x exercise: F1,12 = 9.80, p < 0.01). Finally, Fig. 6D shows that Aβ1-40 administration increased Bacteroidetes/Firmicutes ratio, whereas physical exercise prevented this alteration (Aβ1-40 administration: F1,12 = 13.61, p < 0.01; exercise: F1,12 = 15.35, p < 0.01; Aβ140 administration x exercise: F1,12 = 13.46, p < 0.01). 4. Discussion In the present study, we showed that Aβ1–40 induced a depressivelike behavior, as demonstrated by an increase in the immobility time in mice subjected to the TST, one of the most used predictive tests to screen depression-like behaviors. Importantly, this result is in agreement with previous studies that used similar protocols of Aβ1–40 administration [12,16,23]. Moreover, the decreased time spent sniffing urine from female in estrus cycle in FUST observed in Aβ1–40-exposed mice is suggestive of anhedonic-like behavior, since it has been reported that mice found a cotton-tipped applicator dipped in female urine in estrus cycle more rewarding than one dipped in water [21]. Nonetheless, it is important to mention that deficits in olfactory processing are a common feature in the early stages of Alzheimer's disease in humans [24] and animal models of AD [25]. However, the behavioral tests used to measure olfactory discrimination are based on the fact that mice prefer places with their own odor (familiar compartments) instead of places with unfamiliar odors as well as the absence of odors related to sexual stimulation [25,26]. According to the assumption that FUST is a behavioral paradigm based on the interest in pheromones odors from the opposite sex as a sexual incentive stimulus [21], this effect triggered by Aβ1–40 is likely related to the rewardseeking behavioral modulation, although we cannot rule out that Aβ1–40 administration could affect the olfactory function of mice, an issue that needs to be addressed in future studies. Interestingly, treadmill exercise for 4 weeks was able to increase time spent sniffing regardless of the exposure of mice to Aβ1–40 or vehicle, suggesting that exercised mice present a hedonic-like behavior. These results also indicate a beneficial role of physical exercise even for mice that underwent a functional deterioration due to Aβ1–40. Our results are supported by previous studies showing the ability of physical exercise in abrogating the anhedonic-like behavior induced by olfactory bulbectomy [27], dexamethasone [28], and maternal separation [29] rodent models of depression. Considering that recent literature has linked several facets of gut health with depression and AD [30–32], multiple parameters indicative of gut function were also analyzed. The small intestine is where most of
3.3. Effect of treadmill exercise and/or Aβ1-40 administration on microvilli morphology of duodenum assessed by transmission electron microscopy Fig. 4 illustrates photomicrographs obtained by transmission electron microscopy of a transverse section of the duodenum epithelium of mice subjected to Aβ1-40 administration and/or physical exercise. Regarding microvilli morphology, visible differences in length of these structures can be observed between the groups, with exercised mice presenting apparently higher microvilli length than the other groups. It is possible to observe abnormal epithelial microvilli obtained from sedentary Aβ1-40-exposed mice, characterized by shorter microvilli and heterogeneity in the length of these structures that exhibit a disordered packing. 3.4. Effect of treadmill exercise and/or Aβ1-40 administration on Paneth cell morphology in the duodenum assessed by transmission electron microscopy Fig. 5 shows photomicrographs obtained by transmission electron microscopy of Paneth cells from the duodenum of mice subjected to Aβ1-40 administration and/or physical exercise. These cells contain large secretory granules with a dense core surrounded by a pale halo. It is possible to observe that Aβ1-40 administration caused a reduction in the secretory granule diameter, as well as an enlarged peripheral halo, an ultrastructural alteration not observed in the photomicrographs obtained from exercised mice exposed to Aβ1-40 administration. 5
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Fig. 4. Photomicrographs obtained by transmission electron microscopy of a transverse section of duodenum epithelium of mice subjected to Aβ1-40 administration and/or physical exercise. A- sedentary; B- treadmill exercise; Csedentary/Aβ1-40; D- treadmill exercise/Aβ1-40. Arrows show microvilli. Images were taken with a magnification of 15,000 × (scale bar =1 μm).
regardless of the administration with vehicle or Aβ1–40. Importantly, goblet cells produce mucins that are highly glycosylated proteins which constitute a significant part of the intestinal epithelial protection by forming a dense mucus layer. This layer maintains surface hydration and reduces mechanical stress, besides limiting access of larger-molecular-weight toxins to the mucosa and preventing gut bacteria from penetrating through the intestinal epithelial barrier [35,36]. Therefore, the higher number of these cells induced by physical exercise could contribute to intestinal homeostasis. Another parameter evaluated herein was the number of Paneth cells, which are epithelial cells of the small intestine located at the
the products of the macronutrient hydrolysis are absorbed by enterocytes. These cells possess numerous microvilli which increase the surface area available for absorption [33]. Here, we showed that treadmill exercise increased duodenum villus length regardless of whether the animals were exposed to Aβ1–40. Similarly, swimming exercise was able to increase the length of villi in the jejunum of rats [34]. In addition, treadmill exercise increased villus width regardless of having received Aβ1–40. A similar pattern of protection by physical exercise was shown in the photomicrographs of microvilli in the border of enterocytes in the duodenum epithelium. Treadmill running also increased the number of goblet cells per villus in the duodenum
Fig. 5. Photomicrographs obtained by transmission electron microscopy of Paneth cells in the duodenum of mice subjected to Aβ1-40 administration and/or physical exercise. A - sedentary; B- treadmill exercise; C- sedentary/ Aβ1-40; D- treadmill exercise/Aβ1-40. SG = secretory granules; ER = endoplasmic reticulum. Images were taken with a magnification of 5000 x (scale bar =2 μm).
6
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Fig. 6. Effects of Aβ1-40 administration and/or treadmill running on total bacteria (A), Firmicutes abundance (B), Bacteroidetes abundance (C) and Bacteroidetes/ Firmicutes ratio (D) obtained by quantitative real-time PCR (n = 3-5 animals/group). Bars represent mean + S.E.M. **p < 0.01 as compared with vehicle-treated group; ##p < 0.01 as compared with sedentary Aβ1-40-exposed group; @ p < 0.05 between Aβ1-40-treated mice compared with their vehicle-treated counterparts (i.e., significant main effect of Aβ1-40 administration); $$ p < 0.01 as compared with sedentary mice (i.e., significant main effect of exercise). Two-way ANOVA followed by Duncan’s multiple range test.
and requires future studies. Several studies highlight Paneth cell contribution for the establishment of appropriate colonization with commensal microbiota [37,46]. Indeed, gut microbiota plays an important role in the bidirectional communication between the gut and the CNS [47]. In human adults, the phyla Bacteroidetes and Firmicutes are generally dominant in the gut, with other phyla comprising 10 % or less of the microbiome [14]. Aβ1–40-exposed mice had a decrease in Firmicutes in their fecal content. Accordingly, decreased Firmicutes was observed in fecal samples of Aβ precursor protein (APP) transgenic mouse model (model of AD) [48], in mice subjected to chronic restraint stress (an animal model of depression) [49], in AD individuals [32] as well as in patients with depression [47]. Here, we show that treadmill exercise protocol robustly increased the Firmicutes abundance regardless of the administration with vehicle or Aβ1-40. This result agrees with higher Firmicutes abundance observed after 4-weeks treadmill exercise training in obese rats [50] and in mice subjected to 6-weeks treadmill running [51]. Moreover, higher Firmicutes abundance was found in elite rugby players as compared with non-athlete healthy subjects [52]. Increased abundance of phylum Bacteroidetes was also observed in Aβ1-40-exposed mice. In line with this result, AD patients were reported to have a higher abundance of Bacteroidetes in the fecal microbiota as compared with healthy individuals [32]. Similarly, an increase in Bacteroidetes was reported in patients with major depressive disorder [53] and mice subjected to chronic restraint stress [54]. Although treadmill physical exercise did not alter this parameter in sedentary mice, it was capable of preventing Aβ1-40-induced increase on Bacteroidetes abundance. Although we did not detect any significant difference between sedentary and exercised mice concerning the abundance of Bacteroidetes phylum, it is important to mention that effect size i.e. the difference of means/SEM is far from being negligible. Noteworthy,
bottom of the intestinal crypts. These cells produce enteric antimicrobial peptides such as alpha-defensins that play an important role in small intestine innate immunity [37,38]. The higher number of these cells observed in exercised mice could be related to better functioning of the intestinal defense mechanisms in these animals. Reinforcing this assumption, photomicrographs show that physical exercise was able to counteract the reduction in the diameter of secretory granules per crypt in Paneth cells induced by Aβ1–40 administration. The chronic administration of probiotics to mice was reported to increase these cells at the base of the intestine crypt and increased number of granules per crypt [39]. Probiotics have been recognized as a novel strategy to counteract depressive-like behavior in mice [40,41] besides being useful for the management of depression in humans [42]. Therefore, it is tempting to speculate that the increase in Paneth cell numbers may have contributed to the antidepressant-like effect of physical exercise. This assumption is supported by the ability of treadmill running in increasing the crypt depth, a region in which Paneth cells are positioned alongside the multipotent stem cells. Importantly, dysfunction in crypt homeostasis may compromise Paneth cell function [37,38]. As previously demonstrated in mice [43,44], the photomicrographs obtained by transmission electron microscopy show that mouse Panethcell granules present a central core and peripheral halo. The core is composed of a polysaccharide-protein complex, whereas the halo is composed of acid mucopolysaccharide [45]. Here, photomicrographs show that Aβ1-40-exposed mice presented reduced secretory granule diameter and higher halo size, ultrastructural alterations not observed in Aβ1-40-exercised mice, suggesting that physical exercise exerts a protective effect against the morphological alterations caused by Aβ1-40 in these parameters. However, it is intriguing to observe that treadmill running per se increased the halo size when compared with the vehicletreated sedentary group. The explanation for this result is still obscure 7
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
Aβ1-40 consistently increased the Bacteroidetes/Firmicutes ratio, an effect completely prevented by physical exercise. Literature data regarding the influence of physical exercise on Bacteroidetes abundance has provided divergent results. Although some studies showed an absence of alteration on the abundance of this phylum or in Bacteroidetes/Firmicutes ratio in rats subject to wheel running [55] or in mice subjected to running wheel or treadmill running [56], others demonstrated an increase [57] or reduction [58] in the Bacteroidetes abundance following the practice of physical exercise in mice. Altogether, the results are suggestive that Aβ1-40 administration in mice causes alterations in microbiota composition that resembles those observed in individuals with AD and depression. The protective effect of treadmill physical exercise against these Aβ1-40-induced impairments could, at least in part, account for its ability to prevent the depressivelike behavior elicited by this AD model. Collectively, the results suggest a pivotal role of the gut-brain axis to depression/AD and the protective effect of treadmill running on this comorbidity. However, additional studies are necessary to characterize the genera of bacteria affected by these interventions.
2014.165. [9] S.P. Cass, Alzheimer’s disease and exercise: a literature review, Curr. Sports Med. Rep. 1 (2017) 19–22, https://doi.org/10.1249/JSR.0000000000000332. [10] T. Paillard, Y. Rolland, P. de Souto Barreto, Protective effects of physical exercise in Alzheimer’s disease and Parkinson’s disease: a narrative review, J. Clin. Neurol. 3 (2015) 212–219, https://doi.org/10.3988/jcn.2015.11.3.212. [11] R. Stanton, P. Reaburn, Exercise and the treatment of depression: a review of the exercise program variables, J. Sci. Med. Sport 2 (2014) 177–182, https://doi.org/ 10.1016/j.jsams.2013.03.010. [12] J.M. Rosa, F.L. Pazini, G. Olescowicz, A. Camargo, M. Moretti, J. Gil-Mohapel, A.L.S. Rodrigues, Prophylactic effect of physical exercise on Abeta1-40-induced depressive-like behavior: role of BDNF, mTOR signaling, cell proliferation and survival in the hippocampus, Prog. Neuropsychopharmacol. Biol. Psychiatry 94 (2019) e109646, , https://doi.org/10.1016/j.pnpbp.2019. [13] E.S. Ogbonnaya, G. Clarke, F. Shanahan, T.G. Dinan, J.F. Cryan, O.F. O’Leary, Adult hippocampal neurogenesis is regulated by the microbiome, Biol. Psychiatry 4 (2015) 7–9, https://doi.org/10.1016/j.biopsych.2014. [14] A. Dalton, C. Mermier, M. Zuhl, Exercise influence on the microbiome-gut-brain axis, Gut Microbes 31 (2019) 1–14, https://doi.org/10.1080/19490976.2018. [15] V. Monda, I. Villano, A. Messina, A. Valenzano, T. Esposito, F. Moscatelli, A. Viggiano, G. Cibelli, S. Chieffi, M. Monda, G. Messina, Exercise modifies the gut microbiota with positive health effects, Oxid. Med. Cell. Longev. (2017) e3831972, , https://doi.org/10.1155/2017/3831972. [16] J.M. Rosa, F.L. Pazini, M.P. Cunha, A.R.S. Colla, L.M. Manosso, G. Mancini, A.C.G. Souza, A.F. de Bem, R.D. Prediger, A.L.S. Rodrigues, Antidepressant effects of creatine on amyloid beta1-40-treated mice: the role of GSK-3beta/Nrf2 pathway, Prog. Neuropsychopharmacol. Biol. Psychiatry 86 (2018) 270–278, https://doi.org/ 10.1016/j.pnpbp.2018.05.001. [17] S.E. Laursen, J.K. Belknap, Intracerebroventricular injections in mice. Some methodological refinements, J. Pharmacol. Methods 4 (1986) 355–357, https://doi.org/ 10.1016/0160-5402(86)90038-0. [18] S.C. Barauna, M.P. Kaster, B.T. Heckert, K.S. do Nascimento, F.M. Rossi, E.H. Teixeira B.S. Cavada, A.L.S. Rodrigues, R.B. Leal, Antidepressant-like effect of lectin from Canavalia brasiliensis (ConBr) administered centrally in mice, Pharmacol. Biochem. Behav. 1 (2006) 160–169, https://doi.org/10.1016/j.pbb.2006.07.030. [19] F. Ludka, M.P. Cunha, T. Dal-Cim, L.B. Binder, L.C. Constantino, C.M. Massari, W.C. Martins, A.L.S. Rodrigues, C.I. Tasca, Atorvastatin protects from Abeta1-40Induced cell damage and depressive-like behavior via ProBDNF cleavage, Mol. Neurobiol. 8 (2017) 6163–6173, https://doi.org/10.1007/s12035-016-0134-6. [20] L. Steru, R. Chermat, B. Thierry, P. Simon, The tail suspension test: a new method for screening antidepressants in mice, Psychopharmacology 3 (1985) 367–370, https://doi.org/10.1007/bf00428203. [21] O. Malkesman, M.L. Scattoni, D. Paredes, T. Tragon, B. Pearson, G. Shaltiel, G. Chen, J.N. Crawley, H.K. Manji, The female urine sniffing test: a novel approach for assessing reward-seeking behavior in rodents, Biol. Psychiatry 9 (2010) 864–871, https://doi.org/10.1016/j.biopsych.2009.10.018. [22] N. Fierer, J.A. Jackson, R. Vilgalys, R.B. Jackson, Assessment of soil microbial community structure by use of taxon-specific quantitative PCR assays, Appl. Environ. Microbiol. 71 (2005) 4117–4120, https://doi.org/10.1128/AEM.71.7. 4117-4120.2005. [23] A.C. Guerra de Souza, C.L. Gonçalves, V. de Souza, J.M. Hartwig, M. Farina, R.D. Prediger, Agmatine attenuates depressive-like behavior and hippocampal oxidative stress following amyloid beta (Abeta1-40) administration in mice, Behav. Brain Res. 353 (2018) 51–56, https://doi.org/10.1016/j.bbr.2018.06.032. [24] C. Murphy, Olfactory and other sensory impairments in Alzheimer disease, Nat. Rev. Neurol. 15 (2018) 11–24, https://doi.org/10.1038/s41582-018-0097-5. [25] A. Raj, S. Dey, D.U. Maheshwari, S.N. Manjula1, S.V. Madhunapantula, M. Ali, Evaluating the olfactory dysfunction and cognitive deficits induced by intracerebroventricular injection of Amyloid beta (1–42) in female C57BL/6 mice, J. Appl. Pharm. Sci. 9 (2019) 24–34, https://doi.org/10.7324/JAPS.2019.91004. [26] V.V. Santos, R. Stark, D. Rial, H.B. Silva, J.A. Bayliss, M.B. Lemus, J.S. Davies, R.A. Cunha, R.D. Prediger, Z.B. Andrews, Acyl ghrelin improves cognition, synaptic plasticity deficits and neuroinflammation following amyloid β (Aβ1-40) administration in mice, J. Neuroendocrinol. 29 (2017) 1–11, https://doi.org/10.1111/jne. 12476. [27] M.S. Shin, S.S. Park, J.M. Lee, T.W. Kim, Y.P. Kim, Treadmill exercise improves depression-like symptoms by enhancing serotonergic function through upregulation of 5-HT1A expression in the olfactory bulbectomized rats, J. Exerc. Rehabil. 13 (2017) 36–42, https://doi.org/10.12965/jer.1734918.459. [28] W. L, Y. Xu, J. Lu, Y. Zhang, H. Sheng, X. Ni, Swimming exercise ameliorates depression-like behaviors induced by prenatal exposure to glucocorticoids in rats, Neurosci. Lett. 524 (2012) 119–123, https://doi.org/10.1016/j.neulet.2012.07. 011. [29] M. Sadeghi, M. Peeri, M.J. Hosseini, Adolescent voluntary exercise attenuated hippocampal innate immunity responses and depressive-like behaviors following maternal separation stress in male rats, Physiol. Behav. 163 (2016) 177–183, https://doi.org/10.1016/j.physbeh.2016.05.017. [30] S. Liang, X. Wu, X. Hu, T. Wang, F. Jin, Recognizing depression from the microbiota−Gut−Brain Axis, Int. J. Mol. Sci. 19 (2018) e1592, https://doi.org/10. 3390/ijms19061592. [31] D. Serra, L.M. Almeida, T.C.P. Dinis, The impact of chronic intestinal inflammation on brain disorders: the microbiota-gut-Brain Axis, Mol. Neurobiol. 56 (2019) (2019) 6941–6951, https://doi.org/10.1007/s12035-019-1572-8. [32] N.M. Vogt, R.L. Kerby, K.A. Dill-McFarland, S.J. Harding, A.P. Merluzzi, S.C. Johnson, C.M. Carlsson, S. Asthana, S. Zetterberg, H. Blennow, K. Bendlin, B.B. Rey, Gut microbiome alterations in Alzheimer’s disease, Sci. Rep. 7 (2017)
Author statement The authors declare that no financial support or compensation has been received from any individual or corporate entity over the past three years for research or professional service and there are no personal financial holdings that could be perceived as constituting a potential conflict of interest. Declaration of Competing Interest The authors declare that they have no conflicts of interest to disclose. Acknowledgments This study was supported by grants from Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), Brazil # 310113/ 2017-2, 150082/2018-5, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES), Brazil. ALSR is the recipient of a CNPq Research Productivity Fellowship. Authors thank Laboratório Multiusuário de Estudos em Biologia (LAMEB) for support and the staff of the Central Laboratory of Electron Microscopy (LCME), Federal University of Santa Catarina, Florianópolis, Santa Catarina, Brazil for the use of the transmission electron microscope. References [1] C.A. Lane, J. Hardy, J.M. Schott, Alzheimer’s disease, Eur. J. Neurol. 25 (2018) 59–70, https://doi.org/10.1111/ene.13439. [2] C.P.C. Galts, L.E.B. Bettio, D.C. Jewett, C.C. Yang, P.S. Brocardo, A.L.S. Rodrigues, J.S. Thacker, J. Gil-Mohapel, Depression in neurodegenerative diseases: common mechanisms and current treatment options, Neurosci. Biobehav. Rev. 102 (2019) 56–84, https://doi.org/10.1016/j.neubiorev.2019.04.002. [3] S. Chi, J.T. Yu, M.S. Tan, L. Tan, Depression in Alzheimer’s disease: epidemiology, mechanisms, and management, J. Alzheimers Dis. 42 (2014) 739–755, https://doi. org/10.3233/JAD-140324. [4] Q.F. Zhao, L. Tan, H.F. Wang, T. Jiang, M.S. Tan, L. Tan, W. Xu, J.Q. Li, J. Wang, T.J. Lai, J.T. Yu, The prevalence of neuropsychiatric symptoms in Alzheimer’s disease: systematic review and meta-analysis, J. Affect. Disord. 15 (2016) 264–271, https://doi.org/10.1016/j.jad.2016.04.054. [5] M.C. Cenit, Y. Sanz, P. Codoner-Franch, Influence of gut microbiota on neuropsychiatric disorders, World J. Gastroenterol. 14 (2017) 5486–5498, https://doi. org/10.3748/wjg.v23.i30.5486. [6] S.G. Cheung, A.R. Goldenthal, A.C. Uhlemann, J.J. Mann, J.M. Miller, M.E. Sublette, Systematic review of gut microbiota and major depression, Front. Psychiatry 10 (2019) e34, https://doi.org/10.3389/fpsyt.2019.00034. [7] E.M.M. Quigley, Microbiota-brain-Gut Axis and neurodegenerative diseases, Curr. Neurol. Neurosci. Rep. 17 (2017) 1–9, https://doi.org/10.1007/s11910-0170802-6. [8] H. Zhang, J.B.Sparks S.V. Karyala, R. Settlage, X.M. Luo, Host adaptive immunity alters gut microbiota, ISME J. 3 (2015) 770–781, https://doi.org/10.1038/ismej.
8
Behavioural Brain Research 393 (2020) 112791
J.M. Rosa, et al.
[48] T. Harach, N. Marungruang, N. Duthilleul, V. Cheatham, K.D. Mc Coy, G. Frisoni, J.J. Neher, F. Fåk, M. Jucker, T. Lasser, T. Bolmont, Reduction of Abeta amyloid pathology in APPPS1 transgenic mice in the absence of gut microbiota, Sci. Rep. 7 (2017) e41802, https://doi.org/10.1038/srep46856. [49] X. Guo, J. Li, R. Tang, G. Zhang, H. Zeng, R.J. Wood, Z. Liu, High fat diet alters gut microbiota and the expression of paneth cell-antimicrobial peptides preceding changes of circulating inflammatory cytokines, Mediators Inflamm. (2017) e9474896, https://doi.org/10.1155/2017/9474896. [50] B.A. Petriz, A.P. Castro, J.A. Almeida, C.P. Gomes, G.R. Fernandes, R.H. Kruger, R.W. Pereira, O.L. Franco, Exercise induction of gut microbiota modifications in obese, non-obese and hypertensive rats, BMC Genomics 15 (2014) e511, https:// doi.org/10.1186/1471-2164-15-511. [51] J.E. Lambert, J.P. Myslicki, M.R. Bomhof, D.D. Belke, J. Shearer, R.A. Reimer, Exercise training modifies gut microbiota in normal and diabetic mice, Appl. Physiol. Nutr. Metab. 7 (2015) 749–752, https://doi.org/10.1139/apnm-20140452. [52] S.F. Clarke, E.F. Murphy, O. O’Sullivan, A.J. Lucey, M. Humphreys, A. Hogan, P. Hayes, M. O’Reilly, I.B. Jeffery, R. Wood-Martin, D.M. Kerins, E. Quigley, R.P. Ross, P.W. O’Toole, M.G. Molloy, E. Falvey, F. Shanahan, P.D. Cotter, Exercise and associated dietary extremes impact on gut microbial diversity, Gut. 63 (2014) 1913–1920, https://doi.org/10.1136/gutjnl-2013-306541. [53] H. Jiang, Z. Ling, Y. Zhang, H. Mao, Z. Ma, Y. Yin, W. Wang, W. Tang, Z. Tan, J. Shi, L. Li, B. Ruan, Altered fecal microbiota composition in patients with major depressive disorder, Brain Behav. Immun. 48 (2015) 186–194, https://doi.org/10. 1016/j.bbi.2015.03.016. [54] Y. Guo, J. Xie, X. Li, Y. Yuan, L. Zhang, W. Hu, H. Luo, H. Yu, R. Zhang, Antidepressant effects of rosemary extracts associate with anti-inflammatory effect and rebalance of gut microbiota, Front. Pharmacol. 9 (2018) e1126, https://doi. org/10.3389/fphar.2018.01126. [55] T.W. Liu, Y.M. Park, H.D. Holscher, J. Padilla, R.J. Scroggins, R. Welly, S.L. Britton, L.G. Koch, V.J. Vieira-Potter, K.S. Swanson, Physical activity differentially affects the cecal microbiota of ovariectomized female rats selectively bred for high and low aerobic capacity, PLoS One 8 (2015) e0136150, https://doi.org/10.1371/journal. pone.0136150. [56] J.M. Allen, M.E. Berg Miller, B.D. Pence, K. Whitlock, V. Nehra, H.R. Gaskins, B.A. White, J.D. Fryer, J.A. Woods, Voluntary and forced exercise differentially alters the gut microbiome in C57BL/6J mice, J. Appl. Physiol. 118 (2015) 1059–1066, https://doi.org/10.1152/japplphysiol.01077.2014. [57] C.C. Evans, K.J. LePard, J.W. Kwak, M.C. Stancukas, S. Laskowski, J. Dougherty, L. Moulton, A. Glawe, Y. Wang, V. Leone, D.A. Antonopoulos, D. Smith, E.B. Chang, M.J. Ciancio, Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity, PLoS One 3 (2014) e92193, https:// doi.org/10.1371/journal.pone.0092193. [58] S.S. Kang, P.R. Jeraldo, A. Kurti, M.E. Miller, M.D. Cook, K. Whitlock, N. Goldenfeld, J.A. Woods, B.A. White, N. Chia, J.D. Fryer, Diet and exercise orthogonally alter the gut microbiome and reveal independent associations with anxiety and cognition, Mol. Neurodegener. 9 (2014) e36, https://doi.org/10.1186/ 1750-1326-9-36.
e13537, , https://doi.org/10.1038/s41598-017-13601-y. [33] J.M. DeSesso, C.F. Jacobson, Anatomical and physiological parameters affecting gastrointestinal absorption in humans and rats, Food Chem. Toxicol. 39 (2001) 209–228, https://doi.org/10.1016/s0278-6915(00)00136-8. [34] J.R. Gomes, J.R. Freitas, S. Grassiolli, Effects of physical exercise on the intestinal mucosa of rats submitted to a hypothalamic obesity condition, Anat Rec (Hoboken) 299 (2016) 1389–1396, https://doi.org/10.1002/ar.23453. [35] J.M. Allaire, V. Morampudi, S.M. Crowley, M. Stahl, H. Yu, K. Bhullar, L.A. Knodler, B. Bressler, K. Jacobson, B.A. Vallance, Frontline defenders: goblet cell mediators dictate host-microbe interactions in the intestinal tract during health and disease, Am. J. Physiol. Gastrointest. Liver Physiol. 314 (2018) 360–377, https://doi.org/ 10.1152/ajpgi.00181.2017. [36] Y.S. Kim, S.B. Ho, Intestinal goblet cells and mucins in health and disease: recent insights and progress, Curr. Gastroenterol. Rep. 5 (2010) 319–330, https://doi.org/ 10.1007/s11894-010-0131-0132. [37] N. Gassler, Paneth cells in intestinal physiology and pathophysiology, World J. Gastrointest. Pathophysiol. 4 (2017) 150–160, https://doi.org/10.4291/wjgp.v8.i4. 150. [38] H.C. Clevers, C.L. Bevins, Paneth cells: maestros of the small intestinal crypts, Annu. Rev. Physiol. 75 (2013) 289–311, https://doi.org/10.1146/annurev-physiol030212-183744. [39] S.I. Cazorla, C. Maldonado-Galdeano, R. Weill, J. De Paula, G.D.V. Perdigon, Oral administration of probiotics increases Paneth cells and intestinal antimicrobial activity, Front. Microbiol. 9 (2018) e736, https://doi.org/10.3389/fmicb.2018. 00736. [40] J. Sun, F. Wang, X. Hu, C. Yang, H. Xu, Y. Yao, J. Liu, Clostridium butyricum attenuates chronic unpredictable mild stress-induced depressive-like behavior in mice via the gut-brain Axis, J. Agric. Food Chem. 31 (2018) 8415–8421, https://doi.org/ 10.1021/acs.jafc.8b02462. [41] A. Slyepchenko, A.F. Carvalho, D.S. Cha, S. Kasper, R.S. McIntyre, Gut emotions mechanisms of action of probiotics as novel therapeutic targets for depression and anxiety disorders, CNS Neurol. Disord. Drug Targets 10 (2014) 1770–1786, https:// doi.org/10.2174/1871527313666141130205242. [42] R. Huang, K. Wang, J. Hu, Effect of probiotics on depression: a systematic review and meta-analysis of randomized controlled trials, Nutrients 8 (2016) e483, https:// doi.org/10.3390/nu8080483. [43] Y. Satoh, M. Yamano, M. Matsuda, K. Ono, Ultrastructure of Paneth cells in the intestine of various mammals, J. Electron Microsc. Tech. 1 (1990) 69–80, https:// doi.org/10.1002/jemt.1060160109. [44] W.D. Troughton, J.S. Trier, Paneth and goblet cell renewal in mouse duodenal crypts, J. Cell Biol. 41 (1969) 251–268, https://doi.org/10.1083/jcb.41.1.251. [45] J.C. Hampton, Effects of fixation on the morphology of Paneth cell granules, Stain Technol. 40 (1965) 283–291, https://doi.org/10.3109/10520296509116428. [46] D.A. Elphick, Y.R. Mahida, Paneth cells: their role in innate immunity and inflammatory disease, Gut. 54 (2005) 1802–1809, https://doi.org/10.1136/gut.2005. 068601. [47] T.T. Huang, J.B. Lai, Y.L. Du, Y. Xu, L.M. Ruan, S.H. Hu, Current understanding of gut microbiota in mood disorders: an update of human studies, Front. Genet. 10 (2019) e98, https://doi.org/10.3389/fgene.2019.00098.
9