- Email: [email protected]
Protection against lethal enterovirus 71 infection in newborn mice by passive immunization with subunit VP1 vaccines and inactivated virus
Vaccine 20 (2002) 895–904
Protection against lethal enterovirus 71 infection in newborn mice by passive immunization with subunit VP1 vaccines and inactivated virus夽 Cheng-Nan Wu a,b,1 , Ya-Ching Lin b , Cathy Fann b , Nan-Shih Liao c , Shin-Ru Shih d , Mei-Shang Ho b,∗ a
Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan, ROC b Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, ROC c Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, ROC d School of Medical Technology, Chang Gung University, Tao-Yuan, Taiwan, ROC Received 17 May 2001; received in revised form 6 August 2001; accepted 21 August 2001
Abstract Enterovirus 71 (EV71), the newest member of Enteroviridae, is notable for its etiological role in epidemics of severe neurological diseases in children. Developing effective vaccines is considered a top choice among all control measures. We compared the inactivated virus vaccine (10 g protein/mouse) with subunit vaccines — VP1 DNA vaccine (100 g/mouse) or recombinant VP1 protein (10 g/mouse), in its ability to elicit maternal antibody and to provide protection against lethal infection of EV71 in suckling mice. Prior to gestation, all three groups of vaccinated dams possessed similar levels of neutralizing antibody. With a challenge dose of 2300 LD50 virus/mouse, suckling mice born to dams immunized with inactivated virus showed 80% survival. The subunit vaccines provided protection only at a lower challenge dosage of 230 LD50 per mouse, with 40% survival for DNA vaccine and 80% survival for VP1 protein. The cytokine profile produced by splenocytes showed a high level of IL-4 in the inactivated virus group, high levels of IFN-␥ and IL-12 in the DNA vaccine group, and high levels of IL-10 and IFN-␥ in the VP1 protein group. Overall, the inactivated virus elicited a much greater magnitude of immune response than the subunit vaccines, including total IgG, all four IgG subtypes, and T-helper-cell responses; these antibodies were shown to be protective against lethal infection when passively transferred to susceptible newborn mice. Our data indicated that inactivated virus is the choice of vaccine preparation capable of fulfilling the demand for effective control, and that VP1 subunit vaccines remain promising vaccine strategies that require further refinement. © 2001 Elsevier Science Ltd. All rights reserved. Keywords: DNA vaccine; Subunit VP1 vaccine; Enterovirus 71
1. Introduction Enterovirus 71 (EV71) is a human enterovirus belonging to the Enterovirus genus of the Picornavirus family. Since its first reporting in 1974 [1], several large outbreaks of EV71 infection have been reported, including hand foot and mouth disease [2], polio-like paralysis [3,4], and fatal encephalitis with cardiopulmonary complication [5–7]. EV71 appears to be emerging as an increasingly important virulent neurotropic enterovirus in the upcoming era of poliomyelitis eradication [8]. Since no effective antiviral agents are available, developing vaccines for primary prevention is consid夽 This manuscript was presented in part as a poster during the XIIth International Congress of Virology, Sydney, Australia, 9–13 August 1999. ∗ Corresponding author. Tel.: +886-2-2789-9120; fax: +886-2-2782-3047. E-mail address: [email protected] (M.-S. Ho). 1 Recipient of Mei-Chao Research Award, 1998–2000.
ered to be the best choice among control strategies against EV71. Conventional vaccines, using whole virus particles as live attenuated or inactivated vaccine, have achieved successful control of several viral infections, among which poliomyelitis is facing imminent eradication. Recombinant DNA technology, which delivers only the target subunit antigen and causes fewer adverse effects, is theoretically the choice technology for vaccine production and may be applicable in most viral infections. The isolated viral surface proteins, if they assume a proper conformation, generally possess neutralizing epitopes; one such successful example is hepatitis B virus vaccine [9]. More recently, DNA vectors containing genes encoding viral antigens have also been shown to elicit antibodies and cell-mediated immunity in animal models against viral infections, including influenza virus, human immunodeficiency virus, Dengue virus, Japanese encephalitis virus, and Coxsackievirus B3 [10–17]. A DNA vaccine might provide advantages over conventional vaccines in that it can
0264-410X/01/$ – see front matter © 2001 Elsevier Science Ltd. All rights reserved. PII: S 0 2 6 4 - 4 1 0 X ( 0 1 ) 0 0 3 8 5 - 1
896
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
elicit MHC class I-restricted CD8+ T-cell responses while mitigating some safety concerns associated with live vaccines, and can be stored and transported easily without going through the cumbersome process of “cold chain”. While therapeutic and prophylactic DNA vaccine clinical trials are underway for a variety of infectious diseases and cancers, the scientific basis of DNA vaccines has yet to be clearly defined. If DNA vaccines pass all scientific and regulatory scrutiny, they promise to be products of the next generation. In this study, we compared the potential of inactivated viral particles and two subunit virus vaccines, one administered as a DNA-based vaccine and the other as a recombinant protein vaccine, to elicit immunity and to provide protection against lethal EV71 challenge in susceptible newborn mice. 2. Materials and methods 2.1. Virus growth and purification The neu strain of EV71 was isolated from an autopsied specimen of the spinal cord of an 8-year-old child [18]. A branch lineage of neu, termed YN3, was obtained after two runs of plaque purification in Vero cells. The YN3 strain is highly virulent for newborn ICR mice; infections with the YN3 strain (LD50 4.3 × 10 TCID50 virus) in ICR newborn mice invariably causes hind limb paralysis followed by death (manuscript in preparation). The neu strain, propagated in rhabdomyosarcoma cells (RD) using DMEM with 2% serum, was used as the prototype vaccine virus in antigen preparation. YN3, propagated in African green monkey kidney cells (Vero) using DMEM with 2% serum, was used as the challenge virus in all protection studies. All cell lines were purchased from American Type Culture Collection. The virus in the culture fluid was purified by precipitation with 20% polyethylene glycol 6000 and then centrifugation on a 40–65% discontinuous sucrose gradient at 80,000 × g for 4 h and re-purification on 5–40% liner CsCl gradient at 120,000 × g for 4 h. The virus titre was determined as TCID50 on Vero cells based on a typical cytopathic effect (CPE) produced by viral infection. Before used as a vaccine, the virus was inactivated by heating at 56◦ C for 30 min as previously described [19]. The amount of virion protein was quantified by Bradford method (Bio-Rad protein assay, Bio-Rad Inc., CA). 2.2. Construction of plasmids Viral RNA was extracted from the culture fluid of the neu-infected cells using a commercially-available kit (QIAamp viral RNA mini kit, Qiagen Inc., Santa Clara, CA). The first strand cDNA was synthesized using reverse transcriptase (Promega) and a primer (5 -TCCTCCTGCGAAGCTGCTGACT) that was complementary to the 3 -end of the viral gene encoding capsid protein VP1. The double-stranded cDNA encoding the entire
VP1 protein was amplified by polymerase chain reaction (PCR) for 35 cycles (94 × 1, 55 × 1 and 72◦ C × 2 min), using Pfu DNA polymerase (Stratagene) and a pair of primers (Envp1F/CACTCTTCCATGGATATCCTACAGACAGGCA, Envp1R/TCCTCTTCTAAGGAGAGTGGTRATTGCTGTGCGAC) designed according to the known viral gene sequence encoding the C- and N-termini of VP1 [18,20]. The PCR amplicon of the entire VP1 gene with an additional EcoRI restriction site at both ends was digested, prior to the insertion into plasmid pcDNA3 (Invitrogen Inc., CA) for the DNA vaccine construct and into pDual vector (Stratagene) for the expression of recombinant VP1 (Fig. 1A). Verification of the inserted viral VP1 sequence was performed using the automated dideoxynucleotide chain termination method (ABI prism dye terminator cycle sequencing ready reaction kit, Perkin-Elmer Inc., CA). Verification of proper VP1 protein expression was carried out in BHK cells by transient transfection of the pEvP1D plasmid using Lipofectamine (Gibco BRL). After 48 h of incubation, the transfected BHK cells were lysed with Nonident P40 lysis buffer (Sigma Inc., St. Louis, MO), and centrifuged at 12,000 rpm for 10 min. The supernatant containing expressed VP1 was collected and examined by western blotting. 2.3. VP1 expression and purification The recombinant VP1 protein expressed in E. coli BL21(DE3) that had been transformed with the pEvP1E plasmid was a fusion protein containing calmodulin binding peptide (CBP), which was used as a target in a calmodulin affinity column for purification. After 4 h induction by IPTG, cells were centrifuged (6000 rpm × 10 min) and collected in CaCl2 binding buffer. Cells were lysed by lysozyme (final concentration 200 mg/ml) and by sonication using a microtip. The lysate was centrifuged (12,000 rpm × 10 min), and the supernatant was then transferred to a calmodulin affinity purification column (Stratagene). Proteins were subsequently eluted from the column matrix by EDTA-containing elution buffer (50 mM Tris–HCl (pH 8.0), 10 mM mercaptoethanol, 2 mM EDTA, and 150 mM NaCl). The amount of recombinant protein was quantified by Bradford method (Bio-Rad). 2.4. Neutralization antibody assay The neutralization test was carried out by a TCID50 reduction assay in Vero cells [21]. Serum samples were incubated at 56◦ C for 30 min to inactivate the complement. All serum samples were tested in triplicate and with a two-fold serial dilution before mixing with equal volumes of virus containing 102 TCID50 , and then plated onto monolayers of Vero cells growth to 80% confluence. After 3 days of growth in 2% serum, the titre was read as the highest dilution that resulted in more than 50% CPE. The neutralization titre was taken as the average of the triplicates.
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
897
CPE cells were fixed on the plate by a mixture of acetone and methanol (3:2) for 15 min before washing. Non-fat powdered milk (5%) in PBS was used to block nonspecific binding (RT × 1 h). The plate was washed with PBS containing 0.01% Tween 20. Fifty microliters of serially-diluted test serum was added to each well and incubated for 1 h at 37◦ C. The plate was washed before incubation with peroxidase conjugated goat anti-mouse IgG (H + L) (1:1000 dilution) (Jackson Inc., West Grove, PA) at 37◦ C for 1 h. The color was generated by adding OPD substrate, and the positive cut-off value was defined as 1.5 times optical density of a normal mouse serum used as negative control. 2.6. Immunization of mice Adult female BALB/c or ICR mice in groups of 10 were immunized with either 100 g plasmid DNA by intramuscular (i.m.) injection, 10 g VP1 recombinant protein with complete adjuvant by intraperitoneal (i.p.) injection, or heat inactivated virus (total protein of 10 g) with complete adjuvant by i.p. inoculation. The control groups, each of five mice, were injected with backbone vector for DNA vaccine (i.m.), cell lysate of E. coli BL21(DE3) with no trnasformation (i.p.), or RD-cell lysate (i.p.). After 5 weeks of immunization, animals were boosted once more with the same dose of antigen. 2.7. Th-cell proliferation assay and cytokine production
Fig. 1. (A) Schematic representation of the expression cassettes of the recombinant plasmids used for expression of VP1 protein. The RT-PCR amplicon of VP1 gene plus an initiation codon after the digestion of EcoRI was inserted into pcDNA3 as DNA vaccine (pEv-VP1D) and inserted into pDual (pEv-VP1E) for the expression cassette of recombinant VP1 protein. (B) VP1 protein expression was confirmed by western blotting assay. A 36 kDa protein from BHK cell transfected with plasmid pEv-VP1D and a 40 kDa protein from E. coli BL21(DE3) transformed with plasmid pEv-VP1E were detected by EV71 monoclonal antibody.
2.5. Total specific IgG antibody against EV71 Total anti-EV71 IgG was measured by ELISA using whole virus as coating antigen in an OPD system [22]. Mouse serum samples were collected by tail vein bleeding at specified times post-immunization. The coating viral antigen for ELISA was prepared in a 96-well plate by growing the neu strain (104 TCID50 per well) in Vero cells until more than 50% cells showed CPE. The virus-laden
Splenocytes from individual mice were harvested, and RBCs were lysed with a 0.84% NH4 Cl solution. After several washes in PBS, 106 splenocytes per well were cultured in 96-well plates with 200 ml RPMI 1640 (10% FCS, 1% l-glutamine, and 1% neomycin) in the presence of 5 g recombinant VP1 protein. For each mouse, triplicate wells were set-up for cytokine study, and additional triplicates for [3 H]methylthymidine incorporation study. Plates were incubated for 72 h at 37◦ C in a 5% CO2 incubator. Culture supernatant of the proliferating splenocytes was collected at 48 h and assayed for IFN-␥, IL-4, IL-10, and IL-12 production by a commercially available ELISA kit (Endogen, Woburn, MA). Incorporation of [3 H]methylthymidine (50 Ci/ml) was achieved by adding 20 l [3 H]methylthymidine to each well during the last 16–18 h of incubation. With a semi-automated cell harvesting apparatus, cells were harvested onto glass fiber filters which were placed in scintillation fluid and counted in a scintillation -counter (Beckman 1800 LS). 2.8. IgG subtype distribution The profiles of anti-EV71-specific IgG subtypes in mouse serum were determined by a commercial mouse type subisotyping kit (Zymed Inc.) using whole-virus-coating plates as described above. Serial dilution of a known amount of
898
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
commercially purified EV71 virus-specific IgG1 mouse neutralizing mAbs (Chemicon) was used as a positive control for EV71-specific IgG1; this assay could detect less than 4.3 pg/ml of EV71-specific IgG1 in mouse serum. 2.9. Mice model of protection lethal enterovirus 71 infection EV71 infection caused no apparent clinical symptoms in adult BALB/c, C3H, ICR, CD28 knock-out, and TNF-␣ receptor knock-out mice. In ICR newborn mice, EV71 infection resulted in hind limb paralysis and eventual death within 2 weeks of challenge. The ICR suckling mice possessing passively transferred maternal EV71 antibody were challenged at less than 24 h of age with the YN3 strain by i.p. The mice were observed daily for the occurrence of mortality as the experimental endpoint. 2.10. Survival statistical analysis to protection study Time-to-event data analysis, such as mortality among the three groups of mice, was made using log rank survival analysis. Pairwise comparisons of survival probability between immunized and control groups were performed after an overall comparison was made. All tests were two-sided; a P-value of less than 0.05 was considered significant.
3. Results 3.1. Construction of plasmids and expression of VP1 protein The VP1 subunit vaccines were prepared by inserting the entire VP1 gene into plasmid pcDNA3, designated as pEv-VP1D for DNA vaccine, and into plasmid pDual, designated as pEv-VP1E for VP1 protein expression (Fig. 1A). A 36 kDa VP1 product from cell lysate of BHK cells transiently transfected with pEv-VP1D and a 40 kDa recombinant VP1 fusion protein in E. coli BL21(DE3) lysate was recognized by EV71 neutralizing monoclonal antibody (Fig. 1B) and by mouse polyclonal antiserum (data not shown). 3.2. Immunogenicity 3.2.1. Neutralization antibody Immunogenicity of the three vaccines was evaluated in BALB/c mice by in vitro microneutralization assay. The assay detects only antibody capable of blocking virus entry into the host cell. All immunized mice, regardless of the antigen type, showed a significant rise in the neutralization titre in comparison to the control mice, i.e. no individual non-responder. The second dose of vaccination resulted in a further rise of the neutralization titre by the seventh week
Fig. 2. Titres of EV71 antibody in three groups of BALB/c mice each received two doses of plasmid pEv-VP1D (䉲), VP1 recombinant protein derived from E. coli (䊏), or heat inactivated virus (䊉) with immunization schedule as indicated by arrows. The corresponding control groups received plasmid of the DNA vaccine backbone pcDNA3 (), E. coli lysate (䊐), and RD-cell lysate (䊊). (A) Titres of neutralizing antibody against EV71 as assayed by endpoint dilution of serum in a microneutrolization assay. (B) Titres of total IgG antibody against EV71 viral particles were determined by ELISA.
(Fig. 2A). The neutralization titres of all three experimental groups maintained a significantly elevated level for at least 20 weeks post-immunization. The titres were still detectable at 32 weeks post-immunization, but were only slightly higher than those of the control groups. While the DNA vaccine group reached a lower peak neutralization titre than the recombinant protein and inactivated virus groups after boosting, it maintained a higher neutralization titre, similar to that of the inactivated virus group, than the recombinant protein group at 32 weeks post-immunization (Fig. 2A). 3.2.2. Total IgG and subtypes The total anti-EV71-specific IgG of vaccines was measured by ELISA. The total IgG production was highest in
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
899
Table 1 The distribution of specific anti-EV71 IgG subtypes in BALB/c immunized mice with three types of antigen preparationa Types of antigen preparation administered
OD405 nm of ELISA for EV71 specific IgG at serum dilution of 1:25 IgG1 OD (S.D.)
IgG2a OD (S.D.)
IgG2b OD (S.D.)
IgG3 OD (S.D.)
DNA vaccine (n = 5) VP1 protein (n = 5) Inactivated virus (n = 5)
0.14 (0.02) 0.31 (0.05) 1.08 (0.16)
0.20 (0.03) 0.16 (0.02) 1.09 (0.15)
0.23 (0.04) 0.30 (0.04) 1.27 (0.08)
0.08 (0.01) 0.06 (0.01) 0.77 (0.09)
IgG1:IgG2a
1:1.4 2:1 1:1
a Three groups of mice received pEv-VP1D plasmid, recombinant VP1 protein, or inactivated virus. At tenth week post-immunization, mouse sera were collected by tail vein bleeding and assayed for specific anti-EV71 IgG subtypes by ELISA. Serum samples of each vaccinated group were pooled and tested in triplicate in three separate experiments. The relative titre is expressed as the optical density at 405 nm (OD405 nm ), and S.D. of OD is in parenthesis.
the group that received inactivated virus, with a more than 32-fold higher level at week 3 and more than 256-fold higher level at week 7, compared to the two groups that received subunit vaccines (Fig. 2B). We further delineated the profiles of serum IgG subtypes elicited by each antigen preparation (Table 1). The inactivated virus group showed a much higher OD value of all IgG subtypes, including IgG3 that was not detectable in the subunit vaccine groups. The recombinant protein group showed a slightly higher OD value of IgG1 and IgG2b than the DNA vaccine group. 3.3. Th-cell proliferation The strength of Th-cell responses plays a crucial role in mediating both humoral and cellular immunity. In the splenocytes ex vivo proliferation assay, EV71-specific T-cells proliferated upon stimulation by the recombinant VP1 protein and the degree of proliferation was used as a specific indicator of CD4+ activation. PHA stimulation was used as a positive control for general polyclonal responses to nonspecific antigen stimulation. At 12 weeks post-immunization, splenocytes of all immunized mice showed an enhanced Th-cell proliferation response (Fig. 3A). Spleen cells of mice that received inactivated virus, however, showed a greater increase in Th-cell proliferation than the two groups that received subunit vaccines. 3.4. Cytokine production by enterovirus 71 virus-specific T-cells Profiles of cytokine production by the ex vivo proliferating splenocytes were studied as indicators of the polarization of Th1/Th2 immune response. The Th1 (IFN-␥ and IL-12) and Th2 (IL-4 and IL-10) cytokines in the supernatants of splenocytes after stimulation with VP1 recombinant protein were investigated by ELISA (Fig. 3B). Splenocytes of mice immunized with inactivated virus produced the highest level of IL-4 and the lowest level of IFN-␥ compared with the two subunit groups. Splenocytes derived from the DNA vaccine group produced the highest level of IFN-␥ and the lowest level of IL-4. Spleen cells of mice immunized with recombinant VP1 protein produced a high level of IL-10. The
production of IL-12, though low overall, was only detectable in the DNA vaccine group. 3.5. Protection against lethal viral challenge in a newborn ICR model EV71 caused asymptomatic infection in all strains of adult mice tested, including BALB/c, C3H, nude (BALB/c), B-cell deficient (C57BL/6J), SCID (CB-17), CD28 knock-out (BALB/c), TNF-␣ receptor knock-out (C57BL/6J), and out-breed ICR mice. Inoculation of EV71 to newborn ICR mice resulted in hind limb(s) paralysis and eventual mortality within 2 weeks (manuscript in preparation). Therefore, protection against lethal EV71infection by the passively transferred maternal antibody from immunized dams was evaluated in newborn ICR mice. The immunized female ICR mice were allowed to breed at 6 weeks post-immunization and produced offspring at 10 weeks for the protection study. The kinetics of EV71-specific total IgG response of the immunized female ICR mice were monitored at 4 and 6 weeks post-immunization (Fig. 4A). Compared with BALB/c mice, female immunized ICR mice mounted a similar total IgG response (Fig. 4A), and ICR mice that received inactivated virus mounted a higher total IgG response than the groups that received subunit vaccines. Furthermore, at 10 weeks post-immunization (the term of gestation), neutralization antibody was detectable at 29 –210 dilution in serum of all immunized ICR mice, regardless of antigen type, similar to that of BALB/c mice (Fig. 4B). For the passive protection study, three litters of newborn ICR mice were used per experiment, for a set dosage of challenge virus and a particular vaccine preparation. Despite the near identical level of maternal neutralization antibody in all three groups of immunized ICR mice, the protection in newborns was markedly different according to the vaccine preparation received by their mothers (Fig. 5A–C). At a high virus challenge dose of 2.3 × 103 LD50 , only the group of suckling mice born to dams that received inactivated virus showed a protective efficacy of 80% (25/31); subunit vaccines failed to provide protection at the same virus challenge dose (Fig. 5A). However, at a reduced challenge virus dose of 2.3 × 102 LD50 , the protection efficacy against lethal infection was 95% (22/23) for the group that received VP1
900
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
Fig. 3. Ex vivo lymphocyte proliferation and cytokine production of splenocytes derived from BALB/c mice sacrificed at 12 weeks post-immunization with three types of vaccine preparation, equivalent to 8 weeks post-boosting (same as in Fig. 2). (A) Splenocytes from each mouse were harvested, and tested in a standard [3 H]thymidine uptake assay using purified recombinant VP1 as antigen. The stimulation index (SI) was determined according to the formula SI = (experimental count − spontaneous count)/spontaneous count. The spontaneous count was derived from the control wells in which splenocytes were stimulated by 10% FCS serving as nonspecific protein stimulator. For positive control, PHA (5 mg/ml) was used as a polyclonal stimulator to ensure the general healthy state of splenocytes. The SI of all three experimental groups significantly differed from that of their corresponding control groups (Student’s t-test: ∗, P < 0.05 or ∗∗, P < 0.01). (B) Cytokine produced by cultured splenocytes following stimulation with recombinant VP1 (5 g/well) for 48 h. Concentrations of IL-4, IL-10, IL-12, and IFN-␥ in the culture supernatant were determined by ELISA.
Fig. 4. Comparison of serum anti-EV71 antibody titres between ICR and BALB/c strains. (A) The total IgG antibody titres determined by ELISA at fourth and sixth weeks post-immunization. (B) Titres of neutralizing antibody determined by in vitro microneutrolization assay at the term of gestation, equivalent to 10 weeks post-immunization.
recombinant protein and 40% (10/26) for the group that received VP1 DNA vaccine (Fig. 5B). The protection rate of each litter within each experimental group showed a high consistency. Compared to the respective control groups that received pcDNA3 plasmid backbone, E. coli BL21(DE3) lysate, or RD-cell lysate, all three antigen-immunized groups showed a significant level of protection (log rank survival analysis, P < 0.01). Similarly, passive protection was also observed in newborn mice that each received 30 l of pooled anti-EV71 antiserum with a neutralization titre detectable at 1:2048 dilution. Compared with i.p. injection of PBS,
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
901
anti-EV71 antiserum administration by either i.m. or i.p. offered protection efficacy of 30 (P < 0.05) and 70% (P < 0.05), respectively (Fig. 5C).
4. Discussion
Fig. 5. Survival after challenge with a lethal dose of EV71 in ICR suckling mice. (A) Survival of suckling mice born to mothers immunized with plasmid pEv-VP1D used as DNA vaccine, VP1 recombinant protein derived from E. coli, or heat inactivated virus against virus challenge dose at 2.3 × 103 LD50 , non-immunized mothers as control groups. (B) Survival of suckling mice born to mothers immunized with VP1 DNA vaccine or subunit VP1 recombinant protein against reduced virus challenge dose at 2.3 × 102 LD50 , non-immunized mothers as control group. (C) Survival of suckling mice receiving exogenous antiserum with a detectable neutralizing titres at 1:2048 dilution, by i.p. or by i.m. route, against virus challenge dose at 2.3 × 103 LD50 . Comparison was made with the control group of suckling mice receiving PBS (i.p.).
The potential technological advantages of subunit vaccines over conventional whole virus vaccines has led us to question whether the VP1 subunit of picorna viruses is sufficient to elicit adequate protective immunity [17,23]. Despite the fact that many epitopes have been shown to cluster on VP1 independent of other capsid proteins [24–29], the application of subunit VP1 vaccines for picorna viruses has traditionally been viewed with scepticism because of the perceived antigenic importance of the three-dimensional structure of viral capsids in which all capsid proteins work in concert [30,31]. In this study, we have described two VP1 subunit vaccines of EV71, one administered as a DNA vaccine and another as a recombinant protein vaccine, which elicited a neutralization antibody response in both ICR and BALB/c mice. These findings provide direct evidence that VP1 of EV71 contains neutralizing epitopes independent of the other viral capsid proteins, and pave the way for the potential use of VP1 as the backbone antigen for developing subunit vaccines against EV71. Despite the nearly identical titres of neutralization antibody measured in vitro for all three immunized groups of mice, mice that received inactivated virus had the highest titres of total IgG and its subtypes, as well as the strongest T-helper-cell responses. This could be explained, in part, by the qualitative differences in the apparent broader spectrum of antigenic epitopes localized on whole virus particles versus the spectrum of the VP1 subunit alone and, in part, by the quantitative difference in the strength of the immune stimulation process between particulate antigens and soluble antigens. The particulate form of whole virus antigen is generally thought to be a better T-cell independent activator of B-cell than the soluble antigen [32–34]. The particulate antigen is also generally presented more efficiently by both dendritic cells and macrophages [35–37], and thus is likely to possess antigenic advantages over the soluble antigen. However, whether these mechanisms actually operate in EV71 immunity needs to be investigated empirically. The high titre of total IgG induced by the inactivated virus would also imply that heat inactivation did not alter virus antigenicity to a significant extend, because the virus coating the ELISA plate and the virus used as vaccine were fixed and inactivated by different methods, one by heating and the other by acetone and methanol mixture fixation. Furthermore, native virus mixed with Freund’s adjuvant could induce a similar level of neutralization antibody in mice as the heat inactivated virus (manuscript in preparation). While method used to inactivate virus needs to be worked out in the future for vaccine production, preservation of the native viral form should be attended to [19].
902
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
The higher protection level offered by the inactivated virus vaccine was not corroborated by a demonstrably higher neutralization titre. This may be explained by differences in the in vivo and in vitro functions of pathogen-specific immunoglobulin. The in vitro microneutralization assay measures only the antibody that binds to the functional domains of the viral capsid governing binding and entry to host cells. The in vivo functions of immunoglobulin, that cannot be measured by the in vitro neutralization assay, but contribute significantly to protection, include activating complement cascades, opsonization, and mediating antibody-dependent cytotoxicity. The discrepancy between the level of protection and the neutralization antibody level is unlikely to be due to differences in the usage of receptor binding sites on the virus capsid protein, since a receptor binding site, commonly referred as “receptor canyon” due to its topographical configuration, is present on the surface of the capsid protein in most picornaviruses studied so far [38–40]. Furthermore, our blocking assays of EV71 infection by membrane proteins of several mammalian cell lines showed that cross-species (human, monkey, and mouse cell lines) blockade occurs (data not shown), suggesting the existence of similar virus-cellular receptor binding sites in a variety of host cell lines. The lack of correlation between in vivo protection and in vitro neutralization provided by antibody has been observed in other viral infections [41]. Therefore, our data further suggest that the total capsid-specific antibody, rather than the neutralization antibody, might be a good immunological-protective correlate providing an easy means to monitor EV71 vaccine efficacy. How certain vaccine preparations and means of administration might steer immune responses toward certain Th-cell types and certain antibody subtypes needs to be studied empirically. The nature and effectiveness of immune responses, however, have been shown to vary considerably and may depend on a variety of factors, including the method of application and the physical form of Ag presented to the immune system. Conclusive data on the effect of these factors are therefore important for the design of vaccines and their further development for practical use [42,43]. In general, subunit protein vaccine and inactivated virus vaccines typically induce Th2 immune responses directing stimulation of B-cell proliferation but without significant cell mediated immunity. In contrast, intradermal and intramuscular vaccinations with naked DNA vaccine plasmid stimulate Th1 bias immune responses, including expansion of CD4+ T-cells, production of IFN-␥ and promoting the differentiation of cytotoxic CD8+ T-cells. Moreover, IgG2a is produced as a consequence of Th1-cell activation, whereas Th2-cell activation enhances the production of IgG1 and suppresses IgG2a [44]. The cytokine profile of the immunized mice in the present study indicated that VP1 DNA vaccine elicited predominantly a Th1 response, and that the inactivated virus elicited predominantly a Th2 response. The subunit VP1 recombinant protein elicited a mixed Th1 and Th2 response. Profiles of IgG subtypes, for reasons unknown to us at the
present time, did not indicate a definitive Th1 or Th2 predominance. However, IgG subtyping was helpful in understanding the degree of protection in ICR newborn mice, that reflected the efficiency of each IgG subtype in crossing the placenta; IgG2a is the major subtype transported and IgG2b is also transported to a lesser degree [45]. Overall, the inactivated virus vaccine elicited the strongest immune response in total IgGs and in the proliferation of T-helper-cells. IgG2a and IgG2b, the two subtyes transferrable to newborns, are especially high in the inactivated virus immunized group. Whether the added Th1 immune response elicited by the DNA vaccine contributes to any significant protection effects in natural infection could not be evaluated in the current newborn mouse model; rather, it should be further investigated with more appropriate animal models, such as using the monkey or transgenic mouse receiving human cell receptor similar to that used in polio vaccine evaluation [46]. Since its first identification 30 years ago, EV71 has been implicated as an etiological agent in several large scale outbreaks of severe neurological disorders throughout the world [1–7,47,48]. Similarities between poliovirus and EV71 in many virological and clinical aspects have strongly suggested that a vaccine strategy against poliovirus infection, be it live attenuated or inactivated viral vaccine, could be effectively adopted to control EV71 infection. Our data support the notion that conventional vaccine preparation using whole virus particles is the choice of vaccine currently offering the most expedient method for vaccine development against EV71. However, subunit vaccines, such as DNA vaccine or recombinant VP1 protein, remain viable potential vaccine strategies worth of further study and development. Furthermore, demonstrating the feasibility of VP1 subunit vaccine for EV71 might offer a new dimension in the choice of stock vaccines for poliovirus during the post eradication era because subunit vaccine can minimize the containment problems created during the mass production of a virulent vaccine strain.
Acknowledgements The authors thank Drs. Yi-Lin Lin, Mi-Hwa Tao, Chin-Yun Lee, and Min-Yi Liao for their inspiring discussions and helpful suggestions during the conduct of this study and Douglas Platt for his editorial assistance in the preparation of this manuscript. Grant support of Taiwan Department of Health (DOH Grant #CDC89-VCRD-003) and an institutional Grant from Academia Sinica, Taiwan and Mei-Chao Research Award, 1998–2000.
References [1] Schmidt NJ, Lennette EH, Ho HH. An apparently new enterovirus isolated from patients with disease of the central nervous system. J Infect Dis 1974;129(3):304–9.
C.-N. Wu et al. / Vaccine 20 (2002) 895–904 [2] Hagiwara A, Tagaya I, Yoneyama T. Epidemic of hand, foot and mouth disease associated with enterovirus 71 infection. Intervirology 1978;9(1):60–3. [3] Chumakov KM, Lavrova IK, Martianova LI, Korolev MB, Bashkirtsev VN, Voroshilova MK. Investigation of physicochemical properties of Bulgarian strain 258 of enterovirus type 71. Brief report. Arch Virol 1979;60(3/4):359–62. [4] Chumakov M, Voroshilova M, Shindarov L, Lavrova I, Gracheva L, Koroleva G, et al. Enterovirus 71 isolated from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 1979;60(3/4):329–40. [5] Abubakar S, Chee HY, Shafee N, Chua KB, Lam SK. Molecular detection of enteroviruses from an outbreak of hand, foot and mouth disease in Malaysia in 1997. Scand J Infect Dis 1999;31(4):331–5. [6] Anonymous. Deaths among children during an outbreak of hand, foot, and mouth disease — Taiwan, Republic of China, April–July 1998 [published erratum appears in MMWR Morb Mortal Wkly Rep 1998 Sep 4;47(34):718]. MMWR Morb Mortal Wkly Rep 1998;47(30):629–32. [7] Ho M, Chen ER, Hsu KH, Twu SJ, Chen KT, Tsai SF, et al. An epidemic of enterovirus 71 infection in Taiwan. Taiwan Enterovirus Epidemic Working Group (see comments). New Engl J Med 1999;341(13):929–35. [8] da Silva EE, Winkler MT, Pallansch MA. Role of enterovirus 71 in acute flaccid paralysis after the eradication of poliovirus in Brazil. Emerg Infect Dis 1996;2(3):231–3. [9] Margolis HS. Prevention of acute and chronic liver disease through immunization: hepatitis B and beyond. J Infect Dis 1993;168(1):9– 14. [10] Rota PA, De BK, Shaw MW, Black RA, Gamble WC, Kendal AP. Comparison of inactivated, live and recombinant DNA vaccines against influenza virus in a mouse model. Virus Res 1990;16(1):83– 93. [11] Konishi E, Yamaoka M, Kurane I, Mason PW. A DNA vaccine expressing dengue type 2 virus premembrane and envelope genes induces neutralizing antibody and memory B-cells in mice. Vaccine 2000;18(11/12):1133–9. [12] Boyer JD, Ugen KE, Wang B, Agadjanyan M, Gilbert L, Bagarazzi ML, et al. Protection of chimpanzees from high-dose heterologous HIV-1 challenge by DNA vaccination (see comments). Nat Med 1997;3(5):526–32. [13] Wang B, Boyer J, Srikantan V, Coney L, Carrano R, Phan C, et al. DNA inoculation induces neutralizing immune responses against human immunodeficiency virus type 1 in mice and nonhuman primates. DNA Cell Biol 1993;12(9):799–805. [14] Lin YL, Chen LK, Liao CL, Yeh CT, Ma SH, Chen JL, et al. DNA immunization with Japanese encephalitis virus nonstructural protein NS1 elicits protective immunity in mice. J Virol 1998;72(1):191–200. [15] Chen HW, Pan CH, Liau MY, Jou R, Tsai CJ, Wu HJ, et al. Screening of protective antigens of Japanese encephalitis virus by DNA immunization: a comparative study with conventional viral vaccines. J Virol 1999;73(12):10137–45. [16] Chow YH, Huang WL, Chi WK, Chu YD, Tao MH. Improvement of hepatitis B virus DNA vaccines by plasmids coexpressing hepatitis B surface antigen and interleukin-2. J Virol 1997;71(1):169–78. [17] Henke A, Wagner E, Whitton JL, Zell R, Stelzner A. Protection of mice against lethal Coxsackievirus B3 infection by using DNA immunization. J Virol 1998;72(10):8327–31. [18] Shih SR, Ho MS, Lin KH, Wu SL, Chen YT, Wu CN, et al. Genetic analysis of enterovirus 71 isolated from fatal and non-fatal cases of hand, foot and mouth disease during an epidemic in Taiwan, 1998. Virus Res 2000;68(2):127–36. [19] Blondel B, Akacem O, Crainic R, Couillin P, Horodniceanu F. Detection by monoclonal antibodies of an antigenic determinant critical for poliovirus neutralization present on VP1 and on heat-inactivated virions. Virology 1983;126(2):707–10.
903
[20] Brown BA, Pallansch MA. Complete nucleotide sequence of enterovirus 71 is distinct from poliovirus. Virus Res 1995;39(2/3): 195–205. [21] von Zeipel G. Neutralization of aggregated strains of enterovirus 71 and echovirus type 4 in RD and Vero or GMK-AH1 cells. Acta Pathol Microbiol Scand B 1979;87b(1):71–3. [22] Katze MG, Crowell RL. Indirect enzyme-linked immunosorbent assay (ELISA) for the detection of Coxsackievirus group B antibodies. J Gen Virol 1980;48(1):225–9. [23] Hughes JV, Stanton LW. Isolation and immunizations with hepatitis A viral structural proteins: induction of antiprotein, antiviral, and neutralizing responses. J Virol 1985;55(2):395–401. [24] Emini EA, Jameson BA, Wimmer E. Priming for and induction of anti-poliovirus neutralizing antibodies by synthetic peptides. Nature 1983;304(5928):699–703. [25] Emini EA, Jameson BA, Lewis AJ, Larsen GR, Wimmer E. Poliovirus neutralization epitopes: analysis and localization with neutralizing monoclonal antibodies. J Virol 1982;43(3):997–1005. [26] van der Marel P, Hazendonk TG, Henneke MA, van Wezel AL. Induction of neutralizing antibodies by poliovirus capsid polypeptides VP1, VP2 and VP3. Vaccine 1983;1(1):17–22. [27] van Wezel AL, van der Marel P, Hazendonk TG, Boer Bak V, Henneke MA. Antigenicity and immunogenicity of poliovirus capsid proteins. Dev Biol Stand 1983;55:209–15. [28] van der Werf S, Dreano M, Bruneau P, Kopecka H, Girard M. Expression of poliovirus capsid polypeptide VP1 in Escherichia coli. Gene 1983;23(1):85–93. [29] van der Werf S, Wychowski C, Bruneau P, Blondel B, Crainic R, Horodniceanu F, et al. Localization of a poliovirus type 1 neutralization epitope in viral capsid polypeptide VP1. Proc Natl Acad Sci USA 1983;80(16):5080–4. [30] Page GS, Mosser AG, Hogle JM, Filman DJ, Rueckert RR, Chow M. Three-dimensional structure of poliovirus serotype 1 neutralizing determinants. J Virol 1988;62(5):1781–94. [31] Smith TJ, Chase ES, Schmidt TJ, Olson NH, Baker TS. Neutralizing antibody to human rhinovirus 14 penetrates the receptor-binding canyon. Nature 1996;383(6598):350–4. [32] Fehr T, Skrastina D, Pumpens P, Zinkernagel RM. T-cell-independent type I antibody response against B-cell epitopes expressed repetitively on recombinant virus particles. Proc Natl Acad Sci USA 1998;95(16):9477–81. [33] Bachmann MF, Zinkernagel RM. The influence of virus structure on antibody responses and virus serotype formation. Immunol Today 1996;17(12):553–8. [34] Morein B, Simons K. Subunit vaccines against enveloped viruses: virosomes, micelles and other protein complexes. Vaccine 1985;3(2): 83–93. [35] Rock KL, Rothstein L, Gamble S, Fleischacker C. Characterization of antigen-presenting cells that present exogenous antigens in association with class I MHC molecules. J Immunol 1993;150(2): 438–46. [36] Shen Z, Reznikoff G, Dranoff G, Rock KL. Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J Immunol 1997;158(6):2723–30. [37] Ulmer JB, Donnelly JJ, Liu MA. Presentation of an exogenous antigen by major histocompatibility complex class I molecules. Eur J Immunol 1994;24(7):1590–6. [38] Muckelbauer JK, Kremer M, Minor I, Diana G, Dutko FJ, Groarke J, et al. The structure of Coxsackievirus B3 at 3.5 A resolution. Structure 1995;3(7):653–67. [39] Smyth M, Tate J, Hoey E, Lyons C, Martin S, Stuart D. Implications for viral uncoating from the structure of bovine enterovirus. Nat Struct Biol 1995;2(3):224–31. [40] Pevear DC, Luo M, Lipton HL. Three-dimensional model of the capsid proteins of two biologically different Theiler virus strains: clustering of amino acid difference identifies possible locations of immunogenic sites on the virion. Proc Natl Acad Sci USA 1988;85(12):4496–500.
904
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
[41] Zhang MJ, Wang MX, Jiang SZ, Xiu ZZ, Ma WY. Preparation and characterization of the monoclonal antibodies against Japanese encephalitis virus. Acta Virol 1992;36(6):533–40. [42] Cohen AD, Boyer JD, Weiner DB. Modulating the immune response to genetic immunization. Faseb J 1998;12(15):1611–26. [43] Constant S, Sant’Angelo D, Pasqualini T, Taylor T, Levin D, Flavell R, et al. Peptide and protein antigens require distinct antigen-presenting cell subsets for the priming of CD4+ T-cells. J Immunol 1995;154(10):4915–23. [44] Street NE, Mosmann TR. Functional diversity of T-lymphocytes due to secretion of different cytokine patterns. Faseb J 1991;5(2): 171–7.
[45] Janeway CA, Travers P, Walport M, Capra JD. The humoral immune response. In: Austin P, Lawrence E, editors. Immunobiology: the immune system in health and disease. London: Blink Studio, 1999. [46] Ren RB, Costantini F, Gorgacz EJ, Lee JJ, Racaniello VR. Transgenic mice expressing a human poliovirus receptor: a new model for poliomyelitis. Cell 1990;63(2):353–62. [47] Hagiwara A, Tagaya I, Yoneyama T. Common antigen between Coxsackievirus A 16 and enterovirus 71. Microbiol Immunol 1978; 22(2):81–8. [48] Hagiwara A, Tagaya I, Komatsu T. Seroepidemiology of enterovirus 71 among healthy children near Tokyo. Microbiol Immunol 1979;23(2):121–4.
Protection against lethal enterovirus 71 infection in newborn mice by passive immunization with subunit VP1 vaccines and inactivated virus夽 Cheng-Nan Wu a,b,1 , Ya-Ching Lin b , Cathy Fann b , Nan-Shih Liao c , Shin-Ru Shih d , Mei-Shang Ho b,∗ a
Graduate Institute of Life Sciences, National Defense Medical Center, Taipei, Taiwan, ROC b Institute of Biomedical Sciences, Academia Sinica, Taipei 11529, Taiwan, ROC c Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan, ROC d School of Medical Technology, Chang Gung University, Tao-Yuan, Taiwan, ROC Received 17 May 2001; received in revised form 6 August 2001; accepted 21 August 2001
Abstract Enterovirus 71 (EV71), the newest member of Enteroviridae, is notable for its etiological role in epidemics of severe neurological diseases in children. Developing effective vaccines is considered a top choice among all control measures. We compared the inactivated virus vaccine (10 g protein/mouse) with subunit vaccines — VP1 DNA vaccine (100 g/mouse) or recombinant VP1 protein (10 g/mouse), in its ability to elicit maternal antibody and to provide protection against lethal infection of EV71 in suckling mice. Prior to gestation, all three groups of vaccinated dams possessed similar levels of neutralizing antibody. With a challenge dose of 2300 LD50 virus/mouse, suckling mice born to dams immunized with inactivated virus showed 80% survival. The subunit vaccines provided protection only at a lower challenge dosage of 230 LD50 per mouse, with 40% survival for DNA vaccine and 80% survival for VP1 protein. The cytokine profile produced by splenocytes showed a high level of IL-4 in the inactivated virus group, high levels of IFN-␥ and IL-12 in the DNA vaccine group, and high levels of IL-10 and IFN-␥ in the VP1 protein group. Overall, the inactivated virus elicited a much greater magnitude of immune response than the subunit vaccines, including total IgG, all four IgG subtypes, and T-helper-cell responses; these antibodies were shown to be protective against lethal infection when passively transferred to susceptible newborn mice. Our data indicated that inactivated virus is the choice of vaccine preparation capable of fulfilling the demand for effective control, and that VP1 subunit vaccines remain promising vaccine strategies that require further refinement. © 2001 Elsevier Science Ltd. All rights reserved. Keywords: DNA vaccine; Subunit VP1 vaccine; Enterovirus 71
1. Introduction Enterovirus 71 (EV71) is a human enterovirus belonging to the Enterovirus genus of the Picornavirus family. Since its first reporting in 1974 [1], several large outbreaks of EV71 infection have been reported, including hand foot and mouth disease [2], polio-like paralysis [3,4], and fatal encephalitis with cardiopulmonary complication [5–7]. EV71 appears to be emerging as an increasingly important virulent neurotropic enterovirus in the upcoming era of poliomyelitis eradication [8]. Since no effective antiviral agents are available, developing vaccines for primary prevention is consid夽 This manuscript was presented in part as a poster during the XIIth International Congress of Virology, Sydney, Australia, 9–13 August 1999. ∗ Corresponding author. Tel.: +886-2-2789-9120; fax: +886-2-2782-3047. E-mail address: [email protected] (M.-S. Ho). 1 Recipient of Mei-Chao Research Award, 1998–2000.
ered to be the best choice among control strategies against EV71. Conventional vaccines, using whole virus particles as live attenuated or inactivated vaccine, have achieved successful control of several viral infections, among which poliomyelitis is facing imminent eradication. Recombinant DNA technology, which delivers only the target subunit antigen and causes fewer adverse effects, is theoretically the choice technology for vaccine production and may be applicable in most viral infections. The isolated viral surface proteins, if they assume a proper conformation, generally possess neutralizing epitopes; one such successful example is hepatitis B virus vaccine [9]. More recently, DNA vectors containing genes encoding viral antigens have also been shown to elicit antibodies and cell-mediated immunity in animal models against viral infections, including influenza virus, human immunodeficiency virus, Dengue virus, Japanese encephalitis virus, and Coxsackievirus B3 [10–17]. A DNA vaccine might provide advantages over conventional vaccines in that it can
0264-410X/01/$ – see front matter © 2001 Elsevier Science Ltd. All rights reserved. PII: S 0 2 6 4 - 4 1 0 X ( 0 1 ) 0 0 3 8 5 - 1
896
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
elicit MHC class I-restricted CD8+ T-cell responses while mitigating some safety concerns associated with live vaccines, and can be stored and transported easily without going through the cumbersome process of “cold chain”. While therapeutic and prophylactic DNA vaccine clinical trials are underway for a variety of infectious diseases and cancers, the scientific basis of DNA vaccines has yet to be clearly defined. If DNA vaccines pass all scientific and regulatory scrutiny, they promise to be products of the next generation. In this study, we compared the potential of inactivated viral particles and two subunit virus vaccines, one administered as a DNA-based vaccine and the other as a recombinant protein vaccine, to elicit immunity and to provide protection against lethal EV71 challenge in susceptible newborn mice. 2. Materials and methods 2.1. Virus growth and purification The neu strain of EV71 was isolated from an autopsied specimen of the spinal cord of an 8-year-old child [18]. A branch lineage of neu, termed YN3, was obtained after two runs of plaque purification in Vero cells. The YN3 strain is highly virulent for newborn ICR mice; infections with the YN3 strain (LD50 4.3 × 10 TCID50 virus) in ICR newborn mice invariably causes hind limb paralysis followed by death (manuscript in preparation). The neu strain, propagated in rhabdomyosarcoma cells (RD) using DMEM with 2% serum, was used as the prototype vaccine virus in antigen preparation. YN3, propagated in African green monkey kidney cells (Vero) using DMEM with 2% serum, was used as the challenge virus in all protection studies. All cell lines were purchased from American Type Culture Collection. The virus in the culture fluid was purified by precipitation with 20% polyethylene glycol 6000 and then centrifugation on a 40–65% discontinuous sucrose gradient at 80,000 × g for 4 h and re-purification on 5–40% liner CsCl gradient at 120,000 × g for 4 h. The virus titre was determined as TCID50 on Vero cells based on a typical cytopathic effect (CPE) produced by viral infection. Before used as a vaccine, the virus was inactivated by heating at 56◦ C for 30 min as previously described [19]. The amount of virion protein was quantified by Bradford method (Bio-Rad protein assay, Bio-Rad Inc., CA). 2.2. Construction of plasmids Viral RNA was extracted from the culture fluid of the neu-infected cells using a commercially-available kit (QIAamp viral RNA mini kit, Qiagen Inc., Santa Clara, CA). The first strand cDNA was synthesized using reverse transcriptase (Promega) and a primer (5 -TCCTCCTGCGAAGCTGCTGACT) that was complementary to the 3 -end of the viral gene encoding capsid protein VP1. The double-stranded cDNA encoding the entire
VP1 protein was amplified by polymerase chain reaction (PCR) for 35 cycles (94 × 1, 55 × 1 and 72◦ C × 2 min), using Pfu DNA polymerase (Stratagene) and a pair of primers (Envp1F/CACTCTTCCATGGATATCCTACAGACAGGCA, Envp1R/TCCTCTTCTAAGGAGAGTGGTRATTGCTGTGCGAC) designed according to the known viral gene sequence encoding the C- and N-termini of VP1 [18,20]. The PCR amplicon of the entire VP1 gene with an additional EcoRI restriction site at both ends was digested, prior to the insertion into plasmid pcDNA3 (Invitrogen Inc., CA) for the DNA vaccine construct and into pDual vector (Stratagene) for the expression of recombinant VP1 (Fig. 1A). Verification of the inserted viral VP1 sequence was performed using the automated dideoxynucleotide chain termination method (ABI prism dye terminator cycle sequencing ready reaction kit, Perkin-Elmer Inc., CA). Verification of proper VP1 protein expression was carried out in BHK cells by transient transfection of the pEvP1D plasmid using Lipofectamine (Gibco BRL). After 48 h of incubation, the transfected BHK cells were lysed with Nonident P40 lysis buffer (Sigma Inc., St. Louis, MO), and centrifuged at 12,000 rpm for 10 min. The supernatant containing expressed VP1 was collected and examined by western blotting. 2.3. VP1 expression and purification The recombinant VP1 protein expressed in E. coli BL21(DE3) that had been transformed with the pEvP1E plasmid was a fusion protein containing calmodulin binding peptide (CBP), which was used as a target in a calmodulin affinity column for purification. After 4 h induction by IPTG, cells were centrifuged (6000 rpm × 10 min) and collected in CaCl2 binding buffer. Cells were lysed by lysozyme (final concentration 200 mg/ml) and by sonication using a microtip. The lysate was centrifuged (12,000 rpm × 10 min), and the supernatant was then transferred to a calmodulin affinity purification column (Stratagene). Proteins were subsequently eluted from the column matrix by EDTA-containing elution buffer (50 mM Tris–HCl (pH 8.0), 10 mM mercaptoethanol, 2 mM EDTA, and 150 mM NaCl). The amount of recombinant protein was quantified by Bradford method (Bio-Rad). 2.4. Neutralization antibody assay The neutralization test was carried out by a TCID50 reduction assay in Vero cells [21]. Serum samples were incubated at 56◦ C for 30 min to inactivate the complement. All serum samples were tested in triplicate and with a two-fold serial dilution before mixing with equal volumes of virus containing 102 TCID50 , and then plated onto monolayers of Vero cells growth to 80% confluence. After 3 days of growth in 2% serum, the titre was read as the highest dilution that resulted in more than 50% CPE. The neutralization titre was taken as the average of the triplicates.
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
897
CPE cells were fixed on the plate by a mixture of acetone and methanol (3:2) for 15 min before washing. Non-fat powdered milk (5%) in PBS was used to block nonspecific binding (RT × 1 h). The plate was washed with PBS containing 0.01% Tween 20. Fifty microliters of serially-diluted test serum was added to each well and incubated for 1 h at 37◦ C. The plate was washed before incubation with peroxidase conjugated goat anti-mouse IgG (H + L) (1:1000 dilution) (Jackson Inc., West Grove, PA) at 37◦ C for 1 h. The color was generated by adding OPD substrate, and the positive cut-off value was defined as 1.5 times optical density of a normal mouse serum used as negative control. 2.6. Immunization of mice Adult female BALB/c or ICR mice in groups of 10 were immunized with either 100 g plasmid DNA by intramuscular (i.m.) injection, 10 g VP1 recombinant protein with complete adjuvant by intraperitoneal (i.p.) injection, or heat inactivated virus (total protein of 10 g) with complete adjuvant by i.p. inoculation. The control groups, each of five mice, were injected with backbone vector for DNA vaccine (i.m.), cell lysate of E. coli BL21(DE3) with no trnasformation (i.p.), or RD-cell lysate (i.p.). After 5 weeks of immunization, animals were boosted once more with the same dose of antigen. 2.7. Th-cell proliferation assay and cytokine production
Fig. 1. (A) Schematic representation of the expression cassettes of the recombinant plasmids used for expression of VP1 protein. The RT-PCR amplicon of VP1 gene plus an initiation codon after the digestion of EcoRI was inserted into pcDNA3 as DNA vaccine (pEv-VP1D) and inserted into pDual (pEv-VP1E) for the expression cassette of recombinant VP1 protein. (B) VP1 protein expression was confirmed by western blotting assay. A 36 kDa protein from BHK cell transfected with plasmid pEv-VP1D and a 40 kDa protein from E. coli BL21(DE3) transformed with plasmid pEv-VP1E were detected by EV71 monoclonal antibody.
2.5. Total specific IgG antibody against EV71 Total anti-EV71 IgG was measured by ELISA using whole virus as coating antigen in an OPD system [22]. Mouse serum samples were collected by tail vein bleeding at specified times post-immunization. The coating viral antigen for ELISA was prepared in a 96-well plate by growing the neu strain (104 TCID50 per well) in Vero cells until more than 50% cells showed CPE. The virus-laden
Splenocytes from individual mice were harvested, and RBCs were lysed with a 0.84% NH4 Cl solution. After several washes in PBS, 106 splenocytes per well were cultured in 96-well plates with 200 ml RPMI 1640 (10% FCS, 1% l-glutamine, and 1% neomycin) in the presence of 5 g recombinant VP1 protein. For each mouse, triplicate wells were set-up for cytokine study, and additional triplicates for [3 H]methylthymidine incorporation study. Plates were incubated for 72 h at 37◦ C in a 5% CO2 incubator. Culture supernatant of the proliferating splenocytes was collected at 48 h and assayed for IFN-␥, IL-4, IL-10, and IL-12 production by a commercially available ELISA kit (Endogen, Woburn, MA). Incorporation of [3 H]methylthymidine (50 Ci/ml) was achieved by adding 20 l [3 H]methylthymidine to each well during the last 16–18 h of incubation. With a semi-automated cell harvesting apparatus, cells were harvested onto glass fiber filters which were placed in scintillation fluid and counted in a scintillation -counter (Beckman 1800 LS). 2.8. IgG subtype distribution The profiles of anti-EV71-specific IgG subtypes in mouse serum were determined by a commercial mouse type subisotyping kit (Zymed Inc.) using whole-virus-coating plates as described above. Serial dilution of a known amount of
898
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
commercially purified EV71 virus-specific IgG1 mouse neutralizing mAbs (Chemicon) was used as a positive control for EV71-specific IgG1; this assay could detect less than 4.3 pg/ml of EV71-specific IgG1 in mouse serum. 2.9. Mice model of protection lethal enterovirus 71 infection EV71 infection caused no apparent clinical symptoms in adult BALB/c, C3H, ICR, CD28 knock-out, and TNF-␣ receptor knock-out mice. In ICR newborn mice, EV71 infection resulted in hind limb paralysis and eventual death within 2 weeks of challenge. The ICR suckling mice possessing passively transferred maternal EV71 antibody were challenged at less than 24 h of age with the YN3 strain by i.p. The mice were observed daily for the occurrence of mortality as the experimental endpoint. 2.10. Survival statistical analysis to protection study Time-to-event data analysis, such as mortality among the three groups of mice, was made using log rank survival analysis. Pairwise comparisons of survival probability between immunized and control groups were performed after an overall comparison was made. All tests were two-sided; a P-value of less than 0.05 was considered significant.
3. Results 3.1. Construction of plasmids and expression of VP1 protein The VP1 subunit vaccines were prepared by inserting the entire VP1 gene into plasmid pcDNA3, designated as pEv-VP1D for DNA vaccine, and into plasmid pDual, designated as pEv-VP1E for VP1 protein expression (Fig. 1A). A 36 kDa VP1 product from cell lysate of BHK cells transiently transfected with pEv-VP1D and a 40 kDa recombinant VP1 fusion protein in E. coli BL21(DE3) lysate was recognized by EV71 neutralizing monoclonal antibody (Fig. 1B) and by mouse polyclonal antiserum (data not shown). 3.2. Immunogenicity 3.2.1. Neutralization antibody Immunogenicity of the three vaccines was evaluated in BALB/c mice by in vitro microneutralization assay. The assay detects only antibody capable of blocking virus entry into the host cell. All immunized mice, regardless of the antigen type, showed a significant rise in the neutralization titre in comparison to the control mice, i.e. no individual non-responder. The second dose of vaccination resulted in a further rise of the neutralization titre by the seventh week
Fig. 2. Titres of EV71 antibody in three groups of BALB/c mice each received two doses of plasmid pEv-VP1D (䉲), VP1 recombinant protein derived from E. coli (䊏), or heat inactivated virus (䊉) with immunization schedule as indicated by arrows. The corresponding control groups received plasmid of the DNA vaccine backbone pcDNA3 (), E. coli lysate (䊐), and RD-cell lysate (䊊). (A) Titres of neutralizing antibody against EV71 as assayed by endpoint dilution of serum in a microneutrolization assay. (B) Titres of total IgG antibody against EV71 viral particles were determined by ELISA.
(Fig. 2A). The neutralization titres of all three experimental groups maintained a significantly elevated level for at least 20 weeks post-immunization. The titres were still detectable at 32 weeks post-immunization, but were only slightly higher than those of the control groups. While the DNA vaccine group reached a lower peak neutralization titre than the recombinant protein and inactivated virus groups after boosting, it maintained a higher neutralization titre, similar to that of the inactivated virus group, than the recombinant protein group at 32 weeks post-immunization (Fig. 2A). 3.2.2. Total IgG and subtypes The total anti-EV71-specific IgG of vaccines was measured by ELISA. The total IgG production was highest in
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
899
Table 1 The distribution of specific anti-EV71 IgG subtypes in BALB/c immunized mice with three types of antigen preparationa Types of antigen preparation administered
OD405 nm of ELISA for EV71 specific IgG at serum dilution of 1:25 IgG1 OD (S.D.)
IgG2a OD (S.D.)
IgG2b OD (S.D.)
IgG3 OD (S.D.)
DNA vaccine (n = 5) VP1 protein (n = 5) Inactivated virus (n = 5)
0.14 (0.02) 0.31 (0.05) 1.08 (0.16)
0.20 (0.03) 0.16 (0.02) 1.09 (0.15)
0.23 (0.04) 0.30 (0.04) 1.27 (0.08)
0.08 (0.01) 0.06 (0.01) 0.77 (0.09)
IgG1:IgG2a
1:1.4 2:1 1:1
a Three groups of mice received pEv-VP1D plasmid, recombinant VP1 protein, or inactivated virus. At tenth week post-immunization, mouse sera were collected by tail vein bleeding and assayed for specific anti-EV71 IgG subtypes by ELISA. Serum samples of each vaccinated group were pooled and tested in triplicate in three separate experiments. The relative titre is expressed as the optical density at 405 nm (OD405 nm ), and S.D. of OD is in parenthesis.
the group that received inactivated virus, with a more than 32-fold higher level at week 3 and more than 256-fold higher level at week 7, compared to the two groups that received subunit vaccines (Fig. 2B). We further delineated the profiles of serum IgG subtypes elicited by each antigen preparation (Table 1). The inactivated virus group showed a much higher OD value of all IgG subtypes, including IgG3 that was not detectable in the subunit vaccine groups. The recombinant protein group showed a slightly higher OD value of IgG1 and IgG2b than the DNA vaccine group. 3.3. Th-cell proliferation The strength of Th-cell responses plays a crucial role in mediating both humoral and cellular immunity. In the splenocytes ex vivo proliferation assay, EV71-specific T-cells proliferated upon stimulation by the recombinant VP1 protein and the degree of proliferation was used as a specific indicator of CD4+ activation. PHA stimulation was used as a positive control for general polyclonal responses to nonspecific antigen stimulation. At 12 weeks post-immunization, splenocytes of all immunized mice showed an enhanced Th-cell proliferation response (Fig. 3A). Spleen cells of mice that received inactivated virus, however, showed a greater increase in Th-cell proliferation than the two groups that received subunit vaccines. 3.4. Cytokine production by enterovirus 71 virus-specific T-cells Profiles of cytokine production by the ex vivo proliferating splenocytes were studied as indicators of the polarization of Th1/Th2 immune response. The Th1 (IFN-␥ and IL-12) and Th2 (IL-4 and IL-10) cytokines in the supernatants of splenocytes after stimulation with VP1 recombinant protein were investigated by ELISA (Fig. 3B). Splenocytes of mice immunized with inactivated virus produced the highest level of IL-4 and the lowest level of IFN-␥ compared with the two subunit groups. Splenocytes derived from the DNA vaccine group produced the highest level of IFN-␥ and the lowest level of IL-4. Spleen cells of mice immunized with recombinant VP1 protein produced a high level of IL-10. The
production of IL-12, though low overall, was only detectable in the DNA vaccine group. 3.5. Protection against lethal viral challenge in a newborn ICR model EV71 caused asymptomatic infection in all strains of adult mice tested, including BALB/c, C3H, nude (BALB/c), B-cell deficient (C57BL/6J), SCID (CB-17), CD28 knock-out (BALB/c), TNF-␣ receptor knock-out (C57BL/6J), and out-breed ICR mice. Inoculation of EV71 to newborn ICR mice resulted in hind limb(s) paralysis and eventual mortality within 2 weeks (manuscript in preparation). Therefore, protection against lethal EV71infection by the passively transferred maternal antibody from immunized dams was evaluated in newborn ICR mice. The immunized female ICR mice were allowed to breed at 6 weeks post-immunization and produced offspring at 10 weeks for the protection study. The kinetics of EV71-specific total IgG response of the immunized female ICR mice were monitored at 4 and 6 weeks post-immunization (Fig. 4A). Compared with BALB/c mice, female immunized ICR mice mounted a similar total IgG response (Fig. 4A), and ICR mice that received inactivated virus mounted a higher total IgG response than the groups that received subunit vaccines. Furthermore, at 10 weeks post-immunization (the term of gestation), neutralization antibody was detectable at 29 –210 dilution in serum of all immunized ICR mice, regardless of antigen type, similar to that of BALB/c mice (Fig. 4B). For the passive protection study, three litters of newborn ICR mice were used per experiment, for a set dosage of challenge virus and a particular vaccine preparation. Despite the near identical level of maternal neutralization antibody in all three groups of immunized ICR mice, the protection in newborns was markedly different according to the vaccine preparation received by their mothers (Fig. 5A–C). At a high virus challenge dose of 2.3 × 103 LD50 , only the group of suckling mice born to dams that received inactivated virus showed a protective efficacy of 80% (25/31); subunit vaccines failed to provide protection at the same virus challenge dose (Fig. 5A). However, at a reduced challenge virus dose of 2.3 × 102 LD50 , the protection efficacy against lethal infection was 95% (22/23) for the group that received VP1
900
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
Fig. 3. Ex vivo lymphocyte proliferation and cytokine production of splenocytes derived from BALB/c mice sacrificed at 12 weeks post-immunization with three types of vaccine preparation, equivalent to 8 weeks post-boosting (same as in Fig. 2). (A) Splenocytes from each mouse were harvested, and tested in a standard [3 H]thymidine uptake assay using purified recombinant VP1 as antigen. The stimulation index (SI) was determined according to the formula SI = (experimental count − spontaneous count)/spontaneous count. The spontaneous count was derived from the control wells in which splenocytes were stimulated by 10% FCS serving as nonspecific protein stimulator. For positive control, PHA (5 mg/ml) was used as a polyclonal stimulator to ensure the general healthy state of splenocytes. The SI of all three experimental groups significantly differed from that of their corresponding control groups (Student’s t-test: ∗, P < 0.05 or ∗∗, P < 0.01). (B) Cytokine produced by cultured splenocytes following stimulation with recombinant VP1 (5 g/well) for 48 h. Concentrations of IL-4, IL-10, IL-12, and IFN-␥ in the culture supernatant were determined by ELISA.
Fig. 4. Comparison of serum anti-EV71 antibody titres between ICR and BALB/c strains. (A) The total IgG antibody titres determined by ELISA at fourth and sixth weeks post-immunization. (B) Titres of neutralizing antibody determined by in vitro microneutrolization assay at the term of gestation, equivalent to 10 weeks post-immunization.
recombinant protein and 40% (10/26) for the group that received VP1 DNA vaccine (Fig. 5B). The protection rate of each litter within each experimental group showed a high consistency. Compared to the respective control groups that received pcDNA3 plasmid backbone, E. coli BL21(DE3) lysate, or RD-cell lysate, all three antigen-immunized groups showed a significant level of protection (log rank survival analysis, P < 0.01). Similarly, passive protection was also observed in newborn mice that each received 30 l of pooled anti-EV71 antiserum with a neutralization titre detectable at 1:2048 dilution. Compared with i.p. injection of PBS,
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
901
anti-EV71 antiserum administration by either i.m. or i.p. offered protection efficacy of 30 (P < 0.05) and 70% (P < 0.05), respectively (Fig. 5C).
4. Discussion
Fig. 5. Survival after challenge with a lethal dose of EV71 in ICR suckling mice. (A) Survival of suckling mice born to mothers immunized with plasmid pEv-VP1D used as DNA vaccine, VP1 recombinant protein derived from E. coli, or heat inactivated virus against virus challenge dose at 2.3 × 103 LD50 , non-immunized mothers as control groups. (B) Survival of suckling mice born to mothers immunized with VP1 DNA vaccine or subunit VP1 recombinant protein against reduced virus challenge dose at 2.3 × 102 LD50 , non-immunized mothers as control group. (C) Survival of suckling mice receiving exogenous antiserum with a detectable neutralizing titres at 1:2048 dilution, by i.p. or by i.m. route, against virus challenge dose at 2.3 × 103 LD50 . Comparison was made with the control group of suckling mice receiving PBS (i.p.).
The potential technological advantages of subunit vaccines over conventional whole virus vaccines has led us to question whether the VP1 subunit of picorna viruses is sufficient to elicit adequate protective immunity [17,23]. Despite the fact that many epitopes have been shown to cluster on VP1 independent of other capsid proteins [24–29], the application of subunit VP1 vaccines for picorna viruses has traditionally been viewed with scepticism because of the perceived antigenic importance of the three-dimensional structure of viral capsids in which all capsid proteins work in concert [30,31]. In this study, we have described two VP1 subunit vaccines of EV71, one administered as a DNA vaccine and another as a recombinant protein vaccine, which elicited a neutralization antibody response in both ICR and BALB/c mice. These findings provide direct evidence that VP1 of EV71 contains neutralizing epitopes independent of the other viral capsid proteins, and pave the way for the potential use of VP1 as the backbone antigen for developing subunit vaccines against EV71. Despite the nearly identical titres of neutralization antibody measured in vitro for all three immunized groups of mice, mice that received inactivated virus had the highest titres of total IgG and its subtypes, as well as the strongest T-helper-cell responses. This could be explained, in part, by the qualitative differences in the apparent broader spectrum of antigenic epitopes localized on whole virus particles versus the spectrum of the VP1 subunit alone and, in part, by the quantitative difference in the strength of the immune stimulation process between particulate antigens and soluble antigens. The particulate form of whole virus antigen is generally thought to be a better T-cell independent activator of B-cell than the soluble antigen [32–34]. The particulate antigen is also generally presented more efficiently by both dendritic cells and macrophages [35–37], and thus is likely to possess antigenic advantages over the soluble antigen. However, whether these mechanisms actually operate in EV71 immunity needs to be investigated empirically. The high titre of total IgG induced by the inactivated virus would also imply that heat inactivation did not alter virus antigenicity to a significant extend, because the virus coating the ELISA plate and the virus used as vaccine were fixed and inactivated by different methods, one by heating and the other by acetone and methanol mixture fixation. Furthermore, native virus mixed with Freund’s adjuvant could induce a similar level of neutralization antibody in mice as the heat inactivated virus (manuscript in preparation). While method used to inactivate virus needs to be worked out in the future for vaccine production, preservation of the native viral form should be attended to [19].
902
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
The higher protection level offered by the inactivated virus vaccine was not corroborated by a demonstrably higher neutralization titre. This may be explained by differences in the in vivo and in vitro functions of pathogen-specific immunoglobulin. The in vitro microneutralization assay measures only the antibody that binds to the functional domains of the viral capsid governing binding and entry to host cells. The in vivo functions of immunoglobulin, that cannot be measured by the in vitro neutralization assay, but contribute significantly to protection, include activating complement cascades, opsonization, and mediating antibody-dependent cytotoxicity. The discrepancy between the level of protection and the neutralization antibody level is unlikely to be due to differences in the usage of receptor binding sites on the virus capsid protein, since a receptor binding site, commonly referred as “receptor canyon” due to its topographical configuration, is present on the surface of the capsid protein in most picornaviruses studied so far [38–40]. Furthermore, our blocking assays of EV71 infection by membrane proteins of several mammalian cell lines showed that cross-species (human, monkey, and mouse cell lines) blockade occurs (data not shown), suggesting the existence of similar virus-cellular receptor binding sites in a variety of host cell lines. The lack of correlation between in vivo protection and in vitro neutralization provided by antibody has been observed in other viral infections [41]. Therefore, our data further suggest that the total capsid-specific antibody, rather than the neutralization antibody, might be a good immunological-protective correlate providing an easy means to monitor EV71 vaccine efficacy. How certain vaccine preparations and means of administration might steer immune responses toward certain Th-cell types and certain antibody subtypes needs to be studied empirically. The nature and effectiveness of immune responses, however, have been shown to vary considerably and may depend on a variety of factors, including the method of application and the physical form of Ag presented to the immune system. Conclusive data on the effect of these factors are therefore important for the design of vaccines and their further development for practical use [42,43]. In general, subunit protein vaccine and inactivated virus vaccines typically induce Th2 immune responses directing stimulation of B-cell proliferation but without significant cell mediated immunity. In contrast, intradermal and intramuscular vaccinations with naked DNA vaccine plasmid stimulate Th1 bias immune responses, including expansion of CD4+ T-cells, production of IFN-␥ and promoting the differentiation of cytotoxic CD8+ T-cells. Moreover, IgG2a is produced as a consequence of Th1-cell activation, whereas Th2-cell activation enhances the production of IgG1 and suppresses IgG2a [44]. The cytokine profile of the immunized mice in the present study indicated that VP1 DNA vaccine elicited predominantly a Th1 response, and that the inactivated virus elicited predominantly a Th2 response. The subunit VP1 recombinant protein elicited a mixed Th1 and Th2 response. Profiles of IgG subtypes, for reasons unknown to us at the
present time, did not indicate a definitive Th1 or Th2 predominance. However, IgG subtyping was helpful in understanding the degree of protection in ICR newborn mice, that reflected the efficiency of each IgG subtype in crossing the placenta; IgG2a is the major subtype transported and IgG2b is also transported to a lesser degree [45]. Overall, the inactivated virus vaccine elicited the strongest immune response in total IgGs and in the proliferation of T-helper-cells. IgG2a and IgG2b, the two subtyes transferrable to newborns, are especially high in the inactivated virus immunized group. Whether the added Th1 immune response elicited by the DNA vaccine contributes to any significant protection effects in natural infection could not be evaluated in the current newborn mouse model; rather, it should be further investigated with more appropriate animal models, such as using the monkey or transgenic mouse receiving human cell receptor similar to that used in polio vaccine evaluation [46]. Since its first identification 30 years ago, EV71 has been implicated as an etiological agent in several large scale outbreaks of severe neurological disorders throughout the world [1–7,47,48]. Similarities between poliovirus and EV71 in many virological and clinical aspects have strongly suggested that a vaccine strategy against poliovirus infection, be it live attenuated or inactivated viral vaccine, could be effectively adopted to control EV71 infection. Our data support the notion that conventional vaccine preparation using whole virus particles is the choice of vaccine currently offering the most expedient method for vaccine development against EV71. However, subunit vaccines, such as DNA vaccine or recombinant VP1 protein, remain viable potential vaccine strategies worth of further study and development. Furthermore, demonstrating the feasibility of VP1 subunit vaccine for EV71 might offer a new dimension in the choice of stock vaccines for poliovirus during the post eradication era because subunit vaccine can minimize the containment problems created during the mass production of a virulent vaccine strain.
Acknowledgements The authors thank Drs. Yi-Lin Lin, Mi-Hwa Tao, Chin-Yun Lee, and Min-Yi Liao for their inspiring discussions and helpful suggestions during the conduct of this study and Douglas Platt for his editorial assistance in the preparation of this manuscript. Grant support of Taiwan Department of Health (DOH Grant #CDC89-VCRD-003) and an institutional Grant from Academia Sinica, Taiwan and Mei-Chao Research Award, 1998–2000.
References [1] Schmidt NJ, Lennette EH, Ho HH. An apparently new enterovirus isolated from patients with disease of the central nervous system. J Infect Dis 1974;129(3):304–9.
C.-N. Wu et al. / Vaccine 20 (2002) 895–904 [2] Hagiwara A, Tagaya I, Yoneyama T. Epidemic of hand, foot and mouth disease associated with enterovirus 71 infection. Intervirology 1978;9(1):60–3. [3] Chumakov KM, Lavrova IK, Martianova LI, Korolev MB, Bashkirtsev VN, Voroshilova MK. Investigation of physicochemical properties of Bulgarian strain 258 of enterovirus type 71. Brief report. Arch Virol 1979;60(3/4):359–62. [4] Chumakov M, Voroshilova M, Shindarov L, Lavrova I, Gracheva L, Koroleva G, et al. Enterovirus 71 isolated from cases of epidemic poliomyelitis-like disease in Bulgaria. Arch Virol 1979;60(3/4):329–40. [5] Abubakar S, Chee HY, Shafee N, Chua KB, Lam SK. Molecular detection of enteroviruses from an outbreak of hand, foot and mouth disease in Malaysia in 1997. Scand J Infect Dis 1999;31(4):331–5. [6] Anonymous. Deaths among children during an outbreak of hand, foot, and mouth disease — Taiwan, Republic of China, April–July 1998 [published erratum appears in MMWR Morb Mortal Wkly Rep 1998 Sep 4;47(34):718]. MMWR Morb Mortal Wkly Rep 1998;47(30):629–32. [7] Ho M, Chen ER, Hsu KH, Twu SJ, Chen KT, Tsai SF, et al. An epidemic of enterovirus 71 infection in Taiwan. Taiwan Enterovirus Epidemic Working Group (see comments). New Engl J Med 1999;341(13):929–35. [8] da Silva EE, Winkler MT, Pallansch MA. Role of enterovirus 71 in acute flaccid paralysis after the eradication of poliovirus in Brazil. Emerg Infect Dis 1996;2(3):231–3. [9] Margolis HS. Prevention of acute and chronic liver disease through immunization: hepatitis B and beyond. J Infect Dis 1993;168(1):9– 14. [10] Rota PA, De BK, Shaw MW, Black RA, Gamble WC, Kendal AP. Comparison of inactivated, live and recombinant DNA vaccines against influenza virus in a mouse model. Virus Res 1990;16(1):83– 93. [11] Konishi E, Yamaoka M, Kurane I, Mason PW. A DNA vaccine expressing dengue type 2 virus premembrane and envelope genes induces neutralizing antibody and memory B-cells in mice. Vaccine 2000;18(11/12):1133–9. [12] Boyer JD, Ugen KE, Wang B, Agadjanyan M, Gilbert L, Bagarazzi ML, et al. Protection of chimpanzees from high-dose heterologous HIV-1 challenge by DNA vaccination (see comments). Nat Med 1997;3(5):526–32. [13] Wang B, Boyer J, Srikantan V, Coney L, Carrano R, Phan C, et al. DNA inoculation induces neutralizing immune responses against human immunodeficiency virus type 1 in mice and nonhuman primates. DNA Cell Biol 1993;12(9):799–805. [14] Lin YL, Chen LK, Liao CL, Yeh CT, Ma SH, Chen JL, et al. DNA immunization with Japanese encephalitis virus nonstructural protein NS1 elicits protective immunity in mice. J Virol 1998;72(1):191–200. [15] Chen HW, Pan CH, Liau MY, Jou R, Tsai CJ, Wu HJ, et al. Screening of protective antigens of Japanese encephalitis virus by DNA immunization: a comparative study with conventional viral vaccines. J Virol 1999;73(12):10137–45. [16] Chow YH, Huang WL, Chi WK, Chu YD, Tao MH. Improvement of hepatitis B virus DNA vaccines by plasmids coexpressing hepatitis B surface antigen and interleukin-2. J Virol 1997;71(1):169–78. [17] Henke A, Wagner E, Whitton JL, Zell R, Stelzner A. Protection of mice against lethal Coxsackievirus B3 infection by using DNA immunization. J Virol 1998;72(10):8327–31. [18] Shih SR, Ho MS, Lin KH, Wu SL, Chen YT, Wu CN, et al. Genetic analysis of enterovirus 71 isolated from fatal and non-fatal cases of hand, foot and mouth disease during an epidemic in Taiwan, 1998. Virus Res 2000;68(2):127–36. [19] Blondel B, Akacem O, Crainic R, Couillin P, Horodniceanu F. Detection by monoclonal antibodies of an antigenic determinant critical for poliovirus neutralization present on VP1 and on heat-inactivated virions. Virology 1983;126(2):707–10.
903
[20] Brown BA, Pallansch MA. Complete nucleotide sequence of enterovirus 71 is distinct from poliovirus. Virus Res 1995;39(2/3): 195–205. [21] von Zeipel G. Neutralization of aggregated strains of enterovirus 71 and echovirus type 4 in RD and Vero or GMK-AH1 cells. Acta Pathol Microbiol Scand B 1979;87b(1):71–3. [22] Katze MG, Crowell RL. Indirect enzyme-linked immunosorbent assay (ELISA) for the detection of Coxsackievirus group B antibodies. J Gen Virol 1980;48(1):225–9. [23] Hughes JV, Stanton LW. Isolation and immunizations with hepatitis A viral structural proteins: induction of antiprotein, antiviral, and neutralizing responses. J Virol 1985;55(2):395–401. [24] Emini EA, Jameson BA, Wimmer E. Priming for and induction of anti-poliovirus neutralizing antibodies by synthetic peptides. Nature 1983;304(5928):699–703. [25] Emini EA, Jameson BA, Lewis AJ, Larsen GR, Wimmer E. Poliovirus neutralization epitopes: analysis and localization with neutralizing monoclonal antibodies. J Virol 1982;43(3):997–1005. [26] van der Marel P, Hazendonk TG, Henneke MA, van Wezel AL. Induction of neutralizing antibodies by poliovirus capsid polypeptides VP1, VP2 and VP3. Vaccine 1983;1(1):17–22. [27] van Wezel AL, van der Marel P, Hazendonk TG, Boer Bak V, Henneke MA. Antigenicity and immunogenicity of poliovirus capsid proteins. Dev Biol Stand 1983;55:209–15. [28] van der Werf S, Dreano M, Bruneau P, Kopecka H, Girard M. Expression of poliovirus capsid polypeptide VP1 in Escherichia coli. Gene 1983;23(1):85–93. [29] van der Werf S, Wychowski C, Bruneau P, Blondel B, Crainic R, Horodniceanu F, et al. Localization of a poliovirus type 1 neutralization epitope in viral capsid polypeptide VP1. Proc Natl Acad Sci USA 1983;80(16):5080–4. [30] Page GS, Mosser AG, Hogle JM, Filman DJ, Rueckert RR, Chow M. Three-dimensional structure of poliovirus serotype 1 neutralizing determinants. J Virol 1988;62(5):1781–94. [31] Smith TJ, Chase ES, Schmidt TJ, Olson NH, Baker TS. Neutralizing antibody to human rhinovirus 14 penetrates the receptor-binding canyon. Nature 1996;383(6598):350–4. [32] Fehr T, Skrastina D, Pumpens P, Zinkernagel RM. T-cell-independent type I antibody response against B-cell epitopes expressed repetitively on recombinant virus particles. Proc Natl Acad Sci USA 1998;95(16):9477–81. [33] Bachmann MF, Zinkernagel RM. The influence of virus structure on antibody responses and virus serotype formation. Immunol Today 1996;17(12):553–8. [34] Morein B, Simons K. Subunit vaccines against enveloped viruses: virosomes, micelles and other protein complexes. Vaccine 1985;3(2): 83–93. [35] Rock KL, Rothstein L, Gamble S, Fleischacker C. Characterization of antigen-presenting cells that present exogenous antigens in association with class I MHC molecules. J Immunol 1993;150(2): 438–46. [36] Shen Z, Reznikoff G, Dranoff G, Rock KL. Cloned dendritic cells can present exogenous antigens on both MHC class I and class II molecules. J Immunol 1997;158(6):2723–30. [37] Ulmer JB, Donnelly JJ, Liu MA. Presentation of an exogenous antigen by major histocompatibility complex class I molecules. Eur J Immunol 1994;24(7):1590–6. [38] Muckelbauer JK, Kremer M, Minor I, Diana G, Dutko FJ, Groarke J, et al. The structure of Coxsackievirus B3 at 3.5 A resolution. Structure 1995;3(7):653–67. [39] Smyth M, Tate J, Hoey E, Lyons C, Martin S, Stuart D. Implications for viral uncoating from the structure of bovine enterovirus. Nat Struct Biol 1995;2(3):224–31. [40] Pevear DC, Luo M, Lipton HL. Three-dimensional model of the capsid proteins of two biologically different Theiler virus strains: clustering of amino acid difference identifies possible locations of immunogenic sites on the virion. Proc Natl Acad Sci USA 1988;85(12):4496–500.
904
C.-N. Wu et al. / Vaccine 20 (2002) 895–904
[41] Zhang MJ, Wang MX, Jiang SZ, Xiu ZZ, Ma WY. Preparation and characterization of the monoclonal antibodies against Japanese encephalitis virus. Acta Virol 1992;36(6):533–40. [42] Cohen AD, Boyer JD, Weiner DB. Modulating the immune response to genetic immunization. Faseb J 1998;12(15):1611–26. [43] Constant S, Sant’Angelo D, Pasqualini T, Taylor T, Levin D, Flavell R, et al. Peptide and protein antigens require distinct antigen-presenting cell subsets for the priming of CD4+ T-cells. J Immunol 1995;154(10):4915–23. [44] Street NE, Mosmann TR. Functional diversity of T-lymphocytes due to secretion of different cytokine patterns. Faseb J 1991;5(2): 171–7.
[45] Janeway CA, Travers P, Walport M, Capra JD. The humoral immune response. In: Austin P, Lawrence E, editors. Immunobiology: the immune system in health and disease. London: Blink Studio, 1999. [46] Ren RB, Costantini F, Gorgacz EJ, Lee JJ, Racaniello VR. Transgenic mice expressing a human poliovirus receptor: a new model for poliomyelitis. Cell 1990;63(2):353–62. [47] Hagiwara A, Tagaya I, Yoneyama T. Common antigen between Coxsackievirus A 16 and enterovirus 71. Microbiol Immunol 1978; 22(2):81–8. [48] Hagiwara A, Tagaya I, Komatsu T. Seroepidemiology of enterovirus 71 among healthy children near Tokyo. Microbiol Immunol 1979;23(2):121–4.