- Email: [email protected]
Protective roles and mechanisms of Dendrobium officinal polysaccharides on secondary liver injury in acute colitis
Accepted Manuscript Title: Protective roles and mechanisms of Dendrobium officinal polysaccharides on secondary liver injury in acute colitis Authors: Jian Liang, Shuxian Chen, Youdong Hu, Yiqi Yang, Jun Yuan, Yanfang Wu, Shijie Li, Jizhong Lin, Lian He, Shaozhen Hou, Lian Zhou, Song Huang PII: DOI: Reference:
S0141-8130(17)32358-9 https://doi.org/10.1016/j.ijbiomac.2017.10.085 BIOMAC 8380
To appear in:
International Journal of Biological Macromolecules
Received date: Revised date: Accepted date:
29-6-2017 3-10-2017 14-10-2017
Please cite this article as: Jian Liang, Shuxian Chen, Youdong Hu, Yiqi Yang, Jun Yuan, Yanfang Wu, Shijie Li, Jizhong Lin, Lian He, Shaozhen Hou, Lian Zhou, Song Huang, Protective roles and mechanisms of Dendrobium officinal polysaccharides on secondary liver injury in acute colitis, International Journal of Biological Macromolecules https://doi.org/10.1016/j.ijbiomac.2017.10.085 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Protective roles and mechanisms of Dendrobium officinal polysaccharides on secondary liver injury in acute colitis
Jian Liang a, d, 1, Shuxian Chen b, 1, Youdong Hu c, 1, Yiqi Yanga, Jun Yuane, Yanfang Wu a, d, Shijie Li
a, d,
Jizhong Lin
b, d,
Lian He f, Shaozhen Hou
a, d,
Lian Zhou a, *, Song Huang a, d,
**
a
Guangzhou University of Chinese Medicine, Guangzhou 510006, Guangdong, PR China
b
Department of Hepatobiliary Surgery, the Third Affiliated Hospital of Sun Yat-Sen
University, Guangzhou, Guangdong, China c
Affiliated Huai'an Hospital of Xuzhou Medical University，Huai'an 223002, Jiangsu, PR
China d
Guangdong Provincial Key Laboratory of New Drug Development and Research of
Chinese Medicine, Guangzhou 510006, Guangdong, PR China e
Jiangsu Key Laboratory of Regional Resource Exploitation and Medicinal Research,
College of Chemical Engineering, Huaiyin Institute of Technology, Huai'an 223003, Jiangsu, PR China f
Guangdong Food and Drug Vocational College, Guangzhou 510520, Guangdong, PR
China *Corresponding author: Lian Zhou; E-mail address: [email protected]. **Corresponding author: Song Huang; E-mail address: [email protected]. 1
These authors contributed equally to this paper.
Highlights
Hepatoprotective activity of Dendrobium officinal polysaccharides (DOPS) was studied.
DOPS could alleviate secondary liver injury in acute colitis.
DOPS could down-regulated TNF-α signaling pathway.
DOPS could activate Nrf-2 signaling pathway.
Abstract The purpose of this study was to investigate the protective roles and mechanisms of Dendrobium officinale polysaccharides (DOPS) on secondary liver injury in acute colitis. Firstly, the mice model of secondary liver injury in acute colitis was induced by 4% Dextran sodium sulfate (DSS). Inflammatory cell model was established by LPS-stimulated RAW264.7 cells. Then, the protective roles of DOPS were evaluated by both in vivo and in vitro experiment. The results showed that DOPS attenuated DSS-induced hepatic pathological damage, liver parameters, infiltration of macrophages, cytokines levels, MDA level and increased the antioxidant enzymes activities. In vitro, DOPS markedly inhibited inflammatory cytokines production and increased antioxidant enzymes activities. Finally, its molecular mechanisms were also observed. The results indicated that DOPS could down-regulated TNF-α signaling pathway and activated Nrf-2 signaling pathway in vivo and in vitro. These results suggested that DOPS may be an effective therapeutic reagent to attenuate secondary liver injury in acute colitis.
Keywords: Dendrobium officinale polysaccharides; Secondary liver injury in acute colitis; Nrf-2 signaling pathway
1. Introduction It is reported that secondary liver injury was occurs in many inflammatory bowel disease (IBD) patients [1, 2]. In addition, secondary liver injury can be further aggravated and lead to chronic liver disease [3]. Although the mechanism of liver disorder in the IBD patients remains to be elucidated, the liver injury caused by other factors have been reported extensively [4, 5]. Accumulating evidences have shown that inflammation and oxidative stress are the two major factors inducing liver injury [6]. Inflammatory, autoimmune and oxidative alterations which contribute to the pathogenesis of IBD may provide important clues to understand the pathogenesis of liver injury caused by colitis. The excessive production of pro-inflammatory cytokines (e.g. TNF-α, IL-1β, IL-6) is one
of the main characterizations in IBD [7]. In inflammatory conditions, Kupffer cells and macrophages can be activated and recruit other inflammatory cells in the liver, promoting hepatic inflammation [8]. Meanwhile, massive kinases are continuously activated and lead to the activation of glycogen synthase kinase 3-beta (GSK3β) and p38, which are playing a negative regulation of Nrf-2 via the phosphorylation and result in the weakening the body’s antioxidant effect [9]. As an important cytoprotective transcription factor, Nrf-2 can regulate oxidative stress and inflammatory response. Many studies have shown that Nrf-2 can effectively protect liver, therefore, the regulation of Nrf-2 may be the therapeutic target for liver injury induced by colitis [10, 11]. Dendrobium officinale (Orchidaceae) is a valuable Chinese herbal medicine. Previous studies have shown Dendrobium officinale polysaccharides (DOPS) have anti-oxidative [12, 13], anti-inflammatory [14] and hepatoprotective [15] activities. The hepatoprotective effects of DOPS have been reported in many studies’ by exert its anti-oxidative and anti-inflammatory [16, 17]. It seems that DOPS could have the therapeutic potential in attenuating liver injury in IBD model through its effects of anti-inflammatory and anti-oxidant. But there is little report about these. Besides, the mechanism of DOPS protect against liver injury is still unknown. Dextran sodium sulfate (DSS), a sulfate polysaccharide, which is widely used to induced experimental colitis model and DSS also was reported to cause hepatic damage [18, 19]. Therefore, in the present study, we adopted DSS to induce liver injury in mice, and then investigated the role of inflammation and oxidative stress in the DSS-induced liver injury mice. At last, effect of DOPS on inflammation and Nrf-2/keap1-mediated oxidative
stress signaling pathways were investigated both in vivo and in vitro. 2. Materials and Methods 2.1. Materials and reagents DOPS was prepared by previously published report [12]. Total polysaccharide content of DOPS was 93.80% by phenol sulfuric acid method determination. Its FT-IR Spectrogram, GC chromatograms of monosaccharide composition and HPLC profiles of molecular weight measurement were provided in the Supplementary Fig. 1. FT-IR spectroscopy from Supplementary Fig. 1A indicated that DOPS has a strong and broad absorption peak at 3414 cm-1, a weak peak at 2924 cm-1 and an asymmetric stretching at 1175 cm-1. They were respectively assigned to O-H stretching vibrations, C-H stretching vibrations, and stretching C-C or C-O vibrations stretching vibrations, suggesting the characteristic absorptions of polysaccharides. The results of monosaccharide composition and molecular weight measurement also implied that DOPS was composed of mannose and glucose in a molar ratio of 5.83:1.05 (Supplementary Fig. 2B) with average molecular weight of 393.8 kDa (Supplementary Fig. 2C). Dextran sodium sulfate (DSS) was purchased from MP Biomedicals (MW; 36000-50000, MP Biomedicals, Solon, OH, USA). Aspartate aminotransferase (AST), Alanine aminotransferase (ALT) and ECL assay kits were obtained from Nanjing Jiancheng Bioengineering institute (Nanjing, China). Triglyceride (TG) and Total Cholesterol (TC) detection kits were purchased from Biosino Bio-Technology & Science Inc. The Bio-Plex mouse Cytokine Panel assay kits for measurement of TNF-α and IL-1β were obtained from Bio-Rad (Bio-Rad, USA). The ELISA assay kits for GSH-Px and SOD
were obtained from Huamei (Cusabio Biotech Co. Ltd, China). The MDA ELISA assay kit was obtained from Xitang (Xitang Biotech Co. Ltd, Shanghai, China). The quantitative chromogenic tachypleus amebocyte lysate for endotoxin (pyrogen) detection kit for lipopolysaccharide (LPS) was obtained from Xiamen BioEndo Technology (BioEndo Technology, China). RNAiso Plus reagent, PrimeScriptTMRT reagent kit and SYBR Green PCR Master Mix were provided by Takara (Takara, Japan). Antibodies against TNF-α, Nrf-2, keap1, HO-1 and GAPDH were purchased from Abcam (Abcam, USA). Antibody against CD68 and HistostainTM-plus kits were purchased from Bioss (Bioss, China). RPMI Medium 1640, Fetal bovine serum (FBS), and phosphate buffer saline (PBS) were purchased from GIBCO Laboratories (Grand Island, NY, USA) and penicillin G/streptomycin, MTT, Oil Red O and Dimethyl Sulphoxide (DMSO) were purchased from Sigma (St. Louis, MO, USA). 2.2 Animals and treatment Male BalB/c mice (18-22 g) were purchased from the Laboratory Animal Services Center, Guangzhou University of Chinese Medicine (Guangzhou, China). Animals were housed under specific pathogen free (SPF) condition of temperature at 20-25℃ a 12 h dark/ light cycle and relative humidity of 50 %-80 %, and allowed free access to sterilized water and standard food. The study was guided and approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine. Acute colitis mice were induced according to the method described by Liang [20], with slight modifications. Briefly, colitis was induced in BalB/c mice with 4% DSS (molecular mass 36000-50000, MP Biomedicals) dissolved in drinking water given ad
libitum for 14 days. All mice were randomly divided into 5 groups (n= 10/group): (1) Normal group (only received drinking water), (2) DSS group (given drinking water with 4% DSS throughout the experimental period), (3) other three groups consisted of mice receiving 4% DSS and administrated with DOPS (50, 100, 200 mg/kg/day p.o. respectively for 14 days). The optimal concentration range was determined according to the preliminary experiment. On the day 15, all mice were all sacrificed after being fasted for 12 h and anesthetized by pentobarbital sodium. Then mice blood samples were drawn from orbit and transferred to 2 ml EP tubes followed by the centrifugation at 3000 rpm for 10 min at 4°C and then stored at -80°C for biochemical assays. Liver tissues were quickly removed and weighted. Each liver was divided into two parts, one was used for histopathological examination and the other one was stored at -80°C for further biochemical assays. 2.3. Cell culture and Cytotoxicity The RAW264.7 cells were purchased from iCell Bioscience Inc (Shanghai, China) and cultured in RPMI Medium 1640 with 10 % FBS plus, penicillin (100 U/ml）and streptomycin (100 μg /ml). Cells were incubated in a humidified incubator with 5% (v/v) CO2 atmosphere at 37°C. In all cell experiments, cell viability was higher than 95 %. The cytotoxicity of DOPS for RAW264.7 cells was evaluated by MTT assay. 100 μl of cells were incubated in 96-well plates at 1 × 104 cells/ml and treated with different concentrations of DOPS for 24 h, and then 20 μl MTT (5 mg/ml) was added in each well and continue incubated for 4 h. After the removal of medium, 150 μl DMSO was added in each well, and finally the plates were read at 490 nm with Multiskan Go plate reader. 2.4. Cell treatment
1 ml RAW264.7 cells (2 × 105 cells/ml) were seeded in 6-well plates with different concentrations of DOPS (The optimal concentration range was selected according to the cytotoxicity). After 6 h, one of the wells was selected as a control, the rest wells were stimulated with LPS (2 μg/ml) and continue 24 h under the previous conditions. After 24 h, the cell supernatant was collected and detected for cytokine levels and antioxidant activity. RAW264.7 cells were also collected for detecting gene and protein expressions. 2.5. Cytokine levels The levels of IL-1β and TNF-α in the serum and cell supernatants were measured using the Bio-Plex multiplex mouse cytokine assay system (Bio-Rad, USA) according to the instruction of manufacturer. The results were analyzed using the BioPlex Manager software. The levels of cytokine were quantified by standard curves. 2.6. Histopathological examination and Oil Red O staining The liver tissues from mice were fixed in 4 % buffered paraformaldehyde for 24 h, and then embedded in paraffin. According to standard method, organ tissues were cut into 5 μm and stained with hematoxylin and eosin (H&E) for histopathological examination. The pathological damage was evaluated according to the protocol of Gao [21]. Lipid accumulation in liver was assessed by oil red O staining. Frozen liver samples were embedded in OCT-media on a cryostat (Thermo Scientific, USA) and sectioned at 6 μm. The slides were aie-dried at RT for 20 min and rehydrated, and then stained with 0.5 % oil red O (Siama, USA) for 20 min. The slides were rinsed with 60 % isopropyl alcohol for 2 min, and then the slides were counterstained with hematoxylin for 50 s, rinsed in tap water for 2 min. Finally, the sections were observed under the light microscope (Olympus,
Japan). 2.7. Immunohistochemistry CD68+ macrophage infiltration analysis was assayed on liver tissue slides (4 μm). The sections were deparaffinized, rehydrated and washed in PBS. The slides were tigen retrieval by incubating in citrate buffer in microwave oven, then 3 % H 2O2 was used to block the endogenous peroxidase activity. The slides were then incubated with polyclonal primary antibodies CD68 (1:400, Bioss, Beijing, China) for overnight at 4℃. Then, the slides were incubated in secondray antibody (Bioss, Beijing, China) for 2h at RT. Subsequently, the slides were incubated with streptavidin HRP (Bioss, Beijing, China) and counterstained with hematoxylin for 50 s, rinsed in tap water for 1 min. The sections were observed under the light microscope (Olympus, Japan). 2.8. Serum biochemical analysis The levels of AST and ALT in the serum were detected using commercial detection kits (Jiancheng Bioengineering Institute, China). In addition, TG and TC in the serum were also assayed using triglycerides kit and cholesterol kit (Zhongsheng Bioengineering Institute, China). The level of LPS in the serum and liver were assayed using quantitative chromogenic tachypleus amebocyte lysate for endotoxin (pyrogen) detection kit (Xiamen BioEndo Technology, China). The detections were conducted under the instructions of manufacturers. 2.9. Antioxidant activity The activities of SOD and GSH-Px in liver tissues and cell supernatants were measured by using enzyme-linked immunosorbent assay (ELISA) kits according to the
manufacturers’ protocols. The level of MDA in the liver samples was also detected by using enzyme-linked immunosorbent assay (ELISA) kit following the instruction of manufacturer. 2.10. Gene expressions Total RNA of liver samples was obtained by using RNAiso Plus reagent (TaKaRa, Japan) following the manufacturer’ protocol. The concentration was quantified by Nanodrop 2000c (Thermo Scientific). Then, 1μg RNA was reverse transcribed to cDNA using a PrimeScriptTMRT reagent kit (TaKaRa, Japan). cDNA can be amplified using the SYBR Green PCR Master Mix and specific primers in the CFX96 Real-Time PCR Detection system (Bio-Rad, USA) and these primers were listed as follows: Nrf-2-F, (5’TCCGCTGCCATCAGTCAGTC 3’) and Nrf-2-R, (5’ATTGTGCCTTCAGCGTGCTTC 3’);
NQO-1-F,
(5’
CAAGTTTGGCCTCTCTGTGG
3’)
and
NQO-1-R,
(5’
AAGCTGCGTCTAACTATATGT 3’); HO-1-F, (5’AACAAGCAGAACCCAGTCTATGC 3’)
and
HO-1-R,
(5’ AGGTAGCGGGTATATGCGTGGGCC
3’);
IL-1β-F,
(5’
GCCCATCCTCTGTGACTCA 3’) and IL-1β-R, (5’AGGCCACAGGTATTTTGTC 3’); TNF-α-F,
(5’CCCTTTACTCTGACCCCTTTATTGT
3’)
and
TNF-α-R,
(5’TGTCCCAGCATCTTGTGTTTCT 3’); GAPDH-F, (5’TGTGTCCGTCGTGGATCTGA 3’) and GAPDH-R, (5’TTGCTGTTGAAGTCGCAGGAG 3’). The amplification condition was performed as follows: 95℃ for 30 s, and then 40 cycles of 95℃ for 5 s and 60℃ for 30 s. Relative mRNA expressions of TNF-α, IL-1β, Nrf-2, HO-1 and NQO-1 were calculated using the 2-△△Ct method. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. All target genes were normalized with GAPDH.
2.11. Western blotting analysis Liver samples were soaked in 1 ml pre-cool RIPA buffer (Beyotime, China) containing phenylmethanesulfonyl fluoride (PMSF) inhibitors (Beyotime, China) and homogenized at 4℃. The homogenate was centrifuged at 12000 × g for 10 min. Then the supernatant was collected and finally the concentration was detected by using the BCA protein assay kit (Beyotime, China). Protein samples and loading buffer were mixed at the ratio of 4:1 and boiled for 6 min. The mixture was separated in 8%-10% SDS-PAGE electrophoretic gel and transferred to PVDF membrane (Bio-Rad, USA) for 1.5 h. The membranes were blocked in 5% non-fat powdered milk dissolved in TBST for 1 h. The membranes were then incubated with antibodies against TNF-α, Nrf-2, keap1, HO-1 and GAPDH (1:1000, Abcam, USA) overnight at 4℃. After 3 washes in TBST, the membranes were incubated in appropriate HRP-conjugated secondary antibodies conjugated for 1h at RT. Protein bands were visualized by ECL kit and analyzed using ImageJ software. 2.12. Statistical analysis The data are expressed as the mean ± standard error of mean (mean ± S.E.M). All data were analyzed using the SPSS 17.0 statistical software. The data were compared by the one way-ANOVA with the Student’s t-test. P <0.05 were considered as statistically significant. 3. Result and discussion 3.1 DOPS protected DSS-induced liver injury in mice In order to investigate whether DOPS can protect the liver from the damage caused by colitis, H&E staining was used to analyze the histopathological condition of the liver. In control group, the liver tissue revealed normal hepatic architecture, orderly organization
structure and without steatosis (Fig. 1C). However, in the DSS-induced mice model, the liver pathological score was obviously increased and the liver showed significant pathological changes, such as hepatocyte destructions and hepatic enlargement. The animals treated with DOPS presented less hepatocyte damage, as well as a refin-effect of liver tissue and hepatic enlargement (Fig. 1C). The histopathological scores of liver were significantly decreased after DOPS treatment (Fig. 1E). Representative liver images were also showed in Fig.1A-B. In addition, DOPS inhibited the liver index increase (Fig. 1D). These results suggest that DOPS can protect DSS-induced liver injury. 3.2 Effects of DOPS on the levels of serum AST, ALT, TG, TC and Oil Red O staining in DSS-induced liver injury in mice The activities of serum ALT and AST were detected to evaluate the degree of liver injury [22]. Compared to the control group, the activities of serum ALT and AST increased significantly in DSS group (P<0.01) (Fig. 2A-B). Treatment with DOPS inhibited significantly ALT and AST activities in a dose dependent manner as compared to the DSS group (Fig. 2A-B), suggesting that DOPS play a protective role against DSS-induced liver injury. Liver injury can cause liver dysfunction which leads to hepatic steatosis [23]. In this study, the levels of serum TG and TC were significantly elevated compared to the control group (P<0.01) (Fig. 2C-D), as well as DOPS significantly reversed TG and TC levels compared to the DSS group. Meanwhile, we also analyzed the condition of lipid accumulation in the live by oil red O staining. We found that the deposition of lipid droplets was generally increased in the live tissues of colitis mice. Liver tissues from the
DSS+DOPS groups could dose-dependently limited lipid accumulation in the liver as compared to the DSS group (Fig. 2E-F). These results suggested that DOPS could improve dyslipidemia in DSS-induced liver injury. 3.3 DOPS suppressed the LPS production and relieved macrophage infiltration in liver tissue. In colitis mice, the gut-derived LPS plays an important role in activating inflammatory signal pathway and cause tissues injury [24]. We further investigated the level of LPS in serum and liver. We found that the level of LPS in serum and liver was significantly increased in DSS group. However, treatment with DOPS the level of LPS in serum and liver was markedly decreased when compared to the DSS group. The data showed that DOPS could inhibit LPS production and exert protective effect on DSS-induced liver injury (Fig. 3A-B). In addition, the excessive accumulation of LPS in liver tissue also could induce the activation of macrophages in liver and cause hepatic inflammation [25]. IHC staining for the liver’s macrophage marker showed that DSS-enhanced infiltration of CD68+ macrophages in liver tissues. However, the increase of liver’s macrophages infiltration was obviously decreased by DOPS treatment in DSS-induced colitis mice (Fig. 3C-D). These results showed that DOPS significantly suppresed macrophage recruitment in the liver, which is responsible for relieving liver inflammation. 3.4 The Effects of DOPS on serum inflammatory cytokines production and the activities of SOD, GSH-Px and MDA in liver. The excessive productions of inflammatory cytokines in liver tissues can cause liver
injury [26]. The serum levels of IL-1β and TNF-α were detected to investigate the anti-inflammatory effect of DOPS. The data showed that the levels of inflammatory cytokines significantly increased in the DSS group compared to the control group, while treatment with DOPS effectively inhibited the secretions of inflammatory cytokines (Fig. 3E-F). The activities of liver SOD, GSH-Px and MDA were analyzed to assess the organism anti-oxidative capability. The SOD and GSH-Px activities significantly declined as compared to the control group (Fig. 3G-I). Administration of DOPS could significantly increase the SOD and GSH-Px activities compared to the DSS group. In the DSS group, the level of MDA was obviously higher than the control group. DOPS significantly reduced MDA level compared with DSS group (Fig. 3I). These results suggest that inflammation and oxidative stress were closely related to liver injury caused by colitis. In addition, DOPS could play the protective effect through the anti-inflammatory and anti-oxidative properties. 3.5 DOPS inhibited inflammation and Nrf-2/keap1-mediated oxidative stress signaling pathways in mice To further estimate the anti-inflammation and anti-oxidative effects of DOPS in the liver. We detected the mRNA levels of TNF-α, IL-1β, Nrf-2, HO-1 and NQO-1 by quantitative RT-PCR, as well as the protein levels of TNF-α, IL-1β, Nrf-2, keap1 and HO-1 by Western blot in the liver tissues. According to the data of RT-PCR, in the DSS group, the mRNA levels of TNF-α and IL-1β increased significantly, while significantly reduced the gene expressions of Nrf-2, HO-1and NQO-1 compared with the control group.
Treatment with DOPS could significantly up-regulate the genes expression of Nrf-2, HO-1 and NQO-1 and obviously down-regulate TNF-α and IL-1β genes expression (Fig. 4). As shown in Fig. 5, the protein expressions of Nrf-2, HO-1 and NQO-1 were significantly down-regulated in the liver with DSS treatment and the protein levels of TNF-α and IL-1β were obviously increased compared to the control group. Administration of DOPS could significantly up-regulate Nrf-2, HO-1 and NQO-1 protein levels and down-regulate TNF-α protein level. The data indicates that DOPS can play the role of anti-oxidative and anti-inflammatory by activating the Nrf-2 signaling pathway and down-regulate TNF-α expression. 3.6 Effects of DOPS on macrophages viability The cytotoxicity of DOPS was assessed by MTT assay. The data showed that 50, 100, 200 and 400 μg/ml DOPS did not affect the viability of RAW264.7 cells for 24-hour incubation (Fig.6 B). 3.7 The anti-inflammatory and anti-oxidant effects of DOPS in LPS-stimulated RAW264.7 cells The damage of inflammation and oxidative stress can be induced by LPS in macrophages. Next, we investigated the anti-inflammatory and anti-oxidant effects of DOPS in LPS-stimulated RAW264.7 cells. We found that the activities of SOD and GSH-Px significantly decreased in LPS-stimulated RAW264.7 cells, while the levels of MDA, TNF-α and IL-1β increased significantly. However, treatment with DOPS could significantly reverse all of those parameters caused by DSS in a dose-dependent manner (Fig. 6 C-G) and protected LPS-induced RAW264.7 cells damage (Fig. 6A).
3.8 DOPS inhibited inflammation and Nrf-2/keap1-mediated oxidative stress signaling pathways in LPS-stimulated RAW264.7 cells Nrf-2 is an anti-oxidative regulator [26]. Activation of the Nrf-2 can release HO-1, which could exert anti-oxidative and anti-inflammatory effects [27]. The related genes and proteins of Nrf-2 signal pathway were analyzed by quantitative RT-PCR and Western blot in LPS-stimulated RAW264.7 cells. As shown in Fig. 7 and Fig.8, Nrf-2, HO-1 and NQO-1 mRNA and protein expressions were significantly down-regulated. IL-1β and TNF-α mRNA and protein expressions were obviously up-regulated in LPS-stimulated RAW264.7 cells. Administration with DOPS could effectively protect LPS-stimulated macrophages and markedly up-regulated Nrf-2, HO-1 and NQO-1 mRNA and protein expressions, while reducing the mRNA and protein expressions of IL-1β and TNF-α in a dose-dependent manner. The data showed that signal transduction by Nrf-2 molecules and inflammation could be effectively affected by DOPS. 4. Discussions Liver injury is one of the most common complications of IBD. Few studies have explored the mechanism of liver damage caused by colitis or pay attention to the treatment effect of drugs for liver injury in IBD patients. Dendrobium officinale, a valuable traditional Chinese herbal medicine, which is widely used to treat many disease owing to its potential health benefits [28]. In the present study, we investigated the mechanism of liver damage and demonstrated the therapeutic effects of DOPS on liver injury caused by colitis for the first time. AST and ALT can be used to evaluate liver injury as sensitive indicators. The levels of
AST and ALT in serum can reflect the degree of liver injury [29]. Clinically, patients with IBD often cause liver injury, and the liver injury will be further aggravated and developed into chronic liver diseases such as fatty liver disease, autoimmune hepatitis [30, 31]. In this study, we found that the levels of AST, ALT, TG, TC and the condition of lipid accumulation were markedly increased, the general form and histopathological condition of liver significantly changed in DSS group, indicating that 4% DSS can cause liver injury in mice for 14 days. Interestingly, administration of DOPS could significantly decrease the activities of AST and ALT, and reversed the levels of TG and TC tends to normal level. DOPS also could reduce lipid accumulation in liver. In addition, DOPS could improve histopathological condition of liver and improve the condition of steatosis and liver injury. The results suggested that DOPS may be beneficial for treating liver injury caused by colitis. The mechanism of DSS-induced liver injury is rarely reported. Accumulating evidences suggested that the involvement of inflammation and oxidant stress plays an important role in liver injury [32]. Inflammatory lesions are the major feature of DSS-induced colitis [33], suggesting that inflammation is likely to be the main factor for liver injury caused by colitis. In addition, the gut-derived LPS could cause the activation of macrophages and further aggravate tissues injury [34]. The hyper-activation of inflammatory cytokines also could activate macrophage in liver, which can increase the secretion of numerous pro-inflammation cytokines such as TNF-α and IL-1β and aggravate liver injury and steatosis [35]. Meanwhile, Nrf-2, a nuclear transcription factor, is a regulator of oxidant stress and high expression in the liver [36]. Under the normal state,
Nrf-2 is silenced by link keap1 and form a complex. In the process of oxidative stress, Nrf-2 is released from complex and exerts the anti-oxidative effect [37]. Activated Nrf-2 signal pathway can regulate the expressions of antioxidant enzyme genes HO-1 and NQO-1. Activation of the Nrf-2 can confront various stimuli and play a protective role via anti-oxidation and anti-inflammation in the liver [38]. Nrf-2 knockout mice were more susceptible to develop into liver injury [39]. Therefore, the protective roles of Nrf-2 signal pathway have been widely investigated in the pathogenesis of liver diseases. Based on these evidences, we explored the effects of inflammation and Nrf-2 signal pathway on liver injury caused by colitis. Our data showed that the levels of inflammation cytokines and macrophages infiltration in liver tissue markedly increased, while the antioxidant enzyme activities reduced significantly in DSS group. Meanwhile, our data also evidenced that the mRNA and proteins of Nrf-2, keap1, HO-1 and NQO-1 significantly decreased and TNF-α and IL-1β significantly increased in liver after DSS treatment. These results indicated that inflammation and oxidative stress play a crucial role in the pathogenesis of liver injury caused by colitis. Previous data showed that DOPS could effectively ameliorate DSS-induced liver injury in mice. To study whether the therapeutic effects of DOPS is through the regulation of inflammation via Nrf-2 signaling pathway in vivo and in vitro. TNF-α is a cytokine involved in systemic inflammatory response and an integral part of the acute phase response [40]. In the study, DOPS reversed TNF-α and IL-1β mRNA expression levels in DSS-induced colitis model and LPS-stimulated RAW264.7 cells model. In addition, DOPS could significantly reduce the amounts of macrophages in liver tissues and down-regulated
the expression of TNF-α protein in vivo and in vitro. These show that DOPS could inhibit inflammatory signaling pathway and reduce macrophages infiltration in liver tissue to relief DSS-induced inflammatory response. In addition, Nrf-2 signaling pathway was detected in vivo and in vitro with DOPS. Our data showed that DOPS could obvious up-regulate the mRNA or proteins expressions of Nrf-2, keap1, HO-1 and NQO-1. Nrf-2 signaling pathway owns a negative effect on TNF-α expression [41], which suggests that the activation of Nrf-2 by DOPS may target on the inactivation of DSS-induced inflammatory signaling pathways. DOPS attenuates DSS-induced excessive oxidative stress to attenuate inflammation response, resulting in preventing liver injury. Therefore, DOPS alleviated DSS-induced liver injury by regulating Nrf2 signaling pathway and inflammation response. In conclusion, according to our results, we found that inflammation and oxidative stress are the major factors for DSS-induced liver injury. DOPS protect liver tissues from inflammation and oxidative stress induced by DSS in the liver via modulating the TNF-α/Nrf-2 signaling pathway. DOPS may be an effective therapeutic reagent to attenuate liver injury caused by IBD. Acknowledgements This work was supported by the Guangdong Province Universities and Colleges Pearl-River Scholar Funded Scheme, the Special Funds from Central Finance of China in Support of the Development of Local Colleges and University [Educational Finance Grant no. 276(2016)], Science and Technology Project Scheme of Guangdong Province (No. 2013B090800052), Guangdong Provincial Science and Technology Program - Basic
Conditions for Construction of Science and Technology Projects (2014A030304059), Application Science and Technology Research Special Program of Guangdong (No. 2015B020234008), Six Talent Peaks Project in Jiangsu Province (2017-YY-003), Key Talents Project of Youth Medical Science in Jiangsu Province (QNRC2016422), Innovative Development of Traditional Chinese Medicine Scientific Research Team (No. A1-AFD01515A03) and National Nature Science Foundation of China [81001601].
References [1] S. Restellini, O. Chazouillères, J.L. Frossard, Liver Int. 37 (201) 475-489. [2] F.D. Mendes, C. Levy, F.B. Enders, E.V. Loftus, P. Angulo, K.D. Lindor, American J. Gastroenterol. 102 (2007) 344. [3] L.E. Jr, W.J. Sandborn, K.D. Lindor, N.F. Larusso, Inflamm. Bowel Dis. 3 (1997) 288-302. [4] G. Szabo, J. Petrasek, Nat. Rev. Gastroenterol. Hepat. 12 (2015) 387-400. [5] H. Jaeschke, M.R. Mcgill, A. Ramachandran, Drug Metab. Rev. 44 (2012) 88-106. [6] B. Horváth, L. Magid, P. Mukhopadhyay, S. Bátkai, M. Rajesh, O. Park, G. Tanchian, R.Y. Gao, C.E. Goodfellow, M. Glass, Brit. J. Pharmacol. 165 (2012) 2462-2478. [7] M.A. Engel, M.F. Neurath, Springer New York, 27 (2013) 897-906. [8] X. Cai, C. Fang, S. Hayashi, S. Hao, M. Zhao, H. Tsutsui, S. Nishiguchi, J. Sheng, J. Gastroenterol. 51 (2016) 819-829. [9] I. Buendia, P. Michalska, E. Navarro, I. Gameiro, J. Egea, R. León, Pharmacol. Ther. 157 (2015) 84-104. [10] A.M. Kuhn, N. Tzieply, M.V. Schmidt, K.A. Von, D. Namgaladze, M. Yamamoto, B. Brüne, Free Radical Bio. Med. 50 (2011) 1382-1391. [11] X. Xu, H. Li, X. Hou, D. Li, S. He, C. Wan, P. Yin, M. Liu, F. Liu, J. Xu, Med. Inflam. 2015 (2015) 380218. [12] K. Huang, Y. Li, S. Tao, G. Wei, Y. Huang, D. Chen, C. Wu, Molecules, 21 (2016) 701. [13] A. Luo, Z. Ge, Y. Fan, Z. Chun, X. He, Molecules, 16 (2011) 1579-1592. [14] L. Xiang, C.S. Sze, T. Ng, Y. Tong, P. Shaw, C.S. Tang, Y.K. Zhang, Inflam. Res. 62
(2013) 313-324. [15] C. Liang, H. Li, S. Hou, J. Zhang, S. Huang, X. Lai, Modernization Trad. Chin. Med. Materi. -World Sci. Tech. 15 (2013) 233-237. [16] L.H. Pan, X.F. Li, M.N. Wang, X.Q. Zha, X.F. Yang, Z.J. Liu, Y.B. Luo, J.P. Luo, Int. J. Biol. Macromol. 64 (2014) 420-427. [17] X.Y. Wang, J.P. Luo, R. Chen, X.Q. Zha, L.H. Pan, Int. J. Biol. Macromol, 78 (2015) 354-362. [18] J. Jahnel, P. Fickert, C. Langner, C. Högenauer, D. Silbert, J. Gumhold, A. Fuchsbichler, M. Trauner, Liver Int. 29 (2009) 1316-1325. [19] A. Karlsson, A. Jägervall, M. Pettersson, A.K. Andersson, P.G. Gillberg, S. Melgar, Int. Immunopharmacol. 8 (2008) 20-27. [20] F. Liang, K. Xu, J. Ethnopharmacol. 192 (2016) 236-247. [21] Y.Z. Gao, L.F. Zhao, J. Ma, W.H. Xue, H. Zhao, Eur. J. Pharmacol. 780 (2016) 8. [22] D. Yan, H.L. Liu, Z.J. Yu, Y.H. Huang, D. Gao, H. Hao, S.S. Liao, F.Y. Xu, X.Y. Zhou, Int. J. Mol. Sci. 17 (2016) 1114. [23] W. Khovidhunkit, M.S. Kim, R.A. Memon, J.K. Shigenaga, A.H. Moser, K.R. Feingold, C. Grunfeld, J. Lipid Res. 45 (2004) 1169-1196. [24] Guo S, Nighot M, Al-Sadi R, Alhmoud T, Nighot P, Ma TY, J Immunol, 195 (2015) 4999-5010 [25] L Yao, W Chen, K Song, C Han, C R. Gandhi, K Lim, T Wu, Plos one, 12 (2017) e0176106. [26] S.B. Lee, J.W. Kang, S.J. Kim, J. Ahn, J. Kim, S.M. Lee, Brit. J. Pharmacol. 174
(2017) 195-209. [27] Y. Son, J.H. Lee, N.H. Kim, N.Y. Surh, E.C. Kim, H.T. Chung, D.G. Kang, H.O. Pae, Biofactors, 36 (2010) 210-215. [28] L. Xiao, T.B. Ng, Y.B. Feng, T. Yao, J.H. Wong, R.M. Yao, L. Li, F.Z. Mo, Y. Xiao, P.C. Shaw, Phytomed. 18 (2011) 194-198. [29] N. Yun, J.W. Kang, S.M. Lee, J. Nutr. Biochem. 23 (2012) 1249-1255. [30] A. Ghazalpour, S. Doss, X. Yang, J. Aten, E.M. Toomey, N.A. Van, S. Wang, T.A. Drake, A.J. Lusis, J. Lipid Res. 45 (2004) 1793-1805. [31] K.C.E. Kasmi, A.L. Anderson, M.W. Devereaux, S.A. Fillon, J.K. Harris, M.A. Lovell, M.J. Finegold, R.J.S, Hepat. 55 (2012) 1518-1528. [32] S. Z, J. Leukocyte Biol. 63 (1998) 534-541. [33] S Machtaler, F Knieling, R Luong, L Tian, JK Willmann, Theranostics, 5 (2015) 1175-1186. [34] K Miura, M Ishioka, S Minami, Y Horie, S Ohshima, T Goto, H Ohnishi, J Biol Chem, 291 (2016) 11504-11517. [35] Y.W. Dai, C.C. Zhang, H.X. Zhao, J.Z. Wan, L.L. Deng, Z.Y. Zhou, Y.Y. Dun, C.Q. Liu, D. Yuan, T. Wang, Immunopharmacol. Immunotoxicol. 38 (2016) 167-174. [36] K. Okada, J. Shoda, K. Taguchi, J.M. Maher, K. Ishizaki, Y. Inoue, M. Ohtsuki, N. Goto, H. Sugimoto, H. Utsunomiya, Biochem. Biophys. Res. Commu. 389 (2009) 431-436. [37] K.W. Kang, S.J. Lee, S.G. Kim, Antioxid. Redox Sign. 7 (2005) 1664-1673. [38] D.N. Hai, C. Young‐ Yeon, D.N. Tien, N.N. Hoai, M.C. Van, L. Jeong‐ Hyung, J.
Cell. Biochem. 117 (2015) 659. [39] S.M. Shin, J.H. Yang, S.H. Ki, Oxid. Med. Cell. longevity, 2013 (2013) 763257. [40] A.M. Szczygiel, G. Brzezinka, M. Targosz-Korecka, S. Chlopicki, M. Szymonski, Pflug. Arch. Eur. J. Phy. 463 (2012) 487-496. [41] A. Fragoulis, A. Greiber, C. Rosen, T. Pufe, C.J. Wruck, Free Radical Bio. Med. 53 (2012) S48-S48.
Figure Caption Fig. 1. Macroscopic appearance of liver samples (A and B), representative images showing liver histopathological changes (C) with H&E staining ( 100, 400), the relative liver weight (D) and histopathologic score (E). Values represent mean ± S.E.M (n=6). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 2. ALT activity (A), AST activity (B), TG levels (C), TC levels (D) in serum, (E) Mean lipid area of oil red O staining, (F) Repsentative pictures of frozen liver slides with oil red O staining (× 20). Values represent mean ± S.E.M (n=5-6). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 3.
LPS concentration in serum (A),
LPS concentration in liver (B),
Immunohistochemical staining of CD68+ positive cells in liver sections (× 10) (C), The quantitative analysis of CD68 staining in liver (D), IL-1β concentration (E) and TNF-α concentration (F) in serum samples, SOD activity(G), GSH-Px activity (H) and MDA activity (I) in liver tissues. Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 4. The pro-inflammatory cytokines mRNA expressions of IL-1β (A) and TNF-α (B). The mRNA expressions of Nrf2 (C), HO-1 (D) and NQO-1 (E). Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 5. Representative image of TNF-α (A), Nrf2, keap1 and HO-1 (B). The protein levels
of TNF-α (C), Nrf2 (D), HO-1 (E) and keap1 (F) were determined. Values represent mean ± S.E.M (n=3). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 6. LPS-stimulated RAW264.7 cells were treated with or without DOP (A). Cell viability (B), IL-1β concentration (C), TNF-α concentration (D), SOD activity (E), GSH-Px activity (F), MDA activity (G) in cell supernatants. Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 7. The pro-inflammatory cytokine mRNA expression of IL-1β (A) and TNF-α (B). The mRNA expression of Nrf2 (C), HO-1 (D) and NQO-1 (E). Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 8. Representative image of TNF-α (A) and Nrf2 activation (B). The protein levels of TNF-α (C), Nrf2 (D), HO-1 (E) and keap1 (F) were determined. Values represent mean±S.E.M (n=3). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test.
Fig. 1
Fig. 2
Fig. 3
TNF-α relative expression (GAPDH)
60
40
20
0 Control
DSS
50
P>0.05
9
6
3
DSS
50
E 4
P<0.01 P<0.05 P>0.05
2
1
0 Control
DSS
50
2
1
100 200 DOPS (mg/kg)
Control
100 200 DOPS (mg/kg)
P<0.01
3
3
P<0.01 P>0.05 P>0.05
0
Control
D 4
Fig. 4
P<0.01
P>0.05
0
100 200 DOPS (mg/kg)
HO-1 relative expression (GAPDH)
P<0.01 P<0.01
P>0.05 P>0.05
C 4
Nrf2 relative expression (GAPDH)
P<0.05 P<0.01
IL-1β relative expression (GAPDH)
B 12
DSS
P<0.01
P<0.01
NQO-1 relative expression (GAPDH)
A 80
P<0.05 P>0.05
3
2
1
0 Control
DSS
50
100 200 DOPS (mg/kg)
50
100 200 DOPS (mg/kg)
B B
A A
D P<0.01 P<0.01
1.5
P<0.05 P>0.05
1.0 0.5 0.0
Control DSS
Relative protein expression (HO-1)
Fig. 5
P<0.05 P<0.05
1.2 0.8 0.4
Control DSS
50 100 200 DOPS (mg/kg)
F
0.8
1.2
P<0.01
P<0.01
P<0.05 P<0.05
0.4 0.2 0.0
P<0.01 P<0.01
0.0
50 100 200 DOPS (mg/kg)
E
0.6
1.6
Control DSS
50 100 200 DOPS (mg/kg)
Relative protein expression (Keap1)
Relative protein expression (TNF-α)
2.0
Relative protein expression (Nrf-2)
C
P<0.01
P<0.01
0.9
P<0.05 P>0.05
0.6 0.3 0.0
Control DSS
50 100 DOPS (mg/kg)
LPS (2 μg/ml) +DOPS (50 μg/ml)
LPS (2 μg/ml)
Normal
LPS (2 μg/ml) +DOPS (100 μg/ml) LPS (2 μg/ml) +DOPS (200 μg/ml)
A
B P>0.05 P>0.05 P>0.05 P>0.05
80
40
0 Control
50
100 200 DOPS g/ml) 100( μm
P<0.01 P<0.05
1800
900
0 Control
400
LPS
50
4000
P<0.01 P<0.01 P<0.05 P>0.05
27
18
9
Control
LPS
50
100 200 DOPS g/ml) 100( μm
P<0.05 P>0.05
3000
2000
1000
0
100 200 DOPS g/ml) 100( μm
Control
LPS
50
100 200 DOPS g/ml) 100( μm
G 20
P<0.05 P<0.01 P>0.05 P>0.05
15
10
5
0
0
P<0.01 P<0.01
F 20
GSH-Px activity in vitro (U/ml)
SOD activity in vitro (ng/ml)
P>0.05
2700
E 36
Fig. 6
P<0.01
MDA activity in vitro (mmol/ml)
Cell viability (%)
120
D
3600
TNF-α concentration in vitro (pg/ml)
IL-1β concentration in vitro (pg/ml)
C
160
P<0.01 P<0.01 P<0.05 P>0.05
15
10
5
0
Control
LPS
50
100 200 DOPS g/ml) 100( μm
Control
LPS
50
100 200 DOPS g/ml) 100( μm
P<0.01
27
C
P<0.05
15
10
9
0 Control
DSS
50
5
0
100 200 DOPS (μg/ml)
Control
DSS
50
P<0.05 P>0.05
1.8
1.2
0.6
0.0
100 200 DOPS (μg/ml)
D
Control
DSS
E
2.0
2.4
P<0.01
1.0
0.5
0.0 Control
DSS
50
100 200 DOPS (μg/ml)
NQO-1 relative expression (GAPDH)
P<0.05 P>0.05
1.5
P<0.05
P<0.05
P<0.05
HO-1 relative expression (GAPDH)
P<0.01 P<0.05
P<0.05
P<0.05 P>0.05
18
Fig. 7
2.4
P<0.01
P<0.01
TNF-α relative expression (GAPDH)
P<0.01
IL-1β relative expression (GAPDH)
B 20
Nrf2 relative expression (GAPDH)
A 36
P<0.05 P>0.05
1.8
1.2
0.6
0.0 Control
DSS
50
100 200 DOPS (μg/ml)
50
100 200 DOPS (μg/ml)
Fig. 8
S0141-8130(17)32358-9 https://doi.org/10.1016/j.ijbiomac.2017.10.085 BIOMAC 8380
To appear in:
International Journal of Biological Macromolecules
Received date: Revised date: Accepted date:
29-6-2017 3-10-2017 14-10-2017
Please cite this article as: Jian Liang, Shuxian Chen, Youdong Hu, Yiqi Yang, Jun Yuan, Yanfang Wu, Shijie Li, Jizhong Lin, Lian He, Shaozhen Hou, Lian Zhou, Song Huang, Protective roles and mechanisms of Dendrobium officinal polysaccharides on secondary liver injury in acute colitis, International Journal of Biological Macromolecules https://doi.org/10.1016/j.ijbiomac.2017.10.085 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Protective roles and mechanisms of Dendrobium officinal polysaccharides on secondary liver injury in acute colitis
Jian Liang a, d, 1, Shuxian Chen b, 1, Youdong Hu c, 1, Yiqi Yanga, Jun Yuane, Yanfang Wu a, d, Shijie Li
a, d,
Jizhong Lin
b, d,
Lian He f, Shaozhen Hou
a, d,
Lian Zhou a, *, Song Huang a, d,
**
a
Guangzhou University of Chinese Medicine, Guangzhou 510006, Guangdong, PR China
b
Department of Hepatobiliary Surgery, the Third Affiliated Hospital of Sun Yat-Sen
University, Guangzhou, Guangdong, China c
Affiliated Huai'an Hospital of Xuzhou Medical University，Huai'an 223002, Jiangsu, PR
China d
Guangdong Provincial Key Laboratory of New Drug Development and Research of
Chinese Medicine, Guangzhou 510006, Guangdong, PR China e
Jiangsu Key Laboratory of Regional Resource Exploitation and Medicinal Research,
College of Chemical Engineering, Huaiyin Institute of Technology, Huai'an 223003, Jiangsu, PR China f
Guangdong Food and Drug Vocational College, Guangzhou 510520, Guangdong, PR
China *Corresponding author: Lian Zhou; E-mail address: [email protected]. **Corresponding author: Song Huang; E-mail address: [email protected]. 1
These authors contributed equally to this paper.
Highlights
Hepatoprotective activity of Dendrobium officinal polysaccharides (DOPS) was studied.
DOPS could alleviate secondary liver injury in acute colitis.
DOPS could down-regulated TNF-α signaling pathway.
DOPS could activate Nrf-2 signaling pathway.
Abstract The purpose of this study was to investigate the protective roles and mechanisms of Dendrobium officinale polysaccharides (DOPS) on secondary liver injury in acute colitis. Firstly, the mice model of secondary liver injury in acute colitis was induced by 4% Dextran sodium sulfate (DSS). Inflammatory cell model was established by LPS-stimulated RAW264.7 cells. Then, the protective roles of DOPS were evaluated by both in vivo and in vitro experiment. The results showed that DOPS attenuated DSS-induced hepatic pathological damage, liver parameters, infiltration of macrophages, cytokines levels, MDA level and increased the antioxidant enzymes activities. In vitro, DOPS markedly inhibited inflammatory cytokines production and increased antioxidant enzymes activities. Finally, its molecular mechanisms were also observed. The results indicated that DOPS could down-regulated TNF-α signaling pathway and activated Nrf-2 signaling pathway in vivo and in vitro. These results suggested that DOPS may be an effective therapeutic reagent to attenuate secondary liver injury in acute colitis.
Keywords: Dendrobium officinale polysaccharides; Secondary liver injury in acute colitis; Nrf-2 signaling pathway
1. Introduction It is reported that secondary liver injury was occurs in many inflammatory bowel disease (IBD) patients [1, 2]. In addition, secondary liver injury can be further aggravated and lead to chronic liver disease [3]. Although the mechanism of liver disorder in the IBD patients remains to be elucidated, the liver injury caused by other factors have been reported extensively [4, 5]. Accumulating evidences have shown that inflammation and oxidative stress are the two major factors inducing liver injury [6]. Inflammatory, autoimmune and oxidative alterations which contribute to the pathogenesis of IBD may provide important clues to understand the pathogenesis of liver injury caused by colitis. The excessive production of pro-inflammatory cytokines (e.g. TNF-α, IL-1β, IL-6) is one
of the main characterizations in IBD [7]. In inflammatory conditions, Kupffer cells and macrophages can be activated and recruit other inflammatory cells in the liver, promoting hepatic inflammation [8]. Meanwhile, massive kinases are continuously activated and lead to the activation of glycogen synthase kinase 3-beta (GSK3β) and p38, which are playing a negative regulation of Nrf-2 via the phosphorylation and result in the weakening the body’s antioxidant effect [9]. As an important cytoprotective transcription factor, Nrf-2 can regulate oxidative stress and inflammatory response. Many studies have shown that Nrf-2 can effectively protect liver, therefore, the regulation of Nrf-2 may be the therapeutic target for liver injury induced by colitis [10, 11]. Dendrobium officinale (Orchidaceae) is a valuable Chinese herbal medicine. Previous studies have shown Dendrobium officinale polysaccharides (DOPS) have anti-oxidative [12, 13], anti-inflammatory [14] and hepatoprotective [15] activities. The hepatoprotective effects of DOPS have been reported in many studies’ by exert its anti-oxidative and anti-inflammatory [16, 17]. It seems that DOPS could have the therapeutic potential in attenuating liver injury in IBD model through its effects of anti-inflammatory and anti-oxidant. But there is little report about these. Besides, the mechanism of DOPS protect against liver injury is still unknown. Dextran sodium sulfate (DSS), a sulfate polysaccharide, which is widely used to induced experimental colitis model and DSS also was reported to cause hepatic damage [18, 19]. Therefore, in the present study, we adopted DSS to induce liver injury in mice, and then investigated the role of inflammation and oxidative stress in the DSS-induced liver injury mice. At last, effect of DOPS on inflammation and Nrf-2/keap1-mediated oxidative
stress signaling pathways were investigated both in vivo and in vitro. 2. Materials and Methods 2.1. Materials and reagents DOPS was prepared by previously published report [12]. Total polysaccharide content of DOPS was 93.80% by phenol sulfuric acid method determination. Its FT-IR Spectrogram, GC chromatograms of monosaccharide composition and HPLC profiles of molecular weight measurement were provided in the Supplementary Fig. 1. FT-IR spectroscopy from Supplementary Fig. 1A indicated that DOPS has a strong and broad absorption peak at 3414 cm-1, a weak peak at 2924 cm-1 and an asymmetric stretching at 1175 cm-1. They were respectively assigned to O-H stretching vibrations, C-H stretching vibrations, and stretching C-C or C-O vibrations stretching vibrations, suggesting the characteristic absorptions of polysaccharides. The results of monosaccharide composition and molecular weight measurement also implied that DOPS was composed of mannose and glucose in a molar ratio of 5.83:1.05 (Supplementary Fig. 2B) with average molecular weight of 393.8 kDa (Supplementary Fig. 2C). Dextran sodium sulfate (DSS) was purchased from MP Biomedicals (MW; 36000-50000, MP Biomedicals, Solon, OH, USA). Aspartate aminotransferase (AST), Alanine aminotransferase (ALT) and ECL assay kits were obtained from Nanjing Jiancheng Bioengineering institute (Nanjing, China). Triglyceride (TG) and Total Cholesterol (TC) detection kits were purchased from Biosino Bio-Technology & Science Inc. The Bio-Plex mouse Cytokine Panel assay kits for measurement of TNF-α and IL-1β were obtained from Bio-Rad (Bio-Rad, USA). The ELISA assay kits for GSH-Px and SOD
were obtained from Huamei (Cusabio Biotech Co. Ltd, China). The MDA ELISA assay kit was obtained from Xitang (Xitang Biotech Co. Ltd, Shanghai, China). The quantitative chromogenic tachypleus amebocyte lysate for endotoxin (pyrogen) detection kit for lipopolysaccharide (LPS) was obtained from Xiamen BioEndo Technology (BioEndo Technology, China). RNAiso Plus reagent, PrimeScriptTMRT reagent kit and SYBR Green PCR Master Mix were provided by Takara (Takara, Japan). Antibodies against TNF-α, Nrf-2, keap1, HO-1 and GAPDH were purchased from Abcam (Abcam, USA). Antibody against CD68 and HistostainTM-plus kits were purchased from Bioss (Bioss, China). RPMI Medium 1640, Fetal bovine serum (FBS), and phosphate buffer saline (PBS) were purchased from GIBCO Laboratories (Grand Island, NY, USA) and penicillin G/streptomycin, MTT, Oil Red O and Dimethyl Sulphoxide (DMSO) were purchased from Sigma (St. Louis, MO, USA). 2.2 Animals and treatment Male BalB/c mice (18-22 g) were purchased from the Laboratory Animal Services Center, Guangzhou University of Chinese Medicine (Guangzhou, China). Animals were housed under specific pathogen free (SPF) condition of temperature at 20-25℃ a 12 h dark/ light cycle and relative humidity of 50 %-80 %, and allowed free access to sterilized water and standard food. The study was guided and approved by the Animal Ethics Committee of Guangzhou University of Chinese Medicine. Acute colitis mice were induced according to the method described by Liang [20], with slight modifications. Briefly, colitis was induced in BalB/c mice with 4% DSS (molecular mass 36000-50000, MP Biomedicals) dissolved in drinking water given ad
libitum for 14 days. All mice were randomly divided into 5 groups (n= 10/group): (1) Normal group (only received drinking water), (2) DSS group (given drinking water with 4% DSS throughout the experimental period), (3) other three groups consisted of mice receiving 4% DSS and administrated with DOPS (50, 100, 200 mg/kg/day p.o. respectively for 14 days). The optimal concentration range was determined according to the preliminary experiment. On the day 15, all mice were all sacrificed after being fasted for 12 h and anesthetized by pentobarbital sodium. Then mice blood samples were drawn from orbit and transferred to 2 ml EP tubes followed by the centrifugation at 3000 rpm for 10 min at 4°C and then stored at -80°C for biochemical assays. Liver tissues were quickly removed and weighted. Each liver was divided into two parts, one was used for histopathological examination and the other one was stored at -80°C for further biochemical assays. 2.3. Cell culture and Cytotoxicity The RAW264.7 cells were purchased from iCell Bioscience Inc (Shanghai, China) and cultured in RPMI Medium 1640 with 10 % FBS plus, penicillin (100 U/ml）and streptomycin (100 μg /ml). Cells were incubated in a humidified incubator with 5% (v/v) CO2 atmosphere at 37°C. In all cell experiments, cell viability was higher than 95 %. The cytotoxicity of DOPS for RAW264.7 cells was evaluated by MTT assay. 100 μl of cells were incubated in 96-well plates at 1 × 104 cells/ml and treated with different concentrations of DOPS for 24 h, and then 20 μl MTT (5 mg/ml) was added in each well and continue incubated for 4 h. After the removal of medium, 150 μl DMSO was added in each well, and finally the plates were read at 490 nm with Multiskan Go plate reader. 2.4. Cell treatment
1 ml RAW264.7 cells (2 × 105 cells/ml) were seeded in 6-well plates with different concentrations of DOPS (The optimal concentration range was selected according to the cytotoxicity). After 6 h, one of the wells was selected as a control, the rest wells were stimulated with LPS (2 μg/ml) and continue 24 h under the previous conditions. After 24 h, the cell supernatant was collected and detected for cytokine levels and antioxidant activity. RAW264.7 cells were also collected for detecting gene and protein expressions. 2.5. Cytokine levels The levels of IL-1β and TNF-α in the serum and cell supernatants were measured using the Bio-Plex multiplex mouse cytokine assay system (Bio-Rad, USA) according to the instruction of manufacturer. The results were analyzed using the BioPlex Manager software. The levels of cytokine were quantified by standard curves. 2.6. Histopathological examination and Oil Red O staining The liver tissues from mice were fixed in 4 % buffered paraformaldehyde for 24 h, and then embedded in paraffin. According to standard method, organ tissues were cut into 5 μm and stained with hematoxylin and eosin (H&E) for histopathological examination. The pathological damage was evaluated according to the protocol of Gao [21]. Lipid accumulation in liver was assessed by oil red O staining. Frozen liver samples were embedded in OCT-media on a cryostat (Thermo Scientific, USA) and sectioned at 6 μm. The slides were aie-dried at RT for 20 min and rehydrated, and then stained with 0.5 % oil red O (Siama, USA) for 20 min. The slides were rinsed with 60 % isopropyl alcohol for 2 min, and then the slides were counterstained with hematoxylin for 50 s, rinsed in tap water for 2 min. Finally, the sections were observed under the light microscope (Olympus,
Japan). 2.7. Immunohistochemistry CD68+ macrophage infiltration analysis was assayed on liver tissue slides (4 μm). The sections were deparaffinized, rehydrated and washed in PBS. The slides were tigen retrieval by incubating in citrate buffer in microwave oven, then 3 % H 2O2 was used to block the endogenous peroxidase activity. The slides were then incubated with polyclonal primary antibodies CD68 (1:400, Bioss, Beijing, China) for overnight at 4℃. Then, the slides were incubated in secondray antibody (Bioss, Beijing, China) for 2h at RT. Subsequently, the slides were incubated with streptavidin HRP (Bioss, Beijing, China) and counterstained with hematoxylin for 50 s, rinsed in tap water for 1 min. The sections were observed under the light microscope (Olympus, Japan). 2.8. Serum biochemical analysis The levels of AST and ALT in the serum were detected using commercial detection kits (Jiancheng Bioengineering Institute, China). In addition, TG and TC in the serum were also assayed using triglycerides kit and cholesterol kit (Zhongsheng Bioengineering Institute, China). The level of LPS in the serum and liver were assayed using quantitative chromogenic tachypleus amebocyte lysate for endotoxin (pyrogen) detection kit (Xiamen BioEndo Technology, China). The detections were conducted under the instructions of manufacturers. 2.9. Antioxidant activity The activities of SOD and GSH-Px in liver tissues and cell supernatants were measured by using enzyme-linked immunosorbent assay (ELISA) kits according to the
manufacturers’ protocols. The level of MDA in the liver samples was also detected by using enzyme-linked immunosorbent assay (ELISA) kit following the instruction of manufacturer. 2.10. Gene expressions Total RNA of liver samples was obtained by using RNAiso Plus reagent (TaKaRa, Japan) following the manufacturer’ protocol. The concentration was quantified by Nanodrop 2000c (Thermo Scientific). Then, 1μg RNA was reverse transcribed to cDNA using a PrimeScriptTMRT reagent kit (TaKaRa, Japan). cDNA can be amplified using the SYBR Green PCR Master Mix and specific primers in the CFX96 Real-Time PCR Detection system (Bio-Rad, USA) and these primers were listed as follows: Nrf-2-F, (5’TCCGCTGCCATCAGTCAGTC 3’) and Nrf-2-R, (5’ATTGTGCCTTCAGCGTGCTTC 3’);
NQO-1-F,
(5’
CAAGTTTGGCCTCTCTGTGG
3’)
and
NQO-1-R,
(5’
AAGCTGCGTCTAACTATATGT 3’); HO-1-F, (5’AACAAGCAGAACCCAGTCTATGC 3’)
and
HO-1-R,
(5’ AGGTAGCGGGTATATGCGTGGGCC
3’);
IL-1β-F,
(5’
GCCCATCCTCTGTGACTCA 3’) and IL-1β-R, (5’AGGCCACAGGTATTTTGTC 3’); TNF-α-F,
(5’CCCTTTACTCTGACCCCTTTATTGT
3’)
and
TNF-α-R,
(5’TGTCCCAGCATCTTGTGTTTCT 3’); GAPDH-F, (5’TGTGTCCGTCGTGGATCTGA 3’) and GAPDH-R, (5’TTGCTGTTGAAGTCGCAGGAG 3’). The amplification condition was performed as follows: 95℃ for 30 s, and then 40 cycles of 95℃ for 5 s and 60℃ for 30 s. Relative mRNA expressions of TNF-α, IL-1β, Nrf-2, HO-1 and NQO-1 were calculated using the 2-△△Ct method. The glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. All target genes were normalized with GAPDH.
2.11. Western blotting analysis Liver samples were soaked in 1 ml pre-cool RIPA buffer (Beyotime, China) containing phenylmethanesulfonyl fluoride (PMSF) inhibitors (Beyotime, China) and homogenized at 4℃. The homogenate was centrifuged at 12000 × g for 10 min. Then the supernatant was collected and finally the concentration was detected by using the BCA protein assay kit (Beyotime, China). Protein samples and loading buffer were mixed at the ratio of 4:1 and boiled for 6 min. The mixture was separated in 8%-10% SDS-PAGE electrophoretic gel and transferred to PVDF membrane (Bio-Rad, USA) for 1.5 h. The membranes were blocked in 5% non-fat powdered milk dissolved in TBST for 1 h. The membranes were then incubated with antibodies against TNF-α, Nrf-2, keap1, HO-1 and GAPDH (1:1000, Abcam, USA) overnight at 4℃. After 3 washes in TBST, the membranes were incubated in appropriate HRP-conjugated secondary antibodies conjugated for 1h at RT. Protein bands were visualized by ECL kit and analyzed using ImageJ software. 2.12. Statistical analysis The data are expressed as the mean ± standard error of mean (mean ± S.E.M). All data were analyzed using the SPSS 17.0 statistical software. The data were compared by the one way-ANOVA with the Student’s t-test. P <0.05 were considered as statistically significant. 3. Result and discussion 3.1 DOPS protected DSS-induced liver injury in mice In order to investigate whether DOPS can protect the liver from the damage caused by colitis, H&E staining was used to analyze the histopathological condition of the liver. In control group, the liver tissue revealed normal hepatic architecture, orderly organization
structure and without steatosis (Fig. 1C). However, in the DSS-induced mice model, the liver pathological score was obviously increased and the liver showed significant pathological changes, such as hepatocyte destructions and hepatic enlargement. The animals treated with DOPS presented less hepatocyte damage, as well as a refin-effect of liver tissue and hepatic enlargement (Fig. 1C). The histopathological scores of liver were significantly decreased after DOPS treatment (Fig. 1E). Representative liver images were also showed in Fig.1A-B. In addition, DOPS inhibited the liver index increase (Fig. 1D). These results suggest that DOPS can protect DSS-induced liver injury. 3.2 Effects of DOPS on the levels of serum AST, ALT, TG, TC and Oil Red O staining in DSS-induced liver injury in mice The activities of serum ALT and AST were detected to evaluate the degree of liver injury [22]. Compared to the control group, the activities of serum ALT and AST increased significantly in DSS group (P<0.01) (Fig. 2A-B). Treatment with DOPS inhibited significantly ALT and AST activities in a dose dependent manner as compared to the DSS group (Fig. 2A-B), suggesting that DOPS play a protective role against DSS-induced liver injury. Liver injury can cause liver dysfunction which leads to hepatic steatosis [23]. In this study, the levels of serum TG and TC were significantly elevated compared to the control group (P<0.01) (Fig. 2C-D), as well as DOPS significantly reversed TG and TC levels compared to the DSS group. Meanwhile, we also analyzed the condition of lipid accumulation in the live by oil red O staining. We found that the deposition of lipid droplets was generally increased in the live tissues of colitis mice. Liver tissues from the
DSS+DOPS groups could dose-dependently limited lipid accumulation in the liver as compared to the DSS group (Fig. 2E-F). These results suggested that DOPS could improve dyslipidemia in DSS-induced liver injury. 3.3 DOPS suppressed the LPS production and relieved macrophage infiltration in liver tissue. In colitis mice, the gut-derived LPS plays an important role in activating inflammatory signal pathway and cause tissues injury [24]. We further investigated the level of LPS in serum and liver. We found that the level of LPS in serum and liver was significantly increased in DSS group. However, treatment with DOPS the level of LPS in serum and liver was markedly decreased when compared to the DSS group. The data showed that DOPS could inhibit LPS production and exert protective effect on DSS-induced liver injury (Fig. 3A-B). In addition, the excessive accumulation of LPS in liver tissue also could induce the activation of macrophages in liver and cause hepatic inflammation [25]. IHC staining for the liver’s macrophage marker showed that DSS-enhanced infiltration of CD68+ macrophages in liver tissues. However, the increase of liver’s macrophages infiltration was obviously decreased by DOPS treatment in DSS-induced colitis mice (Fig. 3C-D). These results showed that DOPS significantly suppresed macrophage recruitment in the liver, which is responsible for relieving liver inflammation. 3.4 The Effects of DOPS on serum inflammatory cytokines production and the activities of SOD, GSH-Px and MDA in liver. The excessive productions of inflammatory cytokines in liver tissues can cause liver
injury [26]. The serum levels of IL-1β and TNF-α were detected to investigate the anti-inflammatory effect of DOPS. The data showed that the levels of inflammatory cytokines significantly increased in the DSS group compared to the control group, while treatment with DOPS effectively inhibited the secretions of inflammatory cytokines (Fig. 3E-F). The activities of liver SOD, GSH-Px and MDA were analyzed to assess the organism anti-oxidative capability. The SOD and GSH-Px activities significantly declined as compared to the control group (Fig. 3G-I). Administration of DOPS could significantly increase the SOD and GSH-Px activities compared to the DSS group. In the DSS group, the level of MDA was obviously higher than the control group. DOPS significantly reduced MDA level compared with DSS group (Fig. 3I). These results suggest that inflammation and oxidative stress were closely related to liver injury caused by colitis. In addition, DOPS could play the protective effect through the anti-inflammatory and anti-oxidative properties. 3.5 DOPS inhibited inflammation and Nrf-2/keap1-mediated oxidative stress signaling pathways in mice To further estimate the anti-inflammation and anti-oxidative effects of DOPS in the liver. We detected the mRNA levels of TNF-α, IL-1β, Nrf-2, HO-1 and NQO-1 by quantitative RT-PCR, as well as the protein levels of TNF-α, IL-1β, Nrf-2, keap1 and HO-1 by Western blot in the liver tissues. According to the data of RT-PCR, in the DSS group, the mRNA levels of TNF-α and IL-1β increased significantly, while significantly reduced the gene expressions of Nrf-2, HO-1and NQO-1 compared with the control group.
Treatment with DOPS could significantly up-regulate the genes expression of Nrf-2, HO-1 and NQO-1 and obviously down-regulate TNF-α and IL-1β genes expression (Fig. 4). As shown in Fig. 5, the protein expressions of Nrf-2, HO-1 and NQO-1 were significantly down-regulated in the liver with DSS treatment and the protein levels of TNF-α and IL-1β were obviously increased compared to the control group. Administration of DOPS could significantly up-regulate Nrf-2, HO-1 and NQO-1 protein levels and down-regulate TNF-α protein level. The data indicates that DOPS can play the role of anti-oxidative and anti-inflammatory by activating the Nrf-2 signaling pathway and down-regulate TNF-α expression. 3.6 Effects of DOPS on macrophages viability The cytotoxicity of DOPS was assessed by MTT assay. The data showed that 50, 100, 200 and 400 μg/ml DOPS did not affect the viability of RAW264.7 cells for 24-hour incubation (Fig.6 B). 3.7 The anti-inflammatory and anti-oxidant effects of DOPS in LPS-stimulated RAW264.7 cells The damage of inflammation and oxidative stress can be induced by LPS in macrophages. Next, we investigated the anti-inflammatory and anti-oxidant effects of DOPS in LPS-stimulated RAW264.7 cells. We found that the activities of SOD and GSH-Px significantly decreased in LPS-stimulated RAW264.7 cells, while the levels of MDA, TNF-α and IL-1β increased significantly. However, treatment with DOPS could significantly reverse all of those parameters caused by DSS in a dose-dependent manner (Fig. 6 C-G) and protected LPS-induced RAW264.7 cells damage (Fig. 6A).
3.8 DOPS inhibited inflammation and Nrf-2/keap1-mediated oxidative stress signaling pathways in LPS-stimulated RAW264.7 cells Nrf-2 is an anti-oxidative regulator [26]. Activation of the Nrf-2 can release HO-1, which could exert anti-oxidative and anti-inflammatory effects [27]. The related genes and proteins of Nrf-2 signal pathway were analyzed by quantitative RT-PCR and Western blot in LPS-stimulated RAW264.7 cells. As shown in Fig. 7 and Fig.8, Nrf-2, HO-1 and NQO-1 mRNA and protein expressions were significantly down-regulated. IL-1β and TNF-α mRNA and protein expressions were obviously up-regulated in LPS-stimulated RAW264.7 cells. Administration with DOPS could effectively protect LPS-stimulated macrophages and markedly up-regulated Nrf-2, HO-1 and NQO-1 mRNA and protein expressions, while reducing the mRNA and protein expressions of IL-1β and TNF-α in a dose-dependent manner. The data showed that signal transduction by Nrf-2 molecules and inflammation could be effectively affected by DOPS. 4. Discussions Liver injury is one of the most common complications of IBD. Few studies have explored the mechanism of liver damage caused by colitis or pay attention to the treatment effect of drugs for liver injury in IBD patients. Dendrobium officinale, a valuable traditional Chinese herbal medicine, which is widely used to treat many disease owing to its potential health benefits [28]. In the present study, we investigated the mechanism of liver damage and demonstrated the therapeutic effects of DOPS on liver injury caused by colitis for the first time. AST and ALT can be used to evaluate liver injury as sensitive indicators. The levels of
AST and ALT in serum can reflect the degree of liver injury [29]. Clinically, patients with IBD often cause liver injury, and the liver injury will be further aggravated and developed into chronic liver diseases such as fatty liver disease, autoimmune hepatitis [30, 31]. In this study, we found that the levels of AST, ALT, TG, TC and the condition of lipid accumulation were markedly increased, the general form and histopathological condition of liver significantly changed in DSS group, indicating that 4% DSS can cause liver injury in mice for 14 days. Interestingly, administration of DOPS could significantly decrease the activities of AST and ALT, and reversed the levels of TG and TC tends to normal level. DOPS also could reduce lipid accumulation in liver. In addition, DOPS could improve histopathological condition of liver and improve the condition of steatosis and liver injury. The results suggested that DOPS may be beneficial for treating liver injury caused by colitis. The mechanism of DSS-induced liver injury is rarely reported. Accumulating evidences suggested that the involvement of inflammation and oxidant stress plays an important role in liver injury [32]. Inflammatory lesions are the major feature of DSS-induced colitis [33], suggesting that inflammation is likely to be the main factor for liver injury caused by colitis. In addition, the gut-derived LPS could cause the activation of macrophages and further aggravate tissues injury [34]. The hyper-activation of inflammatory cytokines also could activate macrophage in liver, which can increase the secretion of numerous pro-inflammation cytokines such as TNF-α and IL-1β and aggravate liver injury and steatosis [35]. Meanwhile, Nrf-2, a nuclear transcription factor, is a regulator of oxidant stress and high expression in the liver [36]. Under the normal state,
Nrf-2 is silenced by link keap1 and form a complex. In the process of oxidative stress, Nrf-2 is released from complex and exerts the anti-oxidative effect [37]. Activated Nrf-2 signal pathway can regulate the expressions of antioxidant enzyme genes HO-1 and NQO-1. Activation of the Nrf-2 can confront various stimuli and play a protective role via anti-oxidation and anti-inflammation in the liver [38]. Nrf-2 knockout mice were more susceptible to develop into liver injury [39]. Therefore, the protective roles of Nrf-2 signal pathway have been widely investigated in the pathogenesis of liver diseases. Based on these evidences, we explored the effects of inflammation and Nrf-2 signal pathway on liver injury caused by colitis. Our data showed that the levels of inflammation cytokines and macrophages infiltration in liver tissue markedly increased, while the antioxidant enzyme activities reduced significantly in DSS group. Meanwhile, our data also evidenced that the mRNA and proteins of Nrf-2, keap1, HO-1 and NQO-1 significantly decreased and TNF-α and IL-1β significantly increased in liver after DSS treatment. These results indicated that inflammation and oxidative stress play a crucial role in the pathogenesis of liver injury caused by colitis. Previous data showed that DOPS could effectively ameliorate DSS-induced liver injury in mice. To study whether the therapeutic effects of DOPS is through the regulation of inflammation via Nrf-2 signaling pathway in vivo and in vitro. TNF-α is a cytokine involved in systemic inflammatory response and an integral part of the acute phase response [40]. In the study, DOPS reversed TNF-α and IL-1β mRNA expression levels in DSS-induced colitis model and LPS-stimulated RAW264.7 cells model. In addition, DOPS could significantly reduce the amounts of macrophages in liver tissues and down-regulated
the expression of TNF-α protein in vivo and in vitro. These show that DOPS could inhibit inflammatory signaling pathway and reduce macrophages infiltration in liver tissue to relief DSS-induced inflammatory response. In addition, Nrf-2 signaling pathway was detected in vivo and in vitro with DOPS. Our data showed that DOPS could obvious up-regulate the mRNA or proteins expressions of Nrf-2, keap1, HO-1 and NQO-1. Nrf-2 signaling pathway owns a negative effect on TNF-α expression [41], which suggests that the activation of Nrf-2 by DOPS may target on the inactivation of DSS-induced inflammatory signaling pathways. DOPS attenuates DSS-induced excessive oxidative stress to attenuate inflammation response, resulting in preventing liver injury. Therefore, DOPS alleviated DSS-induced liver injury by regulating Nrf2 signaling pathway and inflammation response. In conclusion, according to our results, we found that inflammation and oxidative stress are the major factors for DSS-induced liver injury. DOPS protect liver tissues from inflammation and oxidative stress induced by DSS in the liver via modulating the TNF-α/Nrf-2 signaling pathway. DOPS may be an effective therapeutic reagent to attenuate liver injury caused by IBD. Acknowledgements This work was supported by the Guangdong Province Universities and Colleges Pearl-River Scholar Funded Scheme, the Special Funds from Central Finance of China in Support of the Development of Local Colleges and University [Educational Finance Grant no. 276(2016)], Science and Technology Project Scheme of Guangdong Province (No. 2013B090800052), Guangdong Provincial Science and Technology Program - Basic
Conditions for Construction of Science and Technology Projects (2014A030304059), Application Science and Technology Research Special Program of Guangdong (No. 2015B020234008), Six Talent Peaks Project in Jiangsu Province (2017-YY-003), Key Talents Project of Youth Medical Science in Jiangsu Province (QNRC2016422), Innovative Development of Traditional Chinese Medicine Scientific Research Team (No. A1-AFD01515A03) and National Nature Science Foundation of China [81001601].
References [1] S. Restellini, O. Chazouillères, J.L. Frossard, Liver Int. 37 (201) 475-489. [2] F.D. Mendes, C. Levy, F.B. Enders, E.V. Loftus, P. Angulo, K.D. Lindor, American J. Gastroenterol. 102 (2007) 344. [3] L.E. Jr, W.J. Sandborn, K.D. Lindor, N.F. Larusso, Inflamm. Bowel Dis. 3 (1997) 288-302. [4] G. Szabo, J. Petrasek, Nat. Rev. Gastroenterol. Hepat. 12 (2015) 387-400. [5] H. Jaeschke, M.R. Mcgill, A. Ramachandran, Drug Metab. Rev. 44 (2012) 88-106. [6] B. Horváth, L. Magid, P. Mukhopadhyay, S. Bátkai, M. Rajesh, O. Park, G. Tanchian, R.Y. Gao, C.E. Goodfellow, M. Glass, Brit. J. Pharmacol. 165 (2012) 2462-2478. [7] M.A. Engel, M.F. Neurath, Springer New York, 27 (2013) 897-906. [8] X. Cai, C. Fang, S. Hayashi, S. Hao, M. Zhao, H. Tsutsui, S. Nishiguchi, J. Sheng, J. Gastroenterol. 51 (2016) 819-829. [9] I. Buendia, P. Michalska, E. Navarro, I. Gameiro, J. Egea, R. León, Pharmacol. Ther. 157 (2015) 84-104. [10] A.M. Kuhn, N. Tzieply, M.V. Schmidt, K.A. Von, D. Namgaladze, M. Yamamoto, B. Brüne, Free Radical Bio. Med. 50 (2011) 1382-1391. [11] X. Xu, H. Li, X. Hou, D. Li, S. He, C. Wan, P. Yin, M. Liu, F. Liu, J. Xu, Med. Inflam. 2015 (2015) 380218. [12] K. Huang, Y. Li, S. Tao, G. Wei, Y. Huang, D. Chen, C. Wu, Molecules, 21 (2016) 701. [13] A. Luo, Z. Ge, Y. Fan, Z. Chun, X. He, Molecules, 16 (2011) 1579-1592. [14] L. Xiang, C.S. Sze, T. Ng, Y. Tong, P. Shaw, C.S. Tang, Y.K. Zhang, Inflam. Res. 62
(2013) 313-324. [15] C. Liang, H. Li, S. Hou, J. Zhang, S. Huang, X. Lai, Modernization Trad. Chin. Med. Materi. -World Sci. Tech. 15 (2013) 233-237. [16] L.H. Pan, X.F. Li, M.N. Wang, X.Q. Zha, X.F. Yang, Z.J. Liu, Y.B. Luo, J.P. Luo, Int. J. Biol. Macromol. 64 (2014) 420-427. [17] X.Y. Wang, J.P. Luo, R. Chen, X.Q. Zha, L.H. Pan, Int. J. Biol. Macromol, 78 (2015) 354-362. [18] J. Jahnel, P. Fickert, C. Langner, C. Högenauer, D. Silbert, J. Gumhold, A. Fuchsbichler, M. Trauner, Liver Int. 29 (2009) 1316-1325. [19] A. Karlsson, A. Jägervall, M. Pettersson, A.K. Andersson, P.G. Gillberg, S. Melgar, Int. Immunopharmacol. 8 (2008) 20-27. [20] F. Liang, K. Xu, J. Ethnopharmacol. 192 (2016) 236-247. [21] Y.Z. Gao, L.F. Zhao, J. Ma, W.H. Xue, H. Zhao, Eur. J. Pharmacol. 780 (2016) 8. [22] D. Yan, H.L. Liu, Z.J. Yu, Y.H. Huang, D. Gao, H. Hao, S.S. Liao, F.Y. Xu, X.Y. Zhou, Int. J. Mol. Sci. 17 (2016) 1114. [23] W. Khovidhunkit, M.S. Kim, R.A. Memon, J.K. Shigenaga, A.H. Moser, K.R. Feingold, C. Grunfeld, J. Lipid Res. 45 (2004) 1169-1196. [24] Guo S, Nighot M, Al-Sadi R, Alhmoud T, Nighot P, Ma TY, J Immunol, 195 (2015) 4999-5010 [25] L Yao, W Chen, K Song, C Han, C R. Gandhi, K Lim, T Wu, Plos one, 12 (2017) e0176106. [26] S.B. Lee, J.W. Kang, S.J. Kim, J. Ahn, J. Kim, S.M. Lee, Brit. J. Pharmacol. 174
(2017) 195-209. [27] Y. Son, J.H. Lee, N.H. Kim, N.Y. Surh, E.C. Kim, H.T. Chung, D.G. Kang, H.O. Pae, Biofactors, 36 (2010) 210-215. [28] L. Xiao, T.B. Ng, Y.B. Feng, T. Yao, J.H. Wong, R.M. Yao, L. Li, F.Z. Mo, Y. Xiao, P.C. Shaw, Phytomed. 18 (2011) 194-198. [29] N. Yun, J.W. Kang, S.M. Lee, J. Nutr. Biochem. 23 (2012) 1249-1255. [30] A. Ghazalpour, S. Doss, X. Yang, J. Aten, E.M. Toomey, N.A. Van, S. Wang, T.A. Drake, A.J. Lusis, J. Lipid Res. 45 (2004) 1793-1805. [31] K.C.E. Kasmi, A.L. Anderson, M.W. Devereaux, S.A. Fillon, J.K. Harris, M.A. Lovell, M.J. Finegold, R.J.S, Hepat. 55 (2012) 1518-1528. [32] S. Z, J. Leukocyte Biol. 63 (1998) 534-541. [33] S Machtaler, F Knieling, R Luong, L Tian, JK Willmann, Theranostics, 5 (2015) 1175-1186. [34] K Miura, M Ishioka, S Minami, Y Horie, S Ohshima, T Goto, H Ohnishi, J Biol Chem, 291 (2016) 11504-11517. [35] Y.W. Dai, C.C. Zhang, H.X. Zhao, J.Z. Wan, L.L. Deng, Z.Y. Zhou, Y.Y. Dun, C.Q. Liu, D. Yuan, T. Wang, Immunopharmacol. Immunotoxicol. 38 (2016) 167-174. [36] K. Okada, J. Shoda, K. Taguchi, J.M. Maher, K. Ishizaki, Y. Inoue, M. Ohtsuki, N. Goto, H. Sugimoto, H. Utsunomiya, Biochem. Biophys. Res. Commu. 389 (2009) 431-436. [37] K.W. Kang, S.J. Lee, S.G. Kim, Antioxid. Redox Sign. 7 (2005) 1664-1673. [38] D.N. Hai, C. Young‐ Yeon, D.N. Tien, N.N. Hoai, M.C. Van, L. Jeong‐ Hyung, J.
Cell. Biochem. 117 (2015) 659. [39] S.M. Shin, J.H. Yang, S.H. Ki, Oxid. Med. Cell. longevity, 2013 (2013) 763257. [40] A.M. Szczygiel, G. Brzezinka, M. Targosz-Korecka, S. Chlopicki, M. Szymonski, Pflug. Arch. Eur. J. Phy. 463 (2012) 487-496. [41] A. Fragoulis, A. Greiber, C. Rosen, T. Pufe, C.J. Wruck, Free Radical Bio. Med. 53 (2012) S48-S48.
Figure Caption Fig. 1. Macroscopic appearance of liver samples (A and B), representative images showing liver histopathological changes (C) with H&E staining ( 100, 400), the relative liver weight (D) and histopathologic score (E). Values represent mean ± S.E.M (n=6). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 2. ALT activity (A), AST activity (B), TG levels (C), TC levels (D) in serum, (E) Mean lipid area of oil red O staining, (F) Repsentative pictures of frozen liver slides with oil red O staining (× 20). Values represent mean ± S.E.M (n=5-6). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 3.
LPS concentration in serum (A),
LPS concentration in liver (B),
Immunohistochemical staining of CD68+ positive cells in liver sections (× 10) (C), The quantitative analysis of CD68 staining in liver (D), IL-1β concentration (E) and TNF-α concentration (F) in serum samples, SOD activity(G), GSH-Px activity (H) and MDA activity (I) in liver tissues. Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 4. The pro-inflammatory cytokines mRNA expressions of IL-1β (A) and TNF-α (B). The mRNA expressions of Nrf2 (C), HO-1 (D) and NQO-1 (E). Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 5. Representative image of TNF-α (A), Nrf2, keap1 and HO-1 (B). The protein levels
of TNF-α (C), Nrf2 (D), HO-1 (E) and keap1 (F) were determined. Values represent mean ± S.E.M (n=3). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 6. LPS-stimulated RAW264.7 cells were treated with or without DOP (A). Cell viability (B), IL-1β concentration (C), TNF-α concentration (D), SOD activity (E), GSH-Px activity (F), MDA activity (G) in cell supernatants. Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 7. The pro-inflammatory cytokine mRNA expression of IL-1β (A) and TNF-α (B). The mRNA expression of Nrf2 (C), HO-1 (D) and NQO-1 (E). Values represent mean ± S.E.M (n=5). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test. Fig. 8. Representative image of TNF-α (A) and Nrf2 activation (B). The protein levels of TNF-α (C), Nrf2 (D), HO-1 (E) and keap1 (F) were determined. Values represent mean±S.E.M (n=3). Comparisons among the different groups were performed with one-way analysis of variance (ANOVA) followed by post hoc Tukey’s test.
Fig. 1
Fig. 2
Fig. 3
TNF-α relative expression (GAPDH)
60
40
20
0 Control
DSS
50
P>0.05
9
6
3
DSS
50
E 4
P<0.01 P<0.05 P>0.05
2
1
0 Control
DSS
50
2
1
100 200 DOPS (mg/kg)
Control
100 200 DOPS (mg/kg)
P<0.01
3
3
P<0.01 P>0.05 P>0.05
0
Control
D 4
Fig. 4
P<0.01
P>0.05
0
100 200 DOPS (mg/kg)
HO-1 relative expression (GAPDH)
P<0.01 P<0.01
P>0.05 P>0.05
C 4
Nrf2 relative expression (GAPDH)
P<0.05 P<0.01
IL-1β relative expression (GAPDH)
B 12
DSS
P<0.01
P<0.01
NQO-1 relative expression (GAPDH)
A 80
P<0.05 P>0.05
3
2
1
0 Control
DSS
50
100 200 DOPS (mg/kg)
50
100 200 DOPS (mg/kg)
B B
A A
D P<0.01 P<0.01
1.5
P<0.05 P>0.05
1.0 0.5 0.0
Control DSS
Relative protein expression (HO-1)
Fig. 5
P<0.05 P<0.05
1.2 0.8 0.4
Control DSS
50 100 200 DOPS (mg/kg)
F
0.8
1.2
P<0.01
P<0.01
P<0.05 P<0.05
0.4 0.2 0.0
P<0.01 P<0.01
0.0
50 100 200 DOPS (mg/kg)
E
0.6
1.6
Control DSS
50 100 200 DOPS (mg/kg)
Relative protein expression (Keap1)
Relative protein expression (TNF-α)
2.0
Relative protein expression (Nrf-2)
C
P<0.01
P<0.01
0.9
P<0.05 P>0.05
0.6 0.3 0.0
Control DSS
50 100 DOPS (mg/kg)
LPS (2 μg/ml) +DOPS (50 μg/ml)
LPS (2 μg/ml)
Normal
LPS (2 μg/ml) +DOPS (100 μg/ml) LPS (2 μg/ml) +DOPS (200 μg/ml)
A
B P>0.05 P>0.05 P>0.05 P>0.05
80
40
0 Control
50
100 200 DOPS g/ml) 100( μm
P<0.01 P<0.05
1800
900
0 Control
400
LPS
50
4000
P<0.01 P<0.01 P<0.05 P>0.05
27
18
9
Control
LPS
50
100 200 DOPS g/ml) 100( μm
P<0.05 P>0.05
3000
2000
1000
0
100 200 DOPS g/ml) 100( μm
Control
LPS
50
100 200 DOPS g/ml) 100( μm
G 20
P<0.05 P<0.01 P>0.05 P>0.05
15
10
5
0
0
P<0.01 P<0.01
F 20
GSH-Px activity in vitro (U/ml)
SOD activity in vitro (ng/ml)
P>0.05
2700
E 36
Fig. 6
P<0.01
MDA activity in vitro (mmol/ml)
Cell viability (%)
120
D
3600
TNF-α concentration in vitro (pg/ml)
IL-1β concentration in vitro (pg/ml)
C
160
P<0.01 P<0.01 P<0.05 P>0.05
15
10
5
0
Control
LPS
50
100 200 DOPS g/ml) 100( μm
Control
LPS
50
100 200 DOPS g/ml) 100( μm
P<0.01
27
C
P<0.05
15
10
9
0 Control
DSS
50
5
0
100 200 DOPS (μg/ml)
Control
DSS
50
P<0.05 P>0.05
1.8
1.2
0.6
0.0
100 200 DOPS (μg/ml)
D
Control
DSS
E
2.0
2.4
P<0.01
1.0
0.5
0.0 Control
DSS
50
100 200 DOPS (μg/ml)
NQO-1 relative expression (GAPDH)
P<0.05 P>0.05
1.5
P<0.05
P<0.05
P<0.05
HO-1 relative expression (GAPDH)
P<0.01 P<0.05
P<0.05
P<0.05 P>0.05
18
Fig. 7
2.4
P<0.01
P<0.01
TNF-α relative expression (GAPDH)
P<0.01
IL-1β relative expression (GAPDH)
B 20
Nrf2 relative expression (GAPDH)
A 36
P<0.05 P>0.05
1.8
1.2
0.6
0.0 Control
DSS
50
100 200 DOPS (μg/ml)
50
100 200 DOPS (μg/ml)
Fig. 8