Protein Binding by the 3′ Untranslated Region of α-Striated Tropomyosin

Molecular Genetics and Metabolism 70, 224 –234 (2000) doi:10.1006/mgme.2000.3018, available online at http://www.idealibrary.com on

Protein Binding by the 3ⴕ Untranslated Region of ␣-Striated Tropomyosin Hai-Lin Fang and Thomas J. L’Ecuyer 1 Department of Pediatrics, Wayne State University, Cardiology Division, Children’s Hospital of Michigan, 3901 Beaubien Boulevard, Detroit, Michigan 48201 Received April 11, 2000

pletely define the mechanism by which it causes differentiation. © 2000 Academic Press Key Words: tropomyosin; 3ⴕ UTR; protein binding.

Tropomyosin is a component protein of the thin filament system in striated muscle, regulating the interaction between actin and myosin. The 3ⴕ untranslated region of the ␣-striated tropomyosin gene (TM UTR) induces muscle differentiation when expressed in primary fibroblasts, but the mechanism has not been defined. We hypothesize that fibroblasts utilize resident proteins to effect this response, perhaps by TM UTR binding to protein(s). In order to facilitate identification of protein(s) involved in mediating this differentiation response, we investigated the potential for this sequence to bind to cellular protein utilizing electrophoretic mobility gel shifting analysis (EMSA) with and without UV cross-linking. Under very specific conditions (including pH, KCl, and Mg concentration and extent of phosphorylation of protein), the TM UTR is able to bind protein in cells that differentiate upon TM UTR expression. Protein binding is significantly more extensive in cytoplasmic than nuclear protein preparations. Secondary structure of the RNA probe facilitates protein binding. The molecular masses of bound proteins are approximately 42 and 115 kDa under basal conditions. EMSA analysis of extract from cultured skeletal muscle confirms that protein binding by the TM UTR occurs in this cell type, and is more extensive in less differentiated cells. The demonstration of highly regulated protein binding by the TM UTR raises the possibility that this sequence may cause differentiation by binding to endogenous proteins, and further that this sequence may play a role in normal differentiation. Identification of proteins bound by the TM UTR will be necessary to com-

An increasing number of roles have been ascribed to the 3⬘ untranslated regions (UTRs) of genes, including control of stability of the mRNA adjacent to the UTR (1), a zipcode function to direct mRNA to specific subcellular locations (2,3), translational regulation (4), and pattern formation during embryonic development (5). These functions often involve protein binding to the UTR. The importance of UTRs is further shown by the observation that mutations within these regions of specific genes are associated with human diseases, including myotonic dystrophy (6), venous thrombosis (7), and breast cancer (8). Tropomyosin (TM) is a structural protein produced from multiple genes generating isoforms in most eukaryotic cells via gene switching and alternative splicing. The role of TM is best understood in striated muscle, where it regulates the interaction between actin and myosin to render calcium sensitivity to this interaction (9). TM expression is known to be controlled at the level of transcription, and posttranscriptional control has not been demonstrated (10). The lack of posttranscriptional control is unusual for genes shown to bind protein within their UTRs. The UTR of ␣-striated TM (TM UTR) has been shown to positively influence differentiation when introduced into primary fibroblasts (11) and mutant muscle cell lines that have lost their differentiation potential; proliferation is inhibited in these mutant cell lines also (12,13). It therefore is a UTR that is capable of influencing the expression of

1

To whom correspondence and reprint requests should be addressed. Fax: (313) 577-9215; e-mail: [email protected] 224 1096-7192/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

TROPOMYOSIN 3⬘ UTR PROTEIN BINDING

genes other than the gene it is a portion of, which is distinctly unusual for an UTR. The sequence appears to play a role in the decision to proliferate or differentiate, cell fates which are thought to be mutually exclusive. The mechanism of differentiation induced by the TM UTR is not known, but does not appear to involve activation of myogenic regulators of the myoD family (14). An attractive candidate protein that may mediate the TM UTR’s effect on differentiation is RNA-dependent protein kinase (PKR). This protein is bound by the TM UTR when purified protein and RNA are incubated in vitro, although an interaction in vivo has not been identified in eukaryotic cells (15). PKR is an enzyme that has a role in antiviral defense by phosphorylating eukaryotic initiation factor 2␣ (eIF-2␣), thereby suppressing translation; inhibition of PKR activity has been shown to interrupt myogenic differentiation (16). RNA with extensive secondary structure is able to activate this enzyme once bound (17). Since the TM UTR is predicted to have extensive secondary structure, PKR appears to be an attractive candidate protein to be bound and activated by this sequence as an initial step in TM UTR-induced differentiation. It is likely that the TM UTR exerts its effect by utilizing proteins that reside in the cells before its expression, possibly by binding such protein(s). If protein binding activates or inhibits an intracellular signaling pathway, e.g., PKR signaling or signaling utilizing tyrosine phosphorylation, a cascade may be initiated that culminates in differentiation. In the series of experiments described here, we have investigated the protein binding ability of this sequence using electromobility shifting (EMSA) with and without crosslinking by UV light using TM UTR probes and cytoplasmic protein extract from fibroblasts and muscle cells. We show that the TM UTR binds under very specific conditions to proteins with approximate molecular masses of 42 and 115 kDa, that this binding is dependent on the degree of phosphorylation of the protein complex and on secondary structure of the RNA, and that binding is seen in muscle cells in addition to fibroblasts. These observations suggest that binding to PKR is not likely to be the sole mechanism mediating the effect of the TM UTR on differentiation, since the molecular mass of this protein is not consistent with that observed using UV cross-linking. We speculate that binding to one or both of these proteins is the initial step by which the TM UTR induces differentiation.

225

Since protein binding is also seen in cultured skeletal muscle, we also suggest that this sequence may have a role in normal muscle differentiation. MATERIALS AND METHODS Preparation of Protein Extract Protein was harvested from fibroblast cultures established from chicken embryo skin on Day 11 of gestation utilizing the methods of Malter (18), Nachaliel et al. (19), and Dignam et al. (20). Initial experiments determined that the most extensive protein binding by the UTR probe was found using the Dignam cytoplasmic preparation, which was used in subsequent experiments to further characterize the binding. The Dignam procedure was also used to prepare cytoplasmic extract from the QM7 quail myocyte cell line at a subconfluent state in growth medium. To produce Dignam extract, cells were scraped from the dish and pelleted for 10 min at 1500g in a Jouan T4 rotor. Pelleted cells were washed three times in phosphate-buffered saline, collected by brief low-speed centrifugation, and suspended in 5 vol of ice-cold lysis buffer containing 10 mM Hepes, pH 7.9, 1.5 mM MgCl 2, 10 mM KCl, and 0.5 mM DTT and collected by centrifugation at 1500g. The pellet was again resuspended in 3 vol of the same buffer, allowed to stand on ice for 10 min, and the pellet was homogenized with 10 strokes of a Dounce homogenizer with a type B pestle. After centrifugation at 5000g for 15 min to pellet nuclei, the supernatant was mixed with 0.11 vol of buffer containing 0.3 M Hepes, pH 7.9, 1.4 M KCl, and 30 mM MgCl 2, and the extract was centrifuged for 60 min at 100,000g in a Beckman TL S55 rotor. The high-speed supernatant was dialyzed for 4 to 6 h against 20 vol of a buffer containing 20 mM Hepes, pH 7.9, 20% (v/v) glycerol, 100 mM KCl, 0.2 mM EDTA, 0.5 mM PMSF, and 0.5 mM DTT. The concentration of all proteins was determined with a BCA protein assay reagent kit (Pierce, Rockford, IL). Preparation of RNA Probes The TM UTR was amplified by PCR from plasmid DNA containing full-length avian ␣-striated TM, a clone kindly provided by Dr. Stephen Hughes. The primers used to amplify the sequence contained nucleotides representing restriction enzyme sites SacII (forward primer, GGCCGCGGTTTTCTTTGCTTCACTTCTCCA) and BamHI (reverse primer, GGGGATCCACAGCTGGGATGTTTATTTTAC),

226

FANG AND L’ECUYER

with nucleotides in bold representing restriction enzyme sites. After PCR amplification, the product and an aliquot of KS bluescript vector were digested with SacII and BamHI, the product was ligated into the cut vector, and the ligation was used to transform bacteria as described (21). After sequencing confirmed that the new clone contained the full-length TM UTR, this plasmid was digested with SacII and gel purified to provide template for production of labeled probe using T3 polymerase (Roche Molecular Biochemicals, Indianapolis, IN) with [ 32P]UTP in the reaction mix. Unincorporated nucleotides were removed from probes using Sephadex G-50 spin columns (5 Prime-3 Prime Inc., Boulder, CO). Unlabeled TM UTR probe for competition experiments was prepared in the same way, except that unlabeled UTP was substituted in the in vitro transcription reaction for [ 32P]UTP. Electromobility Shift Assay Optimal pH and Mg and KCl concentrations for TM UTR RNA–protein interaction were empirically determined. Initial experiments were performed with 20 ␮g cytoplasmic or nuclear lysate incubated with 5–10 ⫻ 10 4 cpm of TM UTR RNA in a 20-␮l reaction consisting of 10% glycerol, 12 mM Hepes, pH 7.9, 40 mM KCl, 0.25 mM EDTA, 0.5 mM DTT, 5 mM MgCl 2, and yeast tRNA (200 ng/␮l) for 10 min at 30°C, essentially as described (22). Fifty units of RNase T1 was added, and reaction mixtures were incubated for 30 min at 37°C before electrophoresis in a 6% native polyacrylamide gel with 0.5 ⫻ Tris borate–EDTA running buffer. After electrophoresis, gels were dried and exposed to x-ray film for identification of probe–protein complexes. In some experiments, nonspecific competitors, including polyA RNA (2 ␮g), poly I:poly C (2 ␮g), and tRNA (4 ␮g), were added to protein extract and incubated for 10 min before labeled TM UTR probe. For specific competition experiments, a large molar excess of unlabeled TM UTR RNA was preincubated for 10 min with protein before addition of labeled TM UTR probe. The influence of secondary structure of RNA probes was studied by heating labeled probe to 95°C for 10 min, followed by slow cooling to room temperature or rapid cooling on ice to maintain the RNA in a denatured state. To evaluate the influence of phosphorylation on RNA–protein interactions, dephosphorylation of cytoplasmic proteins was accomplished by incubation of protein extract with lambda protein phosphatase (New England Biolabs, Bev-

erly, MA), an enzyme that removes phosphate groups from serine, threonine, and tyrosine residues. Incubation with a variable number of units of enzyme was performed for 30 min at 30°C before incubation with the RNA probe, according to the manufacturer’s instructions. UV Cross-linking Assay To identify the molecular weights of RNA–protein complexes, probe–protein reactions were set up as for electromobility experiments, except that 10 6 cpm of labeled probe was used per reaction. After incubation at 30°C, samples were exposed to UV light at 3000 ␮watts/cm 2 for a variable period of time in a Stratalinker chamber as described (22), RNase T1 digestion was performed for 30 min, SDS sample buffer was added, and samples were boiled for 3 min and were electrophoresed on 10% SDS–polyacrylamide gels. Gels were dried and processed for autoradiography as with EMSA experiments. RESULTS The TM UTR Binds to a Protein Complex with Similar Electrophoretic Mobility from Different Preparations In order to study interactions between the TM UTR RNA and cellular protein, we used three different methods to produce cell extracts, yielding four fractions, since the preparation of Dignam yields a nuclear and cytoplasmic fraction. All extracts were prepared from chick embryonic fibroblast (CEF) cultures established on Embryonic Day 11, since these cells differentiate well upon TM UTR expression (11), and 20 ␮g of each protein extract was utilized in this assay. In Fig. 1, lane 1 contains TM UTR probe without incubation with protein. Protein binding is indicated in the EMSA as a retardation in mobility of the signal produced by the probe alone (asterisk denotes shifted complex). There was no significant binding of probe to protein prepared using the method of Malter (lane 2), but a signal representing binding was seen with the Nachaliel prep (lane 3) and the Dignam cytoplasmic (lane 4) and nuclear (lane 5) prep. The strongest binding was seen with the Dignam cytoplasmic prep, although the mobility of probe–protein complex was similar regardless of the protein source. The similar electromobility of RNA–protein complexes in each preparation suggests that the component protein(s) are likely to be the same. All subsequent experiments

TROPOMYOSIN 3⬘ UTR PROTEIN BINDING

227

nam cytoplasmic protein extract was incubated in binding reactions first with probe in buffer containing varying concentrations of KCl (Fig. 2A). Lane 1 contains probe without protein, while lanes 2– 6 contain probe–protein complexes incubated in 0, 50, 100, 200, and 400 mM KCl using conditions otherwise identical to those described in the method of Dignam (20). The major shifted complex, depicted by a single asterisk, is seen at all concentrations of KCl, but the signal is stronger, indicating a stronger interaction, at lower concentrations. Binding to a complex with slower mobility is seen at lower KCl con-

FIG. 1. Binding of TM UTR RNA to cellular protein using standard conditions. Electromobility shift assays were carried out as described under Materials and Methods. Complex formation was performed with TM UTR riboprobe without protein extract (lane 1) or in the presence of 20 ␮g of cytoplasmic protein prepared by the method of Malter (lane 2), Nachaliel (lane 3), or Dignam (lane 4), or in the presence of Dignam nuclear protein preparation (lane 5). The asterisk indicates the major RNA– protein complex. (All figures prepared on Macintosh 7100/80 Power PC with Apple Color OneScanner using Ofoto software, version 2.0.2. Figures were labeled and printed in PowerPoint 4.0.)

utilize the Dignam cytoplasmic prep since it generated the strongest interaction with the TM UTR RNA. This experiment also demonstrates that protein binding in CEF by the TM UTR is stronger in the cytoplasmic than the nuclear compartment, suggesting that this RNA–protein interaction is spatially regulated to some extent. This regulation may be related to differences in protein quantity or posttranslational modifications influencing binding in the two compartments. Defining Optimal Conditions for TM UTR–Protein Interactions Ionic strength, pH, and divalent cation concentration (particularly magnesium) have a strong influence on the ability of an individual protein to interact with and bind to a specific RNA molecule (23). Conditions must be empirically determined that optimize these conditions for a particular protein– RNA interaction. To accomplish this, 20 ␮g of Dig-

FIG. 2. Optimization of concentration of KCl, MgCl 2, and pH in binding buffer for TM UTR RNA–protein binding. Electromobility shift assays were performed using Dignam cytoplasmic protein preparation. Complex formation was performed with TM UTR riboprobe without protein (lane 1 in A, B, and C), or with 20 ␮g protein. In A, KCl concentration was varied, with concentrations including 0 (lane 2), 50 (lane 3), 100 (lane 4), 200 (lane 5), and 400 mM (lane 6). In B, MgCl 2 concentration was varied, with concentrations including 0 (lane 2), 2.5 (lane 3), 5.0 (lane 4), and 10 mM (lane 5). In C, optimal KCl and MgCl 2 concentrations were used at variable pH including 8.4 (lane 2), 7.9 (lane 3), 7.5 (lane 4), and 7.0 (lane 5). The single asterisk represents specific protein binding, while the double asterisk represents binding to a protein complex nonspecifically.

228

FANG AND L’ECUYER

centrations only, as depicted by the double asterisk. Subsequent competition experiments confirmed that this complex bound to the TM UTR nonspecifically. In all subsequent experiments, 50 mM KCl was used in the binding buffer. Similarly, the concentration of MgCl 2 was varied in the binding buffer to determine its influence on protein–RNA interaction. In Fig. 2B, lane 1 contains free probe, while lanes 2–5 contain probe and protein incubated at 0, 2.5, 5, and 10 mM MgCl 2, respectively. The single asterisk indicates an RNA–protein complex that is seen at all Mg concentrations, although the signal is strongest if at least 2.5 mM MgCl 2 is present. Binding to a protein complex with slower mobility is stronger at lower MgCl 2 concentrations (double asterisk), but this complex was shown in subsequent experiments to be bound nonspecifically. In all subsequent experiments, assay buffer contains 5 mM MgCl 2. The pH was varied in EMSA reactions once optimal concentrations of KCl and MgCl 2 were determined. In Fig. 2C, lane 1 contains free probe, while lanes 2–5 contain probe and protein incubated at pH 8.4 (lane 2), 7.9 (lane 3), 7.5 (lane 4), and 7.0 (lane 5). Binding to a protein complex with mobility similar to that seen when varying ionic strength and Mg concentration (single asterisk) is seen to be more extensive at higher pH, although binding takes place at each pH. A second complex with slower mobility (double asterisk) is seen as well, but binding to this complex was subsequently shown to be nonspecific. In subsequent experiments, EMSA experiments were performed at pH ranges from 7.9 to 8.4. The Interaction between the TM UTR and Protein Is Specific To demonstrate specificity of the TM UTR RNA– protein interaction, protein–probe reactions were performed after preincubation with nonspecific or specific competitors, with other conditions as optimized in the legend to Fig. 2. The mobility of the probe incubated without protein is shown (Fig. 3A, B, lane 1), and this mobility is significantly retarded by inclusion of protein, with the major RNA–protein complex indicated with a single asterisk (lane 2 of both panels). In Fig. 3A, formation of this complex is not prevented by preincubation with nonspecific competitors, including tRNA (lane 3), polyA RNA (lane 4), or poly I:poly C (lane 5), but it is inhibited by preincubation with a molar excess of unlabeled TM UTR RNA (lane 6). Two additional protein complexes (double asterisks) are bound by the TM UTR

FIG. 3. TM UTR binding to protein is specific. Electromobility shift assays were performed using Dignam cytoplasmic protein under conditions optimized as in the legend to Fig. 2 in the presence of nonspecific or specific competitors. EMSA was performed without protein (lane 1 in A and B) or with 20 ␮g cytoplasmic protein (lane 2 of each panel). Competition was performed in A by precincubation with tRNA (lane 3), polyA RNA (lane 4), poly I:poly C (lane 5) or unlabeled TM UTR RNA (lane 6). The single asterisk indicates specific probe–protein complex, while the double asterisks indicate nonspecific probe–protein complexes. A variable amount of the specific competitor TM UTR RNA was incubated with protein before addition of probe in B, including 0 (lane 2), 3 (lane 3), 6 (lane 4), or 12 ␮g (lane 5). Only the specific competitor inhibits TM UTR RNA–protein complex formation (asterisk), and it does so in a dose-dependent manner.

probe, but these are nonspecifically bound protein complexes, since they are competed by each nonspecific competitor. When gradually increasing amounts of cold TM UTR RNA are incubated with protein before the addition of labeled probe, a dosedependent inhibition of TM UTR probe–protein interaction is seen, indicated by a progressive loss of signal of the complex indicated by the asterisk in Fig. 3B. Amounts of cold TM UTR used in this experiment include none (lane 2), 3 ␮g (lane 3), 6 ␮g (lane 4), and 12 ␮g (lane 5). A large molar excess of tRNA over probe (2 ␮g) was included in each of these reactions when it was determined that its inclusion reduced or eliminated the appearance of nonspecific RNA–protein complexes (e.g., complexes indicated by double asterisk in Fig. 3A). These experiments indicate that the interaction between the TM UTR RNA and at least one protein complex is a highly specific cytoplasmic event. RNA Secondary Structure Facilitates Protein Binding Our initial bias has been that TM UTR binding to PKR is the first step by which this sequence influences differentiation, since the purified protein and

TROPOMYOSIN 3⬘ UTR PROTEIN BINDING

229

observed (lane 3). When probe is heat denatured and cooled rapidly on ice, eliminating the secondary structure, the ability of the RNA to interact with protein is reduced, as shown by a reduction in band intensity (lane 4). This experiment indicates that secondary structure of the TM UTR has an important influence on its ability to bind protein. This is consistent with the possibility that PKR may be a member of the protein complex that binds the TM UTR. Since poly I:poly C is thought to form secondary structure, and yet it was not successful in competing with the TM UTR for protein binding (see Fig. 3A, lane 5), secondary structure alone does not mediate protein binding. Identification of Apparent Molecular Weight of TM UTR-Bound Proteins

FIG. 4. RNA secondary structure influences extent of protein binding. Electromobility shift assays were performed in the presence of nonspecific competitor tRNA under conditions optimized as in the legend to Fig. 2. Complex formation was performed without protein (lane 1) or with 20 ␮g cytoplasmic protein and probe that was unheated (lane 2), heat denatured and slow cooled to room temperature (lane 3), or heat denatured and rapidly cooled to maintain denatured state (lane 4). RNA–protein complex (asterisk) is formed most extensively with probe in native state.

RNA have been shown to interact in vitro (15). PKR is known to avidly bind double-stranded RNA and inhibit generalized cellular translation, which likely is important in control of growth and differentiation (24). We investigated the influence of secondary structure of TM UTR RNA by preparing probes in various states and observing their interaction with protein using EMSA, with conditions as optimized in the legend to Fig. 2. In Fig. 4, lane 1 shows the mobility of probe incubated without protein. A significant retardation, indicative of binding, occurs when native probe is incubated with protein (lane 2, asterisk indicates RNA–protein complex). This native probe was synthesized by in vitro transcription at 37°C for 20 min, and was incubated with protein at 30°C. When an identical probe is denatured by heating to 95°C for 5 min followed by slow cooling to room temperature, secondary structure is reacquired and a robust interaction with protein is still

The specific TM UTR RNA–protein complex identified in the previous experiments was resolved using nondenaturing polyacrylamide gel electrophoresis, which precludes estimation of the molecular weight(s) of component protein(s). In order to determine the number of proteins in the complex, and to estimate their molecular weights, we performed binding reactions as before, but followed the incubation by exposure of probe–protein reactions to UV light for a variable interval and RNase digestion, and complexes were resolved on an SDS polyacrylamide gel. Lane 1 of Fig. 5 is a reaction between probe and protein that was not exposed to UV light; no proteins are resolved because there is no crosslink between the probe and protein to permit label transfer. The probe–protein complex is resolved into one major protein of approximate molecular weight of 42 kDa (asterisk) and one minor protein of approximate molecular weight of 115 kDa (double asterisk) after exposure to UV light for 8 min (lane 2) or 15 min (lane 3). Both complexes are successfully competed by preincubation of protein with unlabeled TM UTR RNA, indicated by a loss of both signals in lane 4. Since the molecular weight of PKR is 68 kDa, these proteins are likely to be proteins other than PKR. Supershifting experiments (not shown) with a murine antibody to PKR support this contention, although it is possible that avian PKR is not recognized by this antibody. Phosphorylation of Cytoplasmic Protein Influences RNA–Protein Binding RNA–protein interactions can be influenced by posttranslational modifications of cellular proteins,

230

FANG AND L’ECUYER

FIG. 5. Identification of molecular masses of TM UTR-bound proteins. Binding reactions were performed with native TM UTR probe under conditions as optimized in the legend to Fig. 2. Complex formation between 20 ␮g cytoplasmic protein and TM UTR was performed and analyzed by SDS–polyacrylamide gel electrophoresis after RNase digestion and exposure to UV light for 0 (lane 1), 8 (lane 2), or 15 min in the absence of specific competitor (lane 3) or in the presence of specific competitor (lane 4). The asterisks denote proteins of 115 and 42 kDa that are successfully crosslinked and competed by excess unlabeled TM UTR RNA. Molecular weight standards are shown at the left of the figure in kilodaltons.

such as phosphorylation (25). Phosphorylation on specific amino acids, particularly tyrosine, also profoundly influences protein–protein interactions that are involved in signal transduction cascades (26). We hypothesize that the TM UTR induces differentiation by a mechanism that involves protein binding by this sequence, and wished to determine whether any proteins involved in signaling cascades utilizing phosphorylation might be among proteins bound by this sequence. Therefore, cytoplasmic protein was incubated with TM UTR probe using protein in its native state in usual EMSA buffer (Fig. 6, lane 1), or after incubation of protein for 30 min in phosphatase buffer with varying amounts of lambda protein phosphatase, including 0 (lane 3), 100 (lane 4), 200 (lane 5), 400 (lane 6), or 800 (lane 7) units. Probe without protein is shown in lane 2. A single major RNA–protein complex is formed when probe and protein in its native state are incubated together, indicated by the single asterisk in Fig. 6. The intensity of this signal is reduced when buffer conditions for incubation are altered by the incubation in phosphatase buffer before addition of probe (compare intensity of signal indicated by asterisk in lanes 1 vs 3, e.g.), but becomes stronger with increasing amounts of phosphatase enzyme over a range of 100 to 400 units. This complex is not com-

peted by adding the nonspecific competitor poly I:poly C to protein after complete dephosphorylation (lane 8), but is competed by preincubation with unlabeled TM UTR RNA after dephosphorylation (lane 9). This indicates that binding to this complex is specific and regulated by extent of phosphorylation of protein. A new RNA–protein complex (double asterisk) is formed when protein is subjected to dephosphorylation, and the band intensity increases by incubation with increasing amounts of protein phosphatase over a range of 200 (lane 5) to 800 units (lane 7). Binding to this complex is nonspecific, as inclusion of poly I:poly C in the reaction after dephosphorylation eliminates this band (lane 8). This experiment indicates that specific TM UTR RNA binding to a protein complex is favored when the component proteins are dephosphorylated; the specific amino acid residue(s) phosphorylated, and subsequent events in this cascade remain to be elucidated. TM UTR RNA–Protein Interaction Is Observed in Muscle Cells The extent of tyrosine phosphorylation of specific signaling proteins can enhance or inhibit differentiation. The protein src, for example, inhibits differentiation of cultured muscle cells when phosphorylated (27). Since we believe that the TM UTR

FIG. 6. Phosphorylation of cytoplasmic protein influences interaction with the TM UTR. Electromobility shift assays were performed with native TM UTR probe under conditions as optimized in the legend to Fig. 2. Probe incubated without protein is shown in lane 2. Twenty micrograms of unmodified cytoplasmic protein was incubated with TM UTR probe (lane 1), or protein was subjected to treatment for 30 min at 30°C with increasing amounts of lambda protein phosphatase, including 0 (lane 3), 100 (lane 4), 200 (lane 5), 400 (lane 6), or 800 units without competitors (lane 7) or following incubation with poly I:poly C (lane 8) or unlabeled TM UTR RNA (lane 9). After treatment and incubation with probe, RNase T1 digestion was performed before electrophoresis. Single asterisk indicates specific RNA–protein complex, while double asterisk represents nonspecific complex.

231

TROPOMYOSIN 3⬘ UTR PROTEIN BINDING

tions, observed interactions appear to be specific. This experiment demonstrates that this sequence binds protein in a more differentiated cell type in which TM RNA is normally expressed. This observation is compatible with a role of this sequence in normal muscle differentiation. Although not shown, we have been unable to demonstrate TM UTR RNA binding to protein extract prepared from 10 T1/2 fibroblasts, a cell type that does not differentiate upon expression of this sequence. DISCUSSION

FIG. 7. TM UTR RNA binds protein in cultured muscle cell extract. Electromobility shift assays were performed with native TM UTR probe under conditions as optimized in the legend to Fig. 2. Lane 1 contains TM UTR probe incubated without protein. Twenty micrograms cytoplasmic protein from CEF (lane 2), undifferentiated QM7 cells in the absence (lane 3) or presence (lane 5) of unlabeled TM UTR RNA, or differentiated QM7 cells (lane 4) were incubated with labeled TM UTR probe. Single asterisk indicates RNA–protein interaction with similar mobility in both cell types. Double asterisk indicates RNA–protein interaction in myoblasts not seen in fibroblast extract.

influences differentiation by binding to specific cellular protein(s), we examined whether protein binding would be observed in a cell type where musclespecific isoforms of TM are normally expressed to see if the sequence binds protein in its usual environment. We utilized EMSA to compare binding in cytoplasmic extracts prepared from chick embryo fibroblasts (Fig. 7, lane 2), and cultured undifferentiated QM7 cells without (lane 3) or with (lane 5) preincubation with unlabeled TM UTR RNA. Extract from more differentiated QM7 cells was included in the experiment (lane 4) to determine whether protein binding by this sequence was regulated as a function of the extent of differentiation. Probe incubated without protein is seen in lane 1. RNA binding to a complex of similar mobility is seen in each cell type (single asterisk) that is competed for by preincubation with specific competitor. A second RNA–protein complex is also seen in the muscle cells (double asterisk). TM UTR binding to both of these protein complexes is more extensive in protein from less differentiated QM7 cells (lane 3) than protein from more differentiated cells (lane 4), suggesting that protein binding by this sequence is regulated as a function of the extent of muscle differentiation. Since tRNA is included in all reac-

Specific protein binding by UTRs has been described for multiple genes, including ferritin (1), myotonic dystrophy protein kinase (28), fibronectin (29), and cytochrome P450 (30). Protein binding to UTRs appears to play a particularly important role in translational control of gene expression, a level of control that has not been demonstrated for TM. To our knowledge, this is the first report of a muscle structural protein-encoding gene whose UTR binds protein specifically. Since TM genes generate cellspecific isoforms, the striated muscle TM mRNA, and therefore its UTR, are not normally expressed in fibroblasts, so there is no reason to expect that TM translational control is mediated in this cell type by the observed protein binding. It will be critical in future experiments to identify the proteins bound by the TM UTR in fibroblasts and muscle cells in order to define their roles in muscle differentiation. Since fibroblasts are not normally capable of differentiating into muscle, it is unlikely that these proteins will be previously identified proteins with known roles in differentiation, e.g., myoD family members, or spontaneous differentiation would be expected to occur in fibroblasts. We believe that protein binding in TM UTR-expressing transfected fibroblasts permits initiation of a cascade that culminates in differentiation. In a normally replicative cell, this more likely involves binding to and titration of a repressor of differentiation than activation of a positive effector, but purification and identification of the TM UTRbound protein(s) will be required to answer this question. The observation that protein binding by this sequence is more significant in less differentiated muscle cells lends further to the notion that bound protein may act as a repressor of differentiation that is titrated by the TM UTR. The only other gene with a UTR that has been shown to influence muscle differentiation upon overexpression is myotonic dystrophy kinase, overex-

232

FANG AND L’ECUYER

pression of which inhibits differentiation (31). This region of the kinase mRNA is expanded in myotonic dystrophy by a variable number of trinucleotide repeats that is bound by a specific protein ordinarily involved in mRNA processing (28). Protein binding to the UTR is thought to result in sequestration of the bound protein on mutant transcripts, making it unavailable for its usual function. This example lends feasibility to the concept of TM UTR protein binding titrating a protein, thereby inhibiting its normal function. Mutations in the ␣-TM gene have been described in families with the human disease hypertrophic cardiomyopathy, a disease in which cardiac muscle sarcomeric architecture is disturbed (32). Although disease-causing mutations have been localized to the TM coding sequence to this point, it is tempting to speculate that mutations within the UTR may impair the ability of muscle cells to differentiate properly if the mutation changes the ability of this sequence to bind cellular protein. It is therefore possible that this sequence plays an important role in human disease. The strength of RNA–protein interactions observed with EMSA experiments can be influenced by the abundance of the bound protein and by the affinity of the protein for the specific RNA (23). Thus, the difference in signal intensity between cytoplasmic and nuclear extracts after incubation with the TM UTR probe may indicate that the bound protein is more abundant in the cytoplasm, or that its state in the cytoplasm makes it able to bind this sequence more extensively. For example, it is possible that the extent of phosphorylation of the bound protein may be different in the two compartments, and we have shown that extent of phosphorylation influences extent of TM UTR–protein interactions. Our data are consistent with the following model for differentiation induced by the TM UTR. This sequence binds to a dephosphorylated cytoplasmic protein most extensively in cells that are not fully differentiated, e.g., fibroblasts and myoblasts. Such binding titrates bound protein that normally inhibits myogenic differentiation. In the appropriate cell context, this relief of inhibition permits a muscle differentiation program to ensue. We predict that only cell types showing binding by the TM UTR RNA are capable of differentiating in response to its expression. Although this model requires experimental verification, it is consistent with the hypothesis that differentiation requires continual regulation rather than being an irreversible process once initiated. The TM UTR may well function in vivo to

participate in this continual regulation to ensure that the differentiated state is maintained. Since this sequence is known to inhibit proliferation (12), it may be an important sequence in directly regulating the decision to differentiate or proliferate, decisions that are thought to be mutually exclusive. Although the identity of TM UTR-bound proteins is not yet known, many genes with an inhibitory influence on differentiation are candidates. The basic helix–loop– helix factor Mist1, for example, prevents terminal muscle differentiation in myoblasts (33) during embryogenesis by inhibiting myoD-mediated transcriptional activation. It is expressed in multiple tissues in the mature animal (excluding muscle), where it is able to complex with the ubiquitous E-proteins E12 and E47 (34). It is possible that if this protein functioned in nonmuscle tissue to promote proliferation and/or suppress differentiation, then binding and titrating it may permit differentiation. Additional proteins that inhibit differentiation that are candidate proteins for TM UTR binding include the Wnt antagonist Frzb1 (35), a member of the Id family of HLH proteins (36), or the oncogenic protein ras (37). In contrast to our original bias, it appears unlikely that PKR is a major protein bound by the TM UTR. This point is supported by the observation that the sizes of bound proteins are significantly different than PKR, that no supershift is seen with a PKR antibody, and that poly I:poly C, a potent PKR binder, does not effectively compete for binding of protein by the TM UTR. The data presented in this work are further important in that if protein binding mediates the TM UTR influence on differentiation in fibroblasts, then proteins other than myoD family members must be capable of initiating differentiation. This is suggested because myoD family members are not present in fibroblasts (38,39), their expression results in myogenic conversion of fibroblasts (40), and because the sizes of TM UTR-bound proteins are not consistent with any of these family members. ACKNOWLEDGMENT This work was supported by a grant from the Muscular Dystrophy Association to T.J.L.

REFERENCES 1.

Ai LS, Chau LY. Post-transcriptional regulation of H-ferritin mRNA: Identification of a pyrimidine-rich sequence in the 3⬘-untranslated region associated with message stability

TROPOMYOSIN 3⬘ UTR PROTEIN BINDING

233

in human monocyte thp-1 cells. J Biol Chem 274:30209 – 30214, 1999.

17.

Gunnery S, Mathews MB. RNA binding and modulation of PKR activity. Methods 15:189 –198, 1998.

2.

Kislauskis EH, Zhu X, Singer RH. Sequences responsible for intracellular localization of b-actin messenger RNA also affect cell phenotype. J Cell Biol 127:441– 451, 1994.

18.

Malter JE. Identification of an AUUUA-specific messenger RNA binding protein. Science 245:664 – 666, 1989.

19.

3.

Ainger K, Avossa D, Diana AS, Barry C, Barbarese E, Carson JH. Transport and localization elements in myelin basic protein mRNA. J Cell Biol 138:1077–1087, 1997.

Nachaliel N, Jain D, Hod Y. A cAMP-regulated RNA-binding protein that interacts with phosphoenolpyruvate carboxykinase (GTP) mRNA. J Biol Chem 268:24203–24209, 1993.

4.

Kwon S, Barbarese E, Carson JH. The cis-acting RNA trafficking signal from myelin basic protein mRNA and its cognate trans-acting ligand hnRNP A2 enhance cap-dependent translation. J Cell Biol 147:247–256, 1999.

20.

Dignam JD, Lebovitz RM, Roeder RG. Accurate transcription initiation by RNA polymerase II in a soluble extract isolated from mammalian nucleii. Nucleic Acids Res 11: 1475–1489, 1983.

5.

Ferrandon D, Koch I, Westhof E, Nusslein-Volhard C. RNARNA interaction is required for the formation of specific bicoid mRNA 3⬘ UTR-STAUFEN ribonucleoprotein particles. EMBO J 16:1751–1758, 1997.

21.

Short Protocols in Molecular Biology, ed. 2. New York: Greene Publishing Associates and John Wiley and Sons, 1992.

22.

6.

Mahdevan M, Tsilfidis C, Sabourin L, Shutler G, Amemiya C, Jansen G, Neville C, Narang M, Barcelo J, O’Hoy K. Myotonic dystrophy mutation: an unstable CTG repeat in the 3⬘ untranslated region of the gene. Science 6:1253–1255, 1992.

Rondon IJ, MacMillan LA, Beckman BS, Goldberg MA, Schneider T, Bunn HF, Malter JS. Hypoxia up-regulates the activity of a novel erythropoietin mRNA binding protein. J Biol Chem 266:16594 –16598, 1991.

23.

Setzer, DR. RNA–Protein Interaction Protocols. Totowa, NJ: Humana Press, pp. 115–128, 1999.

7.

Vicente V, Gonzalez-Conejero R, Rivera J, Corral J. The prothrombin gene variant 20210A in venous and arterial thromboembolism. Haematologica 84:356 –362, 1999.

24.

Li J, Petryshyn RA. Activation of the double-stranded RNAdependent eIF-2 alpha kinase by cellular RNA from 3T3F442A cells. Eur J Biochem 195:41– 48, 1991.

8.

Jupe ER, Liu XT, Kiehlbauch JL, McClung JK, Dell’Orco RT. Prohibitin in breast cancer cell lines: Loss of antiproliferative activity is linked to 3⬘ untranslated region mutations. Cell Growth Differen 7:871– 878, 1996.

25.

Kwon YK, Hecht NB. Binding of a phosphoprotein to the 3⬘ untranslated region of the mouse protamine 2 mRNA temporally represses its translation. Mol Cell Biol 13:6547– 6557, 1993.

9.

Lees-Miller JP, Helfman DM. The molecular basis for tropomyosin isoform diversity. Bioessays 13:429 – 437, 1991.

26.

10.

Meinnel T, Libri D, Mouly V, Gros D, Fiszman MY, Lemmonier M. Tissue-specific transcriptional control of alphaand beta-tropomyosins in chicken muscle development. Dev Biol 131:430 – 438, 1989.

Koch CA, Anderson D, Moran MF, Ellis C, Pawson T. SH2 and SH3 domains: Elements that control interactions of cytoplasmic signaling proteins. Science 252:668 – 674, 1991.

27.

Hase H, Isobe A, Kim J. Effect of orthovanadate on commitment of avian myoblasts transformed with Rous sarcoma virus to myogenic differentiation. Eur J Cell Biol 68:313– 322, 1995.

11.

L’Ecuyer TJ, Tompach PC, Morris E, Fulton AB. Transdifferentiation of chicken embryonic cells into muscle cells by the 3⬘ untranslated region of muscle tropomyosin. Proc Natl Acad Sci USA 92:7520 –7524, 1995.

28.

12.

Rastinejad F, Blau HM. Genetic complementation reveals a novel regulatory role for 3⬘ untranslated regions in growth and differentiation. Cell 72:903–917, 1993.

Timchenko LT, Miller JW, Timchenko NA, DeVore DR, Datar KV, Lin L, Roberts R, Caskey CT, Swanson MS. Identification of a (CUG)n triplet repeat RNA-binding protein and its expression in myotonic dystrophy. Nucleic Acids Res 24:4407– 4414, 1996.

29.

Zhou B, Boudreau N, Coulber C, Hammarback J, Rabinovitch M. Microtubule-associated protein 1 light chain 3 is a fibronectin mRNA-binding protein linked to mRNA translation in lamb vascular smooth muscle cells. J Clin Invest 100:3070 –3082, 1997.

30.

Tilloy-Ellul A, Rafalli-Mathieu F, Lang MA. Analysis of RNA–protein interactions of mouse liver cytochrome P4502A5 mRNA. Biochem J 339:695–703, 1999.

31.

Sabourin LA, Tamai K, Narang MA, Korneluk RG. Overexpression of 3⬘-untranslated region of the myotonic dystrophy kinase cDNA inhibits myoblast differentiation in vitro. J Biol Chem 272:29626 –29635, 1997.

32.

Golitsina N, An Y, Greenfield NJ, Thierfelder L, Iizuka K, Seidman JG, Seidman CE, Lehrer SS, Hitchcock-DeGregori SE. Effects of two familial hypertrophic cardiomyopathycausing mutations on alpha-tropomyosin structure and function. Biochemistry 38:3850, 1999.

33.

Lemercier C, To RQ, Carrasco RA, Konieczny SF. The basic helix–loop– helix transcription factor Mist1 functions as a

13.

Rastinejad F, Conboy MJ, Rando TA, Blau HM. Tumor suppression by RNA from the 3⬘ untranslated region of a-tropomyosin. Cell 75:1107–1117, 1993.

14.

L’Ecuyer TJ, Schutte BC, Mendel KA, Morris E, Fulton AB. Muscle-specific transcription factors in fibroblasts expressing the ␣-striated tropomyosin 3⬘ untranslated region. Mol Genet Metab 67:213–226, 1999.

15.

Davis S, Watson JC. In vitro activation of the interferoninduced, double-stranded RNA-dependent protein kinase PKR by RNA from the 3⬘ untranslated regions of human alpha-tropomyosin. Proc Natl Acad Sci USA 93:508 –513, 1996.

16.

Salzberg S, Mandelboim M, Zalcberg M, Shainberg A. Interruption of myogenesis by transforming growth factor beta 1 or EGTA inhibits expression and activity of the myogenicassociated (2⬘–5⬘) oligoadenylate synthetase and PKR. Exp Cell Res 219:223–232, 1995.

234

FANG AND L’ECUYER

transcriptional repressor of myoD. EMBO J 17:1412–1422, 1998. 34. Lemercier C, To RQ, Swanson BJ, Lyons GE, Konieczny SF. Mist1: A novel basic helix–loop– helix transcription factor exhibits a developmentally regulated expression pattern. Dev Biol 182:101–113, 1997. 35. Borello U, Coletta M, Tajbakhhsh S, Leyns L, De Robertis EM, Buckingham M, Cossu G. Transplacental delivery of the Wnt antagonist Frzb1 inhibits development of caudal paraxial mesoderm and skeletal myogenesis in mouse embryos. Development 126:4247– 4255, 1999. 36. Melnikova IN, Bounpheng M, Schatteman GC, Gilliam D, Christy BA. Differential biological activities of mammalian Id proteins in muscle cells. Exp Cell Res 247:94 –104, 1999.

37.

Ramocki MB, White MA, Konieczny SF, Taparowsky EJ. A role for RalGDS and a novel Ras effector in the Ras-mediated inhibition of skeletal myogenesis. J Biol Chem 273: 17696 –17701, 1998. 38. Davis RL, Weintraub H, Lassar AB. Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 51:987–1000, 1987. 39. Wright WE, Sassoon DA, Lin VK. Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD1. Cell 56:607– 617, 1989. 40. Weintraub H, Davis R, Tapscott S, Thayer M, Krause M, Benezra R, Blackwell TK, Turner D, Rupp R, Hollenberg S, Zhuang Y, Lassar A. The myoD gene family: Nodal point during specification of the muscle cell lineage. Science 251: 761–766, 1991.