Protein kinase A is a positive regulator of spore coat gene transcription in Dictyostelium

Differentiation (1995) 58:183-188

0 Springer-Verlag 1995

Protein kinase A is a positive regulator of spore coat gene transcription in Dictyostelium Neil A. Hopper', Glenn M. Sanders*, Kathy L. Fosnaugh', Jeffrey G. Williams', William F. Loomis2 i MRC Laboratory For Molecular Cell Biology, University College London, Gower Street, London WCI E 6BT, UK *Centerfor Molecular Biology, Department of Biology, University of California San Diego, La Jolla, CA 92093, USA

Accepted in revised form: 21 September 1994

Abstract. The cotA, cotB, and cotC genes encode the major spore coat proteins of Dictyostelium. All three cot genes are coordinately expressed as aggregation is nearing completion. Induction and maintenance of their expression is dependent upon the presence of extracellular CAMP.We show that expression of a dominant inhibitor of the cAMP dependent protein kinase (PKA) in prespore cells greatly reduces the transcription rates of the corB and cotC genes. All three cot genes contain, in their upstream regulatory regions, short sequence elements that have a high content of cytosine and adenosine residues. These CA-rich sequences are essential for optimal cot gene transcription. We show that expression of the dominant PKA inhibitor results in a greatly reduced level of the binding activity that recognizes the CA-rich sequences upstream of the cotB gene. Thus PKA acts, either directly or indirectly, to control expression of the cot genes and it may do so by modulating the activity of a DNA binding protein. However, we find that mutant cells where PKA is constitutively active still require exogenous cAMP for optimal cot gene expression in dissociated cells, suggesting that a separate, PKA-independent, signalling pathway is also involved in the regulation of cot gene expression by extracellular CAMP.

Introduction

Upon starvation, Dictyostelium discoideum amoebae initiate a multicellular developmenal program that results in the formation of a fruiting body consisting of two major cell types: spores and stalk cells (reviewed in [25, 261). Precursors of these mature cell types first express specific markers late in agregation just before prestalk cells sort out to form a tip [ 13, 421. However, cells do not become irreversibly committed to their fates until the final stages of morphogenesis and will dedifferentiate when dissociated from the slug [7, 8, 331. It is not yet clear what signals are involved in the establishment or Corresportdericc,to: N .A. Hopper

'

maintenance of differentiation but exogenous cAMP clearly affects cell-type specific gene expression in dissociated cells [3,6, 22, 23, 29, 311. cAMP is released in a pulsatile fashion during aggregation add stimulates neighbouring cells which, in turn, release cAMP relaying the signal. Extracellular cAMP binds to a surface receptor which is a member of the family of seven transmembrane receptors [34]. The receptor is coupled to a trimeric @protein which elicits multiple intracellular responses, including the activation of adenylyl cyclase (reviewed in [9]). If cAMP signalling is disrupted, by disaggregating cells and rapidly shaking them in buffered solution, prespore mRNAs disappear from the cells very rapidly [3, 12, 29, 31, 381. However, expression can be restored by adding extracellular CAMP. Among the best defined prespore genes are those encoding the major spore coat proteins, SP96, SP70 and SP60. These genes, cotA, cotB and cotC, are transcribed throughout the post-aggregation stages, exclusively in prespore cells [lo-121. When cells are induced to develop in suspension, under conditions where aggregates of up to 100 cells are formed, expression of cotC is dependent on the addition of extracellular cAMP [ 171. This induction is dependent upon CA-rich elements, designated CAEs, found in multiple copies within the promoter sequences of the cotA, and cotB and cotC genes. Sequential loss of CAEs within the cotC promoter results in progressive loss of cAMP inducibility [ 17, 181. Moreover, extracellular cAMP is essential for expression of the cotA, cotB and cotC genes in single cells following dissociation from slugs [14, 381 and this study). Therefore, it is important to identify the signal transduction mechanisms by which extracellular CAMP exerts its effects on expression of the cot genes. The cAMP dependent protein kinase, PKA, plays multiple roles in the development of Dictyostelium [2, 19, 30, 371. The PKA holoenzyme in Dictyostelium is a dimer, containing a single regulatory (R) and a single catalytic (C) subunit [ 16, 321. Cells in which the the catalytic subunit is inactivated, by gene disruption or by ex-

184

pression of a dominant inhibitor under the control of a non cell-type specific promoter, grow well but fail to aggregate when induced to developed on their own [19, 301. However, they will co-aggregate with wild-type cells in chimeric mixtures but are then left behind when the wild-type cells form fingers and migrate away [19, 301. Studies with a dominant inhibitor of PKA show that accumulation of the cotC mRNA has an absolute requirement for the kinase. Rm is a mutant form of the Dictyostelium regulatory subunit that cannot bind cAMP but which still inhibits PKA activity [19]. PKA activity can be selectively inhibited following aggregation in cells carrying a construct in which the regulatory region of pspA, a prespore gene, is ligated to the gene encoding Rm [21]. In these cells the dominant inhibitory subunit is expected to accumulate during late aggregation and to be restricted to prespore cells. The level of cotC mRNA and that of other prespore genes is greatly diminished a few hours after tip formation in these psA-Rm cells. We show, using nuclear run-on assays, that PKA activity is essential for transcription of the cot genes and that transcription can be correlated with the presence of a nuclear activity that binds specifically to a 1 13 bp fragment of the cotB promoter which contains multiple CAEs. Moreover, we show that there is an additional requirement of extracellular cAMP for the maintenance of expression of the cot genes that is manifest even when PKA is rendered constitutively active due to disruption of the gene encoding the regulatory subunit of PKA. Methods Dictyostelium strains. Cells of the strains AX2 and AX4 were maintained axenically in semi-defined medium [40, 411. The rdeC strain, HTY217 [ 11, has a lesion in the gene encoding the regulatory subunit of PKA producing a defective protein that cannot interact with the catalytic subunit [37]. NP2 [43] is the parental strain of HTY217. psA-Rm and psA-Rc have been described previously [21]. Briefly, psA-Rm selectively inhibits PKA in prespore cells and psA-Rc is a control strain for having a high copy number of the pspA promoter. Growth and development. Cells were grown at 22" C in axenic medium to a density of between 106 and 4x106 cells/ml and subjected to development upon 2% agar in KK, buffer (20mM KH,P04/K2HP04 pH 6.2). For disaggregation experiments, cells were allowed to develop for 12-13 h and harvested at the first finger stage. They were disaggregated into isolated cells and small cell clumps by passing through a 0.5 mm diameter syringe needle and then diluted to 5x106 cells/ml in KK, containing 5 mM EDTA. They were then shaken in a conical flask at 270 rpm either in buffer alone or in buffer containing 1 mM CAMP. Because the cells produce an extracellular form of cAMP phosphodiesterase, cAMP was added to the CAMPtreated flask at 75 min intervals and to a final concentration of 100 pM. Cells were harvested at appropriate periods after diaggregation and RNA extracted.

In v i m nuclear transcription and analysis. After harvesting and washing with cold 0.2% NaCl cells were lysed in nuclear lysis buffer (50 mM HEPES pH 7.5, 5 mM MgOAc, 10% sucrose, 2% cemulsol) at 108 cells/ml. Nuclei were pelleted by centrifugation and washed a further twice in nuclear lysis buffer. Finally, the nuclei were taken up at 2x108/ml in nuclear storage buffer [40 mM TRIS pH 7.9, 10 mM MgCI,, 0.1 mM EDTA, 1 mM dithio-

threitol (DTT) 50% glycerol], frozen in liquid nitrogen and stored at -70" C. Nucler run-on transcription was performed by adding one volume of 2x transcription buffer [80mM TRIS HCI pH7.9, 400 mM NaCI, 20 mM MgCI,, 2 mM DTT, 10% glycerol, 0.5 mM each of adenosine triphosphate (ATP), cytidine triphosphate (CTP) and guanosine triphosphate (GTP), 5 ptd uridine (UTP) triphosphate and 100 p Curies of a-32P UTP (800 Cilmmol). Samples were incubated for 30 min at 22" C, they were then treated with proteinase K (0.4 mg/ml) at 37" C for 30 min and extracted with phenokhloroform. After one ethanol precipitation, unincorporated nucleotides were removed by passing through a sephadex G50 column. Duplicate samples were then taken for Cerenkov counting and equal counts from each reaction product were hybridised for 48 h at 37" C in nuclear run-on hybridisation buffer [50% formamide, 5x standard saline citrate (SSC). 0.2% sodium dodecyl sulfate (SDS), 200 pg/ml bovine serum albumin (BSA), 300 pg/ml Ficoll, 100 pg/ml wheat-germ tRNA, 500 pg/ml poly(rA)] to Southern blots of digested plasmid DNAs bearing the genes of interest. Washing was at 37" C in 50% formamide, 1% SDS and 0.1xSSC for 4x15 min. Quantitative analysis of Northerns and nuclear run-on assays. Quantitation was performed using either X-ray film and a computing densitometer with ImageQuant v3.22 (Molecular Dynamics, Sevenoaks, Kent, UK) or a Phospholmager system with ImageQuant v3.3 (Molecular Dynamics). Gel retardation assays. Dictyostelium nuclear extracts were prepared by a modification of the method of Dignam et al. [5]. Briefly, cells were grown axenically, developed on 15 cm diameter nitrocellulose filters for the specified period of time, and harvested. After harvesting, all operations were performed at 4" C. Cells were washed with distilled water and suspended at a density of 2x108 cells per ml in lysis buffer (40 mM MOPS, pH 7.3, 5% w/v sucrose, 10 mM KCI, 5 mM MgCI,, 2 mM EDTA, 1 mM D'IT). Proteinase inhibitors phenylmethylsulphonyl fluoride (PMSF), benzamidine, leupeptin and pepstatin A were added to the lysis buffer just before use to concentrations of 1 mM, 1 mM, 5 pg/ml, and 0.1 pM respectively. NP40 was added to a final concentration of 0.5% and the suspension was triturated between two her-locked syringes. The resulting lysate was centrifuged at loo00g for 10 min, the supernatant was removed, and the nuclear pellet suspended in extraction buffer (40 mM MOPS pH 7.3,420 mM KCl. 5 mM MgCI,, 20% v/v glycerol, 5% w/v sucrose, 1 mM EDTA, 1 mM EDTA, 1 mM DTT, 0.1% NP40, and protease inhibitors) at a concentration of lo9 nuclei per ml. Nuclei were extracted for 30 min before being pelleted by centrifugation at 2oo00 g for 1 h. Solid ammonium sulfate (0.33 g/ml) was added to the extract and the mixture stirred for 30 min. Precipitated proteins were collected by centrifugation and suspended in a minimum volume of M Z buffer (40mM MOPS pH 7.3. 100 mM KCI, 20% v/v glycerol, 100 pM ZnCI,, 1 mM DTT, 0.1% NP40). The resulting nuclear extract was desalted on a 5 ml Sephadex G25 column, divided into aliquots, frozen in liquid nitrogen, and stored at -70" C. The probe for band shift assays consisted of a 1 13 base pair fragment extending from -253 to -141 bp upstream of the cotB transcription start site [ 131 which was subcloned into the SmaI site of pGEM3. The fragment was released by digestion with EcoR I and Hind 111 and 3' end labelled with T4 DNA polymerase [27]. The labelled 1 13 bp fragment was purified by electrophoresis on a native TBE/polyacrylamide gel, excised, eluted, and quantitated by scintillation counting. Electrophoretic mobility shift assays were performed by a modification of the method of Fried and Crothers [14]. Polyacrylamide gels (4%) were cast in a buffer composed of 20 mM MOPS (pH 7.2) and 2 mM EDTA. The gels were pre-run at 7.5 V/cm for 30min before the running buffer was replaced. The remaining operations were performed at 4" C. ' h o fentomoles of labelled probe were added to 8 pl buffer containing 1 pg sonicated poly (dAdT/dTdA). Four microlitres of nuclear extract containing

I85 5-10 pg protein were added to the DNA and the reaction allowed to proceed for I5 min at 4” C. Competition by poly (dCdA/dGdT) was carried out by adding I ng of poly dCA to the probe before addition of nuclear extract. Reaction mixtures were loaded onto running gels and separated for 90 min at 7.5 V/cm. Buffer was recirculated throughout the procedure. After separation by electrophoresis gels were vacuum dried and complexes detected by autoradiography.

Results Transcription of cotB and cotC requires PKA activity

Stable transformants carrying the psA-Rm construct lacking the two CAMPbinding sites of the R subunit develop to form a normally proportioned fruiting body in which the stalk supports a mass of amoeboid cells rather than spores [21]. Stable transformants carrying a control construct, psA-Rc, from which the inhibitory pseudosubstrate portion of the R subunit is also absent, show no developmental abnormalities. cotC mRNA appears at the normal time in psA-Rm cells, but stops accumulating at the tipped aggregate stage and decreases to near undetectable levels soon thereafter ([2 1 1; Table 1 ). Likewise, corB mRNA appears at the normal time of development but is virtually undetectable by the first finger stage in psA-Rm cells (Table 1). Both of these mRNAs accumulate normally in psA-Rc cells (data not shown). Since the psA-Rm construct is first expressed at the same time as the spore coat genes and the mutant Rm subunit ‘needs to Pble 1. Inhibition of protein kinase A (PKA) affects the rate of transcription of cotB and cotC Relative mRNA levelsa (RdRc)

Relative transcription rates” (Rm/Rc)

cotB

1.4%

COIC

4.20/ch

14.4% 13.2% (H.6; n=3)

cotB and cotC mRNA levels and transcription rates at the first finger stage in psA-Rm cells are given as a percentage of those in psA-Rc cells at the same stage b Data from [ 2 I ] 8

accumulate before it is able to inhibit the C subunit, the cot genes would be expected to be expressed for a short period before responding to the lack of PKA activity. To directly determine the rate of cotC transcription, nuclei were prepared from the same cells used for the Northern analysis of mRNA accumulation. Run-on assays indicate that transcription of cotC is fourfold lower at the tipped aggregate stage in psA-Rm cells than in psA-Rc cells, and that the relative transcription rate falls even further during subsequent development (Fig. 1 ). Several independent determinations of the relative transcription rates of cotB and cofC at the first finger stage showed that transcription was reduced more than sixfold when PKA was inhibited by the mutant R subunit (Table I). Therefore, we conclude that PKA activity is essential for continued high rates of their transcription.

V

T FF PC

psA-Rm transformants

PSA-RC tralrpformants

Fig. 1. cotC nuclear run-on following inhibition of protein kinase A (PKA) in prespore cells. Cells transformed with a construct carrying the dominant inhibitor of PKA expressed from a prespore promoter @sA-Rm) and those transformed with a construct carrying an inactive form of the regulatory subunit expressed from the same promoter @sA-Re) were collected as vegetative cells (V), after developing to tight aggregates ( r ) , first fingers ( F F ) , and preculminants (PC). Nuclei were prepared and used for nuclear run on analyses of the cotC gene

Table 2. Alignments of the CA rich regions within the cotA, cotB and cotC promoters Gene

CAE sequencea

C-rich elementa

cotA

-285AACACACTCAA ACACACATa

COIB

-374AACACACACAC TCACTCAC -230CTCTCACCCAC ACAACCAA - 194 TACACCCACCA ACACACCT -184AACACACCTAC ACCCAGTT -602TTCACACACCC ACACACTA (CAE-1) -518TTCACACATTA ACACACTT (CAE-2) -404AACACACTCCCAACACACAA (CAE-3) CACAC CACAC

-617 AAACACCCAlLA -131TGCCACCCTAA -229TCTCACCCACA - 1 95 ATACACCCAC C - 177 CTACACCCAGT

corc Consensus

-599ACACACCCACA (CAE-1) -401ACACTCCCAAC (CAE-3)

ACACCCA

“CAE elements defined by Haberstroh et al. [ 181 have a consensus of two copies of the sequence CACAC separated by one turn of the DNA helix. The ACACCCA concensus has been identified by Fosnaugh and Loomis [ 121. Often these consensus sequences are overlapping. Positions relative to the transcription start site are shown. Sequences from [ 12, 13, 17, 391. b Sequence in antisense orientation relative to the transcriptional start site

186

E8 ,

Vegetative cells Ax4

psA-Rm

g - + - +

Early first fingers Ax4

.psA-Rm

Late first fingers Ax4

psA-Rm

- + - + - + - +

-I

NP2

t0

4 M P

+CAMP

HTY217

Fig.3. The effects of cAMP and constitutive PKA activity on corC transcription. Wild-type cells ( N f 2 ) and p k R - mutant cells

Fig. 2. Gel retardation activity following inhibition of PKA in prespore cells. Nuclear extracts were prepared from wild-type (Ax4) and psA-Rm cells at various times during development and assayed for retardation of the I 13 bp fragment of the corB promoter. Samples were assayed in the absence (-) and presence (+) of poly [CAI competitor

IdentiBcation of a developmentally regulated DNA binding activity and its dependence upon PKA

The cotA, cotB and cotC genes all have similar CA-rich elements in their upstream regions that have been shown to be essential for their expression (Table 2). Sequential deletion of CAE-1, CAE-2, and CAE-3 from the cotC regulatory region results in a progressive decrease in cAMP induced expression from this region [ 171. Moreover, probes carrying these sequences from the cotC gene are retarded during electrophoresis on native gels when mixed with nuclear extracts [ 181. The sequence specific DNA binding activity, termed GBF, is not present in undeveloped cells but accumulates by 8 h of development as the cells are entering aggregates [18]. We used a 113 bp probe from the regulatory region of cotB that contains three copies of a CAE (Table 2) for gel retardation experiments. Deletions into this region result in complete loss of transcriptional activity [ 131. Nuclear extract were made from wild-type (AX4) and psA-Rm cells at various times of development and incubated with the probe. No specific binding activity was detected in nuclear extracts of vegetative cells from either strain. Nuclear extracts prepared from cells of both strains that had just formed first fingers formed a complex with the probe that was competed by polydAC (Fig. 2). The position of the major retarded band in the gel was identical when extracts from early fingers of either strain were used although extracts of psA-Rm cells retarded less of the probe. The major retarded band seen with extracts of late first finger stage wild type cells migrated more slowly in the gel, perhaps as the consequence of recruitment of other components to the complex. Extracts of psA-Rm cells prepared at the late first

(HTY217) were disaggregated at the first finger stage and shaken in suspension in the presence or absence of 1 mM CAMP. Nuclei were prepared immediately following dissociation (to) or after 2 h in suspension and used for nuclear run on analyses

finger stage showed no specific DNA binding with this probe (Fig. 2). Retardation of the 1 13 bp probe from the cotB regulatory region is competed by excess unlabelled DNA carrying the CAEs of cotC as well as by unlabelled cotB probe (data not shown). It appears that when the dominant negative regulator of PKA accumulates in prespore cells the nuclear DNA binding activity specific for cotB drops dramatically. Loss of this DNA binding activity may account for the lack of cotB transcription after the first finger stage in psA-Rm cells. Extracellular CAMP is requiredfor the maintenance of cotC transcription in disaggregated cells

When cells are disaggregated from slugs and shaken in suspension, cAMP signalling is disrupted and prespore specific mRNA are rapidly lost from the cells [12,20, 24, 351. The addition of extracellular CAMPto disaggregated cells causes prespore mRNAs to reaccumulate. If extracellular CAMP is acting solely through PKA, then disaggregation of cells in which PKA activity is constitutively active should have little effect on continued transcription of prespore genes. Strain HTY217 carries a mutation in the gene encoding the regulatory subunit of PKA, rdeC, which generates an amino acids substitution in the pseudo-substrate site of the R subunit [37].As a result, the catalytic subunit is rendered constitutively active, even in the absence of intercellular signalling. However, when we disaggregated HTY217 cells at the first finger stage and shook them in the absence of CAMP,we found that the rate of cotC transcription measured in run-on assay decreased about fourfold within 2 h (Fig. 3). Addition of CAMPto the buffer in which the cells were shaken resulted in a continued high level of cotC transcription (Fig. 3). The rate of cotC transcription

I87

NP2

+CAMP

-CAMP

mtA cat C

COI A

cot C

HTY217

+CAMP

-CAMP

M A cote

cot A cot C

Fig.4. Co-ordinate regulation of cotA and cotC transcription in the presence or absence of CAMP. Cells were disaggregated from first fingers and developed in suspension for 2 h in the presence or absence of I mM cAMP before nuclei were collected for nuclear run on analyses. The rates of transcription of cotA and cotC can be directly compared in wild-type cells ( N P 2 ) and pkaR- mutant cells

(HTY217)

in wild type, NP2, cells was also dramatically reduced when cells were dissociated at the first finger stage unless cAMP was added to the dissociation buffer (Fig. 3). Thus, both wild-type and PKA constitutive mutant cells require exogenous cAMP for continued high rates of cotC transcription in dissociated cells. Transcription of corA in dissociated cells shows a similar response to exogenous cAMP in both wild-type and PKA constitutive mutant strains (Fig. 4).While constitutive PKA has some effect on cot gene transcription when cAMP signalling is disrupted, it appears that extracellular cAMP acting through a PKA-independent pathway also plays a role in maintaining a high rate of transcription of these genes.

Discussion Since transcription from the pspA promoter is not reduced in psA-Rm cells [20], we were able to generate prespore cells lacking PKA activity. After initial prespore differentiation and activation of both the pspA and the cot promoters, the Rm protein accumulates in prespore cells of the psA-Rm strain and inhibits PKA. Accumulation of corB and cotC mRNAs occurs briefly and then is arrested such that by the first finger stage they are present at less than 5% of wild-type levels [21] and Table 1). By the preculmination stage these mRNAs are barely detectable in psA-Rm cells (Fig. 1). We have shown here, by nuclear run-on assay, that the reduced level of cot mRNA is the direct consequence of a decrease in the rate of transcription. Thus, there appears to

be a dependence on PKA activity for continued high rates of transcription of the cot genes in prespore cells. The decrease in transcriptional activity of the cot gene is correlated with a decrease in a nuclear binding activity that recognizes an essential portion of the cotB regulatory region that contains several CA rich elements. Such elements also occur in the essential regulatory regions of the corA and corC genes and may be involved in their coordinate regulation. Retardation of the probe from the cofB regulatory region is competed by an excess of unlabelled DNA carrying the CAEs of cotC, indicating that the DNA binding activity may recognize these common elements. Although absent in vegetative cells, the DNA binding activity is present in nuclei of psA-Rm cells when prespore cells first differentiate following aggregation. The activity is lost during the finger stage in psA-Rm cells but remains in control cells (Fig. 2). Thus, PKA activity appears to be necessary for maintenance of activity of this DNA binding activity. PKA is known to phosphorylate the kinase-inducible domain of the mammalian transcription factor, CREB, and enhance its ability to activate transcription [4,151. PKA might regulate the cot genes of Dicryosrelium by a similar mechanism or could act indirectly through other components. A DNA binding protein, termed GBF, has been purified from developing Dictyostelium cells which recognizes the CAEs of the cotC regulatory region [36]. A mutant strain was generated by homologous recombination with a disrupted copy of a cDN-A encoding GBF and shown to abort development at the loose aggregate stage before cell-type specific genes are expressed [36]. This DNA binding protein may be responsible for gel-retardation of the cotB probe we used in this study. There are no consensus PKA phosphorylation sites in GBF [36], suggesting that there may be a kinase cascade with GBF at its end point. cotA, corB, and cotC mRNAs rapidly disappear from cells upon disaggregation from fingers [12, 381. The drop in cor mRNAs results from the cessation of transcription from these genes unless cAMP is added to the buffer in which the disaggregated cells are suspended (Figs. 3 and 4).A high rate of transcription can only be maintained by the addition of cAMP to the dissociation buffer. Thus even in the presence of constitutively active PKA, exogenous cAMP regulates the rate of prespore gene expression. These results indicate that a cAMP receptor on the surface of prespore cells transduces the exogenous signal to the genes by a pathway independent of PKA. A likely candidate for such a pathway is one involving internal calcium since it is known that raising the calcium concentration in the buffer allows dissociated cells to maintain high levels of the cot mRNAs [ I21 and addition of chemical agents that disrupt calcium signalling represses prespore gene expression [35]. Acknowledgernenrs. This work was supported by a grant from the NSF (DCB-9017782) to W.F.L.

References I . Abe K, Yanagisawa K (1983) A new class of rapidly developing mutants in Dicryostelictm discoideum: implications for cy-

188

clic AMP metabolism and cell differentiation. Dev Biol 9k2OO-210 2. Anjard C, Pinaud S , Kay RR, Reymond CD (1992) Overexpression of DdPK2 protein kinase causes rapid development and affects the intracellular cAMP pathway of Dictyostelium discoideum. Development 1 15785-790 3. Barklis E, Lodish HF (1983) Regulation of Dictyostelium discoideum mRNAs specific for prespore or prestalk cells. Cell 32~1139-II48 4. Brindle P, Linke S , Montminy M (1993) Protein-kinase-A-dependent activator in transcription factor CREB reveals new role for CREM repressors. Nature 364321-824 5 . Dignam JD, Martin PL, Shastr B, Roeder RG (1983) Eukaryotic gene transcription with purified components. Methods Enzymol 101582-598 6. Early AE, Williams JG, Meyer HE, Por SB, Smith E, Williams KL, Gooley AA (1988) Structural characterization of Dictyostelium discoideum prespore-specific gene D19 and of its product, cell surface glycoprotein PsA. Mol Cell Biol 8:3458-3466 7. Finney R, Mitchell L, Sol1 D, Murray B, Loomis WF (1983) Loss and resynthesis of a developmentally regulated membrane-protein (gp80) during dedifferentiationand redifferentiation in Dictyostelium. Dev Biol98:502-513 8. Finney R, Ellis M, Langtimm C, Rosen E, Firtel R, Sol1 D ( 1987) Gene regulation during dedifferentiation in Dictyostelium discoideum. Dev Biol 120:561-570 9. Firtel RA, Haastert PJM van, Kimmel RA, Devreotes PN (1989) G protein linked signal transduction pathways in development: Dictyostelium as an experimental system. Cell 58~253-259 10. Fosnaugh KL, Loomis WF (1989) Sequence of the Dictyostelium discoideum spore coat gene SP96. Nucleic Acids Res 17~9489-9490 1 1. Fosnaugh KL, Loomis WF (1989) Spore coat genes SP60 and SWO of Dictyostelium discoideum. Mol Cell Biol 9~5215-5218 12. Fosnaugh KL, Loomis WF (1991) Coordinate regulation of the spore coat genes in Dictyostelium discoideum. Dev Genet 12:123-1 32 13. Fosnaugh KL, Loomis WF (1993) Enhancer regions responsible for temporal and cell-type-specific expression of a spore coat gene in Dictyostelium. Dev Biol 157:3848 14. Fried JD, Crothers DM (1981) Equilibria and kinetics of lac repressor/operator interactions by polyacrylamide gel electrophoresis. Nucleic Acids Res 9:6505-6525 15. Gonzalez G,Montminy M (1989) Cyclic AMP stimulates somatostatin gene transcription by phosphorylation of CREB at serine 133. Cell 59:675480 16. Gunzburg J de, Veron M (1982) A CAMP-dependent proteinkinase is present in differentiating Dictyostelium discoideum cells. EMBO J 1:1063-1076 17. Haberstroh L, Firtel RA (1990) A spatial gradient of expression of a CAMP-regulated prespore cell-type-specific gene in Dictyostelium. Genes Dev 4596412 18. Haberstroh L, Galindo J, Firtel RA (1991) Developmental and spatial regulation of a Dictyostelium prespore gene: cis-acting elements and a CAMP-induced, developmentally regulated DNA binding activity. Development 1 13:947-958 19. Harwood AJ, Hopper NA, Simon M, Bouzid S , Veron M, Williams JG (1992) Multiple roles for CAMP-dependent proteinkinase during Dictyostelium development. Dev Biol 149:90-99 20. Hopper NA, Williams JG (1994) A role for CAMP-dependent protein kinase in determining the stability of prespore cell differentiation in Dictyostelium. Dev Biol 163:285-287 21. Hopper NA, Harwood AJ, Bouzid S , Veron M, Williams JG (1993) Activation of the prespore and spore cell pathway of Dictyostelium differentiation by cAMP dependent protein kinase and evidence for its upstream regulation by ammonia. EMBO J 12~2459-2466

22. Kay R (1979) Gene expression in Dictyostelium discoideum: mutually antagonistic roles of cyclic AMP and ammonia. J Embryo1 Exp Morphol52:171-182 23. Kay R (1982) cAMP and spore differentiation in Dictyostelium discoideum. Proc Natl Acad Sci USA 79:322&3234 24. Landfear S , Lefebvre P, Chung S,Lodish H (1982) Transcriptional control of gene expression during development of Dictyostelium discoideum. Mol Cell Biol2: 1417-1425 25. Loomis WF (1982) The development of Dictyostelium discoideum. Academic Press, New York 26. Loomis WF (1 993) Lateral inhibition and pattern formation in Dictyostelium. Cum Top Dev Biol28: 1 4 6 27. Maniatis T, Frisch E, Sambrook J (1982) Molecular cloning. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 28. Mann SK, Firtel RA (1991) A developmentally regulated, putative serineheonine protein kinase is essential for development in Dictyostelium. Mech Dev 3589-101 29. Mann S , Pinko C, Firtel RA (1988) Control of early gene expression in Dictyostelium. Dev Genet 9:337-350 30.Mann SKO, Yonemoto WM, Taylor SS, Firtel RA (1992)DdPK3, which plays essential roles during Dictyostelium development, encodes the catalytic subunit of CAMP-dependent protein kinase. Proc Natl Acad Sci USA 89: 10701-1 0705 3 1. Mehdy MC, Ratner D, Firtel RA (1983) Induction and modulation of cell type specific gene expression in Dictyostelium. Cell 32:763-77 1 32. Mutzel R, Lacombe M, Simon M, Degunzburg J, Veron M (1987) Cloning and cDNA sequence of the regulatory subunit of cAMP dependent protein-kinase from Dictyostelium discoideum. Proc Natl Acad Sci USA 846-10 33. Raper K (1940) Pseudoplasmodium formation and organisation in Dictyostelium discoideum. J Elisha Mitchell Sci Soc 59~241-282 34. Saxe CL 3rd, Klein P, Sun TJ, Kimmel AR, Devreotes PN (1988) Structure and expression of the cAMP cell-surface receptor. Dev Genet 9:227-235 35. Schaap P, Van Looheren Campagne MM, Van Driel R, Spek W, Van Haastert PJM, Pinas J (1986) Postaggregative differentiation induction by CAMP in Dictyostelium: intracellular transduction pathway and requirement for additional stimuli. Dev Biol 1 1852-63 36. Schnitzler G,Fischer W, Firtel RA (1994) Cloning and characterisation of the G-box binding factor, an essential component of the developmental switch between early and late development in Dictyostelium. Genes Dev 8502-5 14 37. Simon MN, Pelegrini 0, Veron M,Kay RR (1992) Mutation of protein kinase-A causes heterochronic development of Dictyostelium. Nature 356:171-172 38. Takemoto K, Takeuchi I, Tasaka M (1990) CAMPregulation of the expression of prespore specific genes, SP96 and Dp87, in disaggregated slug cells of Dictyostelium discoideum. Cell Differ Dev 3 1239-96 39. Tasaka M, Hasegawa M, Nakata M. Orii H,Ozaki T, Takeuchi I (1992) Protein binding and DNase-I-hypersensitive sites in the cis-acting regulatory region of the spore coat SP96 gene of Dictyostelium. Mech Dev 36:105-115 40. Watts DJ, Ashworth JM (1970) Growth and myxamoebae of the cellular slime mould Dictyostelium discoideum in axenic culture. Biochem J 119:171-174 41. Watts DJ, Ashworth JM (1970) Metabolism of the cellular slime mould Dictyostelium discoideum grown in Axenic culture. Biochem J 119:175-182 42. Williams JG, Duffy KT, Lane DP, McRobbie SJ, Harwood AJ, Traynor D, Kay RR, Jermyn KA (1989) Origins of the prestalk-prespore pattern in Dictyostelium development. Cell 59:1157-1163 43. Williams K, Kessin R, Newel1 P (1974) Genetics of growth in axenic medium of the cellular slime mould Dictyostelium discoideum. Nature 247:142-143