Protein nitration promotes inducible nitric oxide synthase transcription mediated by NF-κB in high glucose-stimulated human lens epithelial cells

Molecular and Cellular Endocrinology 370 (2013) 78–86

Contents lists available at SciVerse ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Protein nitration promotes inducible nitric oxide synthase transcription mediated by NF-jB in high glucose-stimulated human lens epithelial cells Yanning Li a, Demei Liu b, Yuan Liu b, En Li b, Hui Wang c, Kun Liu b, Jinsheng Qi b,⇑ a

Department of Molecular Biology, Hebei Key Lab of Laboratory Animal, Hebei Medical University, Shijiazhuang, China Department of Biochemistry, Hebei Key Laboratory of Medical Biotechnology, Hebei Medical University, Shijiazhuang, China c Department of Pathology, Hebei Medical University, Shijiazhuang, China b

a r t i c l e

i n f o

Article history: Received 27 October 2012 Received in revised form 1 February 2013 Accepted 19 February 2013 Available online 27 February 2013 Keywords: Protein nitration NF-jB p300 Inducible nitric oxide synthase Transcriptional control

a b s t r a c t Although an important event in hyperglycaemia-induced oxidative stress is the nuclear factor-kappa b (NF-jB)-activated inducible nitric oxide synthase (iNOS) expression, the underlying mechanism is not fully characterized. Peroxynitrite, formed from NO and superoxide, can induce multiple proteins nitration, even including NF-jB and iNOS, to alter their functions. In this study, we found high glucose caused conspicuous nitration of nuclear NF-jB p65 and its co-activator p300 in human lens epithelial cells. The nitration of NF-jB and p300 promoted their co-localization and binding to ensure the activation of the iNOS gene transcription. Moreover, nearly all predicted NF-jB binding sites in the human iNOS gene promoter were responsive to high glucose stimulation, might for a synergistic role. While, only the NF-jB binding site 5212 showed significant alterations by high glucose and peroxynitrite stimulations, indicating it a more important role in the protein nitration promoted iNOS gene transcription. Our results demonstrated that protein nitration can promote the NF-jB-activated iNOS gene transcription in human lens epithelial cells by high glucose stimulation. Ó 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Diabetic eye disease is the most common cause of blindness, and diabetic cataract is a leading cause of vision loss (Kubo et al., 2005; Ruberte et al., 2004; Osada et al., 2011). The nuclear factor-kappa b (NF-jB), a master transcription factor in hyperglycaemia-induced oxidative stress, has been robustly established to play a crucial role in diabetic complications, including diabetic cataract (El-Osta et al., 2008; Jiang et al., 2011; Kubo et al., 2005; Randazzo et al., 2011; Nambu et al., 2008). The inducible nitric oxide synthase (iNOS) transcription active by NF-jB is very important in diabetes (Azevedo-Martins et al., 2003; Romagnoli et al., 2010). However, how NF-jB regulates iNOS transcription is not fully explored. The p300 family is the most important histone acetyl transferase, participating in regulation of gene transcription (Das et al., Abbreviations: ChIP, chromatin immunoprecipitations; Co-IP, co-immunoprecipitation; FeTPPS, 5,10,15,20-tetrakis-(4-sulfonatophenyl)porphyrinato-iron(III); iNOS, inducible nitric oxide synthase; NF-jB, nuclear factor-kappa b; NRE, negative regulatory element; SIN-1, 3-morpholinosydnonimine. ⇑ Corresponding author. Address: Department of Biochemistry, Hebei Key Laboratory of Medical Biotechnology, Hebei Medical University, No. 361 East Zhongshan Road, Shijiazhuang 050017, Hebei, PR China. Tel.: +86 0311 86265639; fax: +86 0311 86266854. E-mail address: [email protected] (J. Qi). 0303-7207/$ - see front matter Ó 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.mce.2013.02.015

2009). In diabetes, p300 can bind NF-jB, act as a transcription co-activator and activate the iNOS gene transcription (Guo et al., 2008; Kaur et al., 2006). Despite the molecular mechanism of the interaction between NF-jB and p300 has not been fully clarified, the protein post-translational modifications may play a decisive role. In diabetes, peroxynitrite, formed from NO and superoxide, is well known to play a crucial role in the pathological changes (Duplain et al., 2008; Vareniuk et al., 2008). The peroxynitrite can cause conspicuous nitration to tyrosine residue of proteins to form nitrotyrosine (NT), so NT is suggested as a marker of peroxynitrite-caused protein nitration (Fontana et al., 2002). Once proteins are nitrated by peroxynitrite, their structure and functions are altered (Wu and Wilson, 2009). These are also proved by our previous study (Li et al., 2010). Although the iNOS expression is activated by cytokines, there is no evidence showing whether protein nitration can affect the NF-jB-activated iNOS gene transcription, forming a positive feedback. And in different conditions, effect of the peroxynitrite on NF-jB activity is controversial (Levrand et al., 2005; Cooke and Davidge, 2002; Bar-Shai and Reznick, 2006; Park et al., 2005). So the effect of protein nitration on the interaction between NF-jB and p300 has not been fully understood in diabetes. The NF-jB needs binding to the iNOS gene promoter to activate its transcription. In the upstream sequence of human iNOS gene

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

scatter a series of NF-jB binding sites and even a negative regulatory element (NRE) has been identified (Feng et al., 2002). The NF-jB repressing factor binding to NRE is recognized to inhibit the NF-jB-enhancing activity by a direct protein–protein interaction (Niedick et al., 2004; Feng et al., 2002). As the transcription factor binding sites are generally believed to scatter within 10 kb upstream of the transcriptional start site (Teng et al., 2002), the 10 kb iNOS gene promoter had been analyzed and 9 sites were found in our study, locating at 8691 bp, 8657 bp, 8414 bp, 8275 bp, 6074 bp, 5801 bp, 5460 bp, 5212 bp and 115 bp (Fig. 5A). And the NRE locating at 6743 bp was also found (Fig. 5A). The predicted binding sites are basically consistent with the previous reports (Taylor et al., 1998; Ganster et al., 2001). However, which sites play a main role in the regulation of iNOS gene transcription in high glucose stimulation has not been defined. In this study, the effect of peroxynitrite-induced protein nitration on the NF-jB-activated iNOS gene transcription was investigated in high glucose stimulated human lens epithelial cell, using the peroxynitrite donor 3-morpholinosydnonimine (SIN-1) and its decomposition catalyst 5,10,15,20-Tetrakis-(4-sulfonatophenyl)porphyrinato-iron(III) (FeTPPS) as tool drugs. 2. Materials and methods 2.1. Cells and treatments The human lens epithelial cells (SRA01/04), with the morphological features and the normal expression of the characteristic proteins, were purchased from Chinese Academy of Medical Sciences. The cells were treated with 25 mM glucose for 0, 10, 20, 30 and 40 min (Ashall et al., 2009; Tay et al., 2010; Samikkannu et al., 2006; Zhang et al., 2007), and then the NF-jB p65 nuclear translocation was measured to determine the optimal time for high glucose stimulation. Upon the above experiment, the cells were treated with 5.5, 10, 15, 20, 25 and 30 mM glucose to reconfirm the most suitable high glucose concentration. Similarly, the effective concentrations of SIN-1 (Sigma–Aldrich) and FeTPPS (Merck) were ascertained (Tao et al., 2006; Schildknecht et al., 2008; Kohr et al., 2008; Gautier et al., 2008). Then the cells were divided into four groups: Control group (5.5 mM glucose), High glucose group (25 mM glucose), SIN-1 group (100 lM SIN-1) and High glucose + FeTPPS (25 mM glucose + 50 lM FeTPPS) group, for further detection. 2.2. Immunofluorescence detection After fixed, the cells were incubated with 1% Triton X-100 for 30 min. Then they were blocked with 10% goat serum for 1 h and incubated with the primary antibody (NF-jB p65; Santa Cruz) at 37 °C for 2 h. After washed with PBS, the cells were incubated with the secondary antibody (tetramethylrhodamine isothiocyanate [TRITC]; Zhongshan). After 0.5 lg/mL DAPI was added for 15 min at room temperature, the cells were sealed with 50% glycerol and the images were taken with a fluorescence microscope (Olympus IX51). To get exact results, controls (PBS instead of the first antibody or the second antibody) were designed. 2.3. The extraction of nuclear proteins The cells were re-suspended in 1 mL cold lysis buffer A (10 mM HEPES-KOH pH 7.9, 10 mM KCl, 0.1 mM EDTA, 1 mM DTT, 1 mM Na3VO4, and 1 mM PMSF, added just before use). NP-40 was added at the final concentration of 0.6%, and the samples were mixed by 3 s vibration. The mixture was centrifuged at 12,000g, for 5 min at

79

4 °C, and the supernatant was discarded. A small part of the pellet was stained with DAPI for detection of the nucleus. Then the pellet was re-suspended in 0.1 mL cold lysis buffer B (20 mM HEPES-KOH pH7.9, 400 mM NaCl, 1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 1 mM Na3VO4, and 1 mM PMSF, added just before use). The mixture was centrifuged at 12,000g, for 20 min at 4 °C, and the supernatant was collected for Western blotting detections. 2.4. Western blotting The contents of NF-jB p65 and p300 as well as their nitration in nuclear proteins and the content of iNOS protein in the whole were detected by Western blotting, with the protocol previously described (Li et al., 2010). Briefly, after the concentration was determined, the sample was separated by SDS–PAGE and transfered to a polyvinylidene difluoride membrane. The membrane was incubated overnight with the primary antibody (anti-p65, Santa Cruz; anti-p300, Millipore; anti-H2AX, Bioworld; anti-iNOS, Santa Cruz; anti-actin, Epitomics) and then the secondary antibody (Zhongshan). The membrane was developed with an enhanced chemiluminescence kit (Pierce). For the nuclear samples, after being washed with PBST overnight, the membrane was reused to detect the NT content in the p65 or p300 protein. The membrane was incubated with the primary antibody (anti-NT, Cayman Chemical) and the secondary antibody (Zhongshan), and then developed again. Band intensity was quantified and calculated. 2.5. Confocal detection The co-localization of NF-jB p65 and p300 was measured by Confocal detection. The cells on the cover glass were fixed as the procedure in Immunofluorescence detection, and the following procedure was as previously described (Li et al., 2010). The primary antibodies used were anti-p65 (Thermo Scientific) and anti-p300 (Millipore), and the corresponding secondary antibodies were TRITC (Zhongshan) and FITC (Zhongshan). The images were taken during the same intervals with a laser confocal scanning microscope (Olympus). To get exact results, the negative and positive controls were designed. 2.6. Co-immunoprecipitation (Co-IP) The binding of NF-jB p65 and p300 was analyzed by Co-IP assays. The cells were collected and re-suspended in 1 mL cold IP buffer, containing protease inhibitors. The cell suspension was sonicated and the protein content was determined, and Co-IP assays of NF-jB p65 and p300 were performed as described (Li et al., 2010). Briefly, the sample was reacted with the primary antibody (antip65, Thermo Scientific; anti-p300, Millipore) and then incubated with Protein G-Agarose (Santa Cruz) overnight. After centrifuged, the sediment was collected and washed with wash buffer. The co-immunoprecipitated proteins were collected and subjected to SDS–PAGE. Western blotting was used to detect the protein content of co-immunoprecipitated p300 or p65 and its NT content, through the procedure followed above. 2.7. Chromatin immunoprecipitations (ChIP) The binding of NF-jB p65 to the human iNOS gene promoter was analyzed by ChIP, performed as the protocol reported (Nelson et al., 2006). Briefly, the cells were cross-linked, collected and washed. The cell pellets were re-suspended and washed twice with 1 mL cold IP buffer (150 mM NaCl, 50 mM Tris–HCl pH 7.5, 5 mM EDTA, 0.5% NP-40, and 1.0% Triton X-100), containing protease inhibitors (5 lL of 0.1 M PMSF in isopropanol and 1 lL of 10 lg/lL leupeptin, added immediately before use). The cell suspension was sonicated,

80

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

2009; Tay et al., 2010). Transient high glucose stimulation is reported to cause NF-jB nuclear translocation at 20 min and bind to the gene promoter at 30 min (Samikkannu et al., 2006; Zhang et al., 2007). In the study, the extracted nucleus was stained with DAPI to show its purity, and only the nucleus was seen from the sample used for the Western blotting detection (Fig. 1B). The content of nuclear NF-jB p65 was highest at 20 min and had a tendency to decrease at 30 min and 40 min (Fig. 1A). This time-dependent NF-jB p65 nuclear translocation was reconfirmed by Immunofluorescence detection (Fig. 1C). The NF-jB p65 was scattered in the cytoplasm at 0 min and concentrated in the nucleus at 20 min, but the nuclear NF-jB p65 decreased at 40 min. Then with different concentrations of glucose for 20 min, the content of nuclear NF-jB p65 increased significantly, especially in 25 mM glucose groups, compared with the 5.5 mM group (Fig. 1A). From the results, the 25 mM glucose was adopted as high glucose stimulation for a distinct effect.

using the FS-450 ultrasonic processing with three rounds of 15 1-s pulses (2-min rest between rounds) at 50% power output. The sonicated lysate was centrifuged and the supernatant was retained. An aliquot of the sonicated DNA was precipitated with ethanol and analyzed by electrophoresis, with the average fragment sizes 0.5– 1 kb. The anti-p65 antibody (Santa Cruz) or control rabbit IgG (Santa Cruz) was added into an aliquot of 200 lL sonicated lysate, and then 20 lL washed protein G-agarose beads (Santa Cruz) was added. The mixture was rotated at 4 °C for 2 h, and then centrifuged at 2000g for 30 s at 4 °C to wash the beads. The washed beads were re-suspended in 100 lL ddW, vortexed 10 s and boiled for 10 min. The sample as well as the sonicated lysate was treated with 2 lL of 10 lg/lL proteinase K. After centrifuged at 12,000g for 1 min at 4 °C, the digested DNA was used for PCR assay. The primers for the predicted NF-jB binding site in human iNOS promoter (NC_000017.10) were in Table 1. To get exact results, controls with the antibody or the beads only were designed. 2.8. Reverse transcription-PCR The mRNA content of iNOS was quantified by Reverse transcription-PCR. Total RNA was isolated using Trizol reagent (Takara) and reverse transcribed into cDNA using RevertAid First Strand cDNA synthesis Kit (Fermentas), followed by PCR amplification using the specific primers for iNOS. Actin primers were used as an internal standard (Table 1).

3.2. High glucose induced nuclear NF-jB p65 and p300 nitration In diabetes, when iNOS is induced, excess NO as well as superoxide will be generated (Porasuphatana et al., 2006). Once diffusing NO meets superoxide, peroxynitrite will be formed to cause protein nitration. Our previous study has found that besides other proteins, iNOS itself can be nitrated, enhancing its activity (Li et al., 2010). Several groups have reported the nitration of NF-jB with controversial effects (Levrand et al., 2005). While no data concerning p300 nitration has been found. In high glucose stimulation, whether NF-jB p65 and p300 can be nitrated is unclear. In the study, although iNOS hardly expressed in 5.5 mM glucose cultivation, the iNOS protein was notably synthesized at 30 min and 40 min in 25 mM high glucose stimulation (Fig. 2A). The result indicated that the activity of iNOS could exhibit at as early as 30 min for high glucose stimulation, and then this time point was chosen for detection of the nuclear NF-jB p65 and p300 nitration (Fig. 2B), considering the time of NF-jB nuclear translocation. High glucose could induce conspicuous nitration of NF-jB p65 and p300, which was significantly reduced by 50 lM and 100 lM

2.9. Statistical analysis Data are presented as mean ± SD from three separate experiments as indicated in the figure legends. Differences between the two groups were evaluated by Student’s t test and P value <0.05 was considered statistically significant. 3. Results 3.1. High glucose triggered NF-jB nuclear translocation As a quick response factor, the NF-jB oscillated between the cytoplasm and the nucleus for a functional effect (Ashall et al.,

Table 1 Primers used for PCR detection. Primers 115: Sense Anti-sense 5212: Sense Anti-sense 5460: Sense Anti-sense 5801: Sense Anti-sense 6074: Sense Anti-sense 6743: Sense Anti-sense 8275: Sense Anti-sense 8414: Sense Anti-sense 8657: Sense Anti-sense iNOS: Sense Anti-sense Actin: Sense Anti-sense

0

5 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50

0

AGAAAGAGGTGGGTTGGGTGAAGA 3 ATGCCATCCAGAGAGTTGTTTTTGC 30 AGGGAAGGGAGGGTGTTCTGGGGAG 30 TTGCCTGACTCGGAGATGACGGAAG 30 GTCTCACTTCCTCATTCCCCTCCT 30 CTGGCACTTTGCTGCTGTTTCTTT 30 ATTCTAAACCCCCTGTAGCAGTGAC 30 TGACCCAGCAGTTCCAGAGCAT 30 GCCAGTCGTTGCTACATTCTGCCTT 30 AGCCCACCCTCTTGTATCCTTCCCT 30 TAAAGAAAAGATAACTATTGCCCAT 30 ATCGTGACAAGCACCTGTAGACC 30 TAGACACAGGTATTGGAAGCAG 30 AGGAGCATCTTAGGGACACCAC 30 AGGATGAGACAGGCTAGACACAGGT 30 CAGAGGAGGTGACAGTCCCCAACAG 30 GTAAAAGAGACAGAGCAGTGAGACC 30 CCCTTCAGACTCTGCTTTACTTCAT 30 CCTCGGCTCCAGCATGTACCCTCGG 30 CGGAAGGCGTCCTCCTGCCCACTGA 30 AGCGAGCATCCCCCAAAGTT 30 GGGCACGAAGGCTCATCATT 30

Annealing temperature

Product size

55 °C

191 bp

60 °C

226 bp

55 °C

242 bp

55 °C

173 bp

55 °C

228 bp

55 °C

301 bp

55 °C

377 bp

55 °C

130 bp

55 °C

161 bp

60 °C

135 bp

60 °C

285 bp

The primers of the NF-jB binding sites and the NRE in the iNOS gene promoter were used for ChIP-PCR detection, with the 8657 primer for the NF-jB binding site 8657 and 8691. And the primers of the iNOS mRNA as well as actin were used for reverse transcription-PCR detection.

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

81

Fig. 1. The nuclear translocation of NF-jB. (A) The content of NF-jB p65 in nuclear protein (arrows indicated). The content of nuclear NF-jB p65 increased significantly from the 10 min to 30 min, and peaked at the 20 min for 25 mM high glucose stimulation. P < 0.05 or P < 0.01 vs. the 0 min group. And the content of nuclear NF-jB p65 increased significantly for the high glucose, especially 25 mM glucose, treatments for 20 min. P < 0.05 or P < 0.01 vs. the 5.5 mM group. Data are presented as mean ± SD of three independent experiments. (B) The extracted nucleus. The extracted nucleus was stained with DAPI to show its purity, and only the nucleus was seen. Scale bar was 15 lm. (C) The representative nuclear translocation of NF-jB for 25 mM high glucose stimulation. The NF-jB p65 was scattered in the cytoplasm at 0 min and concentrated in the nucleus at 20 min, but the nuclear NF-jB p65 decreased at 40 min. The nucleus was bule and NF-jB p65 was red. Scale bar was 25 lm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

FeTPPS treatments. Meanwhile, 100 lM SIN-1 could cause NF-jB p65 and p300 nitration with statistical significance. 3.3. Protein nitration enhanced the interaction between NF-jB and p300 The interaction between NF-jB and p300 is largely dependent on the post-translational modifications, such as acetylation and phosphorylation (Deng and Wu, 2003; Granja et al., 2006; Chew et al., 2009). However in diabetes, a predominant change is peroxynitrite-induced protein nitration (DeRubertis et al., 2004). Although in different conditions, the effect of protein nitration on the activity of NF-jB shows disparity, whether protein nitration affects the interaction between NF-jB and p300 in high glucose stimulation has not been clarified. In the study, the co-localization of NF-jB p65 and p300 was detected with laser confocal microscopy (Fig. 3). As manifested, the NF-jB p65 was scattered in the cytoplasm and the co-localization of NF-jB p65 and p300 was hardly seen in the normal glucose group. However, the NF-jB p65 translocated to the nucleus and co-localized obviously with its co-activator p300 in high glucose and SIN-1 groups. And the co-localization of NF-jB p65 and p300 induced by high glucose was weakened notably by FeTPPS treatment. The binding of NF-jB p65 and p300 was further detected by CoIP (Fig. 4). The ratio of co-immunoprecipitated NF-jB p65 or p300

to its protein content was calculated to avoid the effect of protein content on their binding. Similarly, the ratio of NT content to the co-immunoprecipitated NF-jB p65 or p300 was calculated to show the nitration level of NF-jB p65 or p300. The content of co-immunoprecipitated NF-jB p65 and p300 increased significantly in high glucose group, which could be reduced by FeTPPS treatment. Although the content of co-immunoprecipitated NF-jB p65 showed a tendency to increase in SIN-1 group, the content of coimmunoprecipitated p300 increased significantly. Similarly, the nitration level of the co-immunoprecipitated NF-jB p65 and p300 increased significantly in high glucose and SIN-1 groups, and the high glucose induced increase was inhibited by FeTPPS treatment. The results showed that high glucose as well as SIN-1 could promote the binding of NF-jB p65 and p300, and the high glucose-induced binding was attenuated by FeTPPS treatment, consistent with the changes of their nitration level, manifesting that protein nitration induced by high glucose may promote the interaction between NF-jB p65 and p300. 3.4. Protein nitration promoted the binding of NF-jB to the iNOS gene promoter In human iNOS gene promoter, there exist a series of binding sites for NF-jB (Taylor et al., 1998), reflecting the complexity of the regulation of human iNOS gene transcription by NF-jB. In

82

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

Fig. 2. The nitration of NF-jB p65 and its co-activator p300. (A) The content of iNOS for 25 mM high glucose stimulation. The content of iNOS protein was hardly detected at 0 min and 20 min, but was apparent at 30 min and 40 min, permitting the exhibition of its activity to induce protein nitration. (B) Treatment with 25 mM high glucose stimulation for 30 min could induce apparent nitration of nuclear NF-jB p65 and p300, which could both be attenuated by 50 lM and 100 lM FeTPPS. P < 0.01 vs. the 0 lM group. While 100 lM as well as 500 lM SIN-1 treatment for 30 min also caused conspicuous nitration of NF-jB p65 and p300. P < 0.05 or P < 0.01 vs. the 0 lM group. Data are presented as mean ± SD of three independent experiments.

order to investigate their roles in the high glucose stimulated cells, ChIP analysis was adopted to evaluate all the binding sites predicted for NF-jB and the NRE in the human iNOS gene promoter (Fig. 5B). First of all, it was found that in normal glucose, although NFjB hardly bind the sites 8275, 5460 and 115, the binding sites 8414, 6074 and 5212 were routinely occupied by NF-jB. However, after the cells were treated with high glucose for 30 min, nearly all the binding sites occupied by NF-jB increased significantly, except the sites 8414, which had no statistical difference between the control and high glucose groups. Similarly, compared with the control group, treatment with SIN-1 for 30 min also increased the NF-jB binding sites with statistical significance, excluding 8414 and 6074. Meanwhile, the FeTPPS treatment could significantly attenuate the high glucose induced increase of the sites 6074 and 5212. In addition, the NRE 6743 was partly occupied in normal glucose. And high glucose as well as SIN-1 treatment for 30 min increased the occupied NRE 6743 significantly. However, the FeTPPS could not decrease the high glucose induced increase of the NRE 6743. Furthermore, the content of iNOS mRNA (Fig. 5B) showed that it was hardly detected in control group, increased remarkably in high glucose as well as SIN-1 groups, and the high glucose induced increase could be reduced significantly by FeTPPS treatment.

4. Discussion Although the NF-jB-activated iNOS gene transcription plays an important role in the pathogenesis of diabetic complications, the detail mechanism is not fully explained. This study demonstrated that high glucose could induce protein nitration of nuclear NF-rB p65 and p300, which promoted their interaction and the binding of NF-rB to the more important site 5212, further activated the iNOS gene transcription. These findings revealed that protein nitration may promote the NF-jB-activated iNOS gene transcription in high glucose stimulation. The NF-jB has been well established to play a crucial role in diabetic complications (El-Osta et al., 2008; Jiang et al., 2011). The co-activator p300 is thought to serve as a physical ‘‘bridge’’ to form multi-component complexes, initiating the NF-jB activated gene transcription (Guo et al., 2008; Karamouzis et al., 2007). As known, the activity and the interaction of proteins are largely dependent on the post-translational modifications. Then in diabetes, what is responsible for the promoting binding of NFjB and p300 so as to activate the iNOS gene transcription? It’s widely accepted that peroxynitrite plays a crucial role in the pathologic changes in diabetes (Duplain et al., 2008; Vareniuk et al., 2008). The representative change caused by peroxynitrite is to induce protein nitration and alter its structure and functions (Wu and Wilson, 2009; Li et al., 2010).

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

83

Fig. 3. The co-localization of NF-jB p65 and p300 by Confocal detection. The NF-jB p65 was red, the p300 was green, and the yellow in the nucleus (blue) indicated the colocalization of NF-jB p65 and p300. Their co-localization was apparent in high glucose (HG) and SIN-1 groups (arrows indicated), and became weaken in the high glucose plus FeTPPS group for 30 min treatments. Scale bar was 25 lm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 4. The binding of NF-jB p65 and p300 was evaluated by Co-IP. The ratio of co-immunoprecipitated NF-jB p65 or p300 to its protein content (input) was calculated to avoid the effect of protein content on their binding. Similarly, the ratio of NT content to the co-immunoprecipitated NF-jB p65 or p300 was calculated to show the nitration level of NF-jB p65 or p300. The immunoprecipitated NF-jB p65 or p300 increased in the high glucose (HG) and SIN-1 groups. P < 0.05 or P < 0.01 vs. the control group. And the high glucose-induced increase was attenuated by FeTPPS treatment. P < 0.05 or P < 0.01 vs. the HG group. The nitration level of the immunoprecipitated NF-jB p65 or p300 also increased in the HG and SIN-1 groups. P < 0.05 or P < 0.01 vs. the control group. And FeTPPS treatment could reduce the high glucose-induced increase. P < 0.05 vs. the HG group. Data are presented as mean ± SD of three independent experiments.

It was found that high glucose treatment could induce notable iNOS protein synthesis at 30 min, leading to the formation of peroxynitrite and the subsequent protein nitration. Then the

conspicuous nitration of nuclear NF-jB p65 and p300 was found by high glucose stimulation, which was mimicked by peroxynitrite donor SIN-1 and attenuated by its decomposition catalyst FeTPPS.

84

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

Fig. 5. The analysis of NF-jB binding sites and the iNOS mRNA content. (A) The predicted NF-jB binding sites (gray) as well as the NRE (black) scattered in the iNOS gene promoter were illustrated. (B) The changes of all the predicted sites were detected by ChIP for 30 min treatments and the content of iNOS mRNA was evaluated by RT-PCR for 1 h treatments. Nearly all the binding sites and the iNOS mRNA increased significantly in high glucose (HG) and SIN-1 groups. P < 0.05 or P < 0.01 vs. the control group. The FeTPPS treatment could reduce the high glucose-induced increase of the sites 5212, 6074 and the iNOS mRNA. P < 0.05 or P < 0.01 vs. the HG group. Data are presented as mean ± SD of three independent experiments.

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

These results showed that high glucose could induce nitration of the nuclear NF-jB p65 and p300. The interaction between NF-jB and its co-activator p300 was evaluated. We found that high glucose could cause obvious colocalization and enhanced binding of NF-jB p65 and p300, consistent with the conspicuous nitration of the co-immunoprecipitated NF-jB p65 and p300. Similarly, SIN-1 could mimic the effect of high glucose, while FeTPPs attenuated the high glucose induced effect, which verified that high glucose could promote the binding between NF-jB and p300 via protein nitration. In diabetes, NF-jB exhibits its role through the up-regulation of iNOS. Although several NF-jB binding sites in the human iNOS gene promoter have been identified, which sites play a main role in diabetes was unknown. In the study, the 10 kb promoter region upstream the human iNOS gene was analyzed and 9 NF-jB binding sites as well as 1 NRE site were found. All the predicted sites were evaluated by ChIP to investigate their roles in the high glucose stimulated cells. Unexpectedly, the sites 5212, 6074 and 8414 were obviously occupied by NF-jB in normal glucose, revealing their important role in the quick activation of iNOS gene transcription for stimulation. But for high glucose as well as SIN-1 stimulation, nearly all the sites were occupied by NF-jB, showing that they might play a synergistic role to ensure the activation of the iNOS gene transcription. However, FeTPPS treatment only attenuated the increase of the sites 5212 and 6074 induced by high glucose. The results showed that the NF-jB binding site 5212 was routinely occupied partly, and high glucose as well as SIN-1 stimulation increased the occupied site 5212 significantly. FeTPPS could reduce its increase, indicating that the site 5212 might play a more important role in the protein nitration promoted iNOS gene transcription. Although Stat 1 had been reported to inhibit the NF-jB activity via binding to the site 5212 in other conditions (Ganster et al., 2001), it was found that high glucose could promote the NF-jB binding to the site 5212, activating the iNOS gene transcription in this study. In addition, the NRE 6743 exhibited similar changes, suggesting the NRE might play a balanced role for the NF-jB binding sites. Consistent with these findings, the content of the iNOS mRNA was hardly detected in normal glucose cultivation, increased remarkably in high glucose stimulation as well as SIN-1 treatment, and the high glucose induced increase was attenuated significantly by FeTPPS treatment. These results demonstrated that high glucose induced protein nitration played an important role in the promoted iNOS gene transcription. In conclusion, high glucose could induce protein nitration of nuclear NF-rB p65 and p300, which promoted their interaction and the NF-rB binding to the more important site 5212 so as to further activate the iNOS gene transcription. These data identified that protein nitration may promote the NF-jB-activated iNOS gene transcription in high glucose stimulation. Acknowledgments This work was supported by Grants from the Major State Basic Research Development Program of China (973 Program) (2012CB518601), the National Natural Science Foundation of China (81070658), the Hebei Natural Science Foundation (C2009001092 and H2012206005). References Ashall, L., Horton, C.A., Nelson, D.E., Paszek, P., Harper, C.V., Sillitoe, K., Ryan, S., Spiller, D.G., Unitt, J.F., Broomhead, D.S., Kell, D.B., Rand, D.A., Sée, V., White, M.R., 2009. Pulsatile stimulation determines timing and specificity of NFkappaB-dependent transcription. Science 324, 242–246. Azevedo-Martins, A.K., Lortz, S., Lenzen, S., Curi, R., Eizirik, D.L., Tiedge, M., 2003. Improvement of the mitochondrial antioxidant defense status prevents

85

cytokine-induced nuclear factor-kappaB activation in insulin-producing cells. Diabetes 52, 93–101. Bar-Shai, M., Reznick, A.Z., 2006. Peroxynitrite induces an alternative NF-kappaB activation pathway in L8 rat myoblasts. Antioxid. Redox Signal. 8, 639–652. Chew, J., Biswas, S., Shreeram, S., Humaidi, M., Wong, E.T., Dhillion, M.K., Teo, H., Hazra, A., Fang, C.C., López-Collazo, E., Bulavin, D.V., Tergaonkar, V., 2009. WIP1 phosphatase is a negative regulator of NF-kappaB signalling. Nat. Cell Biol. 11, 659–666. Cooke, C.L., Davidge, S.T., 2002. Peroxynitrite increases iNOS through NF-kappaB and decreases prostacyclin synthase in endothelial cells. Am. J. Physiol. Cell Physiol. 282, C395–C402. Das, C., Lucia, M.S., Hansen, K.C., Tyler, J.K., 2009. CBP/p300-mediated acetylation of histone H3 on lysine 56. Nature 459, 113–117. Deng, W.G., Wu, K.K., 2003. Regulation of inducible nitric oxide synthase expression by p300 and p50 acetylation. J. Immunol. 171, 6581–6588. DeRubertis, F.R., Craven, P.A., Melhem, M.F., Salah, E.M., 2004. Attenuation of renal injury in db/db mice overexpressing superoxide dismutase: evidence for reduced superoxide-nitric oxide interaction. Diabetes 53, 762–768. Duplain, H., Sartori, C., Dessen, P., Jayet, P.Y., Schwab, M., Bloch, J., Nicod, P., Scherrer, U., 2008. Stimulation of peroxynitrite catalysis improves insulin sensitivity in high fat diet-fed mice. J. Physiol. 586, 4011–4016. El-Osta, A., Brasacchio, D., Yao, D., Pocai, A., Jones, P.L., Roeder, R.G., Cooper, M.E., Brownlee, M., 2008. Transient high glucose causes persistent epigenetic changes and altered gene expression during subsequent normoglycemia. J. Exp. Med. 205, 2409–2417. Feng, X., Guo, Z., Nourbakhsh, M., Hauser, H., Ganster, R., Shao, L., Geller, D.A., 2002. Identification of a negative response element in the human inducible nitricoxide synthase (hiNOS) promoter: the role of NF-kappa B-repressing factor (NRF) in basal repression of the hiNOS gene. Proc. Natl. Acad. Sci. USA 99, 14212–14217. Fontana, M., Pinnen, F., Lucente, G., Pecci, L., 2002. Prevention of peroxynitritedependent damage by carnosine and related sulphonamido pseudodipeptides. Cell. Mol. Life Sci. 59, 546–551. Ganster, R.W., Taylor, B.S., Shao, L., Geller, D.A., 2001. Complex regulation of human inducible nitric oxide synthase gene transcription by Stat 1 and NF-kappa B. Proc. Natl. Acad. Sci. USA 98, 8638–8643. Gautier, M., Zhang, H., Fearon, I.M., 2008. Peroxynitrite formation mediates LPCinduced augmentation of cardiac late sodium currents. J. Mol. Cell. Cardiol. 44, 241–251. Granja, A.G., Sabina, P., Salas, M.L., Fresno, M., Revilla, Y., 2006. Regulation of inducible nitric oxide synthase expression by viral A238L-mediated inhibition of p65/RelA acetylation and p300 transactivation. J. Virol. 80, 10487–10496. Guo, H., Mi, Z., Kuo, P.C., 2008. Characterization of short range DNA looping in endotoxin-mediated transcription of the murine inducible nitric-oxide synthase (iNOS) gene. J. Biol. Chem. 283, 25209–25217. Jiang, Q., Liu, P., Wu, X., Liu, W., Shen, X., Lan, T., Xu, S., Peng, J., Xie, X., Huang, H., 2011. Berberine attenuates lipopolysaccharide-induced extracelluar matrix accumulation and inflammation in rat mesangial cells: involvement of NF-jB signaling pathway. Mol. Cell. Endocrinol. 331, 34–40. Karamouzis, M.V., Konstantinopoulos, P.A., Papavassiliou, A.G., 2007. Roles of CREBbinding protein (CBP)/p300 in respiratory epithelium tumorigenesis. Cell Res. 17, 324–332. Kaur, H., Chen, S., Xin, X., Chiu, J., Khan, Z.A., Chakrabarti, S., 2006. Diabetes-induced extracellular matrix protein expression is mediated by transcription coactivator p300. Diabetes 55, 3104–3111. Kohr, M.J., Wang, H., Wheeler, D.G., Velayutham, M., Zweier, J.L., Ziolo, M.T., 2008. Targeting of phospholamban by peroxynitrite decreases beta-adrenergic stimulation in cardiomyocytes. Cardiovasc. Res. 77, 353–361. Kubo, E., Singh, D.P., Akagi, Y., 2005. Gene expression profiling of diabetic and galactosaemic cataractous rat lens by microarray analysis. Diabetologia 48, 790–798. Levrand, S., Pesse, B., Feihl, F., Waeber, B., Pacher, P., Rolli, J., Schaller, M.D., Liaudet, L., 2005. Peroxynitrite is a potent inhibitor of NF-{kappa}B activation triggered by inflammatory stimuli in cardiac and endothelial cell lines. J. Biol. Chem. 280, 34878–34887. Li, Y., Qi, J., Liu, K., Li, B., Wang, H., Jia, J., 2010. Peroxynitrite-induced nitration of cyclooxygenase-2 and inducible nitric oxide synthase promotes their binding in diabetic angiopathy. Mol. Med. 16, 335–342. Nambu, H., Kubo, E., Takamura, Y., Tsuzuki, S., Tamura, M., Akagi, Y., 2008. Attenuation of aldose reductase gene suppresses high-glucose-induced apoptosis and oxidative stress in rat lens epithelial cells. Diabetes Res. Clin. Pract. 82, 18–24. Nelson, J.D., Denisenko, O., Bomsztyk, K., 2006. Protocol for the fast chromatin immunoprecipitation (ChIP) method. Nat. Protoc. 1, 179–185. Niedick, I., Froese, N., Oumard, A., Mueller, P.P., Nourbakhsh, M., Hauser, H., Köster, M., 2004. Nucleolar localization and mobility analysis of the NF-kappaB repressing factor NRF. J. Cell. Sci. 117, 3447–3458. Osada, H., Yoshitake, Y., Ikeda, T., Ishigaki, Y., Takata, T., Tomosugi, N., Sasaki, H., Yonekura, H., 2011. Ultraviolet B-induced expression of amphiregulin and growth differentiation factor 15 in human lens epithelial cells. Mol. Vis. 17, 159–169. Park, S.W., Huq, M.D., Hu, X., Wei, L.N., 2005. Tyrosine nitration on p65: a novel mechanism to rapidly inactivate nuclear factor-kappaB. Mol. Cell Proteomics 4, 300–309. Porasuphatana, S., Weaver, J., Rosen, G.M., 2006. Inducible nitric oxide synthase catalyzes ethanol oxidation to alpha-hydroxyethyl radical and acetaldehyde. Toxicology 223, 167–174.

86

Y. Li et al. / Molecular and Cellular Endocrinology 370 (2013) 78–86

Randazzo, J., Zhang, P., Makita, J., Blessing, K., Kador, P.F., 2011. Orally active multifunctional antioxidants delay cataract formation in streptozotocin (type 1) diabetic and gamma-irradiated rats. PLoS ONE 6, e18980. Romagnoli, M., Gomez-Cabrera, M.C., Perrelli, M.G., Biasi, F., Pallardo, F.V., Sastre, J., Poli, G., Vina, J., 2010. Xanthine oxidase-induced oxidative stress causes activation of NF-kappaB and inflammation in the liver of type I diabetic rats. Free Radic. Biol. Med. 49, 171–177. Ruberte, J., Ayuso, E., Navarro, M., Carretero, A., Nacher, V., Haurigot, V., George, M., Llombart, C., Casellas, A., Costa, C., Bosch, A., Bosch, F., 2004. Increased ocular levels of IGF-1 in transgenic mice lead to diabetes-like eye disease. J. Clin. Invest. 113, 1149–1157. Samikkannu, T., Thomas, J.J., Bhat, G.J., Wittman, V., Thekkumkara, T.J., 2006. Acute effect of high glucose on long-term cell growth: a role for transient glucose increase in proximal tubule cell injury. Am. J. Physiol. Renal Physiol. 291, F162– F175. Schildknecht, S., Daiber, A., Ghisla, S., Cohen, R.A., Bachschmid, M.M., 2008. Acetaminophen inhibits prostanoid synthesis by scavenging the PGHSactivator peroxynitrite. FASEB J. 22, 215–224. Tao, L., Jiao, X., Gao, E., Lau, W.B., Yuan, Y., Lopez, B., Christopher, T., RamachandraRao, S.P., Williams, W., Southan, G., Sharma, K., Koch, W., Ma, X.L., 2006. Nitrative inactivation of thioredoxin-1 and its role in postischemic myocardial apoptosis. Circulation 114, 1395–1402.

Tay, S., Hughey, J.J., Lee, T.K., Lipniacki, T., Quake, S.R., Covert, M.W., 2010. Single-cell NF-kappaB dynamics reveal digital activation and analogue information processing. Nature 466, 267–271. Taylor, B.S., de Vera, M.E., Ganster, R.W., Wang, Q., Shapiro, R.A., Morris, S.M., Billiar, T.R., Geller, D.A., 1998. Multiple NF-kappaB enhancer elements regulate cytokine induction of the human inducible nitric oxide synthase gene. J. Biol. Chem. 273, 15148–15156. Teng, X., Zhang, H., Snead, C., Catravas, J.D., 2002. Molecular mechanisms of iNOS induction by IL-1 beta and IFN-gamma in rat aortic smooth muscle cells. Am. J. Physiol. Cell Physiol. 282, C144–C152. Vareniuk, I., Pavlov, I.A., Obrosova, I.G., 2008. Inducible nitric oxide synthase gene deficiency counteracts multiple manifestations of peripheral neuropathy in a streptozotocin-induced mouse model of diabetes. Diabetologia 51, 2126–2133. Wu, F., Wilson, J.X., 2009. Peroxynitrite-dependent activation of protein phosphatase type 2A mediates microvascular endothelial barrier dysfunction. Cardiovasc. Res. 81, 38–45. Zhang, Z., Yuan, W., Sun, L., Szeto, F.L., Wong, K.E., Li, X., Kong, J., Li, Y.C., 2007. 1,25Dihydroxyvitamin D3 targeting of NF-kappaB suppresses high glucose-induced MCP-1 expression in mesangial cells. Kidney Int. 72, 193–201.