- Email: [email protected]
Protein–protein interactions in two potyviruses using the yeast two-hybrid system
Virus Research 142 (2009) 36–40
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Protein–protein interactions in two potyviruses using the yeast two-hybrid system Lin Lin a,b , Yuhong Shi b , Zhaopeng Luo b , Yuwen Lu b , Hongying Zheng b , Fei Yan b , Jiong Chen b , Jianping Chen b,∗ , M.J. Adams c , Yunfeng Wu a a b c
College of Plant Protection, Northwest A & F University, Yangling, Shaanxi 712100, China Department of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China Department of Plant Pathology and Microbiology, Rothamsted Research, Harpenden, Herts AL5 2JQ, UK
a r t i c l e
i n f o
Article history: Received 27 August 2008 Received in revised form 10 December 2008 Accepted 10 January 2009 Available online 2 February 2009 Keywords: Potyvirus SMVP SYSV-O Y2HS Interaction
a b s t r a c t Interactions between all ten mature proteins of the potyviruses Soybean mosaic virus (Pinellia ternata isolate) and Shallot yellow stripe virus were investigated using yeast two-hybrid (Y2H) assays. Consistently strong self-interactions were found between the pairs of HC-Pro, VPg, NIa-Pro, NIb and CP in both viruses. Apart from the NIb, such interactions have been previously reported for some other potyviruses. The 6K1/NIa-Pro combination gave a consistently moderate to strong interaction in both directions for both viruses. This interaction occurred even when the 6K1 of SMV-P was truncated to eliminate the C-terminal motif that acts as a recognition site for cleavage by the NIa-Pro. Many other interactions occurred only in one direction or only for one of the two viruses. When taken together with other published reports, the data suggest that interactions detected by Y2H should be regarded as only preliminary indications. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Viruses of the genus Potyvirus (family Potyviridae) occur throughout the world and cause major diseases on a wide range of crop plants. They have a single-stranded positive-sense RNA genome of up to about 10 kb and this has a strictly conserved organisation consisting of a single large open reading frame that encodes a polyprotein precursor of 340–370 kDa. This is processed by three virus-encoded proteases into 10 mature proteins designated P1, HCPro, P3, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb and CP (capsid protein). Cleavage probably occurs co-translationally because the individual mature proteins, but not the whole polyprotein, can be detected in vivo. However, the different sites are not all processed at the same rate and some intermediate products can be detected (Merits et al., 2002). Most of these proteins are believed to be multifunctional and they play different roles during the virus cycle including aphidtransmission (Blanc et al., 1997, 1998; Plisson et al., 2003), virus replication (Revers et al., 1999; Carrington et al., 1998), cell-to-cell movement (Cronin et al., 1995; Carrington et al., 1998; Kasschau et al., 1997; Kasschau and Carrington, 2001; Rojas et al., 1997) and symptom development (Riechmann et al., 1992; Urcuqui-Inchima et al., 2001). Several interactions between the virus-encoded pro-
teins have been found to be associated with these processes (Blanc et al., 1997, 1998; Rojas et al., 1997; Roudet-Tavert et al., 2002). In recent years, yeast two-hybrid (Y2H) screens have been widely used to investigate interactions between viral proteins (Fields and Song, 1989; Guo et al., 2008). Within the genus Potyvirus, experiments with different viruses have not always given similar results but the HC-Pro peptide has been shown to interact with itself in Soybean mosaic virus (SMV) (Kang et al., 2004), Clover yellow vein virus (ClYVV) (Yambao et al., 2003), Potato virus A (PVA) and Pea seed-borne mosaic virus (PSbMV) (Guo et al., 2001). Heterologous interactions have also been reported especially between NIb and NIa in ClYVV (Yambao et al., 2003), Zucchini yellow mosaic virus (Lee et al., 2002), PVA and PSbMV (Guo et al., 2001). We now report Y2H studies of the interactions between all the (ten) mature viral proteins of two potyviruses. The viruses used both occur in China but are not closely related to one another and infect different host plants. The Pinellia isolate of SMV (SMV-P) occurs widely in aroid plants in China (Chen et al., 2004; Shi et al., 2005) whereas Shallot stripe yellow virus (SYSV) has a worldwide distribution in onion and related plants (Chen et al., 2003, 2005; Luo et al., 2007). 2. Materials and methods
∗ Corresponding author. E-mail address: [email protected] (J. Chen). 0168-1702/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.01.006
Yeast two-hybrid tests were performed using the Matchmaker Two-Hybrid System 3 (Clontech, Mountain View, USA) according
L. Lin et al. / Virus Research 142 (2009) 36–40
37
Table 1 Primers used to amplify the different genes from the Pinellia isolate of Soybean mosaic virus. Restriction sites introduced to aid cloning are underlined. Primer
Nucleotide sequence (5 to 3 )
Enzyme
pYTHS-SMVP-P1(+) pYTHS-SMVP-P1(−) pYTHS-SMVP-HC-Pro(+) pGAD-SMVP-HC-Pro(−) pGBK-SMVP-HC-Pro(−) pYTHS-SMVP-P3(+) pYTHS-SMVP-P3(−) Pyths-SMVP-6K1(+) pYTHS-SMVP-6K1(−) pYTHS-SMVP-CI(+) pYTHS-SMVP-CI(−) pYTHS-SMVP-6K2(+) pYTHS-SMVP-6K2(−) pYTHS-SMVP-VPg(+) pYTHS-SMVP-VPg(−) pYTHS-SMVP-NIa-Pro(+) pYTHS-SMVP-NIa-Pro(−) pYTHS-SMVP-NIb(+) pYTHS-SMVP-NIb(−) pYTHS-SMVP-CP(+) pYTHS-SMVP-CP(−)
CGGAATTCGCTAGCATTATGATTGGGTC CGGGATCCAAATTGAACAATTTGGTGAAGTG CCCATGGAGTCAAAGACTCCAGAAGCTCA AATCGATACCAACCCTATAGAATTTCAT GGTCGACACCAACCCTATAGAATTTCAT CGGAATTCGGTGAAGTGCAGCAGAGG CGGGATCCCTGCACAGAAACATCCTC CGGAATTCACCAAAACAGCCATTCAATTG CGGGATCCTTGTGCTCTGACATCCTCG CATGCCATGGAGAGCCTTGATGAAGTTCAGAA CGGAATTCCAGTTGCACTGCGTTGAC CGGAATTCAGTAAGCACGAGATCAGTAA CGGGATCCTTGAGTTGTGACTGGCTCTC CGGAATTCGGGAAGAAGAGACAGACAC AACTGCAGTTCCATCTCAACTCTCTCTTTA CGGAATTCAGCAAGTCTGTGTACAAAGG CGGGATCCCACTGCTACTGTGTCCCC CGGGATCCGTAGTAGAAAAGAGAGATGGGTT AACTGCAGTTGCAAAGCGACCGATTCGC CGGAATTCTCAGGGAAAGAGACAGGTG CGGGATCCGCATGGGTCCGCTACAG
EcoRI BamHI NcoI ClaI SalI EcoRI BamHI EcoRI BamHI NcoI EcoRI EcoRI BamHI EcoRI PstI EcoRI BamHI BamHI PstI EcoRI BamHI
to the manufacturer’s protocols. Yeast (Saccharomyces cerevisiae) strains AH109 or Y187 were used to determine protein–protein interactions. The GAL4 DNA binding domain (BD) vector pGBKT7 and the activation domain (AD) vector pGADT7 were used throughout. PCR primers (Tables 1 and 2) were designed from the complete genome sequences of SMV-P (AJ507388; Chen et al., 2004) and SYSV-O (AM267479; Luo et al., 2007) and used to amplify each gene of both viruses from purified virus using LaTaq DNA polymerase (Takara). The PCR products were initially cloned into pGEM-T vector (Promega) and then, after verifying the sequence, they were digested and ligated into the yeast fusion vectors pGADT7 and pGBKT7. These plasmids were then transformed into S. cerevisiae AH109 using Gene pulser (Bio-Rad Ltd.) with conditions of 2.5 kV, 25 F and 200 , then plated on SD/-Try or SD/-Leu medium (Clontech) and grown at 30 ◦ C. Colonies >1 mm in diameter were tested for the presence of the inserted viral gene by PCR. To verify expression of the desired gene in the transformed yeast, total yeast proteins were extracted by the urea/SDS method after growth on selective medium with the appropriate antibiotic. All protein
Expected product (bp) 990 1371 1041 156 1902 159 570 729 1551 864
extracts were analyzed by 12% SDS-PAGE and transferred to nitrocellulose membrane. Western blot was then done using c-Myc monoclonal and HA-Tag polyclonal antibodies (Clontech). Checks were done with all constructs to confirm that the reporter gene was not self-activated. The small-scale LiAc transformation method was used to transform pairs of constructs simultaneously into yeast which was then grown on SD/-Try/-Leu medium for 3–7 days at 30 ◦ C. Colonies 2–3 mm in diameter were transferred to 1 ml SD/-Ade/-His/-Leu/Trp liquid medium and grown for 1–3 days with shaking at 30 ◦ C. If the yeast grew, it was plated to solid SD/-Ade/-His/-Leu/-Try/X␣-Gal medium and grown for 3–5 days at 30 ◦ C. Blue colonies were considered as positive clones. Murine p53 and SV40 large T-antigen are known to interact in Y2H assays and were used as positive controls. Lamin C, which does not form complexes and does not interact with most other proteins (Fields and Song, 1989; Guo et al., 2008), was expressed from pGBKT7-lam as a negative control for any fortuitous interaction between an unrelated protein and either the pGADT7-T control or DNA-AD plasmids.
Table 2 Primers used to amplify the different genes from Shallot yellow stripe virus. Restriction sites introduced to aid cloning are underlined. Primer
Nucleotide sequence (5 to 3 )
Enzyme
pYTHS-SYSV(O)-P1(+) pYTHS-SYSV(O)-P1(−) pYTHS-SYSV(O)-HC-Pro(+) pYTHS-SYSV(O)-HC-Pro(−) pYTHS-SYSV(O)-P3(+) pGBKT7-SYSV(O)-P3(−) pGADT7-SYSV(O)-P3(−) pYTHS-SYSV(O)-6K1(+) pYTHS-SYSV(O)-6K1(−) pYTHS-SYSV(O)-CI(+) pGADT7-SYSV(O)-CI(−) pGBKT7-SYSV(O)-CI(−) pYTHS-SYSV(O)-6K2(+) pYTHS-SYSV(O)-6K2(−) pYTHS-SYSV(O)-VPg(+) pYTHS-SYSV(O)-VPg(−) pYTHS-SYSV(O)-NIa-Pro(+) pYTHS-SYSV(O)-NIa-Pro(−) pYTHS-SYSV(O)-NIb(+) pYTHS-SYSV(O)-NIb(−) pYTHS-SYSV(O)-CP(+) pGADT7-SYSV(O)-CP(−) pGBKT7-SYSV(O)-CP(−)
GGAATTCATGCTGAAACAAAAGAACCATA GGGATCCGATAATGATCTACGTCTTTTAGGTC GGAATTCTCGGATTCAGAGATTGCGCTAA GGGATCCGTCCAACATTATACATGTTCATTT GCCATGGAGGGTAGGCAAGCACCAATTCA CGTCGACTTGGTATTCAACGCCAATGTAA CCTCGAGTTGGTATTCAACGCCAATGTAA GGAATTC GCAAAGTCACAGTCTGAAGTTA GGGATCCGTTGGTAATGAACATCCGTTGTTG CCATATGGCACTGGACTCTCCGGATGA GCTCGAGGATTGATACTCAACTGCAGAAACC CCTGCAGGTTGATACTCAACTGCAGAAACC GGAATTCACGAAAGAACAACTTTCAAAAGG GGGATCCGCTGATAATGCACTTTTGATTCCA GGAATTCGCAAAGTCTAGAAGACGACTT GGGATCCGCTCATATGCAACCTCATAAACT GGAATTCGCAAAATCGCTTTGTTCAGGA GGGATCCGCTGAAATGCGACTCCGTTGAT CCATATGGCACAGGATTACACATGGTTG GGGATCCCTTGATACGATACGTAACTTGGT GGGATCCATGTATCAGAGACAGAAGATGCTGCA CCTCGAGCATTACATACGAAGACCGAGCA CCTGCAGGATTACATACGAAGACCGAGCA
EcoRI BamHI EcoRI BamHI NcoI SalI XhoI EcoRI BamHI NdeI EcoRI PstI EcoRI BamHI EcoRI BamHI EcoRI BamHI NdeI BamHI BamHI XhoI PstI
Expected product (bp) 1224 1377 1536 150 1911 159 609 726 1554 778
38
L. Lin et al. / Virus Research 142 (2009) 36–40
Initial results suggested that the small 6K1 protein (rarely examined in previously published work) interacted with the NIa-Pro. The 6K1 protein is known to be cleaved from the polyprotein by the NIa-Pro and this involves recognition of a conserved motif (VXXQ) at the C-terminus (Riechmann et al., 1992; Chen, 2001; Tözsér et al., 2005). To detect whether the interaction between 6K1 and NIa-Pro occurs at this motif, a construct (D6K1) containing a truncated form of the 6K1 protein of SMV-P was also prepared and used in experiments. This lacks the 12 nucleotides encoding the motif VRAQ at the C terminus of the protein. 3. Results All fusion proteins of both viruses were expressed in yeast at detectable levels (Fig. 1). None of the plasmids was able to autonomously activate the reporter gene and no interactions with the vector or with the Lamin C control were detected. Thus these recombinant plasmids were suitable for use in Y2H. For each virus, each combination of viral proteins was tested at least three times in both directions and the results are summarized in Table 3. Negative results were recorded if colonies grew on the SD/-Ade/-His/-Leu/-Trp-x-␣-gal plates but did not become blue or if the two target genes could not be detected by PCR from blue colonies. Many positive interactions were detected at different levels of intensity. Consistently moderate to strong self-interactions were found between the pairs of HC-Pro, CI, VPg, NIa-Pro, NIb and CP in both viruses. Amongst the combinations of different genes, only 6K1/NIa-Pro gave a consistently moderate to strong interaction in both directions for both viruses. This interaction also occurred in SMV-P using the truncated D6K1 form of the 6K1 either as bait or prey. The AD/BD interactions were also moderate to strong for both viruses with 6K1/NIa-Pro, 6K2/VPg, VPg/NIb and NIb/NIa-Pro. The P1 and P3 proteins of SYSV-O interacted with several other SYSV-O proteins, but those from SMV-P had fewer, or no interactions. In contrast, the NIb of SMV-P showed many interactions while that of SYSV-O had fewer.
Fig. 1. Western blot analysis confirming the expression of the AD and BD fusion proteins from SMV-P and SYSV-O in yeast strain AH109. (A) AD fusions of SYSV-O proteins detected with HA-Tag polyclonal antibody. (B) BD fusions of SYSV-O proteins with c-Myc monoclonal antibody. (C) BD fusions of SMV-P proteins with c-Myc monoclonal antibody. Note that AD fusions of SMV-P proteins with HA-Tag polyclonal antibody have been reported previously (Shi et al., 2007). Lane M contains the size marker proteins and C is the AD or BD control.
Additional tests were done with both viruses to test the interactions between the HC-Pro and each of the proteins of the other virus. These heterologous virus combinations provide a form of control because the two viruses are not closely related and do not infect a common host. Any interactions detected would therefore probably be non-specific and certainly of no direct biological significance. Of the 38 combinations, interactions were detected in only the three (AD/BD) combinations SMV-HC-Pro/SYSV-NIa-Pro (weak), SYSV-HC-Pro/SMV-NIa-Pro (moderate) and SYSV-HC-Pro/SMV-NIb (moderate).
4. Discussion There are several previous reports of complete potyvirus Y2H interaction matrices (Guo et al., 2001; Yambao et al., 2003; Kang et al., 2004), but in no case were all the fusion proteins detected by Western blot and most did not examine the small proteins 6K1 and 6K2. In our experiments, the pGBKT7 and pGADT7 gave high levels of expression of all proteins and help to provide a more complete picture. Guo et al. (2001) suggested that some interactions showed directionality. For example, interactions between the P3 and NIa-Pro of PSbMV were detected only when these proteins were expressed in fusion with BD and AD, respectively. Our data show many examples of directionality in the interactions between pairs of proteins if only one virus was considered but the same combination of proteins in the other virus did not show the same effect. Guo et al., suggested that protein fusions in one direction may have more favorable protein folding or exposure of binding sites than those in the other direction but it seems best to treat such examples with some caution. There is no particular reason to expect interactions between the proteins of the two viruses that are not closely related and which do not have any known common host. The fact that 2/38 combinations gave moderate interactions may give some indication of the level of non-specific interactions in these experiments. Our results confirm the HC-Pro self-interaction consistently reported for other potyviruses (Urcuqui-Inchima et al., 1999; Guo et al., 2001; Yambao et al., 2003; Kang et al., 2004). It is also consistent with previous biochemical data indicating that the protein is present as a homodimer in its role facilitating aphid transmission (Urcuqui-Inchima et al., 1999). We also found self-interactions similar to those reported previously in some viruses for the VPg protein (Hong et al., 1995; Fellers et al., 1998; Guo et al., 2001; Yambao et al., 2003) and also for the NIa-Pro and CP (Li et al., 1997; Guo et al., 2001; Kang et al., 2004). A potentially significant and novel finding in our experiments was the consistently strong 6K1/NIa-Pro interaction in both directions and for both viruses. This activity was retained in a slightly truncated form of the SMV-P protein showing that it was not simply associated with the cleavage activity of NIa-Pro. It therefore seems probable that an interaction between these two viral proteins is also significant in the process of virus infection. Most of the published experiments have not tested for interactions involving the 6K1 protein and the role of this protein is not very well understood. It has been suggested that both 6K proteins might play a role in potyvirus RNA replication together with VPg (Riechmann et al., 1992). 6K1 localizes to the cell periphery but, unlike 6K2 (Restrepo-Hartwig and Carrington, 1994), it is not a recognized transmembrane protein (Hong et al., 2007). NIa-Pro has been better studied but mostly for its role in polyprotein cleavage or as part of a 6K2-VPg-Pro precursor, in which form it interacts with the translation eukaryotic initiation factor iso 4E (eIF(iso)4E) and is located in cytoplasmic vesicles embedded in the endoplasmic reticulum(ER) (Léonard et al., 2004; Beauchemin et al., 2007). The possible role of 6K1 in viral replication is clearly worthy of further investigation.
L. Lin et al. / Virus Research 142 (2009) 36–40
39
Table 3 Protein–protein interactions detected in Y2H assays between the viral proteins of (a) SMV-P and (b) SYSV-O.
+++, Strong: More than fifty colonies appeared and turned deep blue in <1 day. ++, Moderate: more than twenty colonies appeared and turned blue in <1 day. +, Weak: less than twenty colonies appeared and turned light blue in <1 day. −, None: no colonies appeared even after 7 days.
In other respects, it is difficult to find consistent patterns between the published data (and between them and our data) supporting the possibility of important functional interactions. While it is possible that there might be different interactions in different viruses (or in different hosts), the basic elements of the viral life cycles are likely to be similar given the conserved genetic organization within potyviruses. Although Y2H assays have proved powerful and informative, it is clear that they are insufficiently reliable on their own for elucidating viral protein–protein interactions and other methods of looking for such interactions may give different results (e.g. Merits et al., 1999). These assays therefore provide useful indications that now need investigation using other techniques that can examine interactions in the more natural conditions of infected plant cells. Acknowledgements Lin Lin is a student registered at Northwest A & F University for the degree of PhD. This work was done at Department of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences and was funded by grants from Chinese 973 Program (2006CB708209), the National Natural Foundation of China (30470080, 30771404) and International Science and Technology Cooperation Project of Ministry of Science and Technology of China (2007DFB30350). Rothamsted Research receives grant-aided support from the Biotechnology and Biological Sciences Research Council of the United Kingdom.
References Beauchemin, C., Boutet, N., Laliberté, J.F., 2007. Visualization of the interaction between the precursors of VPg, the viral protein linked to the genome of turnip mosaic virus, and the translation eukaryotic initiation factor iso 4E in Planta. J. Virol. 81, 775–782. Blanc, S., Lopez-Moya, J.J., Wang, R., Garcia-Lampasona, S., Thornbury, D.W., Pirone, T.P., 1997. A specific interaction between coat protein and helper component correlates with aphid transmission of a potyvirus. Virology 231, 141–147. Blanc, S., Ammar, E.D., Garcia-Lampasona, S., Dolja, V.V., Llave, C., Baker, J., Pirone, T.P., 1998. Mutations in the potyvirus helper component protein: effects on interactions with virions and aphid stylets. J. Gen. Virol. 79, 3119–3122. Carrington, J.C., Jensen, P.E., Schaad, M.C., 1998. Genetic evidence for an essential role for potyvirus CI protein in cell to cell movement. Plant J. 14, 393–400. Chen, J., 2001. Molecular characterization and genomic study of some filamentous plant viruses in China. Ph.D. Thesis. Zhejiang University. Chen, J., Adams, M.J., Zheng, H.-Y., Chen, J.P., 2003. Sequence analysis demonstrates that Onion yellow dwarf virus isolates from China contain a P3 region much larger than other potyviruses. Arch. Virol. 148, 1165–1173. Chen, J., Zheng, H.Y., Lin, L., Adams, M.J., Antoniw, J.F., Zhao, M.F., Shang, Y.F., Chen, J.P., 2004. A virus related to Soybean mosaic virus from Pinellia ternata in China and its comparison with local soybean SMV isolates. Arch. Virol. 149, 349–363. Chen, J., Wei, C.B., Zheng, H.Y., Shi, Y.H., Adams, M.J., Lin, L., Zhang, Q.Y., Wang, S.J., Chen, J.P., 2005. Characterisation of the welsh onion isolate of Shallot yellow stripe virus from China. Arch. Virol. 150, 2091–2099. Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M.C., Carrington, J.C., 1995. Long-distance movement factor: a transport function of the potyvirus helper component proteinase. Plant Cell 7, 549–559. Fellers, J., Wan, J., Hong, Y., Collins, G.B., Hunt, A.G., 1998. In vitro interactions between a potyvirus-encoded, genome-linked protein and RNA-dependent RNA polymerase. J. Gen. Virol. 79, 2043–2049. Fields, S., Song, O., 1989. A novel genetic system to detect protein–protein interactions. Nature 340, 245–246.
40
L. Lin et al. / Virus Research 142 (2009) 36–40
Guo, D., Rajamäki, M.L., Saarma, M., Valkonen, J.P., 2001. Towards a protein interaction map of potyviruses: protein interaction matrixes of two potyviruses based on the yeast two-hybrid system. J. Gen. Virol. 82, 935–939. Guo, D., Rajamäki, M.L., Valkonen, J., 2008. Protein–protein interactions: the yeast two-hybrid system. Methods Mol. Biol. 451, 421–439. Hong, Y., Levay, K., Murphy, J.F., Klein, P.G., Shaw, J.G., Hun, A.G., 1995. A potyvirus polymerase interacts with the viral coat protein and VPg in yeast cells. Virology 214, 159–166. Hong, X.Y., Chen, J., Shi, Y.H., Chen, J.P., 2007. The ‘6K1’ protein of a strain of Soybean mosaic virus localizes to the cell periphery. Arch. Virol. 152, 1547–1551. Kang, S.H., Lim, W.S., Kim, K.H., 2004. A protein interaction map of soybean mosaic virus strain G7H based on the yeast two-hybrid system. Mol. Cells 18, 122–126. Kasschau, K.D., Carrington, J.C., 2001. Long-distance movement and replication maintenance functions correlate with silencing suppression activity of potyviral HC-Pro. Virology 285, 71–81. Kasschau, K.D., Cronin, S., Carrington, J.C., 1997. Genome amplification and longdistance movement functions associated with the central domain of tobacco etch potyvirus helper component—proteinase. Virology 228, 251–262. Lee, K.C., Lin, S.S., Yeh, S.D., Wong, S.M., 2002. TI Interactions between nuclear inclusion protein a (NIa) and nuclear inclusion protein b (NIb) of Zucchini yellow mosaic virus and Papaya ringspot virus. Plant Pathol. Bull. 11, 79–86. Léonard, S., Viel, C., Beauchemin, C., Daigneault, N., Fortin, M.G., Laliberté, J.F., 2004. Interaction of VPg-Pro of turnip mosaic virus with the translation initiation factor 4E and the poly(A)-binding protein in planta. J. Gen. Virol. 85, 1055–1063. Li, X.H., Valdez, P., Olvera, R.E., Carrington, J.C., 1997. Functions of the tobacco etch virus RNA polymerase (NIb): subcellular transport and protein–protein interaction with VPg/proteinase (NIa). J. Virol. 71, 1598–1607. Luo, Z.P., Lin, L., Chen, J., Wu, Y.F., Chen, J.P., 2007. Full-length sequence analysis of shallot yellow stripe virus from onion in Shaanxi Province. Chin. J. Virol. 23, 157–160. Merits, A., Guo, D., Jarvekulg, L., Saarma, M., 1999. Biochemical and genetic evidence for interactions between potato A potyvirus-encoded proteins P1 and P3 and proteins of the putative replication complex. Virology 263, 15–22. Merits, A., Rajamäki, M.L., Lindholm, P., Runeberg-Roos, P., Kekarainen, T., Puustinen, P., Mäkeläinen, K., Valkonen, J.P., Saarma, M., 2002. Proteolytic processing of potyviral proteins and polyprotein processing intermediates in insect and plant cells. J. Gen. Virol. 83, 1211–1221.
Plisson, C., Drucker, M., Blanc, S., German-Retana, S., Le Gall, O., Thomas, D., Bron, P., 2003. Structural characterization of HC-Pro, a plant virus multifunctional protein. J. Biol. Chem. 278, 23753–23761. Restrepo-Hartwig, M.A., Carrington, J.C., 1994. The tobacco etch Potyvirus 6kilodalton protein is membrane associated and involved in viral replication. J. Virol. 68, 2388–2397. Revers, F., Le Gall, O., Candresse, T., Maule, A.J., 1999. New advances in understanding the molecular biology of plant/potyvirus interaction. Mol. Plant-Microbe Interact. 12, 367–376. Riechmann, J.L., Lain., S., Garcia, J.A., 1992. Highlights and prospects of potyvirus molecular biology. J. Gen. Virol. 73, 1–16. Rojas, M.R., Zerbini, M.M., Allison, R.F., Gilbertson, R.L., Lucal, W., 1997. Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins. Virology 237, 283–295. Roudet-Tavert, G., German-Rerana, S., Delaunay, T., Delecolle, B., Candresse, T., Le Gall, O., 2002. Interaction between potyvirus helper component-proteinase and capsid protein in infected plants. J. Gen. Virol. 83, 1765–1770. Shi, Y.H., Hong, X.Y., Chen, J., Adams, M.J., Zheng, H.Y., Lin, L., Qin, B.X., Chen, J.P., 2005. Further molecular characterization of potyviruses infecting aroid plants for medicinal use in China. Arch. Virol. 150, 125–135. Shi, Y.H., Chen, J., Hong, X.Y., Chen, J.P., Adams, M.J., 2007. A potyvirus P1 protein interacts with the Rieske Fe/S protein of its host. Mol. Plant Pathol. 8, 785–790. Tözsér, J., Tropea, J.E., Cherry, S., Bagossi, P., Copeland, T.D., Wlodawer, A., Waugh, D.S., 2005. Comparison of the substrate specificity of two potyvirus proteases. FEBS J. 272, 514–523. Urcuqui-Inchima, S., Walter, J., Drugeon, G., German-Retana, S., Haenni, A.L., Candresse, T., Bernardi, F., Le Gall, O., 1999. Potyvirus helper component-proteinase self-interaction in the yeast two-hybrid system and delineation of the interaction domain involved. Virology 258, 95–99. Urcuqui-Inchima, S., Haenni, A.L., Bernardi, F., 2001. Potyvirus proteins: a wealth of functions. Virus Res. 74, 157–175. Yambao, M.L., Masuta, C., Nakahara, K., Uyeda, I., 2003. The central and C-terminal domains of VPg of Clover yellow vein virus are important for VPg-HCPro and VPg-VPg interactions. J. Gen. Virol. 84, 2861–2869.
Contents lists available at ScienceDirect
Virus Research journal homepage: www.elsevier.com/locate/virusres
Protein–protein interactions in two potyviruses using the yeast two-hybrid system Lin Lin a,b , Yuhong Shi b , Zhaopeng Luo b , Yuwen Lu b , Hongying Zheng b , Fei Yan b , Jiong Chen b , Jianping Chen b,∗ , M.J. Adams c , Yunfeng Wu a a b c
College of Plant Protection, Northwest A & F University, Yangling, Shaanxi 712100, China Department of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China Department of Plant Pathology and Microbiology, Rothamsted Research, Harpenden, Herts AL5 2JQ, UK
a r t i c l e
i n f o
Article history: Received 27 August 2008 Received in revised form 10 December 2008 Accepted 10 January 2009 Available online 2 February 2009 Keywords: Potyvirus SMVP SYSV-O Y2HS Interaction
a b s t r a c t Interactions between all ten mature proteins of the potyviruses Soybean mosaic virus (Pinellia ternata isolate) and Shallot yellow stripe virus were investigated using yeast two-hybrid (Y2H) assays. Consistently strong self-interactions were found between the pairs of HC-Pro, VPg, NIa-Pro, NIb and CP in both viruses. Apart from the NIb, such interactions have been previously reported for some other potyviruses. The 6K1/NIa-Pro combination gave a consistently moderate to strong interaction in both directions for both viruses. This interaction occurred even when the 6K1 of SMV-P was truncated to eliminate the C-terminal motif that acts as a recognition site for cleavage by the NIa-Pro. Many other interactions occurred only in one direction or only for one of the two viruses. When taken together with other published reports, the data suggest that interactions detected by Y2H should be regarded as only preliminary indications. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Viruses of the genus Potyvirus (family Potyviridae) occur throughout the world and cause major diseases on a wide range of crop plants. They have a single-stranded positive-sense RNA genome of up to about 10 kb and this has a strictly conserved organisation consisting of a single large open reading frame that encodes a polyprotein precursor of 340–370 kDa. This is processed by three virus-encoded proteases into 10 mature proteins designated P1, HCPro, P3, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb and CP (capsid protein). Cleavage probably occurs co-translationally because the individual mature proteins, but not the whole polyprotein, can be detected in vivo. However, the different sites are not all processed at the same rate and some intermediate products can be detected (Merits et al., 2002). Most of these proteins are believed to be multifunctional and they play different roles during the virus cycle including aphidtransmission (Blanc et al., 1997, 1998; Plisson et al., 2003), virus replication (Revers et al., 1999; Carrington et al., 1998), cell-to-cell movement (Cronin et al., 1995; Carrington et al., 1998; Kasschau et al., 1997; Kasschau and Carrington, 2001; Rojas et al., 1997) and symptom development (Riechmann et al., 1992; Urcuqui-Inchima et al., 2001). Several interactions between the virus-encoded pro-
teins have been found to be associated with these processes (Blanc et al., 1997, 1998; Rojas et al., 1997; Roudet-Tavert et al., 2002). In recent years, yeast two-hybrid (Y2H) screens have been widely used to investigate interactions between viral proteins (Fields and Song, 1989; Guo et al., 2008). Within the genus Potyvirus, experiments with different viruses have not always given similar results but the HC-Pro peptide has been shown to interact with itself in Soybean mosaic virus (SMV) (Kang et al., 2004), Clover yellow vein virus (ClYVV) (Yambao et al., 2003), Potato virus A (PVA) and Pea seed-borne mosaic virus (PSbMV) (Guo et al., 2001). Heterologous interactions have also been reported especially between NIb and NIa in ClYVV (Yambao et al., 2003), Zucchini yellow mosaic virus (Lee et al., 2002), PVA and PSbMV (Guo et al., 2001). We now report Y2H studies of the interactions between all the (ten) mature viral proteins of two potyviruses. The viruses used both occur in China but are not closely related to one another and infect different host plants. The Pinellia isolate of SMV (SMV-P) occurs widely in aroid plants in China (Chen et al., 2004; Shi et al., 2005) whereas Shallot stripe yellow virus (SYSV) has a worldwide distribution in onion and related plants (Chen et al., 2003, 2005; Luo et al., 2007). 2. Materials and methods
∗ Corresponding author. E-mail address: [email protected] (J. Chen). 0168-1702/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.virusres.2009.01.006
Yeast two-hybrid tests were performed using the Matchmaker Two-Hybrid System 3 (Clontech, Mountain View, USA) according
L. Lin et al. / Virus Research 142 (2009) 36–40
37
Table 1 Primers used to amplify the different genes from the Pinellia isolate of Soybean mosaic virus. Restriction sites introduced to aid cloning are underlined. Primer
Nucleotide sequence (5 to 3 )
Enzyme
pYTHS-SMVP-P1(+) pYTHS-SMVP-P1(−) pYTHS-SMVP-HC-Pro(+) pGAD-SMVP-HC-Pro(−) pGBK-SMVP-HC-Pro(−) pYTHS-SMVP-P3(+) pYTHS-SMVP-P3(−) Pyths-SMVP-6K1(+) pYTHS-SMVP-6K1(−) pYTHS-SMVP-CI(+) pYTHS-SMVP-CI(−) pYTHS-SMVP-6K2(+) pYTHS-SMVP-6K2(−) pYTHS-SMVP-VPg(+) pYTHS-SMVP-VPg(−) pYTHS-SMVP-NIa-Pro(+) pYTHS-SMVP-NIa-Pro(−) pYTHS-SMVP-NIb(+) pYTHS-SMVP-NIb(−) pYTHS-SMVP-CP(+) pYTHS-SMVP-CP(−)
CGGAATTCGCTAGCATTATGATTGGGTC CGGGATCCAAATTGAACAATTTGGTGAAGTG CCCATGGAGTCAAAGACTCCAGAAGCTCA AATCGATACCAACCCTATAGAATTTCAT GGTCGACACCAACCCTATAGAATTTCAT CGGAATTCGGTGAAGTGCAGCAGAGG CGGGATCCCTGCACAGAAACATCCTC CGGAATTCACCAAAACAGCCATTCAATTG CGGGATCCTTGTGCTCTGACATCCTCG CATGCCATGGAGAGCCTTGATGAAGTTCAGAA CGGAATTCCAGTTGCACTGCGTTGAC CGGAATTCAGTAAGCACGAGATCAGTAA CGGGATCCTTGAGTTGTGACTGGCTCTC CGGAATTCGGGAAGAAGAGACAGACAC AACTGCAGTTCCATCTCAACTCTCTCTTTA CGGAATTCAGCAAGTCTGTGTACAAAGG CGGGATCCCACTGCTACTGTGTCCCC CGGGATCCGTAGTAGAAAAGAGAGATGGGTT AACTGCAGTTGCAAAGCGACCGATTCGC CGGAATTCTCAGGGAAAGAGACAGGTG CGGGATCCGCATGGGTCCGCTACAG
EcoRI BamHI NcoI ClaI SalI EcoRI BamHI EcoRI BamHI NcoI EcoRI EcoRI BamHI EcoRI PstI EcoRI BamHI BamHI PstI EcoRI BamHI
to the manufacturer’s protocols. Yeast (Saccharomyces cerevisiae) strains AH109 or Y187 were used to determine protein–protein interactions. The GAL4 DNA binding domain (BD) vector pGBKT7 and the activation domain (AD) vector pGADT7 were used throughout. PCR primers (Tables 1 and 2) were designed from the complete genome sequences of SMV-P (AJ507388; Chen et al., 2004) and SYSV-O (AM267479; Luo et al., 2007) and used to amplify each gene of both viruses from purified virus using LaTaq DNA polymerase (Takara). The PCR products were initially cloned into pGEM-T vector (Promega) and then, after verifying the sequence, they were digested and ligated into the yeast fusion vectors pGADT7 and pGBKT7. These plasmids were then transformed into S. cerevisiae AH109 using Gene pulser (Bio-Rad Ltd.) with conditions of 2.5 kV, 25 F and 200 , then plated on SD/-Try or SD/-Leu medium (Clontech) and grown at 30 ◦ C. Colonies >1 mm in diameter were tested for the presence of the inserted viral gene by PCR. To verify expression of the desired gene in the transformed yeast, total yeast proteins were extracted by the urea/SDS method after growth on selective medium with the appropriate antibiotic. All protein
Expected product (bp) 990 1371 1041 156 1902 159 570 729 1551 864
extracts were analyzed by 12% SDS-PAGE and transferred to nitrocellulose membrane. Western blot was then done using c-Myc monoclonal and HA-Tag polyclonal antibodies (Clontech). Checks were done with all constructs to confirm that the reporter gene was not self-activated. The small-scale LiAc transformation method was used to transform pairs of constructs simultaneously into yeast which was then grown on SD/-Try/-Leu medium for 3–7 days at 30 ◦ C. Colonies 2–3 mm in diameter were transferred to 1 ml SD/-Ade/-His/-Leu/Trp liquid medium and grown for 1–3 days with shaking at 30 ◦ C. If the yeast grew, it was plated to solid SD/-Ade/-His/-Leu/-Try/X␣-Gal medium and grown for 3–5 days at 30 ◦ C. Blue colonies were considered as positive clones. Murine p53 and SV40 large T-antigen are known to interact in Y2H assays and were used as positive controls. Lamin C, which does not form complexes and does not interact with most other proteins (Fields and Song, 1989; Guo et al., 2008), was expressed from pGBKT7-lam as a negative control for any fortuitous interaction between an unrelated protein and either the pGADT7-T control or DNA-AD plasmids.
Table 2 Primers used to amplify the different genes from Shallot yellow stripe virus. Restriction sites introduced to aid cloning are underlined. Primer
Nucleotide sequence (5 to 3 )
Enzyme
pYTHS-SYSV(O)-P1(+) pYTHS-SYSV(O)-P1(−) pYTHS-SYSV(O)-HC-Pro(+) pYTHS-SYSV(O)-HC-Pro(−) pYTHS-SYSV(O)-P3(+) pGBKT7-SYSV(O)-P3(−) pGADT7-SYSV(O)-P3(−) pYTHS-SYSV(O)-6K1(+) pYTHS-SYSV(O)-6K1(−) pYTHS-SYSV(O)-CI(+) pGADT7-SYSV(O)-CI(−) pGBKT7-SYSV(O)-CI(−) pYTHS-SYSV(O)-6K2(+) pYTHS-SYSV(O)-6K2(−) pYTHS-SYSV(O)-VPg(+) pYTHS-SYSV(O)-VPg(−) pYTHS-SYSV(O)-NIa-Pro(+) pYTHS-SYSV(O)-NIa-Pro(−) pYTHS-SYSV(O)-NIb(+) pYTHS-SYSV(O)-NIb(−) pYTHS-SYSV(O)-CP(+) pGADT7-SYSV(O)-CP(−) pGBKT7-SYSV(O)-CP(−)
GGAATTCATGCTGAAACAAAAGAACCATA GGGATCCGATAATGATCTACGTCTTTTAGGTC GGAATTCTCGGATTCAGAGATTGCGCTAA GGGATCCGTCCAACATTATACATGTTCATTT GCCATGGAGGGTAGGCAAGCACCAATTCA CGTCGACTTGGTATTCAACGCCAATGTAA CCTCGAGTTGGTATTCAACGCCAATGTAA GGAATTC GCAAAGTCACAGTCTGAAGTTA GGGATCCGTTGGTAATGAACATCCGTTGTTG CCATATGGCACTGGACTCTCCGGATGA GCTCGAGGATTGATACTCAACTGCAGAAACC CCTGCAGGTTGATACTCAACTGCAGAAACC GGAATTCACGAAAGAACAACTTTCAAAAGG GGGATCCGCTGATAATGCACTTTTGATTCCA GGAATTCGCAAAGTCTAGAAGACGACTT GGGATCCGCTCATATGCAACCTCATAAACT GGAATTCGCAAAATCGCTTTGTTCAGGA GGGATCCGCTGAAATGCGACTCCGTTGAT CCATATGGCACAGGATTACACATGGTTG GGGATCCCTTGATACGATACGTAACTTGGT GGGATCCATGTATCAGAGACAGAAGATGCTGCA CCTCGAGCATTACATACGAAGACCGAGCA CCTGCAGGATTACATACGAAGACCGAGCA
EcoRI BamHI EcoRI BamHI NcoI SalI XhoI EcoRI BamHI NdeI EcoRI PstI EcoRI BamHI EcoRI BamHI EcoRI BamHI NdeI BamHI BamHI XhoI PstI
Expected product (bp) 1224 1377 1536 150 1911 159 609 726 1554 778
38
L. Lin et al. / Virus Research 142 (2009) 36–40
Initial results suggested that the small 6K1 protein (rarely examined in previously published work) interacted with the NIa-Pro. The 6K1 protein is known to be cleaved from the polyprotein by the NIa-Pro and this involves recognition of a conserved motif (VXXQ) at the C-terminus (Riechmann et al., 1992; Chen, 2001; Tözsér et al., 2005). To detect whether the interaction between 6K1 and NIa-Pro occurs at this motif, a construct (D6K1) containing a truncated form of the 6K1 protein of SMV-P was also prepared and used in experiments. This lacks the 12 nucleotides encoding the motif VRAQ at the C terminus of the protein. 3. Results All fusion proteins of both viruses were expressed in yeast at detectable levels (Fig. 1). None of the plasmids was able to autonomously activate the reporter gene and no interactions with the vector or with the Lamin C control were detected. Thus these recombinant plasmids were suitable for use in Y2H. For each virus, each combination of viral proteins was tested at least three times in both directions and the results are summarized in Table 3. Negative results were recorded if colonies grew on the SD/-Ade/-His/-Leu/-Trp-x-␣-gal plates but did not become blue or if the two target genes could not be detected by PCR from blue colonies. Many positive interactions were detected at different levels of intensity. Consistently moderate to strong self-interactions were found between the pairs of HC-Pro, CI, VPg, NIa-Pro, NIb and CP in both viruses. Amongst the combinations of different genes, only 6K1/NIa-Pro gave a consistently moderate to strong interaction in both directions for both viruses. This interaction also occurred in SMV-P using the truncated D6K1 form of the 6K1 either as bait or prey. The AD/BD interactions were also moderate to strong for both viruses with 6K1/NIa-Pro, 6K2/VPg, VPg/NIb and NIb/NIa-Pro. The P1 and P3 proteins of SYSV-O interacted with several other SYSV-O proteins, but those from SMV-P had fewer, or no interactions. In contrast, the NIb of SMV-P showed many interactions while that of SYSV-O had fewer.
Fig. 1. Western blot analysis confirming the expression of the AD and BD fusion proteins from SMV-P and SYSV-O in yeast strain AH109. (A) AD fusions of SYSV-O proteins detected with HA-Tag polyclonal antibody. (B) BD fusions of SYSV-O proteins with c-Myc monoclonal antibody. (C) BD fusions of SMV-P proteins with c-Myc monoclonal antibody. Note that AD fusions of SMV-P proteins with HA-Tag polyclonal antibody have been reported previously (Shi et al., 2007). Lane M contains the size marker proteins and C is the AD or BD control.
Additional tests were done with both viruses to test the interactions between the HC-Pro and each of the proteins of the other virus. These heterologous virus combinations provide a form of control because the two viruses are not closely related and do not infect a common host. Any interactions detected would therefore probably be non-specific and certainly of no direct biological significance. Of the 38 combinations, interactions were detected in only the three (AD/BD) combinations SMV-HC-Pro/SYSV-NIa-Pro (weak), SYSV-HC-Pro/SMV-NIa-Pro (moderate) and SYSV-HC-Pro/SMV-NIb (moderate).
4. Discussion There are several previous reports of complete potyvirus Y2H interaction matrices (Guo et al., 2001; Yambao et al., 2003; Kang et al., 2004), but in no case were all the fusion proteins detected by Western blot and most did not examine the small proteins 6K1 and 6K2. In our experiments, the pGBKT7 and pGADT7 gave high levels of expression of all proteins and help to provide a more complete picture. Guo et al. (2001) suggested that some interactions showed directionality. For example, interactions between the P3 and NIa-Pro of PSbMV were detected only when these proteins were expressed in fusion with BD and AD, respectively. Our data show many examples of directionality in the interactions between pairs of proteins if only one virus was considered but the same combination of proteins in the other virus did not show the same effect. Guo et al., suggested that protein fusions in one direction may have more favorable protein folding or exposure of binding sites than those in the other direction but it seems best to treat such examples with some caution. There is no particular reason to expect interactions between the proteins of the two viruses that are not closely related and which do not have any known common host. The fact that 2/38 combinations gave moderate interactions may give some indication of the level of non-specific interactions in these experiments. Our results confirm the HC-Pro self-interaction consistently reported for other potyviruses (Urcuqui-Inchima et al., 1999; Guo et al., 2001; Yambao et al., 2003; Kang et al., 2004). It is also consistent with previous biochemical data indicating that the protein is present as a homodimer in its role facilitating aphid transmission (Urcuqui-Inchima et al., 1999). We also found self-interactions similar to those reported previously in some viruses for the VPg protein (Hong et al., 1995; Fellers et al., 1998; Guo et al., 2001; Yambao et al., 2003) and also for the NIa-Pro and CP (Li et al., 1997; Guo et al., 2001; Kang et al., 2004). A potentially significant and novel finding in our experiments was the consistently strong 6K1/NIa-Pro interaction in both directions and for both viruses. This activity was retained in a slightly truncated form of the SMV-P protein showing that it was not simply associated with the cleavage activity of NIa-Pro. It therefore seems probable that an interaction between these two viral proteins is also significant in the process of virus infection. Most of the published experiments have not tested for interactions involving the 6K1 protein and the role of this protein is not very well understood. It has been suggested that both 6K proteins might play a role in potyvirus RNA replication together with VPg (Riechmann et al., 1992). 6K1 localizes to the cell periphery but, unlike 6K2 (Restrepo-Hartwig and Carrington, 1994), it is not a recognized transmembrane protein (Hong et al., 2007). NIa-Pro has been better studied but mostly for its role in polyprotein cleavage or as part of a 6K2-VPg-Pro precursor, in which form it interacts with the translation eukaryotic initiation factor iso 4E (eIF(iso)4E) and is located in cytoplasmic vesicles embedded in the endoplasmic reticulum(ER) (Léonard et al., 2004; Beauchemin et al., 2007). The possible role of 6K1 in viral replication is clearly worthy of further investigation.
L. Lin et al. / Virus Research 142 (2009) 36–40
39
Table 3 Protein–protein interactions detected in Y2H assays between the viral proteins of (a) SMV-P and (b) SYSV-O.
+++, Strong: More than fifty colonies appeared and turned deep blue in <1 day. ++, Moderate: more than twenty colonies appeared and turned blue in <1 day. +, Weak: less than twenty colonies appeared and turned light blue in <1 day. −, None: no colonies appeared even after 7 days.
In other respects, it is difficult to find consistent patterns between the published data (and between them and our data) supporting the possibility of important functional interactions. While it is possible that there might be different interactions in different viruses (or in different hosts), the basic elements of the viral life cycles are likely to be similar given the conserved genetic organization within potyviruses. Although Y2H assays have proved powerful and informative, it is clear that they are insufficiently reliable on their own for elucidating viral protein–protein interactions and other methods of looking for such interactions may give different results (e.g. Merits et al., 1999). These assays therefore provide useful indications that now need investigation using other techniques that can examine interactions in the more natural conditions of infected plant cells. Acknowledgements Lin Lin is a student registered at Northwest A & F University for the degree of PhD. This work was done at Department of Virology and Biotechnology, Zhejiang Academy of Agricultural Sciences and was funded by grants from Chinese 973 Program (2006CB708209), the National Natural Foundation of China (30470080, 30771404) and International Science and Technology Cooperation Project of Ministry of Science and Technology of China (2007DFB30350). Rothamsted Research receives grant-aided support from the Biotechnology and Biological Sciences Research Council of the United Kingdom.
References Beauchemin, C., Boutet, N., Laliberté, J.F., 2007. Visualization of the interaction between the precursors of VPg, the viral protein linked to the genome of turnip mosaic virus, and the translation eukaryotic initiation factor iso 4E in Planta. J. Virol. 81, 775–782. Blanc, S., Lopez-Moya, J.J., Wang, R., Garcia-Lampasona, S., Thornbury, D.W., Pirone, T.P., 1997. A specific interaction between coat protein and helper component correlates with aphid transmission of a potyvirus. Virology 231, 141–147. Blanc, S., Ammar, E.D., Garcia-Lampasona, S., Dolja, V.V., Llave, C., Baker, J., Pirone, T.P., 1998. Mutations in the potyvirus helper component protein: effects on interactions with virions and aphid stylets. J. Gen. Virol. 79, 3119–3122. Carrington, J.C., Jensen, P.E., Schaad, M.C., 1998. Genetic evidence for an essential role for potyvirus CI protein in cell to cell movement. Plant J. 14, 393–400. Chen, J., 2001. Molecular characterization and genomic study of some filamentous plant viruses in China. Ph.D. Thesis. Zhejiang University. Chen, J., Adams, M.J., Zheng, H.-Y., Chen, J.P., 2003. Sequence analysis demonstrates that Onion yellow dwarf virus isolates from China contain a P3 region much larger than other potyviruses. Arch. Virol. 148, 1165–1173. Chen, J., Zheng, H.Y., Lin, L., Adams, M.J., Antoniw, J.F., Zhao, M.F., Shang, Y.F., Chen, J.P., 2004. A virus related to Soybean mosaic virus from Pinellia ternata in China and its comparison with local soybean SMV isolates. Arch. Virol. 149, 349–363. Chen, J., Wei, C.B., Zheng, H.Y., Shi, Y.H., Adams, M.J., Lin, L., Zhang, Q.Y., Wang, S.J., Chen, J.P., 2005. Characterisation of the welsh onion isolate of Shallot yellow stripe virus from China. Arch. Virol. 150, 2091–2099. Cronin, S., Verchot, J., Haldeman-Cahill, R., Schaad, M.C., Carrington, J.C., 1995. Long-distance movement factor: a transport function of the potyvirus helper component proteinase. Plant Cell 7, 549–559. Fellers, J., Wan, J., Hong, Y., Collins, G.B., Hunt, A.G., 1998. In vitro interactions between a potyvirus-encoded, genome-linked protein and RNA-dependent RNA polymerase. J. Gen. Virol. 79, 2043–2049. Fields, S., Song, O., 1989. A novel genetic system to detect protein–protein interactions. Nature 340, 245–246.
40
L. Lin et al. / Virus Research 142 (2009) 36–40
Guo, D., Rajamäki, M.L., Saarma, M., Valkonen, J.P., 2001. Towards a protein interaction map of potyviruses: protein interaction matrixes of two potyviruses based on the yeast two-hybrid system. J. Gen. Virol. 82, 935–939. Guo, D., Rajamäki, M.L., Valkonen, J., 2008. Protein–protein interactions: the yeast two-hybrid system. Methods Mol. Biol. 451, 421–439. Hong, Y., Levay, K., Murphy, J.F., Klein, P.G., Shaw, J.G., Hun, A.G., 1995. A potyvirus polymerase interacts with the viral coat protein and VPg in yeast cells. Virology 214, 159–166. Hong, X.Y., Chen, J., Shi, Y.H., Chen, J.P., 2007. The ‘6K1’ protein of a strain of Soybean mosaic virus localizes to the cell periphery. Arch. Virol. 152, 1547–1551. Kang, S.H., Lim, W.S., Kim, K.H., 2004. A protein interaction map of soybean mosaic virus strain G7H based on the yeast two-hybrid system. Mol. Cells 18, 122–126. Kasschau, K.D., Carrington, J.C., 2001. Long-distance movement and replication maintenance functions correlate with silencing suppression activity of potyviral HC-Pro. Virology 285, 71–81. Kasschau, K.D., Cronin, S., Carrington, J.C., 1997. Genome amplification and longdistance movement functions associated with the central domain of tobacco etch potyvirus helper component—proteinase. Virology 228, 251–262. Lee, K.C., Lin, S.S., Yeh, S.D., Wong, S.M., 2002. TI Interactions between nuclear inclusion protein a (NIa) and nuclear inclusion protein b (NIb) of Zucchini yellow mosaic virus and Papaya ringspot virus. Plant Pathol. Bull. 11, 79–86. Léonard, S., Viel, C., Beauchemin, C., Daigneault, N., Fortin, M.G., Laliberté, J.F., 2004. Interaction of VPg-Pro of turnip mosaic virus with the translation initiation factor 4E and the poly(A)-binding protein in planta. J. Gen. Virol. 85, 1055–1063. Li, X.H., Valdez, P., Olvera, R.E., Carrington, J.C., 1997. Functions of the tobacco etch virus RNA polymerase (NIb): subcellular transport and protein–protein interaction with VPg/proteinase (NIa). J. Virol. 71, 1598–1607. Luo, Z.P., Lin, L., Chen, J., Wu, Y.F., Chen, J.P., 2007. Full-length sequence analysis of shallot yellow stripe virus from onion in Shaanxi Province. Chin. J. Virol. 23, 157–160. Merits, A., Guo, D., Jarvekulg, L., Saarma, M., 1999. Biochemical and genetic evidence for interactions between potato A potyvirus-encoded proteins P1 and P3 and proteins of the putative replication complex. Virology 263, 15–22. Merits, A., Rajamäki, M.L., Lindholm, P., Runeberg-Roos, P., Kekarainen, T., Puustinen, P., Mäkeläinen, K., Valkonen, J.P., Saarma, M., 2002. Proteolytic processing of potyviral proteins and polyprotein processing intermediates in insect and plant cells. J. Gen. Virol. 83, 1211–1221.
Plisson, C., Drucker, M., Blanc, S., German-Retana, S., Le Gall, O., Thomas, D., Bron, P., 2003. Structural characterization of HC-Pro, a plant virus multifunctional protein. J. Biol. Chem. 278, 23753–23761. Restrepo-Hartwig, M.A., Carrington, J.C., 1994. The tobacco etch Potyvirus 6kilodalton protein is membrane associated and involved in viral replication. J. Virol. 68, 2388–2397. Revers, F., Le Gall, O., Candresse, T., Maule, A.J., 1999. New advances in understanding the molecular biology of plant/potyvirus interaction. Mol. Plant-Microbe Interact. 12, 367–376. Riechmann, J.L., Lain., S., Garcia, J.A., 1992. Highlights and prospects of potyvirus molecular biology. J. Gen. Virol. 73, 1–16. Rojas, M.R., Zerbini, M.M., Allison, R.F., Gilbertson, R.L., Lucal, W., 1997. Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins. Virology 237, 283–295. Roudet-Tavert, G., German-Rerana, S., Delaunay, T., Delecolle, B., Candresse, T., Le Gall, O., 2002. Interaction between potyvirus helper component-proteinase and capsid protein in infected plants. J. Gen. Virol. 83, 1765–1770. Shi, Y.H., Hong, X.Y., Chen, J., Adams, M.J., Zheng, H.Y., Lin, L., Qin, B.X., Chen, J.P., 2005. Further molecular characterization of potyviruses infecting aroid plants for medicinal use in China. Arch. Virol. 150, 125–135. Shi, Y.H., Chen, J., Hong, X.Y., Chen, J.P., Adams, M.J., 2007. A potyvirus P1 protein interacts with the Rieske Fe/S protein of its host. Mol. Plant Pathol. 8, 785–790. Tözsér, J., Tropea, J.E., Cherry, S., Bagossi, P., Copeland, T.D., Wlodawer, A., Waugh, D.S., 2005. Comparison of the substrate specificity of two potyvirus proteases. FEBS J. 272, 514–523. Urcuqui-Inchima, S., Walter, J., Drugeon, G., German-Retana, S., Haenni, A.L., Candresse, T., Bernardi, F., Le Gall, O., 1999. Potyvirus helper component-proteinase self-interaction in the yeast two-hybrid system and delineation of the interaction domain involved. Virology 258, 95–99. Urcuqui-Inchima, S., Haenni, A.L., Bernardi, F., 2001. Potyvirus proteins: a wealth of functions. Virus Res. 74, 157–175. Yambao, M.L., Masuta, C., Nakahara, K., Uyeda, I., 2003. The central and C-terminal domains of VPg of Clover yellow vein virus are important for VPg-HCPro and VPg-VPg interactions. J. Gen. Virol. 84, 2861–2869.