- Email: [email protected]
PTP1B antisense-treated mice show regulation of genes involved in lipogenesis in liver and fat
Molecular and Cellular Endocrinology 203 (2003) 155 /168 www.elsevier.com/locate/mce
PTP1B antisense-treated mice show regulation of genes involved in lipogenesis in liver and fat Jeffrey F. Waring *, Rita Ciurlionis, Jill E. Clampit, Sherry Morgan, Rebecca J. Gum, Robert A. Jolly 1, Paul Kroeger, Leigh Frost, James Trevillyan, Bradley A. Zinker, Michael Jirousek 2, Roger G. Ulrich 3, Cristina M. Rondinone Abbott Laboratories, 100 Abbott Park Road, Abbott Park, IL 60064-6123, USA Received 21 October 2002; accepted 23 December 2002
Abstract Protein tyrosine phosphatases are important regulators of insulin signal transduction. Our studies have shown that in insulin resistant and diabetic ob /ob and db /db mice, reducing the levels of protein tyrosine phosphatase 1B (PTP1B) protein by treatment with a PTP1B antisense oligonucleotide resulted in improved insulin sensitivity and normalized plasma glucose levels. The mechanism by which PTP1B inhibition improves insulin sensitivity is not fully understood. We have used microarray analysis to compare gene expression changes in adipose tissue, liver and muscle of PTP1B antisense-treated ob /ob mice. Our results show that treatment with PTP1B antisense resulted in the downregulation of genes involved in lipogenesis in both fat and liver, and a downregulation of genes involved in adipocyte differentiation in fat, suggesting that PTP1B antisense acts through a different mechanism than thiazolidinedione (TZD) treatment. In summary, microarray results suggest that reduction of PTP1B may alleviate hyperglycemia and enhance insulin sensitivity by a different mechanism than TZD treatment. # 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Microarray; Diabetes; PTP1B; Antisense; ob /ob mice; Lipogenesis
1. Introduction Type 2 diabetes is a polygenic disease affecting over 100 million people worldwide. Affected patients manifest insulin resistance, hyperinsulinemia, and hyperglycemia (Reaven, 1988). The molecular mechanism underlying the insulin resistance is not well understood but appears to involve a defect in the post-insulin receptor (IR) signal transduction pathway (Olefsky et al., 1988). The IR is a receptor tyrosine kinase, and the
* Corresponding author. Address: Department of Cellular and Molecular Toxicology, Abbott Laboratories R463, Abbott Park, IL 60064-6104, USA. Tel.: /1-847-935-4124; fax: /1-847-935-7845. E-mail address: [email protected] (J.F. Waring). 1 Present address: Lilly Research Labs, 2001 West Main Street, Greenfield, IN 46140, USA. 2 Present address: Pfizer Global R&D, 10770 Science Center Drive, San Diego, CA 92121-1187, USA. 3 Present address: Rosetta Inpharmatics, 12040 115th Avenue NE, Kirkland, WA 98034, USA.
binding of insulin to its receptor results in autophosphorylation of the IR and tyrosyl phosphorylation of IR substrate proteins (Czech and Corvera, 1999; Kao et al., 1997; Olefsky, 1999; White, 1998). Protein tyrosine kinases and protein tyrosine phosphatases are important regulators of insulin signal transduction. Much attention has been focused on protein tyrosine phosphatase 1B (PTP1B), which inhibits insulin phosphorylation of the IR and insulin receptor substrates (Goldstein et al., 2000; Kenner et al., 1996; Kennedy and Ramachandran, 2000). Mice deficient in PTP1B expression have increased insulin sensitivity and low adiposity with resistance to weight gain on a high fat diet. In addition, the mice show increased basal metabolic rate and total energy expenditure (Elchebly et al., 1999; Klaman et al., 2000). Thus, while it is clear that PTP1B plays a role in insulin sensitivity and glucose homeostasis, the molecular mechanism of how the protein may act in diabetes is not understood. Recently, microarray technology has been applied to study the regulation of genes in diabetic mouse models
0303-7207/03/$ - see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0303-7207(03)00008-X
156
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
(Nadler et al., 2000; Soukas et al., 2000). In two separate cases, researchers showed that in adipose tissue from ob / ob mice, which have a missense mutation in the gene encoding leptin, the pattern of gene expression was the reverse of the pattern observed during adipocyte differentiation. This suggests that adipocytes from ob /ob mice have decreased lipogenic capacity, similar to preadipocytes (Nadler and Attie, 2001). The lack of lipogenic adipocytes in ob /ob mice results in a shift of lipogenesis from adipose tissue to the liver, resulting in hepatic steatosis and the upregulation of genes in the liver such as sterol response element binding protein 1 (SREBP-1), fatty acid synthase, ATP-citrate lyase and malic enzyme (Shimomura et al., 1999). Soukas et al. (2000) obtained similar results concerning the regulation of genes involved in lipid metabolism of adipocytes from ob /ob versus lean mice. The results also showed a downregulation of genes that have been shown to be upregulated in adipocyte differentiation. In addition, gene expression changes were characterized when ob /ob mice were treated with leptin, a hormone produced in adipocytes which functions in satiety and regulation of adipose tissue mass (Friedman and Halaas, 1998). Microarray results showed that treatment with leptin caused a further downregulation of some of the genes involved in lipid metabolism such as fatty acid synthase, while normalizing others (Soukas et al., 2000). Previous studies have suggested that leptin activates a program that reverses differentiation in adipocytes (Zhou et al., 1999). The insulin-sensitizing class of drugs known as thiazolidinediones (TZD) are ligands for the peroxisome proliferator activated receptor gamma (PPARg). These compounds have been shown to cause adipocyte differentiation. The adipocyte differentiation, in the absence of increased energy storage, would produce more fat cells of smaller average size, which are more sensitive to insulin-dependent glucose uptake (as reviewed in (Spiegelman, 1998)). We have treated ob /ob mice with an antisense oligonucleotide (ASO, ISIS-113715) directed specifically against PTP1B mRNA. Antisense technology offers a powerful method to study gene function in an organism without the potential developmental issues inherent with using knockout mice. Treatment of ob /ob mice with ISIS-113715 led to a decrease in mRNA and protein expression and resulted in improved insulin sensitivity and normalized plasma glucose levels (Zinker et al., 2002; Rondinone et al., 2002). In order to better understand the function of PTP1B in insulin regulation and glucose homeostasis, we have utilized oligonucleotide microarrays to characterize the response to ISIS-113715 treatment in ob /ob mice. Gene expression changes from mice treated with ISIS-113715 were compared to saline-treated controls in adipose tissue, liver and muscle. The results demonstrate that
treatment with ISIS-113715 resulted in a downregulation of genes involved in lipogenesis in both liver and adipose tissue. Histopathological examination of livers from ob/ob mice treated with ISIS-113715 showed a marked reduction in lipid accumulation. In addition, PTP1B antisense treatment resulted in a downregulation of genes involved in adipocyte differentiation, strongly suggesting that ISIS-113715 acts by a different mechanism than TZDs. These data suggest PTP1B improved insulin sensitivity in ob /ob mice without causing an increase in adipocyte mass as seen in some cases with TZD therapy, and suggest that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes.
2. Experimental animals The following investigations were conducted in accordance with each institution’s IACUC guidelines and were conducted in accord with accepted standards of humane animal care.
3. Materials and methods 3.1. Identification of ASO inhibitors Rapid throughput screens for identifying ASO inhibitors selective against PTP1B were performed with 20-base chimeric ASOs where the first five bases and last five bases have a 2?-O -(2-methoxy)-ethyl (2?MOE) modification. The 2?MOE modification increases binding affinity to complementary RNA sequences and increases resistance to nucleases (Dean et al., 2001). The ASO oligonucleotides have a phosphorothiorate backbone and use an RNase H dependent mechanism for activity. Initial screens were conducted against rat PTP1B and ten ASOs were identified as hits, all of which targeted the same region within the coding sequences of the PTP1B mRNA. Subsequently, a series of in vitro characterization experiments were performed in primary rat and mouse hepatocytes, in which ISIS-113715 was consistently identified to be the most potent and specific oligonucleotide in reducing PTP1B mRNA levels. ISIS113715 hybridizes to PTP1B mRNA at nucleotides 862/ 882 in the coding sequence. 3.2. Animal care and treatments ob /ob mice and their lean littermates of 6 /7 weeks of age (Jackson Laboratories, Bar Harbor, ME) were acclimated to the animal research facilities for 5 days. The following investigations were conducted in accordance with each institution IACUC guidelines. Animals were housed (5 per cage, ob /ob , C57BL/6J-Lepob; 4 per
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
cage, db /db , C57BLKS/J-m ///Leprdb; 2 per cage lean littermates) and maintained on mouse chow (ob/ob Labdiets #5015, St. Louis, MO; db/db Harlan /Teklad rodent diet #8604 Madison, WI; 26% fat calories) ad libitum. After acclimation the ob /ob and lean mice were weighed and tail snip glucose levels were determined by the glucose oxidase method (Precision G glucose meter, Abbott Laboratories, North Chicago, IL). The animals were randomized to the various treatment groups based on plasma glucose levels and body weight. Baseline plasma insulin samples were taken from a subset of the animals representing each treatment group once randomized (n /10 ob /ob and n /10 lean littermates; ELISA, ALPCO Diagnostics, Windham, NH). Treatment groups were: ob/ob PTP1B ASO 25 mg/kg, 2.5, 0.25 and saline (n/10/treatment) for 6 week. All mice were dosed i.p. twice/week. A scrambled ASO oligonucleotide treated group of ob/ob mice was run as a negative control. The dosing and treatment of the ob / ob mice has been previously described (Zinker et al., 2002). At the end of the studies, liver, epididymal fat pads and skeletal muscle were harvested and frozen immediately in liquid nitrogen for further analysis. 3.3. Histopathology Three saline control and three PTP1B ASO treated mice were utilized for histopathologic examination. Sections of liver, brain, lung, spleen, pancreas, myocardium, skeletal muscle, sciatic nerve, eye, kidney, and bone marrow were harvested at necropsy and fixed in 10% neutral buffered formalin for 24/48 h. The specimens were then dehydrated through graded alcohols, and embedded in paraffin wax. Five-micron sections were cut and stained with hematoxylin and eosin. 3.4. Tissue extraction and RNA isolation RNA preparation was done by grinding approximately 100 mg of liver, muscle or adipose tissue in 1 ml of TRIzol reagent and analysis was done according to the Affymetrix Inc. protocol. The integrity of the RNA was confirmed using an Agilent 2100 Bioanalyzer (data not shown). Briefly, the RNA from four mice in PTP1B ASO-treated or control groups was pooled using equal amounts to make a total of 20 mg of RNA. cDNA was prepared using the Superscript Choice system from Gibco BRL Life Technologies (Cat. No. 18090-019). The protocol was followed with the exception that the primer used for the reverse transcription reaction was a modified T7 primer with 24 thymidines at the 5? end. The sequence was: 5?GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT)24-3?. Following this, labeled cRNA was synthesized according to the manufacturers instructions from the cDNA using
157
the Enzo RNA Transcript Labeling Kit (Cat. No. 900182). Approximately 20 mg of cRNA was then fragmented in a solution of 40 mM Tris-acetate, pH 8.1, 100 mM KOAc, and 30 mM MgOAc at 94 8C for 35 min.
3.5. Microarray analysis Labeled cRNA was hybridized to the AFFYMETRIX Test2 Array to verify the quality of labeled cRNA. Following this, cRNA was hybridized to the Affymetrix MU11K A and B chip for all treatments of muscle and liver and for fat treated at 25 mg/kg. The MU-U74 V.2 chip was used for fat treated at 2.5 and the 25 mg/kg treatment done on the MU11K A and B was repeated on the MU-U74 V.2 chip. The cRNA was hybridized overnight at 45 8C. The data was analyzed using AFFYMETRIX GENECHIP Version 3.2 software and Rosetta Resolver Gene Expression Data Analysis System.
GENECHIP
3.6. Real time PCR analysis Real time PCR was performed using the Taqman† EZ RT-PCR Core Reagents kit (Perkin Elmer Part Number N808-0236). For the analysis, 100 ng of total RNA was used. The reactions were done in triplicate. The probe sequences for fatty acid synthetase and Spot 14 have been reported previously (Rondinone et al., 2002). The probe sequences for adipsin were: GCAGTCGAAGGTGTGGTTACGT */Forward Probe CTCGCGTCTGTGGCAATGGCAA */Taqman Probe GGGTATAGACGCCCGGCTT */Reverse Probe The probe sequences for plasminogen activator inhibitor-1 (PAI-1) were: CTCCACAGCCTTTGTCATCTCA */Forward Probe CATGGCCCCCACGGAGATGGTT */Taqman Probe GTGCCGAACCACAAAGAGAAA */Reverse Probe The probe sequences for p85 were: GCGAAACCGTTGAAATGCATAA */Forward Probe TGCAAACACTGCCCCCCAAACC */Taqman Probe GTTGTTGGCTACAGTAGTGGGCTT */Reverse Probe
158
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
4. Results 4.1. PTP1B ASO treatment normalizes blood glucose and insulin levels in ob/ob mice In a 6-week study, ob /ob mice were treated with ISIS113715 in a dose response study at 25, 2.5 and 0.25 mg/ kg twice per week. We have shown that treatment with PTP1B antisense reduced the levels of PTP1B mRNA and protein (Zinker et al., 2002). Fig. 1A and B show the western blotting analysis of the levels of PTP1B in both fat and liver at 25 and 2.5 mg/kg. The western blots show a clear reduction in the protein level of PTP1B at both 25 and 2.5 mg/kg in both adipose and liver. No change in PTP1B protein levels was seen in muscle (Zinker et al., 2002). In addition, quantitative PCR analysis showed a reduction in PTP1B message. Treatment of ob /ob mice using a scrambled oligonucleotide showed no effect on PTP1B mRNA or protein levels (Zinker et al., 2002). Plasma glucose levels were normal-
ized to lean (ob//) levels in the 25 mg/kg treatment groups, and plasma glucose levels were improved in the 2.5 mg/kg treatment group. Plasma insulin levels were decreased 77% in the 25 mg/kg treatment group. In addition, an enhanced reduction in glucose level occurred during an insulin tolerance test with ASO treatment. Epididymal fat weight was reduced 42 and 17% in animals treated at 25 and 2.5 mg/kg, respectively, compared to saline-treated controls (Zinker et al., 2002). 4.2. PTP1B ASO treatment results in a downregulation of genes involved in lipogenesis and gluconeogenesis in the liver In genetically obese animals research has shown that in the liver and muscle, the expression of many lipogenic genes increase as a result of lipid storage being shifted to the liver (Nadler and Attie, 2001). Fig. 2 shows a heat map of gene expression changes in the liver and muscle from ob/ob mice treated with PTP1B ASO compared to
Fig. 1. (A and B), Western blots showing the levels of PTP1B protein in ob /ob liver (A) and fat (B) in saline treated- or mice treated with 2.5 or 25 mg/kg of PTP1B antisense. The graphs show quantitative levels of PTP1B protein relative to saline-treated controls.
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
159
Fig. 1 (Continued)
saline-treated controls. The results show that several genes that are involved in lipogenesis such as SREBP, ATP-citrate lyase, Spot 14 and malic enzyme are downregulated in the liver with PTP1B ASO treatment. In agreement with this, histopathology findings showed reduced levels of lipid in livers from ob /ob mice treated with PTP1B ASO. Fig. 3 depicts the difference in histologically detectable hepatocellular lipid accumulation in the livers of ob /ob mice treated with PTP1B ASO compared to saline control mice. Saline-treated mice consistently exhibited marked diffuse hepatocellular lipid accumulation whereas PTP1B ASO treated mice exhibited mild, or occasionally moderate focal to multifocal hepatocellular lipid accumulation. Although it has been shown that lipogenesis can also shift to muscle in genetically obese animals, similar gene changes were not seen in muscle. Microarray analysis shows that the expression of two genes involved in gluconeogenesis, phosphoenolpyruvate carboxykinase (PEPCK) and fructose-1,6-bisphosphatase are downregulated in livers of ob /ob mice with high-dose treatment of PTP1B ASO.
4.3. Reduction of PTP1B mRNA results in decreased expression of genes involved in lipogenesis and adipocyte differentiation in fat cells RNA was harvested from white adipose tissue (WAT) from saline or PTP1B ASO-treated mice. RNA was pooled from the different treatment groups and hybridized to the Affymetrix MG-U74 v2 microarray chip. The results from the 25 mg/kg treatment group were repeated for confirmation. Fig. 4 shows some of the gene expression changes seen with 6 weeks of PTP1B ASO treatment at 25 and 2.5 mg/kg. Many of the genes that produce changes in expression were shown to be differentially expressed in adipose tissue between ob /ob and lean mice such as Spot 14, adipsin, retinol-binding protein and malic enzyme (Nadler et al., 2000). These genes have also been shown to be upregulated during adipocyte differentiation (Cornelius et al., 1994). In fact, the microarray results show that approximately half of the genes shown to be regulated during adipocyte differentiation were regulated in the opposite manner with PTP1B ASO treatment. This is in contrast to
160
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 2. Graph showing some of the gene expression changes in liver and muscle from ob /ob mice treated with PTP1B ASO relative to liver and muscle from saline-treated control mice. The results in liver are from mice treated with ASO at 25 and 2.5 mg/kg and the results in muscle are from mice treated at 25 mg/kg. Genes that are shown in red were upregulated and genes that are shown in green were downregulated as a result of ASO treatment. The relative fold change was determined as described in Methods.
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
161
Fig. 2 (Continued)
treatment with TZDs, which have been shown to act by causing adipocyte differentiation and have been shown to upregulate genes indicative of mature adipocytes (Kletzien et al., 1992; Hallakou et al., 1997). For instance, genes such as adipsin, c-Cbl-associating protein and PAI-1, which are expressed in highly differentiated adipocytes, have been shown to be upregulated by treatment with rosiglitazone or other TZDs and are downregulated with treatment with ISIS-113715 (Fig. 4) (Ihara et al., 2001; Baumann et al., 2000; Okazaki et al., 1999). Lipogenesis, the process of fatty acid synthesis, takes place in both adipose tissue and liver. Many of the genes
involved in lipogenesis are regulated by SREBP-1, including fatty acid synthase, glycerol-3-phosphate acetyltransferase, and Spot 14 (Mater et al., 1999; Shimomura et al., 1998). Other genes that are crucial for lipogenesis that may be directly or indirectly regulated by SREBP are stearoyl-CoA desaturase, squalene synthase, malic enzyme and long chain acyl-CoA synthetase. All of these genes are downregulated in adipose tissue with PTP1B ASO treatment (Fig. 4). Several factors have been shown to regulate genes involved in lipogenesis. Leptin downregulates the expression of these genes (Soukas et al., 2000), while treatment with TZDs results in an increase in lipogenesis
162
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 3. Histopathology slide showing sections of liver from an ob /ob mouse treated with saline or with PTP1B ASO at 25 mg/kg. The top sections show 4 / magnification, the bottom show 10/ magnification.
genes (Yamauchi et al., 2001; Way et al., 2001). Table 1 shows a list of genes that have been shown to be upregulated with TZD treatment in adipocytes and were downregulated with PTP1B ASO treatment. Using quantitative PCR, we have previously confirmed the expression changes for Spot 14 and fatty acid synthase (Rondinone et al., 2002). Fig. 5A /C shows additional confirmation of the microarray results for PAI-1, PI3 kinase p85 and adipsin using Q-PCR. The results show good correlation between the microarray results and the Q-PCR analysis.
5. Discussion We have treated ob /ob mice with an ASO directed specifically against PTP1B mRNA. The treated mice showed a reduction in mRNA levels in liver and protein levels of PTP1B in both adipocytes and liver. Treated ob /ob mice showed improved insulin sensitivity and normalized plasma glucose levels (Zinker et al., 2002). PTP1B ASO treatment resulted in a decrease in genes involved in lipogenesis in liver, including SREBP-1 which regulates many of these genes. Interestingly, a recent paper showed that SREBP-1 was induced in livers from mice deficient for IRS-2 (Tobe et al., 2001). Since PTP1B-antisense mice show an increase in IRS-2 expression, this may account for the downregulation of SREBP-1 in the liver (Zinker et al., 2002).
The downregulation of genes involved in lipogenesis in the liver is in contrast to what has been seen previously with TZD treatment. Previous research in Zucker diabetic rats has shown that TZDs generally have little effect on hepatic lipogenesis (Murakami et al., 1998) or actually result in an increase in lipogenic gene expression (Way et al., 2001). Lipid accumulation in the liver has been shown to play a key role in insulin resistance, and the alleviation of this condition may be one mechanism whereby PTP1B ASO improves insulin sensitivity (Kim et al., 2001). PTP1B ASO treatment also resulted in a decrease in genes involved in gluconeogenesis such as PEPCK and fructose-1,6-bisphosphatase and glucose-6-phosphatase. Previous research has shown that mice deficient in leptin levels display increased expression of genes involved in gluconeogenesis (Shimomura et al., 2000). Additionally, treatment of perfused livers with leptin resulted in decreased gluconeogenesis (Ceddia et al., 1999). Whether treatment with PTP1B ASO results in a direct or indirect effect on gluconeogenesis is unclear. None of the genes involved in adipogenesis or gluconeogenesis were regulated in muscle at 25 mg/kg. Previous studies have shown that antisense treatment in animals shows high distribution in fat and liver with little distribution in muscle (Levin, 1999). Thus it is very possible the gene changes seen in the muscle were due to secondary effects. Our results show that treatment with PTP1B ASO also resulted in a downregulation of genes involved in
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
163
Fig. 4. Gene expression changes for some of the genes regulated as a result of treatment with PTP1B ASO in ob /ob adipose tissue. The change in gene expression is shown relative to saline-treated control mice.
164
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 4 (Continued)
lipogenesis and adipocyte differentiation in fat. The regulation of many of the genes in adipose tissue with PTP1B ASO treatment causes an opposite reaction than treatment with TZDs. Previous research has shown that treatment with TZDs results in adipocyte differentiation and upregulation of genes involved in lipogenesis in fat (Kletzien et al., 1992; Hallakou et al., 1997; Yamauchi et
al., 2001). This in turn leads to increased number of mature fat cells, which are more insulin sensitive. Treatment with TZDs does lead to weight gain and increased fat deposition in rodent and clinical studies (Spiegelman, 1998). Since PTP1B ASO treatment does not lead to adipocyte differentiation, it is interesting to speculate that treatment with an antagonist to PTP1B
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
165
Fig. 4 (Continued)
would not lead to the weight gain seen with TZD treatment. In fact, as opposed to what is seen with TZD-treated mice, ob /ob mice treated with PTP1B ASO more closely resemble what is seen in mice with decreased PPARg expression. Mice treated with PTP1B antisense also showed a downregulation of PPARg gene expression (Fig. 4*/Adipose specific genes). Yamauchi et al. (2001)
showed that heterozygous PPARg mice displayed decreased lipogenesis in WAT, liver and muscle, were resistant to increased adipose mass on high fat diets, and showed increased serum leptin levels and improved insulin resistance. Possibly, decreasing PTP1B expression may improve insulin sensitivity through some of the same mechanisms as seen with decreased PPARg expression.
Table 1 Gene regulation from PTP1B ASO or TZD treatment in adipocytes Gene name
PTP1B ASO
TZD
Reference
c-Cbl-associated protein (CAP) ATP-citrate lyase mRNA Glycerol-3-phosphate dehydrogenase Stearoyl-CoA desaturase Pyruvate carboxylase Lipoprotein Lipase Malic enzyme Long chain fatty acyl-CoA synthetase Glycerol-3-phosphate acetyltransferase Adipsin AdipoQ (adiponectin) PAI-1 PPARg Stearoyl-CoA desaturase(scd2) Fatty Acid Synthase Stearoyl-coenzyme A desaturase 1
Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease
Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase
Ribon et al. (1998) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Okazaki et al. (1999) Maeda et al. (2001) Ihara et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001)
166
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 5. (A /C), Q-PCR results showing the regulation of adipsin (A), PAI-1 (B), PI3 kinase p85 (C), fatty acid synthase in adipocytes. The results are an average from 4 individual ob /ob mice treated with PTP1B ASO at the indicated dose levels.
Interestingly, previous research has shown that treatment with leptin also results in a downregulation of genes involved in lipogenesis. Evidence has suggested that adipocytes treated with leptin show increased fatty acid oxidation and decreased lipogenic capability (Soukas et al., 2000; Zhou et al., 1999). It is possible that downregulation of PTP1B expression causes a similar change in adipocytes. Both leptin and PTP1B ASO result in a decrease in fatty acid synthase and glycerol-3phosphate acetyltransferase, suggesting a loss in lipogenic capability. In addition, treatment with leptin or PTP1B ASO result in a downregulation of lipogenic genes in the liver. The results suggest that both leptin
and PTP1B may modulate some, but not all of the same pathways regulating glucose sensitivity and fatty acid metabolism. A recent paper by Cheng et al. (2002) supports this hypothesis. Using mice deficient for both PTP1B and leptin, the authors showed that, in the absence of leptin, loss of PTP1B is able to attenuate weight gain. However, administration of exogenous leptin showed that PTP1B deficiency led to enhanced leptin sensitivity, supporting the theory that PTP1B regulates body weight via leptin-independent and dependent pathways. Another gene that was shown to be downregulated in adipose tissue by treatment with PTP1B antisense, and which might be important for the normalization of glucose levels and improvement of insulin sensitivity is 11b-hydroxysteroid dehydrogenase type 1 (11b-HSD1). Mice deficient for 11b-HSD1 showed increased lipid catabolism with ad lib feeding, reduced intracellular glucocorticoid concentrations during fasting and increased hepatic insulin sensitivity after refeeding (Morton et al., 2001). The fact that lowering PTP1B results in decreased levels of 11b-HSD1 is intriguing. Whether this is due to secondary effects or possibly a direct effect of PTP1B is unclear at this time. Overall, our results show that treatment of ob /ob mice with PTP1B antisense results in a downregulation of genes involved in lipogenesis in both fat and liver. Furthermore, PTP1B ASO does not seem to be acting through the same pathways as TZD treatment, but in fact may be acting in an opposite manner to PPARg activation and possibly may be acting downstream of the leptin pathway. Based on our results we would postulate that mice expressing decreased levels of PTP1B would display increased leptin sensitivity. Our results strongly suggest that therapies targeting PTP1B should result in lower blood glucose and insulin sensitivity without leading to increased weight gain seen with TZD treatment.
Acknowledgements We would like to thank Brett Monia and Mandy Butler of ISIS Pharmaceuticals and Don Halbert and Regina Reilly of Abbott Laboratories for helpful discussions on the project.
References Baumann, C., Chokshi, N., Saltiel, A.R., Ribon, V., 2000. Cloning and characterization of a functional peroxisome proliferator activator receptor-gamma-responsive element in the promoter of the CAP gene. J. Biol. Chem. 275, 9131 /9135. Ceddia, R.B., Lopes, G., Souza, H.M., Borba-Murad, G.R., William, W.N., Bazotte, R.B., Curi, R., 1999. Acute effects of leptin on
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168 glucose metabolism of in situ rat perfused livers and isolated hepatocytes. Int. J. Obes. Relat. Metab. Disord. 23, 1207 /1212. Cheng, A., Uetani, N., Simoncic, P.D., Chaubey, V.P., Lee-Loy, A., McGlade, C.J., Kennedy, B.P., Tremblay, M.L., 2002. Attenuation of leptin action and regulation of obesity by protein tyrosine phosphatase 1B. Dev. Cell 2, 497 /503. Cornelius, P., MacDougald, O.A., Lane, M.D., 1994. Regulation of adipocyte development. Annu. Rev. Nutr. 14, 99 /129. Czech, M.P., Corvera, S., 1999. Signaling mechanisms that regulate glucose transport. J. Biol. Chem. 274, 1865 /1868. Dean, N.M., Butler, M., Monia, B.P., Manoharan, M., 2001. Pharmacology of 2?-O -(2-methoxy)ethyl modified antisense oligonucleotides. In: Crooke, S.T. (Ed.), Antisense Technology: Principles, Strategies and Applications. Decker, New York, pp. 319 /338. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A.L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C.C., Ramachandran, C., Gresser, M.J., Tremblay, M.L., Kennedy, B.P., 1999. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544 /1548. Friedman, J.M., Halaas, J.L., 1998. Leptin and the regulation of body weight in mammals. Nature 395, 763 /770. Goldstein, B.J., Bittner-Kowalczyk, A., White, M.F., Harbeck, M., 2000. Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J. Biol. Chem. 275, 4283 /4289. Hallakou, S., Doare, L., Foufelle, F., Kergoat, M., Guerre-Millo, M., Berthault, M.F., Dugail, I., Morin, J., Auwerx, J., Ferre, P., 1997. Pioglitazone induces in vivo adipocyte differentiation in the obese Zucker fa/fa rat. Diabetes 46, 1393 /1399. Ihara, H., Urano, T., Takada, A., Loskutoff, D.J., 2001. Induction of plasminogen activator inhibitor 1 gene expression in adipocytes by thiazolidinediones. FASEB J. 15, 1233 /1235. Kao, A.W., Waters, S.B., Okada, S., Pessin, J.E., 1997. Insulin stimulates the phosphorylation of the 66- and 52-kilodalton Shc isoforms by distinct pathways. Endocrinology 138, 2474 /2480. Kennedy, B.P., Ramachandran, C., 2000. Protein tyrosine phosphatase-1B in diabetes. Biochem. Pharmacol. 60, 877 /883. Kenner, K.A., Anyanwu, E., Olefsky, J.M., Kusari, J., 1996. Proteintyrosine phosphatase 1B is a negative regulator of insulin- and insulin-like growth factor-I-stimulated signaling. J. Biol. Chem. 271, 19810 /19816. Kim, J.K., Fillmore, J.J., Chen, Y., Yu, C., Moore, I.K., Pypaert, M., Lutz, E.P., Kako, Y., Velez-Carrasco, W., Goldberg, I.J., Breslow, J.L., Shulman, G.I., 2001. Tissue-specific overexpression of lipoprotein lipase causes tissue-specific insulin resistance. Proc. Natl. Acad. Sci. USA 98, 7522 /7577. Klaman, L.D., Boss, O., Peroni, O.D., Kim, J.K., Martino, J.L., Zabolotny, J.M., Moghal, N., Lubkin, M., Kim, Y.B., Sharpe, A.H., Stricker-Krongrad, A., Shulman, G.I., Neel, B.G., Kahn, B.B., 2000. Increased energy expenditure, decreased adiposity, and tissue-specific insulin sensitivity in protein-tyrosine phosphatase 1B-deficient mice. Mol. Cell Biol. 20, 5479 /5489. Kletzien, R.F., Clarke, S.D., Ulrich, R.G., 1992. Enhancement of adipocyte differentiation by an insulin-sensitizing agent. Mol. Pharmacol. 41, 393 /398. Levin, A.A., 1999. A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides. Biochim. Biophys. Acta 1489, 69 /84. Maeda, N., Takahashi, M., Funahashi, T., Kihara, S., Nishizawa, H., Kishida, K., Nagaretani, H., Matsuda, M., Komuro, R., Ouchi, N., Kuriyama, H., Hotta, K., Nakamura, T., Shimomura, I., Matsuzawa, Y., 2001. PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50, 2094 /2099.
167
Mater, M.K., Thelen, A.P., Pan, D.A., Jump, D.B., 1999. Sterol response element-binding protein 1c (SREBP1c) is involved in the polyunsaturated fatty acid suppression of hepatic S14 gene transcription. J. Biol. Chem. 274, 32725 /32732. Morton, N.M., Holmes, M.C., Fievet, C., Staels, B., Tailleux, A., Mullins, J.J., Seckl, J.R., 2001. Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerence in 11bhydroxysteroid dehydrogenase type 1 null mice. J. Biol. Chem. 276, 41293 /41300. Murakami, K., Tobe, K., Ide, T., Mochizuki, T., Ohashi, M., Akanuma, Y., Yazaki, Y., Kadowaki, T., 1998. A novel insulin sensitizer acts as a coligand for peroxisome proliferator-activated receptor-alpha (PPAR-alpha) and PPAR-gamma: effect of PPARalpha activation on abnormal lipid metabolism in liver of Zucker fatty rats. Diabetes 47, 1841 /1847. Nadler, S.T., Attie, A.D., 2001. Please pass the chips: genomic insights into obesity and diabetes. J. Nutr. 138, 2078 /2081. Nadler, S.T., Stoehr, J.P., Schueler, K.L., Tanimoto, G., Yandell, B.S., Attie, A.D., 2000. The expression of adipogenic genes is decreased in obesity and diabetes mellitus. PNAS 97, 11371 /11376. Okazaki, R., Miura, M., Toriumi, M., Taguchi, M., Hirota, Y., Fukumoto, S., Fujita, T., Tanaka, K., Takeuchi, 1999. Short-term treatment with troglitazone decreases bone turnover in patients with type 2 diabetes mellitus. Endocr. J. 46, 795 /801. Olefsky, J.M., 1999. Insulin-stimulated glucose transport minireview series. J. Biol. Chem. 274, 1863. Olefsky, J.M., Garvey, W.T., Henry, R.R., Brillon, D., Matthaei, S., Freidenberg, G.R., 1988. Cellular mechanisms of insulin resistance in non-insulin-dependent (type II) diabetes. Am. J. Med. 85, 86 / 105. Reaven, G.M., 1988. Role of insulin resistance in human disease. Diabetes 37, 1595 /1607 (Banting lecture 1988). Ribon, V., Johnson, J.H., Camp, H.S., Saltiel, A.R., 1998. Thiazolidinediones and insulin resistance: peroxisome proliferator-activated receptor gamma stimulates the expression of the CAP gene. Proc. Natl. Acad. Sci. USA 95, 14751 /14756. Rondinone, C.M., Trevillyan, J.M., Clampit, J., Gum, R.J., Berg, C., Kroeger, P., Frost, L., Zinker, B.A., Reilly, R., Ulrich, R., Butler, M., Monia, B.P., Jirousek, M.R., Waring, J.F., 2002. Protein tyrosine phosphatase 1B reduction regulates adiposity and expression of genes involved in lipogenesis. Diabetes 51, 2405 /2411. Shimomura, I., Hammer, R.E., Ikemoto, S., Brown, M.S., Goldstein, J.L., 1999. Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 401, 73 /76. Shimomura, I., Matsuda, M., Hammer, R.E., Bashmakov, Y., Brown, M.S., Goldstein, J.L., 2000. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob /ob mice. Mol. Cell 6, 77 /86. Shimomura, I., Shimano, H., Korn, B.S., Bashmakov, Y., Horton, J.D., 1998. Nuclear sterol regulatory element-binding proteins activate genes responsible for the entire program of unsaturated fatty acid biosynthesis in transgenic mouse liver. J. Biol. Chem. 273, 35299 /35306. Soukas, A., Cohen, P., Socci, N.D., Friedman, J.M., 2000. Leptinspecific patterns of gene expression in white adipose tissue. Genes. Dev. 14, 963 /980. Spiegelman, B.M., 1998. PPAR-g adipogenic regulator and thiazolidinedione receptor. Diabetes 47, 507 /514. Tobe, K., Suzuki, R., Aoyama, M., Yamauchi, T., Kamon, J., Kubota, N., Terauchi, Y., Matsui, J., Akanuma, Y., Kimura, S., Tanaka, J., Abe, M., Ohsumi, J., Nagai, R., Kadowaki, T., 2001. Increased expression of the sterol regulatory element-binding protein-1 gene in insulin receptor substrate-2(///) mouse liver. J. Biol. Chem. 276, 38337 /38340. Way, J.M., Harrington, W.W., Brown, K.K., Gottschalk, W.K., Sundseth, S.S., Mansfield, T.A., Ramachandran, R.K., Willson, T.M., Kliewer, S.A., 2001. Comprehensive messenger ribonucleic
168
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
acid profiling reveals that peroxisome proliferator-activated receptor gamma activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142, 1269 / 1277. White, M.F., 1998. The IRS-signalling system: a network of docking proteins that mediate insulin action. Mol. Cell Biochem. 182, 3 /11. Yamauchi, T., Kamon, J., Waki, H., Murakami, K., Motojima, K., Komeda, K., Ide, T., Kubota, N., Terauchi, Y., Tobe, K., Miki, H., Tsuchida, A., Akanuma, Y., Nagai, R., Kimura, S., Kadowaki, T., 2001. The mechanisms by which both heterozygous PPARgamma deficiency and PPARgamma agonist improve insulin resistance. J. Biol. Chem. 276, 41245 /41254.
Zhou, Y.T., Wang, Z.W., Higa, M., Newgard, C.B., Unger, R.H., 1999. Reversing adipocyte differentiation: implications for treatment of obesity. Proc. Natl. Acad. Sci. USA 96, 2391 /2395. Zinker, B.A., Rondinone, C.M., Trevillyan, J.M., Gum, R.J., Clampit, J.E., Waring, J.F., Xie, N., Wilcox, D., Jacobson, P., Frost, L., Kroeger, P.E., Reilly, R.M., Koterski, S., Opgenorth, T.J., Ulrich, R.G., Crosby, S., Butler, M., Murray, S.F., McKay, R.A., Bhanot, S., Monia, B.P., Jirousek, M.R., 2002. PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice. PNAS 99, 11357 / 11362.
PTP1B antisense-treated mice show regulation of genes involved in lipogenesis in liver and fat Jeffrey F. Waring *, Rita Ciurlionis, Jill E. Clampit, Sherry Morgan, Rebecca J. Gum, Robert A. Jolly 1, Paul Kroeger, Leigh Frost, James Trevillyan, Bradley A. Zinker, Michael Jirousek 2, Roger G. Ulrich 3, Cristina M. Rondinone Abbott Laboratories, 100 Abbott Park Road, Abbott Park, IL 60064-6123, USA Received 21 October 2002; accepted 23 December 2002
Abstract Protein tyrosine phosphatases are important regulators of insulin signal transduction. Our studies have shown that in insulin resistant and diabetic ob /ob and db /db mice, reducing the levels of protein tyrosine phosphatase 1B (PTP1B) protein by treatment with a PTP1B antisense oligonucleotide resulted in improved insulin sensitivity and normalized plasma glucose levels. The mechanism by which PTP1B inhibition improves insulin sensitivity is not fully understood. We have used microarray analysis to compare gene expression changes in adipose tissue, liver and muscle of PTP1B antisense-treated ob /ob mice. Our results show that treatment with PTP1B antisense resulted in the downregulation of genes involved in lipogenesis in both fat and liver, and a downregulation of genes involved in adipocyte differentiation in fat, suggesting that PTP1B antisense acts through a different mechanism than thiazolidinedione (TZD) treatment. In summary, microarray results suggest that reduction of PTP1B may alleviate hyperglycemia and enhance insulin sensitivity by a different mechanism than TZD treatment. # 2003 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Microarray; Diabetes; PTP1B; Antisense; ob /ob mice; Lipogenesis
1. Introduction Type 2 diabetes is a polygenic disease affecting over 100 million people worldwide. Affected patients manifest insulin resistance, hyperinsulinemia, and hyperglycemia (Reaven, 1988). The molecular mechanism underlying the insulin resistance is not well understood but appears to involve a defect in the post-insulin receptor (IR) signal transduction pathway (Olefsky et al., 1988). The IR is a receptor tyrosine kinase, and the
* Corresponding author. Address: Department of Cellular and Molecular Toxicology, Abbott Laboratories R463, Abbott Park, IL 60064-6104, USA. Tel.: /1-847-935-4124; fax: /1-847-935-7845. E-mail address: [email protected] (J.F. Waring). 1 Present address: Lilly Research Labs, 2001 West Main Street, Greenfield, IN 46140, USA. 2 Present address: Pfizer Global R&D, 10770 Science Center Drive, San Diego, CA 92121-1187, USA. 3 Present address: Rosetta Inpharmatics, 12040 115th Avenue NE, Kirkland, WA 98034, USA.
binding of insulin to its receptor results in autophosphorylation of the IR and tyrosyl phosphorylation of IR substrate proteins (Czech and Corvera, 1999; Kao et al., 1997; Olefsky, 1999; White, 1998). Protein tyrosine kinases and protein tyrosine phosphatases are important regulators of insulin signal transduction. Much attention has been focused on protein tyrosine phosphatase 1B (PTP1B), which inhibits insulin phosphorylation of the IR and insulin receptor substrates (Goldstein et al., 2000; Kenner et al., 1996; Kennedy and Ramachandran, 2000). Mice deficient in PTP1B expression have increased insulin sensitivity and low adiposity with resistance to weight gain on a high fat diet. In addition, the mice show increased basal metabolic rate and total energy expenditure (Elchebly et al., 1999; Klaman et al., 2000). Thus, while it is clear that PTP1B plays a role in insulin sensitivity and glucose homeostasis, the molecular mechanism of how the protein may act in diabetes is not understood. Recently, microarray technology has been applied to study the regulation of genes in diabetic mouse models
0303-7207/03/$ - see front matter # 2003 Elsevier Science Ireland Ltd. All rights reserved. doi:10.1016/S0303-7207(03)00008-X
156
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
(Nadler et al., 2000; Soukas et al., 2000). In two separate cases, researchers showed that in adipose tissue from ob / ob mice, which have a missense mutation in the gene encoding leptin, the pattern of gene expression was the reverse of the pattern observed during adipocyte differentiation. This suggests that adipocytes from ob /ob mice have decreased lipogenic capacity, similar to preadipocytes (Nadler and Attie, 2001). The lack of lipogenic adipocytes in ob /ob mice results in a shift of lipogenesis from adipose tissue to the liver, resulting in hepatic steatosis and the upregulation of genes in the liver such as sterol response element binding protein 1 (SREBP-1), fatty acid synthase, ATP-citrate lyase and malic enzyme (Shimomura et al., 1999). Soukas et al. (2000) obtained similar results concerning the regulation of genes involved in lipid metabolism of adipocytes from ob /ob versus lean mice. The results also showed a downregulation of genes that have been shown to be upregulated in adipocyte differentiation. In addition, gene expression changes were characterized when ob /ob mice were treated with leptin, a hormone produced in adipocytes which functions in satiety and regulation of adipose tissue mass (Friedman and Halaas, 1998). Microarray results showed that treatment with leptin caused a further downregulation of some of the genes involved in lipid metabolism such as fatty acid synthase, while normalizing others (Soukas et al., 2000). Previous studies have suggested that leptin activates a program that reverses differentiation in adipocytes (Zhou et al., 1999). The insulin-sensitizing class of drugs known as thiazolidinediones (TZD) are ligands for the peroxisome proliferator activated receptor gamma (PPARg). These compounds have been shown to cause adipocyte differentiation. The adipocyte differentiation, in the absence of increased energy storage, would produce more fat cells of smaller average size, which are more sensitive to insulin-dependent glucose uptake (as reviewed in (Spiegelman, 1998)). We have treated ob /ob mice with an antisense oligonucleotide (ASO, ISIS-113715) directed specifically against PTP1B mRNA. Antisense technology offers a powerful method to study gene function in an organism without the potential developmental issues inherent with using knockout mice. Treatment of ob /ob mice with ISIS-113715 led to a decrease in mRNA and protein expression and resulted in improved insulin sensitivity and normalized plasma glucose levels (Zinker et al., 2002; Rondinone et al., 2002). In order to better understand the function of PTP1B in insulin regulation and glucose homeostasis, we have utilized oligonucleotide microarrays to characterize the response to ISIS-113715 treatment in ob /ob mice. Gene expression changes from mice treated with ISIS-113715 were compared to saline-treated controls in adipose tissue, liver and muscle. The results demonstrate that
treatment with ISIS-113715 resulted in a downregulation of genes involved in lipogenesis in both liver and adipose tissue. Histopathological examination of livers from ob/ob mice treated with ISIS-113715 showed a marked reduction in lipid accumulation. In addition, PTP1B antisense treatment resulted in a downregulation of genes involved in adipocyte differentiation, strongly suggesting that ISIS-113715 acts by a different mechanism than TZDs. These data suggest PTP1B improved insulin sensitivity in ob /ob mice without causing an increase in adipocyte mass as seen in some cases with TZD therapy, and suggest that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes.
2. Experimental animals The following investigations were conducted in accordance with each institution’s IACUC guidelines and were conducted in accord with accepted standards of humane animal care.
3. Materials and methods 3.1. Identification of ASO inhibitors Rapid throughput screens for identifying ASO inhibitors selective against PTP1B were performed with 20-base chimeric ASOs where the first five bases and last five bases have a 2?-O -(2-methoxy)-ethyl (2?MOE) modification. The 2?MOE modification increases binding affinity to complementary RNA sequences and increases resistance to nucleases (Dean et al., 2001). The ASO oligonucleotides have a phosphorothiorate backbone and use an RNase H dependent mechanism for activity. Initial screens were conducted against rat PTP1B and ten ASOs were identified as hits, all of which targeted the same region within the coding sequences of the PTP1B mRNA. Subsequently, a series of in vitro characterization experiments were performed in primary rat and mouse hepatocytes, in which ISIS-113715 was consistently identified to be the most potent and specific oligonucleotide in reducing PTP1B mRNA levels. ISIS113715 hybridizes to PTP1B mRNA at nucleotides 862/ 882 in the coding sequence. 3.2. Animal care and treatments ob /ob mice and their lean littermates of 6 /7 weeks of age (Jackson Laboratories, Bar Harbor, ME) were acclimated to the animal research facilities for 5 days. The following investigations were conducted in accordance with each institution IACUC guidelines. Animals were housed (5 per cage, ob /ob , C57BL/6J-Lepob; 4 per
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
cage, db /db , C57BLKS/J-m ///Leprdb; 2 per cage lean littermates) and maintained on mouse chow (ob/ob Labdiets #5015, St. Louis, MO; db/db Harlan /Teklad rodent diet #8604 Madison, WI; 26% fat calories) ad libitum. After acclimation the ob /ob and lean mice were weighed and tail snip glucose levels were determined by the glucose oxidase method (Precision G glucose meter, Abbott Laboratories, North Chicago, IL). The animals were randomized to the various treatment groups based on plasma glucose levels and body weight. Baseline plasma insulin samples were taken from a subset of the animals representing each treatment group once randomized (n /10 ob /ob and n /10 lean littermates; ELISA, ALPCO Diagnostics, Windham, NH). Treatment groups were: ob/ob PTP1B ASO 25 mg/kg, 2.5, 0.25 and saline (n/10/treatment) for 6 week. All mice were dosed i.p. twice/week. A scrambled ASO oligonucleotide treated group of ob/ob mice was run as a negative control. The dosing and treatment of the ob / ob mice has been previously described (Zinker et al., 2002). At the end of the studies, liver, epididymal fat pads and skeletal muscle were harvested and frozen immediately in liquid nitrogen for further analysis. 3.3. Histopathology Three saline control and three PTP1B ASO treated mice were utilized for histopathologic examination. Sections of liver, brain, lung, spleen, pancreas, myocardium, skeletal muscle, sciatic nerve, eye, kidney, and bone marrow were harvested at necropsy and fixed in 10% neutral buffered formalin for 24/48 h. The specimens were then dehydrated through graded alcohols, and embedded in paraffin wax. Five-micron sections were cut and stained with hematoxylin and eosin. 3.4. Tissue extraction and RNA isolation RNA preparation was done by grinding approximately 100 mg of liver, muscle or adipose tissue in 1 ml of TRIzol reagent and analysis was done according to the Affymetrix Inc. protocol. The integrity of the RNA was confirmed using an Agilent 2100 Bioanalyzer (data not shown). Briefly, the RNA from four mice in PTP1B ASO-treated or control groups was pooled using equal amounts to make a total of 20 mg of RNA. cDNA was prepared using the Superscript Choice system from Gibco BRL Life Technologies (Cat. No. 18090-019). The protocol was followed with the exception that the primer used for the reverse transcription reaction was a modified T7 primer with 24 thymidines at the 5? end. The sequence was: 5?GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT)24-3?. Following this, labeled cRNA was synthesized according to the manufacturers instructions from the cDNA using
157
the Enzo RNA Transcript Labeling Kit (Cat. No. 900182). Approximately 20 mg of cRNA was then fragmented in a solution of 40 mM Tris-acetate, pH 8.1, 100 mM KOAc, and 30 mM MgOAc at 94 8C for 35 min.
3.5. Microarray analysis Labeled cRNA was hybridized to the AFFYMETRIX Test2 Array to verify the quality of labeled cRNA. Following this, cRNA was hybridized to the Affymetrix MU11K A and B chip for all treatments of muscle and liver and for fat treated at 25 mg/kg. The MU-U74 V.2 chip was used for fat treated at 2.5 and the 25 mg/kg treatment done on the MU11K A and B was repeated on the MU-U74 V.2 chip. The cRNA was hybridized overnight at 45 8C. The data was analyzed using AFFYMETRIX GENECHIP Version 3.2 software and Rosetta Resolver Gene Expression Data Analysis System.
GENECHIP
3.6. Real time PCR analysis Real time PCR was performed using the Taqman† EZ RT-PCR Core Reagents kit (Perkin Elmer Part Number N808-0236). For the analysis, 100 ng of total RNA was used. The reactions were done in triplicate. The probe sequences for fatty acid synthetase and Spot 14 have been reported previously (Rondinone et al., 2002). The probe sequences for adipsin were: GCAGTCGAAGGTGTGGTTACGT */Forward Probe CTCGCGTCTGTGGCAATGGCAA */Taqman Probe GGGTATAGACGCCCGGCTT */Reverse Probe The probe sequences for plasminogen activator inhibitor-1 (PAI-1) were: CTCCACAGCCTTTGTCATCTCA */Forward Probe CATGGCCCCCACGGAGATGGTT */Taqman Probe GTGCCGAACCACAAAGAGAAA */Reverse Probe The probe sequences for p85 were: GCGAAACCGTTGAAATGCATAA */Forward Probe TGCAAACACTGCCCCCCAAACC */Taqman Probe GTTGTTGGCTACAGTAGTGGGCTT */Reverse Probe
158
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
4. Results 4.1. PTP1B ASO treatment normalizes blood glucose and insulin levels in ob/ob mice In a 6-week study, ob /ob mice were treated with ISIS113715 in a dose response study at 25, 2.5 and 0.25 mg/ kg twice per week. We have shown that treatment with PTP1B antisense reduced the levels of PTP1B mRNA and protein (Zinker et al., 2002). Fig. 1A and B show the western blotting analysis of the levels of PTP1B in both fat and liver at 25 and 2.5 mg/kg. The western blots show a clear reduction in the protein level of PTP1B at both 25 and 2.5 mg/kg in both adipose and liver. No change in PTP1B protein levels was seen in muscle (Zinker et al., 2002). In addition, quantitative PCR analysis showed a reduction in PTP1B message. Treatment of ob /ob mice using a scrambled oligonucleotide showed no effect on PTP1B mRNA or protein levels (Zinker et al., 2002). Plasma glucose levels were normal-
ized to lean (ob//) levels in the 25 mg/kg treatment groups, and plasma glucose levels were improved in the 2.5 mg/kg treatment group. Plasma insulin levels were decreased 77% in the 25 mg/kg treatment group. In addition, an enhanced reduction in glucose level occurred during an insulin tolerance test with ASO treatment. Epididymal fat weight was reduced 42 and 17% in animals treated at 25 and 2.5 mg/kg, respectively, compared to saline-treated controls (Zinker et al., 2002). 4.2. PTP1B ASO treatment results in a downregulation of genes involved in lipogenesis and gluconeogenesis in the liver In genetically obese animals research has shown that in the liver and muscle, the expression of many lipogenic genes increase as a result of lipid storage being shifted to the liver (Nadler and Attie, 2001). Fig. 2 shows a heat map of gene expression changes in the liver and muscle from ob/ob mice treated with PTP1B ASO compared to
Fig. 1. (A and B), Western blots showing the levels of PTP1B protein in ob /ob liver (A) and fat (B) in saline treated- or mice treated with 2.5 or 25 mg/kg of PTP1B antisense. The graphs show quantitative levels of PTP1B protein relative to saline-treated controls.
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
159
Fig. 1 (Continued)
saline-treated controls. The results show that several genes that are involved in lipogenesis such as SREBP, ATP-citrate lyase, Spot 14 and malic enzyme are downregulated in the liver with PTP1B ASO treatment. In agreement with this, histopathology findings showed reduced levels of lipid in livers from ob /ob mice treated with PTP1B ASO. Fig. 3 depicts the difference in histologically detectable hepatocellular lipid accumulation in the livers of ob /ob mice treated with PTP1B ASO compared to saline control mice. Saline-treated mice consistently exhibited marked diffuse hepatocellular lipid accumulation whereas PTP1B ASO treated mice exhibited mild, or occasionally moderate focal to multifocal hepatocellular lipid accumulation. Although it has been shown that lipogenesis can also shift to muscle in genetically obese animals, similar gene changes were not seen in muscle. Microarray analysis shows that the expression of two genes involved in gluconeogenesis, phosphoenolpyruvate carboxykinase (PEPCK) and fructose-1,6-bisphosphatase are downregulated in livers of ob /ob mice with high-dose treatment of PTP1B ASO.
4.3. Reduction of PTP1B mRNA results in decreased expression of genes involved in lipogenesis and adipocyte differentiation in fat cells RNA was harvested from white adipose tissue (WAT) from saline or PTP1B ASO-treated mice. RNA was pooled from the different treatment groups and hybridized to the Affymetrix MG-U74 v2 microarray chip. The results from the 25 mg/kg treatment group were repeated for confirmation. Fig. 4 shows some of the gene expression changes seen with 6 weeks of PTP1B ASO treatment at 25 and 2.5 mg/kg. Many of the genes that produce changes in expression were shown to be differentially expressed in adipose tissue between ob /ob and lean mice such as Spot 14, adipsin, retinol-binding protein and malic enzyme (Nadler et al., 2000). These genes have also been shown to be upregulated during adipocyte differentiation (Cornelius et al., 1994). In fact, the microarray results show that approximately half of the genes shown to be regulated during adipocyte differentiation were regulated in the opposite manner with PTP1B ASO treatment. This is in contrast to
160
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 2. Graph showing some of the gene expression changes in liver and muscle from ob /ob mice treated with PTP1B ASO relative to liver and muscle from saline-treated control mice. The results in liver are from mice treated with ASO at 25 and 2.5 mg/kg and the results in muscle are from mice treated at 25 mg/kg. Genes that are shown in red were upregulated and genes that are shown in green were downregulated as a result of ASO treatment. The relative fold change was determined as described in Methods.
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
161
Fig. 2 (Continued)
treatment with TZDs, which have been shown to act by causing adipocyte differentiation and have been shown to upregulate genes indicative of mature adipocytes (Kletzien et al., 1992; Hallakou et al., 1997). For instance, genes such as adipsin, c-Cbl-associating protein and PAI-1, which are expressed in highly differentiated adipocytes, have been shown to be upregulated by treatment with rosiglitazone or other TZDs and are downregulated with treatment with ISIS-113715 (Fig. 4) (Ihara et al., 2001; Baumann et al., 2000; Okazaki et al., 1999). Lipogenesis, the process of fatty acid synthesis, takes place in both adipose tissue and liver. Many of the genes
involved in lipogenesis are regulated by SREBP-1, including fatty acid synthase, glycerol-3-phosphate acetyltransferase, and Spot 14 (Mater et al., 1999; Shimomura et al., 1998). Other genes that are crucial for lipogenesis that may be directly or indirectly regulated by SREBP are stearoyl-CoA desaturase, squalene synthase, malic enzyme and long chain acyl-CoA synthetase. All of these genes are downregulated in adipose tissue with PTP1B ASO treatment (Fig. 4). Several factors have been shown to regulate genes involved in lipogenesis. Leptin downregulates the expression of these genes (Soukas et al., 2000), while treatment with TZDs results in an increase in lipogenesis
162
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 3. Histopathology slide showing sections of liver from an ob /ob mouse treated with saline or with PTP1B ASO at 25 mg/kg. The top sections show 4 / magnification, the bottom show 10/ magnification.
genes (Yamauchi et al., 2001; Way et al., 2001). Table 1 shows a list of genes that have been shown to be upregulated with TZD treatment in adipocytes and were downregulated with PTP1B ASO treatment. Using quantitative PCR, we have previously confirmed the expression changes for Spot 14 and fatty acid synthase (Rondinone et al., 2002). Fig. 5A /C shows additional confirmation of the microarray results for PAI-1, PI3 kinase p85 and adipsin using Q-PCR. The results show good correlation between the microarray results and the Q-PCR analysis.
5. Discussion We have treated ob /ob mice with an ASO directed specifically against PTP1B mRNA. The treated mice showed a reduction in mRNA levels in liver and protein levels of PTP1B in both adipocytes and liver. Treated ob /ob mice showed improved insulin sensitivity and normalized plasma glucose levels (Zinker et al., 2002). PTP1B ASO treatment resulted in a decrease in genes involved in lipogenesis in liver, including SREBP-1 which regulates many of these genes. Interestingly, a recent paper showed that SREBP-1 was induced in livers from mice deficient for IRS-2 (Tobe et al., 2001). Since PTP1B-antisense mice show an increase in IRS-2 expression, this may account for the downregulation of SREBP-1 in the liver (Zinker et al., 2002).
The downregulation of genes involved in lipogenesis in the liver is in contrast to what has been seen previously with TZD treatment. Previous research in Zucker diabetic rats has shown that TZDs generally have little effect on hepatic lipogenesis (Murakami et al., 1998) or actually result in an increase in lipogenic gene expression (Way et al., 2001). Lipid accumulation in the liver has been shown to play a key role in insulin resistance, and the alleviation of this condition may be one mechanism whereby PTP1B ASO improves insulin sensitivity (Kim et al., 2001). PTP1B ASO treatment also resulted in a decrease in genes involved in gluconeogenesis such as PEPCK and fructose-1,6-bisphosphatase and glucose-6-phosphatase. Previous research has shown that mice deficient in leptin levels display increased expression of genes involved in gluconeogenesis (Shimomura et al., 2000). Additionally, treatment of perfused livers with leptin resulted in decreased gluconeogenesis (Ceddia et al., 1999). Whether treatment with PTP1B ASO results in a direct or indirect effect on gluconeogenesis is unclear. None of the genes involved in adipogenesis or gluconeogenesis were regulated in muscle at 25 mg/kg. Previous studies have shown that antisense treatment in animals shows high distribution in fat and liver with little distribution in muscle (Levin, 1999). Thus it is very possible the gene changes seen in the muscle were due to secondary effects. Our results show that treatment with PTP1B ASO also resulted in a downregulation of genes involved in
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
163
Fig. 4. Gene expression changes for some of the genes regulated as a result of treatment with PTP1B ASO in ob /ob adipose tissue. The change in gene expression is shown relative to saline-treated control mice.
164
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 4 (Continued)
lipogenesis and adipocyte differentiation in fat. The regulation of many of the genes in adipose tissue with PTP1B ASO treatment causes an opposite reaction than treatment with TZDs. Previous research has shown that treatment with TZDs results in adipocyte differentiation and upregulation of genes involved in lipogenesis in fat (Kletzien et al., 1992; Hallakou et al., 1997; Yamauchi et
al., 2001). This in turn leads to increased number of mature fat cells, which are more insulin sensitive. Treatment with TZDs does lead to weight gain and increased fat deposition in rodent and clinical studies (Spiegelman, 1998). Since PTP1B ASO treatment does not lead to adipocyte differentiation, it is interesting to speculate that treatment with an antagonist to PTP1B
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
165
Fig. 4 (Continued)
would not lead to the weight gain seen with TZD treatment. In fact, as opposed to what is seen with TZD-treated mice, ob /ob mice treated with PTP1B ASO more closely resemble what is seen in mice with decreased PPARg expression. Mice treated with PTP1B antisense also showed a downregulation of PPARg gene expression (Fig. 4*/Adipose specific genes). Yamauchi et al. (2001)
showed that heterozygous PPARg mice displayed decreased lipogenesis in WAT, liver and muscle, were resistant to increased adipose mass on high fat diets, and showed increased serum leptin levels and improved insulin resistance. Possibly, decreasing PTP1B expression may improve insulin sensitivity through some of the same mechanisms as seen with decreased PPARg expression.
Table 1 Gene regulation from PTP1B ASO or TZD treatment in adipocytes Gene name
PTP1B ASO
TZD
Reference
c-Cbl-associated protein (CAP) ATP-citrate lyase mRNA Glycerol-3-phosphate dehydrogenase Stearoyl-CoA desaturase Pyruvate carboxylase Lipoprotein Lipase Malic enzyme Long chain fatty acyl-CoA synthetase Glycerol-3-phosphate acetyltransferase Adipsin AdipoQ (adiponectin) PAI-1 PPARg Stearoyl-CoA desaturase(scd2) Fatty Acid Synthase Stearoyl-coenzyme A desaturase 1
Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease Decrease
Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase Increase
Ribon et al. (1998) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001) Okazaki et al. (1999) Maeda et al. (2001) Ihara et al. (2001) Way et al. (2001) Way et al. (2001) Way et al. (2001)
166
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
Fig. 5. (A /C), Q-PCR results showing the regulation of adipsin (A), PAI-1 (B), PI3 kinase p85 (C), fatty acid synthase in adipocytes. The results are an average from 4 individual ob /ob mice treated with PTP1B ASO at the indicated dose levels.
Interestingly, previous research has shown that treatment with leptin also results in a downregulation of genes involved in lipogenesis. Evidence has suggested that adipocytes treated with leptin show increased fatty acid oxidation and decreased lipogenic capability (Soukas et al., 2000; Zhou et al., 1999). It is possible that downregulation of PTP1B expression causes a similar change in adipocytes. Both leptin and PTP1B ASO result in a decrease in fatty acid synthase and glycerol-3phosphate acetyltransferase, suggesting a loss in lipogenic capability. In addition, treatment with leptin or PTP1B ASO result in a downregulation of lipogenic genes in the liver. The results suggest that both leptin
and PTP1B may modulate some, but not all of the same pathways regulating glucose sensitivity and fatty acid metabolism. A recent paper by Cheng et al. (2002) supports this hypothesis. Using mice deficient for both PTP1B and leptin, the authors showed that, in the absence of leptin, loss of PTP1B is able to attenuate weight gain. However, administration of exogenous leptin showed that PTP1B deficiency led to enhanced leptin sensitivity, supporting the theory that PTP1B regulates body weight via leptin-independent and dependent pathways. Another gene that was shown to be downregulated in adipose tissue by treatment with PTP1B antisense, and which might be important for the normalization of glucose levels and improvement of insulin sensitivity is 11b-hydroxysteroid dehydrogenase type 1 (11b-HSD1). Mice deficient for 11b-HSD1 showed increased lipid catabolism with ad lib feeding, reduced intracellular glucocorticoid concentrations during fasting and increased hepatic insulin sensitivity after refeeding (Morton et al., 2001). The fact that lowering PTP1B results in decreased levels of 11b-HSD1 is intriguing. Whether this is due to secondary effects or possibly a direct effect of PTP1B is unclear at this time. Overall, our results show that treatment of ob /ob mice with PTP1B antisense results in a downregulation of genes involved in lipogenesis in both fat and liver. Furthermore, PTP1B ASO does not seem to be acting through the same pathways as TZD treatment, but in fact may be acting in an opposite manner to PPARg activation and possibly may be acting downstream of the leptin pathway. Based on our results we would postulate that mice expressing decreased levels of PTP1B would display increased leptin sensitivity. Our results strongly suggest that therapies targeting PTP1B should result in lower blood glucose and insulin sensitivity without leading to increased weight gain seen with TZD treatment.
Acknowledgements We would like to thank Brett Monia and Mandy Butler of ISIS Pharmaceuticals and Don Halbert and Regina Reilly of Abbott Laboratories for helpful discussions on the project.
References Baumann, C., Chokshi, N., Saltiel, A.R., Ribon, V., 2000. Cloning and characterization of a functional peroxisome proliferator activator receptor-gamma-responsive element in the promoter of the CAP gene. J. Biol. Chem. 275, 9131 /9135. Ceddia, R.B., Lopes, G., Souza, H.M., Borba-Murad, G.R., William, W.N., Bazotte, R.B., Curi, R., 1999. Acute effects of leptin on
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168 glucose metabolism of in situ rat perfused livers and isolated hepatocytes. Int. J. Obes. Relat. Metab. Disord. 23, 1207 /1212. Cheng, A., Uetani, N., Simoncic, P.D., Chaubey, V.P., Lee-Loy, A., McGlade, C.J., Kennedy, B.P., Tremblay, M.L., 2002. Attenuation of leptin action and regulation of obesity by protein tyrosine phosphatase 1B. Dev. Cell 2, 497 /503. Cornelius, P., MacDougald, O.A., Lane, M.D., 1994. Regulation of adipocyte development. Annu. Rev. Nutr. 14, 99 /129. Czech, M.P., Corvera, S., 1999. Signaling mechanisms that regulate glucose transport. J. Biol. Chem. 274, 1865 /1868. Dean, N.M., Butler, M., Monia, B.P., Manoharan, M., 2001. Pharmacology of 2?-O -(2-methoxy)ethyl modified antisense oligonucleotides. In: Crooke, S.T. (Ed.), Antisense Technology: Principles, Strategies and Applications. Decker, New York, pp. 319 /338. Elchebly, M., Payette, P., Michaliszyn, E., Cromlish, W., Collins, S., Loy, A.L., Normandin, D., Cheng, A., Himms-Hagen, J., Chan, C.C., Ramachandran, C., Gresser, M.J., Tremblay, M.L., Kennedy, B.P., 1999. Increased insulin sensitivity and obesity resistance in mice lacking the protein tyrosine phosphatase-1B gene. Science 283, 1544 /1548. Friedman, J.M., Halaas, J.L., 1998. Leptin and the regulation of body weight in mammals. Nature 395, 763 /770. Goldstein, B.J., Bittner-Kowalczyk, A., White, M.F., Harbeck, M., 2000. Tyrosine dephosphorylation and deactivation of insulin receptor substrate-1 by protein-tyrosine phosphatase 1B. Possible facilitation by the formation of a ternary complex with the Grb2 adaptor protein. J. Biol. Chem. 275, 4283 /4289. Hallakou, S., Doare, L., Foufelle, F., Kergoat, M., Guerre-Millo, M., Berthault, M.F., Dugail, I., Morin, J., Auwerx, J., Ferre, P., 1997. Pioglitazone induces in vivo adipocyte differentiation in the obese Zucker fa/fa rat. Diabetes 46, 1393 /1399. Ihara, H., Urano, T., Takada, A., Loskutoff, D.J., 2001. Induction of plasminogen activator inhibitor 1 gene expression in adipocytes by thiazolidinediones. FASEB J. 15, 1233 /1235. Kao, A.W., Waters, S.B., Okada, S., Pessin, J.E., 1997. Insulin stimulates the phosphorylation of the 66- and 52-kilodalton Shc isoforms by distinct pathways. Endocrinology 138, 2474 /2480. Kennedy, B.P., Ramachandran, C., 2000. Protein tyrosine phosphatase-1B in diabetes. Biochem. Pharmacol. 60, 877 /883. Kenner, K.A., Anyanwu, E., Olefsky, J.M., Kusari, J., 1996. Proteintyrosine phosphatase 1B is a negative regulator of insulin- and insulin-like growth factor-I-stimulated signaling. J. Biol. Chem. 271, 19810 /19816. Kim, J.K., Fillmore, J.J., Chen, Y., Yu, C., Moore, I.K., Pypaert, M., Lutz, E.P., Kako, Y., Velez-Carrasco, W., Goldberg, I.J., Breslow, J.L., Shulman, G.I., 2001. Tissue-specific overexpression of lipoprotein lipase causes tissue-specific insulin resistance. Proc. Natl. Acad. Sci. USA 98, 7522 /7577. Klaman, L.D., Boss, O., Peroni, O.D., Kim, J.K., Martino, J.L., Zabolotny, J.M., Moghal, N., Lubkin, M., Kim, Y.B., Sharpe, A.H., Stricker-Krongrad, A., Shulman, G.I., Neel, B.G., Kahn, B.B., 2000. Increased energy expenditure, decreased adiposity, and tissue-specific insulin sensitivity in protein-tyrosine phosphatase 1B-deficient mice. Mol. Cell Biol. 20, 5479 /5489. Kletzien, R.F., Clarke, S.D., Ulrich, R.G., 1992. Enhancement of adipocyte differentiation by an insulin-sensitizing agent. Mol. Pharmacol. 41, 393 /398. Levin, A.A., 1999. A review of the issues in the pharmacokinetics and toxicology of phosphorothioate antisense oligonucleotides. Biochim. Biophys. Acta 1489, 69 /84. Maeda, N., Takahashi, M., Funahashi, T., Kihara, S., Nishizawa, H., Kishida, K., Nagaretani, H., Matsuda, M., Komuro, R., Ouchi, N., Kuriyama, H., Hotta, K., Nakamura, T., Shimomura, I., Matsuzawa, Y., 2001. PPARgamma ligands increase expression and plasma concentrations of adiponectin, an adipose-derived protein. Diabetes 50, 2094 /2099.
167
Mater, M.K., Thelen, A.P., Pan, D.A., Jump, D.B., 1999. Sterol response element-binding protein 1c (SREBP1c) is involved in the polyunsaturated fatty acid suppression of hepatic S14 gene transcription. J. Biol. Chem. 274, 32725 /32732. Morton, N.M., Holmes, M.C., Fievet, C., Staels, B., Tailleux, A., Mullins, J.J., Seckl, J.R., 2001. Improved lipid and lipoprotein profile, hepatic insulin sensitivity, and glucose tolerence in 11bhydroxysteroid dehydrogenase type 1 null mice. J. Biol. Chem. 276, 41293 /41300. Murakami, K., Tobe, K., Ide, T., Mochizuki, T., Ohashi, M., Akanuma, Y., Yazaki, Y., Kadowaki, T., 1998. A novel insulin sensitizer acts as a coligand for peroxisome proliferator-activated receptor-alpha (PPAR-alpha) and PPAR-gamma: effect of PPARalpha activation on abnormal lipid metabolism in liver of Zucker fatty rats. Diabetes 47, 1841 /1847. Nadler, S.T., Attie, A.D., 2001. Please pass the chips: genomic insights into obesity and diabetes. J. Nutr. 138, 2078 /2081. Nadler, S.T., Stoehr, J.P., Schueler, K.L., Tanimoto, G., Yandell, B.S., Attie, A.D., 2000. The expression of adipogenic genes is decreased in obesity and diabetes mellitus. PNAS 97, 11371 /11376. Okazaki, R., Miura, M., Toriumi, M., Taguchi, M., Hirota, Y., Fukumoto, S., Fujita, T., Tanaka, K., Takeuchi, 1999. Short-term treatment with troglitazone decreases bone turnover in patients with type 2 diabetes mellitus. Endocr. J. 46, 795 /801. Olefsky, J.M., 1999. Insulin-stimulated glucose transport minireview series. J. Biol. Chem. 274, 1863. Olefsky, J.M., Garvey, W.T., Henry, R.R., Brillon, D., Matthaei, S., Freidenberg, G.R., 1988. Cellular mechanisms of insulin resistance in non-insulin-dependent (type II) diabetes. Am. J. Med. 85, 86 / 105. Reaven, G.M., 1988. Role of insulin resistance in human disease. Diabetes 37, 1595 /1607 (Banting lecture 1988). Ribon, V., Johnson, J.H., Camp, H.S., Saltiel, A.R., 1998. Thiazolidinediones and insulin resistance: peroxisome proliferator-activated receptor gamma stimulates the expression of the CAP gene. Proc. Natl. Acad. Sci. USA 95, 14751 /14756. Rondinone, C.M., Trevillyan, J.M., Clampit, J., Gum, R.J., Berg, C., Kroeger, P., Frost, L., Zinker, B.A., Reilly, R., Ulrich, R., Butler, M., Monia, B.P., Jirousek, M.R., Waring, J.F., 2002. Protein tyrosine phosphatase 1B reduction regulates adiposity and expression of genes involved in lipogenesis. Diabetes 51, 2405 /2411. Shimomura, I., Hammer, R.E., Ikemoto, S., Brown, M.S., Goldstein, J.L., 1999. Leptin reverses insulin resistance and diabetes mellitus in mice with congenital lipodystrophy. Nature 401, 73 /76. Shimomura, I., Matsuda, M., Hammer, R.E., Bashmakov, Y., Brown, M.S., Goldstein, J.L., 2000. Decreased IRS-2 and increased SREBP-1c lead to mixed insulin resistance and sensitivity in livers of lipodystrophic and ob /ob mice. Mol. Cell 6, 77 /86. Shimomura, I., Shimano, H., Korn, B.S., Bashmakov, Y., Horton, J.D., 1998. Nuclear sterol regulatory element-binding proteins activate genes responsible for the entire program of unsaturated fatty acid biosynthesis in transgenic mouse liver. J. Biol. Chem. 273, 35299 /35306. Soukas, A., Cohen, P., Socci, N.D., Friedman, J.M., 2000. Leptinspecific patterns of gene expression in white adipose tissue. Genes. Dev. 14, 963 /980. Spiegelman, B.M., 1998. PPAR-g adipogenic regulator and thiazolidinedione receptor. Diabetes 47, 507 /514. Tobe, K., Suzuki, R., Aoyama, M., Yamauchi, T., Kamon, J., Kubota, N., Terauchi, Y., Matsui, J., Akanuma, Y., Kimura, S., Tanaka, J., Abe, M., Ohsumi, J., Nagai, R., Kadowaki, T., 2001. Increased expression of the sterol regulatory element-binding protein-1 gene in insulin receptor substrate-2(///) mouse liver. J. Biol. Chem. 276, 38337 /38340. Way, J.M., Harrington, W.W., Brown, K.K., Gottschalk, W.K., Sundseth, S.S., Mansfield, T.A., Ramachandran, R.K., Willson, T.M., Kliewer, S.A., 2001. Comprehensive messenger ribonucleic
168
J.F. Waring et al. / Molecular and Cellular Endocrinology 203 (2003) 155 /168
acid profiling reveals that peroxisome proliferator-activated receptor gamma activation has coordinate effects on gene expression in multiple insulin-sensitive tissues. Endocrinology 142, 1269 / 1277. White, M.F., 1998. The IRS-signalling system: a network of docking proteins that mediate insulin action. Mol. Cell Biochem. 182, 3 /11. Yamauchi, T., Kamon, J., Waki, H., Murakami, K., Motojima, K., Komeda, K., Ide, T., Kubota, N., Terauchi, Y., Tobe, K., Miki, H., Tsuchida, A., Akanuma, Y., Nagai, R., Kimura, S., Kadowaki, T., 2001. The mechanisms by which both heterozygous PPARgamma deficiency and PPARgamma agonist improve insulin resistance. J. Biol. Chem. 276, 41245 /41254.
Zhou, Y.T., Wang, Z.W., Higa, M., Newgard, C.B., Unger, R.H., 1999. Reversing adipocyte differentiation: implications for treatment of obesity. Proc. Natl. Acad. Sci. USA 96, 2391 /2395. Zinker, B.A., Rondinone, C.M., Trevillyan, J.M., Gum, R.J., Clampit, J.E., Waring, J.F., Xie, N., Wilcox, D., Jacobson, P., Frost, L., Kroeger, P.E., Reilly, R.M., Koterski, S., Opgenorth, T.J., Ulrich, R.G., Crosby, S., Butler, M., Murray, S.F., McKay, R.A., Bhanot, S., Monia, B.P., Jirousek, M.R., 2002. PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice. PNAS 99, 11357 / 11362.