- Email: [email protected]
Quantification of HIV-1 group M (subtypes A–G) and group O by the LCx HIV RNA quantitative assay
Journal of Virological Methods 89 (2000) 97 – 108 www.elsevier.com/locate/jviromet
Quantification of HIV-1 group M (subtypes A–G) and group O by the LCx HIV RNA quantitative assay Priscilla Swanson, Barbara J. Harris, Vera Holzmayer, Sushil G. Devare, Gerald Schochetman, John Hackett Jr. * AIDS Research and Retro6irus Disco6ery, Abbott Laboratories, D-9NG, Bldg. AP20, 100 Abbott Park Road, Abbott Park, IL 60064 -6015, USA Received 3 April 2000; received in revised form 22 May 2000; accepted 23 May 2000
Abstract Human immunodeficiency virus type 1 (HIV-1) genetic diversity presents a challenge to nucleic acid-based assays with regard to sensitivity of detection and accuracy of quantification. The Abbott LCx HIV RNA Quantitative assay (LCx® HIV assay), a competitive RT-PCR targeting the pol integrase region, was evaluated using a panel of 297 HIV-1 seropositive plasma samples from Cameroon, Uganda, Brazil, Thailand, Spain, Argentina and South Africa. The panel included group M subtypes A–G, mosaics, and group O based on sequence analysis of gag p24, pol integrase, and en6 gp41. The LCx HIV assay quantified 290 (97.6%) of the samples, including all the group O samples tested. In comparison, the Roche AMPLICOR HIV-1 MONITOR test versions 1.0 and 1.5 quantified 67.3 and 94.6% of the samples, respectively. No group O specimens were quantified by either version of AMPLICOR HIV-1 MONITOR. Seven specimens were below the detectable limits of all the three assays. The LCx HIV assay had fewer nucleotide mismatches at primer/probe binding sites as compared with both AMPLICOR HIV-1 MONITOR tests. The high degree of nucleotide conservation within the pol target region enables the LCx HIV assay to efficiently quantify the HIV-1 subtypes A–G and the most genetically diverse HIV-1, group O. © 2000 Elsevier Science B.V. All rights reserved. Keywords: HIV-1; RT-PCR assay; Viral load; Genetic diversity
1. Introduction Quantification of human immunodeficiency virus type 1 (HIV-1) is used routinely for the * Corresponding author. Tel.: +1-847-9380457; fax: +1847-9371401. E-mail address: [email protected] (J. Hackett Jr.).
clinical management of HIV infected patients. Plasma levels of HIV-1 RNA are measured to assess disease progression (Mellors et al., 1996) and to monitor response to antiretroviral therapy (Saag et al., 1996). Although, a variety of nucleic acid amplification or signal amplification technologies are available commercially (Kievits et al., 1991; Mulder et al., 1994; Kern et al., 1996; Michael et al., 1999; Murphy et al., 1999), all of
0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 0 0 ) 0 0 2 0 5 - 6
98
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
these methods rely on HIV sequence-specific primers and/or probes. Consequently, HIV-1 sequence variation within assay target regions can directly impact the efficiency of amplification and detection. HIV-1 is characterized by extensive genetic variability. Phylogenetic analysis of HIV-1 sequences collected from around the world has revealed the existence of three distinct groups: M, N, and O (Korber et al., 1998). Group M viruses have been further subdivided into subtypes A – J. In addition, recombination among HIV-1 subtypes that cocirculate has resulted in viral genomes consisting of unique combinations of subtypes. Subtype E is an example of a recombinant virus composed of subtype A in gag and pol genes and subtype E in en6 (Robertson et al., 1995). Variants with other mosaic patterns of intersubtype recombination such as G/A, H/G, A/G/I, and intergroup recombinants, such as group M (A)/group O, have also been described (Janssens et al., 1994; McCutchan et al., 1996; Carr et al., 1998; Nasioulas et al., 1999; Peeters et al., 1999). HIV-1 subtypes are distributed unevenly throughout the world. Current viral load testing has focused on quantitation of subtype B which predominates in the US and western Europe. Recently, an increasing number of non-B subtype infections has been identified in the US (Brodine et al., 1995; Rayfield et al., 1996), Belgium (Fransen et al., 1996), France (Barin et al., 1997), England (Arnold et al., 1995a), Sweden (Alaeus et al., 1997a), and Germany (Dietrich et al., 1997). For this reason, it has become imperative that viral load assays accurately quantitate all the HIV-1 group M subtypes, as well as group O infections. It has already been reported that some commercial assays either underquantitate or fail to detect HIV subtypes A, E, and G, and none reliably quantify group O strains (Loussert-Ajaka et al., 1995; Arnold et al., 1995b; Coste et al., 1996; Vandamme et al., 1996; Dunne and Crowe, 1997; Gobbers et al., 1997; Jackson et al., 1997; Alaeus et al., 1997b; Debyser et al., 1998; Nolte et al., 1998; Triques et al., 1999). The Abbott LCx HIV RNA Quantitative assay (LCx® HIV assay) measures HIV-1 RNA concen-
trations through a competitive reverse transcriptase polymerase chain reaction (RT-PCR) that targets a highly conserved region of the HIV-1 pol integrase gene (pol IN). The objective of this study was to evaluate the performance of the LCx HIV assay on a well-characterized panel of 297 plasma specimens consisting of HIV-1 group M subtypes A–G, intersubtype recombinants, and group O. Viral load determinations by the LCx HIV assay were compared with those obtained by the AMPLICOR HIV MONITOR test version 1.0 (Roche Diagnostics; US Food and Drug Administration licensed test) and version 1.5, both of which target the gag region. In addition, we sequenced the gag p24 and pol IN target regions of the samples to evaluate the level of genetic variation at primer and probe binding sites. 2. Materials and methods
2.1. Sample collection HIV-1-infected plasma samples were collected from individual asymptomatic blood donors from January 1993 to November 1998 by; (1) Dr Lutz Gu¨rtler, University of Greifswald, Institute of Medical Microbiology, Greifswald, Germany, (2) Dr Leopold Zekeng and Dr Lazare Kaptue´, Labo et Transfusion Sanguine, Centre Hospitalier Universitaire, Yaounde, Cameroon, (3) Dr Peter Kataaha, Nakasero Blood Bank, Kampala, Uganda, (4) Dr Brooks Jackson, Department of Pathology, Johns Hopkins Medical Institutions, Baltimore, MA, USA, (5) Dr Amilcar Tanuri, Departamento de Genetica, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Brazil, (6) Dr Vincent Soriano, Service of Infectious Diseases, Instituto de Salud Carlos III, Madrid, Spain, (7) Dr Sasitorn Bejrachandra, Sirirah Hospital, Bangkok, Thailand, (8) Monica Galloway, WP Blood Transfusion Service, Cape Town, South Africa, and (9) Carlos Filipini, Abbott Diagnostics Division, Buenos Aires, Argentina. All the specimens tested positive for antibodies to HIV by at least one commercially available HIV-1 antibody enzyme immunoassay. Plasma samples were aliquotted into 0.2-ml aliquots and stored at − 70°C until testing.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
2.2. Molecular characterization of the plasma panel Three regions of the HIV-1 genome were targeted for sequence analysis, gag p24, pol IN, and en6 gp41 immunodominant region (IDR). Total nucleic acid was extracted from 200 to 400 ml plasma using the QIAamp Blood Kit (Qiagen Inc., Chatsworth, CA). Primers and conditions for RT-PCR amplification of p24 and IDR regions have been described earlier (Hackett et al., 1997; Brennan et al., 1997a,b; Tanuri et al., 1999). Primers used for integrase analysis are listed in Table 1.
2.2.1. Integrase RT-PCR The integrase region was amplified using an RNA PCR kit (Perkin Elmer, Foster City, CA). Complementary DNA synthesis was carried out as described earlier (Hackett et al., 1997). Firstround PCR amplification consisted of denaturation at 95°C for 1 min, 40 cycles of 94°C for 30 s, 45°C for 30 s, 72°C for 90 s, and a final extension at 72°C for 10 min. A GeneAmp PCR kit (Perkin Elmer) was used for nested PCR amplification with 1/20th of the first round product as template and 25 pmol of each primer. Cycling conditions were similar to the first round except that annealing was performed at 55°C.
99
2.2.2. Sequence analysis PCR products were purified using either a QIAamp PCR purification kit, QIAEX II gel extraction kit, or QIAquick gel extraction kit (Qiagen Inc). Both the strands were sequenced directly using an ABI Prism Big Dye Terminator Cycle Sequencing Reaction Kit (PE Applied Biosystems, Foster City, CA) and an ABI model 377 automated sequencer (PE Applied Biosystems). Sequence data were analyzed using Sequencher 3.0 (Gene Codes Corp., Ann Arbor, MI). For subtype determination, nucleic acid sequences were trimmed to equivalent lengths (399nt gag p24, 864nt pol IN, and 369nt en6 gp41 IDR) and aligned with representative HIV-1 group M subtypes and group O sequences. Alignments were generated using Sequencher 3.0 or Geneworks 2.45 (Oxford Molecular Group, Inc., Campbell, CA, USA) and edited manually. Phylogenetic analysis was undertaken using the Phylip software package (University of Washington, Seattle, WA) with a SIVcpz (GenBank accession no. X52154) outgroup as described earlier (Brennan et al., 1997a). 2.3. HIV-1 6iral load determination 2.3.1. The LCx HIV RNA Quantitati6e assay The LCx® HIV assay (Abbott Laboratories, Abbott Park, IL) was carried out on 297 HIV-1
Table 1 Oligonucleotides for amplification of HIV-1 integrase RT-PCR steps Group M cDNA and 1st round PCR Nested PCR Group O cDNA and 1st round PCR Nested PCR
a
Primer
Sequence (5%\3%)a
Locationb
M-poli8 M-poli5 M-poli7 M-poli6
TAGTGGGATGTGTACTTCTGAAC CACACAAAGGRATTGGAGGAAATG AACAAGTAGATAAATTAGTCAGT ATACATATGRTGTTTTACTAARCT
5210B5232 4177\4200 4201\4223 5122B5145
O-poli8 O-poli5 O-poli7 O-poli6
GATTYCTGGATTCATAATGATG GTATCTTACATGGGTTCCTGC CAYAAAGGCATAGGAGGAAATG CCTGTAYTTATGGTATTTCAC
5219B5240 4197\4217 4219\4240 5168B5188
Degenerate nucleotide positions are identified using the IUPAC code. Primer positions for group M correspond to HIVMNCG GenBank accession no. M17449 and for group O correspond to HIVANT70C GenBank accession no. L20587. b
100
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
seropositive specimens according to the manufacturer’s specifications. A detailed description of the assay is provided by Johanson et al., 2000. Briefly, total nucleic acid was extracted from 0.2 ml of plasma using a modified QIAamp viral nucleic acid extraction kit (Qiagen, Gmbh, Hilden, Germany). Internal standard (IS) transcript (HIV-1 RNA transcript, similar to native HIV-1 except for a short unique internal sequence) was added to each sample and processed simultaneously with the clinical specimen. HIV-1 was then quantitated by (i) single step rTth DNA polymerase-mediated competitive RT-PCR using one hapten-labeled primer, (ii) hybridization with hapten-labeled probes specific for HIV-1 or IS, and (iii) dual detection of amplification products using microparticle enzyme immunoassay (MEIA) on an automated LCx analyzer. The LCx analyzer calculates a log of the rate ratio (LCx rate counts for HIV divided by rate counts for IS) and plots a standard curve of the mean log ratio for each calibrator against its corresponding RNA concentration. For the 0.2 ml sample preparation protocol, the upper (ULQ) and lower (LLQ) limits of quantitation are 5 011 872 (6.7 log10) copies per ml and 178 copies (2.25 log10) copies per ml, respectively.
2.3.2. AMPLICOR HIV MONITOR test 6ersions 1.0 and 1.5 The AMPLICOR HIV-1 MONITOR tests version 1.0 and version 1.5 (Roche Diagnostics, Branchburg, NJ) were performed according to the manufacturer’s instructions. Version 1.0 was used by Ronald Lollar at Rush Presbyterian St. Luke’s Medical Center, Chicago, IL to analyze 278 specimens and version 1.5 was used at LabCorp, Research Triangle Park, NC to analyze 297 specimens. Both the procedures utilize 0.2 ml plasma and involve (i) disruption of the virus, (ii) single step rTth DNA polymerase-mediated RTPCR using biotinylated primers and one internal competitor RNA (quantification standard QS), (iii) hybridization of HIV-1 and QS amplification products in specific probe-coated microtiter plates, (iv) enzyme-linked colorimetric detection of amplification products, and (v) calculation of RNA copies per ml. Both the assays target the
gag p24 region of HIV-1: version 1.0 uses primers SK431 and SK462 and version 1.5 uses SK145 and SKCC1B (Triques et al., 1999). The ULQ and LLQ for both assays are 750 000 (5.87 log10) copies per ml and 400 (2.6 log10) copies per ml, respectively. The lower limit of detection for version 1.0 is 200 copies per ml (2.3 log10).
3. Results
3.1. Genetic analysis of clinical specimens A total of 297 HIV-1 seropositive plasma samples were studied. These specimens were obtained from a variety of geographic regions including Cameroon (n= 114), Uganda (n=65), South Africa (n=19), Brazil (n=51), Argentina (n= 3), Spain (n= 2), Thailand (n=42) and the US (n= 1). To assign group and subtype, three distinct regions of the genome (gag p24, pol IN, and en6 gp41 IDR) were PCR-amplified for sequence analysis. Amplification of all the three regions was successful for 288 of the 297 specimens. Group and subtype could not be determined for two specimens because they were PCR-negative for all the regions examined. For seven specimens, sequence could be obtained on only one or two of the regions analyzed. Therefore, subtype was assigned provisionally based on available sequence information. Specimens for which the subtype designation differed between the genetic regions analyzed were categorized as mosaics. However, subtype E, known to be an intersubtype recombinant of A and E, was designated herein as a subtype to conform with the prevailing designations. Based on phylogenetic analysis, the panel was composed of group M subtypes A–G, mosaics, and group O specimens (Table 2). Of interest, 104 of the 295 (35.2%) specimens for which group/subtype could be determined were categorized as mosaics. Of the mosaics, 70 of 104 (66.7%) were subtyped as A for gag p24, G for pol IN and A for en6 gp41 IDR and originated from Cameroon. Other subtype combinations observed in the mosaic category included; 7 A/G (distinct from those described above), 15 D/A, 3 F/A, 7 F/B, 1 D/B, and 2 C/A.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
101
Table 2 HIV-1 RNA quantitation by LCx HIV quantitative assay and AMPLICOR MONITOR test versions 1.0 and 1.5 Genetic subtype
N
Quantitated samples (%) AMPLICOR MONITOR LCx HIV
A B C D E F G Mosaic Not determined Group O Total
38 46 18 30 36 9 8 104 2 6 297
97 93 100 100 100 100 88 100 0 100 97.6% (290/297)
Version 1.0a 71 91 100 90 91 38 62 47 0 0 67.3% (187/278)
Version 1.5 97 93 100 100 100 100 75 98 0 0 94.6% (281/297)
a 278 of the 297 samples were tested by AMPLICOR HIV MONITOR version 1.0. Samples not tested included 2 B, 13 C, 1 D, 1 E, 1 F, and 1 group O.
3.2. Viral load determination The LCx® HIV assay quantitated HIV-1 viral RNA in 290 of 297 (97.6%) seropositive plasma samples (Table 2). The range of viral load concentrations and subtype distribution of quantitated samples is shown in Fig. 1. Within each HIV-1 group M subtype (A – G and mosaics), specimens had measurable levels of RNA spanning the assay dynamic range. The six group O samples tested were all quantitated by the LCx HIV assay, and viral loads ranged between 500 and 20 000 copies per ml. The AMPLICOR HIV-1 MONITOR test version 1.0 was used to examine 278 of the 297 samples; 2 B, 13 C, 1 D, 1 E, 1 F, and 1 group O were not tested in version 1.0. MONITOR version 1.0 quantified 187 of 278 (67.3%) samples (Table 2). Eighty-four of 278 (30.2%) samples (including 10 A, 1 B, 3 D, 3 E, 5 F, 2 G, 55 mosaics, and the five group O specimens tested) were quantitated by the LCx HIV assay but were below the version 1.0 LLQ of 400 copies per ml. In fact, 71 of these 84 samples (84.5%) were below the lower limit of detection (200 copies per ml) of version 1.0. Of the 55 mosaics, 51 (92.7%) were recombinants consisting of subtype A in gag p24 and G in pol
IN, 3 (5.4%) were recombinants of subtypes A and D (one A in gag p24 and D in pol IN, one D in gag p24 and A in pol IN, one A in gag p24 and pol IN, but D in en6 gp41 IDR), and 1 sample was F in gag p24 and pol IN but B in en6 gp41 IDR. AMPLICOR HIV-1 MONITOR test version 1.5 quantified 281 of 297 (94.6%) samples (Table
Fig. 1. Subtype and viral load distribution of samples quantified by LCx RNA Quantitative assay (n = 290). LCx log10 copies per ml are represented by black diamonds. Average log10 copies per ml for each subtype are represented by open squares. Lower limit of quantitation (LLQ) is shown as a dashed line at 2.25 log10 copies per ml.
102
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
Fig. 2. Comparison of HIV-1 seropositive specimens quantified by LCx HIV RNA Quantitative assay (lower limit of quantitation shown as 2.25 log10 copies per ml) and AMPLICOR HIV-1 MONITOR test version 1.0 (lower limit of quantitation shown as 2.6 log10 copies per ml) (n= 278) HIV-1 group M samples are represented as black circles. Group O samples are represented as open circles.
Fig. 3. Comparison of HIV-1 seropositive specimens quantified by LCx HIV RNA Quantitative assay (lower limit of quantitation shown as 2.25 log10 copies per ml) and AMPLICOR HIV-1 MONITOR test version 1.5 (lower limit of quantitation shown as 2.6 log10 copies per ml) (n= 297) HIV-1 group M samples are represented as black circles. Group O samples are represented as open circles.
2). Nine of the 297 (3%) samples were quantitated by the LCx HIV assay but were below the MONITOR version 1.5 LLQ of 400 copies per ml, and included one subtype G from Cameroon, one mosaic from Cameroon (A in gag p24, G in pol IN, and A in en6 gp41 IDR), one mosaic from Uganda (D in gag p24 and pol IN and A in en6 gp41 IDR), and all six group O specimens tested. Seven of the 297 HIV seropositive samples (2.4%) were below the LLQ of all the three assays. These included; 1 Cameroonian G, 1 Ugandan A, 3 Brazilian B and 2 Brazilian specimens for which subtype could not be determined because they were PCR-negative for all the three regions. A comparison of RNA levels as determined by the LCx® HIV assay and AMPLICOR HIV-1 MONITOR version 1.0 is presented in Fig. 2. Correlation of the 187 samples quantitated by both the assays was 0.564 with a slope of 0.512 and intercept of 2.3. Relative to AMPLICOR MONITOR version 1.0, the LCx HIV assay underquantified just 1 sample (subtype B from Cameroon) by more than 1 log10 copies per ml (1.49 logs). Conversely, relative to the LCx HIV assay, version 1.0 detected but underquantified 24 specimens (12.8%) by greater than 1 log10 copies per ml. The underquantitated specimens consisted of 7 A, 2 E, 1 F, and 14 mosaics. Thirteen of the 14 mosaics had gag p24 of subtype A, the other was subtype F. There was an improved correlation of plasma RNA levels obtained by the LCx HIV assay and AMPLICOR HIV-1 MONITOR version 1.5 (Fig. 3). The observed correlation of 281 quantitated specimens was 0.841 with a slope of 0.850 and intercept of 0.45. Notably, viral loads determined by the two assays differed by \1 log10 for only 6 of 281 specimens (2.1%). Relative to version 1.5, the LCx® HIV assay underquantified 1 Cameroonian B, 1 Argentinian F, and 4 Cameroonian A/G mosaics (A gag p24/G pol IN/A en6 gp41 IDR). Upon retest in both the assays, the viral load determined for the subtype F and 2 of the mosaic specimens were within 1 log10 copies per ml between the two assays. Thus, consistent differences in quantitation of \ 1 log10 between the LCx HIV assay and AMPLICOR HIV-1 MONITOR version 1.5 were observed for only three of the 281 specimens examined.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
Average log10 copies per ml for each subtype were compared for the LCx® HIV assay versus both MONITOR tests. Between LCx and version 1.0 assays, mean RNA levels for quantified samples were within 0.5 log10 copies per ml for subtypes B, C, D, G, and the mosaics and were within 0.68, 0.57, and 0.86 log10 copies per ml for subtypes A, E, and F, respectively. Relative to version 1.5, mean RNA values determined by the LCx HIV assay were within 0.22 log10 copies per ml for all the group M subtypes.
3.3. Nucleotide mismatches at primer/probe sites To assess the number of nucleotide mismatches at primer and probe binding sites, the pol IN and gag p24 sequences of each specimen were evaluated (Table 3). Overall, specimens had fewer total primer/probe mismatches within the pol IN target region of the LCx HIV assay than was observed for the gag p24 target regions of AMPLICOR HIV-1 MONITOR versions 1.0 or 1.5. The LCx assay had a mean number of total nucleotide mismatches of
103
1.18 (range of 0–8 mismatches). In contrast, AMPLICOR HIV-1 MONITOR versions 1.0 and 1.5 had four to six times more total nucleotide mismatches: version 1.0 had a mean 6.7 changes (range of 2–24) and version 1.5 had a mean 4.2 changes (range 0–23). For the LCx HIV assay, the greatest number of mismatches was observed for the forward primer relative to group O sequences (mean of 4.0 and range of 3–5). By comparison, forward primers for AMPLICOR HIV-1 MONITOR versions 1.0 and 1.5 had a mean of 9.0 (range 8–11) and 9.7 (range 8–12) mismatches, respectively, versus group O sequences. Of the 290 pol IN sequences examined, 90.5% of samples had two or fewer total nucleotide mismatches at the primer and probe binding sites in the LCx HIV assay. For the LCx HIV assay, two or fewer mismatches were observed in the forward primer in 97.2% of samples and in 99.3% of samples at the reverse primer and probe sites. In contrast, of 292 gag p24 sequences analyzed, only 0.3 and 22.6% of samples had two or fewer total mismatches at primer/probe binding sites in version 1.0 and version 1.5, respectively.
Table 3 Nucleotide mismatches at primer/probe binding sites for LCx HIV and Monitor versions 1.0 and 1.5 HIV-1 group M subtype A
B
LCx HIV HIV-1 forward HIV-1 probe HIV-1 reverse Total
0.3 (0–2)a 0 0.08 (0–1) 0.4 (0–2)
0.2 0.1 0.3 0.6
MONITOR 1.0 SK462 forward SK102 probe SK431 reverse Total
4.9 1.9 1.7 8.5
MONITOR 1.5 SK145 forward SK102 probe SKCC1B reverse Total
3 (2–5) 1.9 (1–3) 0.8 (0–3) 5.7 (4–8)
a
Mean (range).
(4–6) (1–3) (1–3) (7–11)
Group C
D
E
F
(0–1) (0–1) (0–3) (0–3)
1.1 (1–2) 0.06 (0–1) 0.2 (0–1) 1.3 (1–2)
0.2 (0–1) 0 0.1 (0–1) 0.3 (0–2)
1.1 (1–2) 0.03 (0–1) 0.06 (0–1) 1.2 (1–3)
0.8 0.4 0.8 1.9
2.4 0.7 1.3 4.4
(2–4) (0–2) (1–2) (3–7)
2.4 2.6 1.3 6.3
(1–4) (1–5) (1–2) (4–9)
2.1 0.6 2.5 5.2
(0–5) (0–2) (2–4) (2–7)
5.0 1.4 2.1 8.5
0.6 0.7 0.4 1.6
(0–3) (0–2) (0–2) (0–4)
0.6 2.6 0.2 3.3
(0–2) (1–5) (0–1) (2–6)
0.9 0.6 1.2 2.7
(0–3) (0–2) (0–3) (1–7)
3 (2–5) 1.4 (0.5) 0.1 (0–1) 4.5 (3–8)
(4–7) (0–5) (2–3) (7–12)
G
O
(0–4) (0–1) (0–1) (0–5)
1.1 (0–2) 0.6 (0–1) 0.3 (0–1) 2 (0–3)
4.0 (3–5) 0 1.3 (1–3) 5.3 (4–8)
2.3 2.6 4.3 9.2
(2–4) (2–3) (3–5) (8–10)
3.5 (2–5) 4.0 (2–6) 3.0 (2–6) 10.5 (8–17)
9.0 (8–11) 7.0 (6–8) 6.3 (6–7) 22.3 (20–24)
0.6 2.6 1.8 4.9
(0–2) (2–3) (1–2) (4–6)
3 (2–5) 4.0 (2–6) 1.6 (0–3) 8.6 (6–12)
9.7 (8–12) 7.0 (6–8) 4.7 (4–5) 21.3 (19–23)
104
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
4. Discussion It is important that diagnostic assays accurately quantify all the known HIV-1 subtypes, intersubtype recombinants, and emerging variants since viral load is used to monitor drug efficiency in HIV-1 infected patients in many parts of the world. Furthermore, HIV-1 group and subtyperelated sequence differences have been shown to lead to underquantitation in a variety of nucleic acid-based assays including the AMPLICOR HIV-1 MONITOR version 1.0, gag-based NASBA (NucliSens HIV-1 QT assay; Organon Teknika), and the Quantiplex HIV-1 RNA assay (Chiron Corporation; Loussert-Ajaka et al., 1995; Christopherson et al., 1997; Gobbers et al., 1997; Jackson et al., 1997; Respess et al., 1997; Alaeus et al., 1997b; Debyser et al., 1998; De Baar et al., 1999; Triques et al., 1999). To date, the only assays shown to quantify HIV-1 group O are the LTR-based NASBA (De Baar et al., 1999) and the Digene Hybrid Capture® II HIV RNA v1.0 test (Schiltz et al., 2000). In the present study, a panel of 297 HIV-1 seropositive plasma samples was collected from a variety of geographic sites, and the group and subtype assignment of HIV-1 present in each sample was characterized by sequence analysis of the three distinct regions of the genome (gag p24, pol IN and en6 gp41 IDR). This degree of genetic analysis, provides the opportunity to identify the ever-increasing proportion of intersubtype recombinant (mosaic) HIV-1 infections, and is particularly relevant when comparing assay performance between probes-based technologies that target different regions of the viral genome (e.g. pol IN for LCx® HIV assay and gag p24 for AMPLICOR HIV-1 MONITOR tests). Analysis of the panel revealed that 35% of the specimens were infected with mosaic viruses. The majority of the mosaics (66.7%) were collected in Cameroon and have a genomic organization consistent with IbNG isolates (A in gag p24, G in pol IN, A in en6 gp41 IDR (Carr et al., 1998)). It was reported recently that IbNG-like infections predominate in Cameroon (Hackett et al., 1999), a region of Africa where the majority of infections were previously thought to be subtype A viruses (Takehisa
et al., 1998). This confirms the value of analyzing multiple genomic regions to reveal the presence of many infections where the subtype assignment differs between the gag and pol target regions. The LCx HIV RNA Quantitative assay is a semi-automated assay based on nucleic acid amplification and probe detection. The assay was designed to take advantage of the high degree of nucleotide conservation in the pol IN region of the HIV-1 genome. To assess performance on genetically diverse HIV-1 infections, we examined the ability of the LCx® HIV assay to quantify viral RNA levels in a plasma panel composed of HIV-1 group M subtypes A through G, intersubtype mosaics, and group O infections. Of these specimens, 97.6% were quantitated by the LCx HIV assay. No group- or subtype-specific deficiencies in quantification were observed. Seven HIV-1 antibody positive specimens not detected/ quantified by the LCx HIV assay were also below the detectable limits of the AMPLICOR HIV-1 MONITOR version 1.0 and 1.5 tests. As compared with the LCx HIV assay, AMPLICOR HIV-1 MONITOR version 1.0 either failed to detect or underquantitated 43% of the samples tested; 30.2% were below the LLQ of version 1.0 and an additional 12.8% were underquantitated by greater than 1 log10 copies per ml. Notably, 80% of these samples were subtype A in the gag target region. These data are consistent with results of the earlier studies demonstrating deficiencies in detection and accuracy in quantification of subtype A infections by the version 1.0 test (Loussert-Ajaka et al., 1995; Coste et al., 1996; Christopherson et al., 1997; Jackson et al., 1997; Michael et al., 1999; Triques et al., 1999). Similar to others, we also observed significant deficiencies in quantification of subtype E, F and G and group O infections (Respess et al., 1997; Debyser et al., 1998; Michael et al., 1999; Triques et al., 1999). In contrast, for HIV-1 group M subtypes A–G, there was a high degree of correlation between viral loads determined by the LCx® HIV assay and the AMPLICOR HIV-1 MONITOR version 1.5 test. Thus, detection of group M subtype infections (particularly A, E, F and G) by version 1.5 is significantly improved relative to the version
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
1.0 test, and overall sensitivity is similar to the LCx HIV assay. These results are consistent with reports that demonstrate version 1.5 quantifies more reliably and accurately subtypes A through G (Michael et al., 1999; Triques et al., 1999). This improvement in performance is presumably due to both the revised primer selection reducing the number of nucleotide mismatches and to the adjustments in PCR cycling conditions. However, even with these modifications, version 1.5 failed to detect any of the group O samples tested. In some cases, plasma RNA levels obtained by version 1.5 tended to be slightly higher than those measured by the LCx HIV assay. There are data to suggest that the version 1.5 assay may slightly overestimate viral RNA levels (Triques et al., 1999) which could account for the observed difference. Remarkably, reproducible differences of more than 1 log10 copies per ml in viral load determinations for group M infections between the LCx HIV assay and the version 1.5 test were only seen in 1% of cases. None of the samples underquantitated by the LCx assay relative to version 1.5 had more than three mismatches in any primer, and the mismatches did not appear to be in critical positions (e.g. near the 3% end). Based on studies of Christopherson et al., 1997, the efficiency of RT-PCR amplification is not significantly impacted unless there are five or more mismatches in the primer – template duplex. Thus, the molecular basis for the observed difference in viral quantification for these specimens is unclear. Seven seropositive samples were not detected by any of the quantitative assays. Based on the available sequence information, the infections included 1 Cameroonian G, 1 A from Uganda, 3 Brazilian B and 2 Brazilian samples for which subtype could not be determined since they were PCRnegative for all the three regions. We believe that failure to detect viral RNA is due to very low viral loads (below detectable limits of all three assays) in these specimens. Consistent with this interpretation is the difficulty experienced in the molecular characterization of these samples using nested PCR. For only one of these specimens (subtype G) could all three regions (gag, pol, en6) be amplified. Only two regions were successfully amplified from one subtype A (pol and en6) and
105
from one subtype B (gag and en6) infection. Only the gag region could be amplified from the two other B infections. Moreover, analysis of the available gag and pol target regions from these specimens revealed no molecular basis for inefficient or failed detection in the quantitative assays. Analysis of the primer and probe binding sites within gag p24 and pol IN revealed significant differences in the level of nucleotide conservation between the LCx® HIV assay and the AMPLICOR HIV-1 MONITOR tests. The LCx HIV primers and probes had fewer mismatches across all the groups and subtypes of HIV-1 than observed for either the version 1.0 or 1.5 tests. For example, MONITOR version 1.5 was designed to enhance the detection of subtype A infections relative to version 1.0. However, the mean number of total mismatches was only reduced from 8.5 in version 1.0 to 5.7 in version 1.5, which is substantially more than the 0.4 observed for the LCx HIV assay. For the LCx HIV assay, a maximum of five total mismatches were observed for group M subtypes and up to eight mismatches were present in group O samples. In comparison, in the AMPLICOR HIV-1 MONITOR version 1.0 test, there were up to 17 total mismatches in group M specimens and 24 for group O. Although the AMPLICOR HIV-1 MONITOR version 1.5 test had reduced the numbers of mismatches relative to version 1.0, up to 12 total mismatches were observed for group M specimens and 23 in group O. The large number of total mismatches seen for group O isolates is consistent with the inability of both versions of the AMPLICOR HIV-1 MONITOR test to detect group O infections. It has been reported that up to four primer/template mismatches can be tolerated for accurate RNA quantitation (Christopherson et al., 1997). Of interest, only 1 group M specimen out of 284 evaluated had as many as four mismatches within a LCx primer site. In fact, the specimens had two or fewer mismatches in 96, 98 and 100% of cases for the forward primer, reverse primer, and probe, respectively. Although representative subtype H, I and J specimens were not available for evaluation in the LCx® HIV assay, examination of pol IN sequences in the Los Alamos database revealed that
106
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
the primer and probe sites are highly conserved (two or fewer mismatches per primer or probe). None of the observed mismatches were in critical regions of the primer. Therefore, the LCx HIV assay would be expected to accurately quantify subtype H, I, and J infections. Based on these data, the LCx HIV assay offers a desirable alternative to the existing commercial assays for monitoring viral load. It combines a simple and reproducible sample preparation procedure with automated amplicon detection. Moreover, nucleotide conservation within the primer and probe regions results in subtype-independent quantification. This provides a significant advantage for quantitation of non-B subtype specimens and the increasing number of intersubtype recombinant infections. The overall concordance between viral loads as determined by the LCx HIV assay and AMPLICOR HIV-1 MONITOR version 1.5 test will facilitate the use of LCx HIV RNA Quantitative assay in patients who have been tested earlier using the AMPLICOR MONITOR tests. Reliable detection of all HIV-1 infections, regardless of the group or subtype, would also be beneficial to ensure the safety of plasma-derived products. This study demonstrates that the LCx HIV RNA Quantitative assay detects and efficiently quantifies HIV-1 group M subtypes A – G. The high level of nucleotide conservation at the primer and probe binding sites allows the LCx HIV assay to quantify even the most genetically diverse HIV-1 infections, group O.
Acknowledgements The authors would like to thank Janet Winkler, Julie Johanson, Gregor Leckie, Marilyn Vi, and Arthur Martinez for providing LCx technical expertise and reagents, Catherine Brennan, Julie Yamaguchi, Alan Golden, Pierre Bodelle, Ana Vallari and Jennifer Lund for help in molecular characterization of the panel, and Catherine Brennan, John Robinson, Julie Johanson and Sharon Muldoon for critical review of the manuscript.
References Alaeus, A., Leitner, T., Lidman, K., Albert, J., 1997a. Most HIV-1 genetic subtypes have entered Sweden. AIDS 11, 199 – 202. Alaeus, A., Lidman, K., So¨nnerborg, A., Albert, J., 1997b. Subtype-specific problems with quantification of plasma HIV-1 RNA. AIDS 11, 859 – 865. Arnold, C., Barlow, K.L., Parry, J.V., Clewley, J.P., 1995a. At least five HIV-1 sequence subypes (A, B, C, D, A/E) occur in England. AIDS Res. Hum. Retroviruses 11, 427 – 429. Arnold, C., Barlow, K.L., Kaye, S., Loveday, C., Balfe, P., Clewley, J.P., 1995b. HIV type 1 sequence subtype G transmission from mother to infant: failure of variant sequence species to amplify in the Roche Amplicor test. AIDS Res. Hum. Retroviruses 11, 999 – 1001. Barin, F., Courouce, A.-M., Pillonel, J., Buzelay, L., 1997. Increasing diversity of HIV-1m serotypes in French blood donors over a 10-year period (1985 – 1995). AIDS 11, 1503 – 1508. Brennan, C.A., Lund, J.K., Golden, A., Yamaguchi, J., Vallari, A.S., Phillips, J.F., Kataaha, P.K., Jackson, J.B., Devare, S.G., 1997a. Serologic and phylogenetic characterization of HIV-1 subtypes in Uganda. AIDS 11, 1823 – 1832. Brennan, C.A., Hackett, J. Jr, Zekeng, L., Lund, J.K., Vallari, A.S., Hickman, R.K, Gu¨rtler, L., Kaptue, L., Von Overbeck, J., Hampl, H., Devare, S.G., 1997b. Sequence of gp41en6 immunodominant region of HIV type 1 group O from West Central Africa. AIDS Res. Hum. Retroviruses 13, 901 – 904. Brodine, S.K., Mascola, J.R., Weiss, P.J., Ito, S.I., Porter, K.R., Artenstein, A.W., Garland, F.C., McCutchan, F.E., Burke, D.S., 1995. Detection of diverse HIV-1 genetic subtypes in the USA. Lancet 346, 1198 – 1199. Carr, J.K., Salminen, M.O., Albert, J., Sanders-Buell, E., Gotte, D., Birx, D.L., McCutchan, F.E., 1998. Full genome sequences of human immunodeficiency virus type 1 subtypes G and A/G intersubtype recombinants. Virology 247, 22 – 31. Christopherson, C., Sninsky, J., Kwok, S., 1997. The effects of internal primer-template mismatches on RT-PCR: HIV-1 model studies. Nucl. Acids Res. 25, 654 – 658. Coste, J., Montes, B., Reynes, J., Peeters, M., Segarra, C., Vendrell, J.-P., Delaporte, E., Segondy, M., 1996. Comparative evaluation of three assays for the quantitation of human immunodeficiency virus type 1 RNA in plasma. J. Med. Virol. 50, 293 – 302. De Baar, M.P., Van der Schoot, A.M., Goudsmit, J., Jacobs, F., Ehren, R., Van der Horn, K.H.M., Oudshoorn, P., De Wolf, F., De Ronde, A., 1999. Design and evaluation of a human immunodeficiency virus type 1 RNA assay using nucleic acid sequence-based amplification technology able to quantify both group M and O viruses by using the long terminal repeat as target. J. Clin. Microbiol. 37, 1813 – 1818.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108 Debyser, Z., Van Wungaerden, E., Van Laethem, K., Beuselinck, K., Reynders, M., De Clercq, E., Desmyter, J., Vandamme, A.-M., 1998. Failure to quantify viral load with two of the three commercial methods in a pregnant woman harboring an HIV type 1 subtype G strain. AIDS Res. Hum. Retroviruses 14, 453–459. Dietrich, U., Ruppach, H., Gehring, S., Knechten, H., Knickmann, M., Ja¨ger, H., Wolf, E., Husak, R., Orfanos, C.E., Brede, H.D., Ru¨bsamen-Waigmann, H., Von Briesen, H., 1997. Large proportion of non-B HIV-1 subtypes and presence of zidovudine resistance mutations among German seroconvertors. AIDS 11, 1532–1533. Dunne, A.L., Crowe, S.M., 1997. Comparison of branched DNA and reverse transcriptase polymerase chain reaction for quantifying six different HIV-1 subtypes in plasma. AIDS 11, 126 – 127. Fransen, K., Buve´, A., Nkengasong, J.N., Laga, M., Van der Groen, G., 1996. Longstanding presence in Belgians of multiple non-B HIV-1 subtypes. Lancet (Letter) 347, 1403. Gobbers, E., Fransen, K., Oosterlaken, T., Janssens, W., Heyndrickx, L., Ivens, T., Vereecken, K., Schoones, R., Van de Wiel, P., Van der Groen, G., 1997. Reactivity and amplification efficiency of the NASBA HIV-1 RNA amplification system with regard to different HIV-1 subtypes. J. Virol. Methods 66, 293–301. Hackett, J. Jr, Zekeng, L., Brennan, C.A., Lund, J.K., Vallari, A.S., Hickman, R.K., Gu¨rtler, L., Kaptue´, L., Devare, S.G., 1997. Genetic analysis of HIV type 1 group O p24gag sequences from Cameroon and equatorial Guinea. AIDS Res. Hum. Retroviruses 13, 1155–1158. Hackett, J. Jr, Brennan, C., Yamaguchi, J., Fedosova, V., Swanson, P., Zekeng, L., Kaptue´, L., Gu¨rtler, L., Devare, S., 1999. Predominance of HIV-1 A/G intersubtype recombinants in Cameroon. In: 6th Conference on Retroviruses and Opportunistic Infections, Abstr., p. 120. Jackson, J.B., Piwowar, E.M., Parsons, J., Kataaha, P., Bihibwa, G., Onecan, J., Kabengera, S., Kennedy, S.D., Butcher, A., 1997. Detection of human immunodeficiency virus type 1 (HIV-1) DNA and RNA sequences in HIV-1 antibody-positive blood donors in Uganda by the Roche AMPLICOR assay. J. Clin. Microbiol. 35, 873–876. Janssens, W., Heyndrickx, L., Fransen, K., Motte, J., Peeters, M., Nkengasong, J.N., Ndumbe, P.M., Delaporte, E., Perret, J.-L., Atende, C., Piot, P., Van der Groen, G., 1994. Genetic and phylogenetic analysis of en6 subtypes G and H in Central Africa. AIDS Res. Hum. Retroviruses 10, 877– 879. Johanson, J., Abravaya, K., Caminiti, W., Erickson, D., Flanders, R., Leckie, G., Marshall, E., Mullen, C., Ohhashi, Y., Perry, R., Ricci, J., Salituro, J., Smith, A., Tang, N., Vi, M., Robinson, J., The Abbott LCx HIV RNA quantitative assay: a new ultrasensitive assay for quantitation of HIV-1 RNA in plasma, submitted. Kern, D., Collins, M., Fultz, T., Detmer, J., Hamren, S., Peterkin, J.J., Sheridan, P., Urdea, M., White, R., Yeghiazarian, T., Todd, J., 1996. An enhanced-sensitivity branched-DNA assay for quantification of human im-
107
munodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 34, 3196 – 3202. Kievits, T., Van Gemen, B., Van Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H., Malek, L., Sooknanan, R., Lens, P., 1991. NASBA™ isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. J. Virol. Methods 35, 273 – 286. Korber, B., Kuiken, C., Foley, B., Hahn, B., McCutchan, F., Mellors, J.W., Sodroski, J., 1998. Human retroviruses and AIDS 1998. A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Group T-10, Los Alamos National Laboratory, Los Alamos, New Mexico. Loussert-Ajaka, I., Chaix, M.-L., Korber, B., Letourneur, F., Gomas, E., Allen, E., Ly, T.-D., Brun-Ve´zinet, F., Simon, F., Saragosti, S., 1995. Variability of human immunodeficiency virus type 1 group O strains isolated from Cameroonian patients living in France. J. Virol. 69, 5640 – 5649. McCutchan, F.E., Salminen, M.O., Carr, J.K., Burke, D.S., 1996. HIV-1 genetic diversity. AIDS 10 (suppl 3), S13 – S20. Mellors, J.W., Rinaldo, C.R. Jr, Gupta, P., White, R.M., Todd, J.A., Kingsley, L.A., 1996. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science 272, 1167 – 1170. Michael, N.L., Herman, S.A., Kwok, S., Dreyer, K., Wang, J., Christopherson, C., Spadoro, J.P., Young, K.K.Y., Polonis, V., McCutchan, F.E., Carr, J., Mascola, J.R., Jagodzinski, L.L., Robb, M.L., 1999. Development of calibrated viral load standards for group M subtypes of human immunodeficiency virus type 1 and performance of an improved AMPLICOR HIV-1 MONITOR test with isolates of diverse subtypes. J. Clin. Microbiol. 37, 2557 – 2563. Mulder, J., McKinney, N., Christopherson, C., Sninsky, J., Greenfield, L., Kwok, S., 1994. Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: application to acute retroviral infection. J. Clin. Microbiol. 32, 292 – 300. Murphy, D.G., Gonin, P., Fauvel, M., 1999. Reproducibility and performance of the second-generation branched-DNA assay in routine quantification of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 37, 812 – 814. Nasioulas, G., Paraskevis, D., Magiorkinis, E., Theodoridou, M., Hatzakis, A., 1999. Molecular analysis of the fulllength genome of HIV type 1 subtype I: evidence of A/G/I recombination. AIDS Res. Hum. Retroviruses 15, 745 – 758. Nolte, F.S., Boysza, J., Thurmond, C., Clark, W.S., Lennox, J.L., 1998. Clinical comparison of an enhanced-sensitivity branched-DNA assay and reverse transcription-PCR for quantitation of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 36, 716 – 720. Peeters, M., Liegeois, F., Torimiro, N., Bourgeois, A., Mpoudi, E., Vergne, L., Saman, E., Delaporte, E., Saragosti, S., 1999. Characterization of a highly replicative
108
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
intergroup M/O human immunodeficiency virus type 1 recombinant isolated from a Cameroonian patient. J. Virol. 73, 7368 – 7375. Rayfield, M.A., Sullivan, P., Bandea, C.I., Britvan, L., Otten, R.A., Pau, C.P., Pieniazek, D., Subbarao, S., Simon, P., Schable, C.A., Wright, A.C., Ward, J., Schochetman, G., 1996. HIV-1 group O virus identified for the first time in the US. Emerg. Infect. Dis. 2, 209–212. Respess, R.A., Butcher, A., Wang, H., Chaowanachan, T., Young, N., Shaffer, N., Mastro, T.D., Biryahwaho, B., Downing, R., Tanuri, A., Schechter, M., Pascu, R., Zekeng, L., Kaptue´, L., Gu¨rtler, L., Eberle, J., Ellenberger, D., Fridlund, C., Rayfield, M., Kwok, S., 1997. Detection of genetically diverse human immunodeficiency virus type 1 group M and group O isolates by PCR. J. Clin. Microbiol. 35, 1284 – 1286. Robertson, D.L., Sharp, P.M., McCutchan, F.E., Hahn, B.H., 1995. Recombination in HIV-1. Nature 374, 124–126. Saag, M.S., Holodniy, M., Kuritzkes, D.R., O’Brien, W.A., Coombs, R., Poscher, M.E., Jacobsen, D.M., Shaw, G.M., Richman, D.D., Volberding, P.A., 1996. HIV viral load markers in clinical practice. Nat. Med. 2, 625–629. Schiltz, H., Wild, C., Kilgore, N., Singh, P., Chorley, M., Garcia-Meijide, M., 2000. Quantification of HIV-1 group O virus isolates using the hybrid capture II HIV RNA v1.0
.
test and other conventional methods. In: 7th Conference on Retroviruses and Opportunistic Infections, Abstr., p. 220. Takehisa, J., Zekeng, L., Ido, E., Mboudjeka, I., Moriyama, H., Miura, T., Yamashita, M., Gu¨rtler, L.G., Hayami, M., Kaptue´, L., 1998. Various types of HIV mixed infections in Cameroon. Virology 245, 1 – 10. Tanuri, A., Swanson, P., Devare, S., Berro, O.J., Savedra, A., Costa, L.J., Telles, J.G., Brindeiro, R., Schable, C., Pieniazek, D., Rayfield, M., 1999. HIV-1 subtypes among blood donors from Rio de Janeiro, Brazil. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 20, 60 – 66. Triques, K., Coste, J., Perret, J.L., Segarra, C., Mpoudi, E., Reynes, J., Delaporte, E., Butcher, A., Dreyer, K., Herman, S., Spadoro, J., Peeters, M., 1999. Efficiencies of four versions of the AMPLICOR HIV-1 MONITOR test for quantification of different subtypes of human immunodeficiency virus type 1. J. Clin. Microbiol. 37, 110 – 116. Vandamme, A.-M., Schmit, J.-C., Van Dooren, S., Van Laethem, K., Gobbers, E., Kok, W., Goubau, P., Witvrouw, M., Peetermans, W., De Clercq, E., Desmyter, J., 1996. Quantification of HIV-1 RNA in plasma: comparable results with the NASBA HIV-1 RNA QT and AMPLICOR HIV monitor test. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 13, 127 – 139.
Quantification of HIV-1 group M (subtypes A–G) and group O by the LCx HIV RNA quantitative assay Priscilla Swanson, Barbara J. Harris, Vera Holzmayer, Sushil G. Devare, Gerald Schochetman, John Hackett Jr. * AIDS Research and Retro6irus Disco6ery, Abbott Laboratories, D-9NG, Bldg. AP20, 100 Abbott Park Road, Abbott Park, IL 60064 -6015, USA Received 3 April 2000; received in revised form 22 May 2000; accepted 23 May 2000
Abstract Human immunodeficiency virus type 1 (HIV-1) genetic diversity presents a challenge to nucleic acid-based assays with regard to sensitivity of detection and accuracy of quantification. The Abbott LCx HIV RNA Quantitative assay (LCx® HIV assay), a competitive RT-PCR targeting the pol integrase region, was evaluated using a panel of 297 HIV-1 seropositive plasma samples from Cameroon, Uganda, Brazil, Thailand, Spain, Argentina and South Africa. The panel included group M subtypes A–G, mosaics, and group O based on sequence analysis of gag p24, pol integrase, and en6 gp41. The LCx HIV assay quantified 290 (97.6%) of the samples, including all the group O samples tested. In comparison, the Roche AMPLICOR HIV-1 MONITOR test versions 1.0 and 1.5 quantified 67.3 and 94.6% of the samples, respectively. No group O specimens were quantified by either version of AMPLICOR HIV-1 MONITOR. Seven specimens were below the detectable limits of all the three assays. The LCx HIV assay had fewer nucleotide mismatches at primer/probe binding sites as compared with both AMPLICOR HIV-1 MONITOR tests. The high degree of nucleotide conservation within the pol target region enables the LCx HIV assay to efficiently quantify the HIV-1 subtypes A–G and the most genetically diverse HIV-1, group O. © 2000 Elsevier Science B.V. All rights reserved. Keywords: HIV-1; RT-PCR assay; Viral load; Genetic diversity
1. Introduction Quantification of human immunodeficiency virus type 1 (HIV-1) is used routinely for the * Corresponding author. Tel.: +1-847-9380457; fax: +1847-9371401. E-mail address: [email protected] (J. Hackett Jr.).
clinical management of HIV infected patients. Plasma levels of HIV-1 RNA are measured to assess disease progression (Mellors et al., 1996) and to monitor response to antiretroviral therapy (Saag et al., 1996). Although, a variety of nucleic acid amplification or signal amplification technologies are available commercially (Kievits et al., 1991; Mulder et al., 1994; Kern et al., 1996; Michael et al., 1999; Murphy et al., 1999), all of
0166-0934/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 0 0 ) 0 0 2 0 5 - 6
98
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
these methods rely on HIV sequence-specific primers and/or probes. Consequently, HIV-1 sequence variation within assay target regions can directly impact the efficiency of amplification and detection. HIV-1 is characterized by extensive genetic variability. Phylogenetic analysis of HIV-1 sequences collected from around the world has revealed the existence of three distinct groups: M, N, and O (Korber et al., 1998). Group M viruses have been further subdivided into subtypes A – J. In addition, recombination among HIV-1 subtypes that cocirculate has resulted in viral genomes consisting of unique combinations of subtypes. Subtype E is an example of a recombinant virus composed of subtype A in gag and pol genes and subtype E in en6 (Robertson et al., 1995). Variants with other mosaic patterns of intersubtype recombination such as G/A, H/G, A/G/I, and intergroup recombinants, such as group M (A)/group O, have also been described (Janssens et al., 1994; McCutchan et al., 1996; Carr et al., 1998; Nasioulas et al., 1999; Peeters et al., 1999). HIV-1 subtypes are distributed unevenly throughout the world. Current viral load testing has focused on quantitation of subtype B which predominates in the US and western Europe. Recently, an increasing number of non-B subtype infections has been identified in the US (Brodine et al., 1995; Rayfield et al., 1996), Belgium (Fransen et al., 1996), France (Barin et al., 1997), England (Arnold et al., 1995a), Sweden (Alaeus et al., 1997a), and Germany (Dietrich et al., 1997). For this reason, it has become imperative that viral load assays accurately quantitate all the HIV-1 group M subtypes, as well as group O infections. It has already been reported that some commercial assays either underquantitate or fail to detect HIV subtypes A, E, and G, and none reliably quantify group O strains (Loussert-Ajaka et al., 1995; Arnold et al., 1995b; Coste et al., 1996; Vandamme et al., 1996; Dunne and Crowe, 1997; Gobbers et al., 1997; Jackson et al., 1997; Alaeus et al., 1997b; Debyser et al., 1998; Nolte et al., 1998; Triques et al., 1999). The Abbott LCx HIV RNA Quantitative assay (LCx® HIV assay) measures HIV-1 RNA concen-
trations through a competitive reverse transcriptase polymerase chain reaction (RT-PCR) that targets a highly conserved region of the HIV-1 pol integrase gene (pol IN). The objective of this study was to evaluate the performance of the LCx HIV assay on a well-characterized panel of 297 plasma specimens consisting of HIV-1 group M subtypes A–G, intersubtype recombinants, and group O. Viral load determinations by the LCx HIV assay were compared with those obtained by the AMPLICOR HIV MONITOR test version 1.0 (Roche Diagnostics; US Food and Drug Administration licensed test) and version 1.5, both of which target the gag region. In addition, we sequenced the gag p24 and pol IN target regions of the samples to evaluate the level of genetic variation at primer and probe binding sites. 2. Materials and methods
2.1. Sample collection HIV-1-infected plasma samples were collected from individual asymptomatic blood donors from January 1993 to November 1998 by; (1) Dr Lutz Gu¨rtler, University of Greifswald, Institute of Medical Microbiology, Greifswald, Germany, (2) Dr Leopold Zekeng and Dr Lazare Kaptue´, Labo et Transfusion Sanguine, Centre Hospitalier Universitaire, Yaounde, Cameroon, (3) Dr Peter Kataaha, Nakasero Blood Bank, Kampala, Uganda, (4) Dr Brooks Jackson, Department of Pathology, Johns Hopkins Medical Institutions, Baltimore, MA, USA, (5) Dr Amilcar Tanuri, Departamento de Genetica, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Brazil, (6) Dr Vincent Soriano, Service of Infectious Diseases, Instituto de Salud Carlos III, Madrid, Spain, (7) Dr Sasitorn Bejrachandra, Sirirah Hospital, Bangkok, Thailand, (8) Monica Galloway, WP Blood Transfusion Service, Cape Town, South Africa, and (9) Carlos Filipini, Abbott Diagnostics Division, Buenos Aires, Argentina. All the specimens tested positive for antibodies to HIV by at least one commercially available HIV-1 antibody enzyme immunoassay. Plasma samples were aliquotted into 0.2-ml aliquots and stored at − 70°C until testing.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
2.2. Molecular characterization of the plasma panel Three regions of the HIV-1 genome were targeted for sequence analysis, gag p24, pol IN, and en6 gp41 immunodominant region (IDR). Total nucleic acid was extracted from 200 to 400 ml plasma using the QIAamp Blood Kit (Qiagen Inc., Chatsworth, CA). Primers and conditions for RT-PCR amplification of p24 and IDR regions have been described earlier (Hackett et al., 1997; Brennan et al., 1997a,b; Tanuri et al., 1999). Primers used for integrase analysis are listed in Table 1.
2.2.1. Integrase RT-PCR The integrase region was amplified using an RNA PCR kit (Perkin Elmer, Foster City, CA). Complementary DNA synthesis was carried out as described earlier (Hackett et al., 1997). Firstround PCR amplification consisted of denaturation at 95°C for 1 min, 40 cycles of 94°C for 30 s, 45°C for 30 s, 72°C for 90 s, and a final extension at 72°C for 10 min. A GeneAmp PCR kit (Perkin Elmer) was used for nested PCR amplification with 1/20th of the first round product as template and 25 pmol of each primer. Cycling conditions were similar to the first round except that annealing was performed at 55°C.
99
2.2.2. Sequence analysis PCR products were purified using either a QIAamp PCR purification kit, QIAEX II gel extraction kit, or QIAquick gel extraction kit (Qiagen Inc). Both the strands were sequenced directly using an ABI Prism Big Dye Terminator Cycle Sequencing Reaction Kit (PE Applied Biosystems, Foster City, CA) and an ABI model 377 automated sequencer (PE Applied Biosystems). Sequence data were analyzed using Sequencher 3.0 (Gene Codes Corp., Ann Arbor, MI). For subtype determination, nucleic acid sequences were trimmed to equivalent lengths (399nt gag p24, 864nt pol IN, and 369nt en6 gp41 IDR) and aligned with representative HIV-1 group M subtypes and group O sequences. Alignments were generated using Sequencher 3.0 or Geneworks 2.45 (Oxford Molecular Group, Inc., Campbell, CA, USA) and edited manually. Phylogenetic analysis was undertaken using the Phylip software package (University of Washington, Seattle, WA) with a SIVcpz (GenBank accession no. X52154) outgroup as described earlier (Brennan et al., 1997a). 2.3. HIV-1 6iral load determination 2.3.1. The LCx HIV RNA Quantitati6e assay The LCx® HIV assay (Abbott Laboratories, Abbott Park, IL) was carried out on 297 HIV-1
Table 1 Oligonucleotides for amplification of HIV-1 integrase RT-PCR steps Group M cDNA and 1st round PCR Nested PCR Group O cDNA and 1st round PCR Nested PCR
a
Primer
Sequence (5%\3%)a
Locationb
M-poli8 M-poli5 M-poli7 M-poli6
TAGTGGGATGTGTACTTCTGAAC CACACAAAGGRATTGGAGGAAATG AACAAGTAGATAAATTAGTCAGT ATACATATGRTGTTTTACTAARCT
5210B5232 4177\4200 4201\4223 5122B5145
O-poli8 O-poli5 O-poli7 O-poli6
GATTYCTGGATTCATAATGATG GTATCTTACATGGGTTCCTGC CAYAAAGGCATAGGAGGAAATG CCTGTAYTTATGGTATTTCAC
5219B5240 4197\4217 4219\4240 5168B5188
Degenerate nucleotide positions are identified using the IUPAC code. Primer positions for group M correspond to HIVMNCG GenBank accession no. M17449 and for group O correspond to HIVANT70C GenBank accession no. L20587. b
100
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
seropositive specimens according to the manufacturer’s specifications. A detailed description of the assay is provided by Johanson et al., 2000. Briefly, total nucleic acid was extracted from 0.2 ml of plasma using a modified QIAamp viral nucleic acid extraction kit (Qiagen, Gmbh, Hilden, Germany). Internal standard (IS) transcript (HIV-1 RNA transcript, similar to native HIV-1 except for a short unique internal sequence) was added to each sample and processed simultaneously with the clinical specimen. HIV-1 was then quantitated by (i) single step rTth DNA polymerase-mediated competitive RT-PCR using one hapten-labeled primer, (ii) hybridization with hapten-labeled probes specific for HIV-1 or IS, and (iii) dual detection of amplification products using microparticle enzyme immunoassay (MEIA) on an automated LCx analyzer. The LCx analyzer calculates a log of the rate ratio (LCx rate counts for HIV divided by rate counts for IS) and plots a standard curve of the mean log ratio for each calibrator against its corresponding RNA concentration. For the 0.2 ml sample preparation protocol, the upper (ULQ) and lower (LLQ) limits of quantitation are 5 011 872 (6.7 log10) copies per ml and 178 copies (2.25 log10) copies per ml, respectively.
2.3.2. AMPLICOR HIV MONITOR test 6ersions 1.0 and 1.5 The AMPLICOR HIV-1 MONITOR tests version 1.0 and version 1.5 (Roche Diagnostics, Branchburg, NJ) were performed according to the manufacturer’s instructions. Version 1.0 was used by Ronald Lollar at Rush Presbyterian St. Luke’s Medical Center, Chicago, IL to analyze 278 specimens and version 1.5 was used at LabCorp, Research Triangle Park, NC to analyze 297 specimens. Both the procedures utilize 0.2 ml plasma and involve (i) disruption of the virus, (ii) single step rTth DNA polymerase-mediated RTPCR using biotinylated primers and one internal competitor RNA (quantification standard QS), (iii) hybridization of HIV-1 and QS amplification products in specific probe-coated microtiter plates, (iv) enzyme-linked colorimetric detection of amplification products, and (v) calculation of RNA copies per ml. Both the assays target the
gag p24 region of HIV-1: version 1.0 uses primers SK431 and SK462 and version 1.5 uses SK145 and SKCC1B (Triques et al., 1999). The ULQ and LLQ for both assays are 750 000 (5.87 log10) copies per ml and 400 (2.6 log10) copies per ml, respectively. The lower limit of detection for version 1.0 is 200 copies per ml (2.3 log10).
3. Results
3.1. Genetic analysis of clinical specimens A total of 297 HIV-1 seropositive plasma samples were studied. These specimens were obtained from a variety of geographic regions including Cameroon (n= 114), Uganda (n=65), South Africa (n=19), Brazil (n=51), Argentina (n= 3), Spain (n= 2), Thailand (n=42) and the US (n= 1). To assign group and subtype, three distinct regions of the genome (gag p24, pol IN, and en6 gp41 IDR) were PCR-amplified for sequence analysis. Amplification of all the three regions was successful for 288 of the 297 specimens. Group and subtype could not be determined for two specimens because they were PCR-negative for all the regions examined. For seven specimens, sequence could be obtained on only one or two of the regions analyzed. Therefore, subtype was assigned provisionally based on available sequence information. Specimens for which the subtype designation differed between the genetic regions analyzed were categorized as mosaics. However, subtype E, known to be an intersubtype recombinant of A and E, was designated herein as a subtype to conform with the prevailing designations. Based on phylogenetic analysis, the panel was composed of group M subtypes A–G, mosaics, and group O specimens (Table 2). Of interest, 104 of the 295 (35.2%) specimens for which group/subtype could be determined were categorized as mosaics. Of the mosaics, 70 of 104 (66.7%) were subtyped as A for gag p24, G for pol IN and A for en6 gp41 IDR and originated from Cameroon. Other subtype combinations observed in the mosaic category included; 7 A/G (distinct from those described above), 15 D/A, 3 F/A, 7 F/B, 1 D/B, and 2 C/A.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
101
Table 2 HIV-1 RNA quantitation by LCx HIV quantitative assay and AMPLICOR MONITOR test versions 1.0 and 1.5 Genetic subtype
N
Quantitated samples (%) AMPLICOR MONITOR LCx HIV
A B C D E F G Mosaic Not determined Group O Total
38 46 18 30 36 9 8 104 2 6 297
97 93 100 100 100 100 88 100 0 100 97.6% (290/297)
Version 1.0a 71 91 100 90 91 38 62 47 0 0 67.3% (187/278)
Version 1.5 97 93 100 100 100 100 75 98 0 0 94.6% (281/297)
a 278 of the 297 samples were tested by AMPLICOR HIV MONITOR version 1.0. Samples not tested included 2 B, 13 C, 1 D, 1 E, 1 F, and 1 group O.
3.2. Viral load determination The LCx® HIV assay quantitated HIV-1 viral RNA in 290 of 297 (97.6%) seropositive plasma samples (Table 2). The range of viral load concentrations and subtype distribution of quantitated samples is shown in Fig. 1. Within each HIV-1 group M subtype (A – G and mosaics), specimens had measurable levels of RNA spanning the assay dynamic range. The six group O samples tested were all quantitated by the LCx HIV assay, and viral loads ranged between 500 and 20 000 copies per ml. The AMPLICOR HIV-1 MONITOR test version 1.0 was used to examine 278 of the 297 samples; 2 B, 13 C, 1 D, 1 E, 1 F, and 1 group O were not tested in version 1.0. MONITOR version 1.0 quantified 187 of 278 (67.3%) samples (Table 2). Eighty-four of 278 (30.2%) samples (including 10 A, 1 B, 3 D, 3 E, 5 F, 2 G, 55 mosaics, and the five group O specimens tested) were quantitated by the LCx HIV assay but were below the version 1.0 LLQ of 400 copies per ml. In fact, 71 of these 84 samples (84.5%) were below the lower limit of detection (200 copies per ml) of version 1.0. Of the 55 mosaics, 51 (92.7%) were recombinants consisting of subtype A in gag p24 and G in pol
IN, 3 (5.4%) were recombinants of subtypes A and D (one A in gag p24 and D in pol IN, one D in gag p24 and A in pol IN, one A in gag p24 and pol IN, but D in en6 gp41 IDR), and 1 sample was F in gag p24 and pol IN but B in en6 gp41 IDR. AMPLICOR HIV-1 MONITOR test version 1.5 quantified 281 of 297 (94.6%) samples (Table
Fig. 1. Subtype and viral load distribution of samples quantified by LCx RNA Quantitative assay (n = 290). LCx log10 copies per ml are represented by black diamonds. Average log10 copies per ml for each subtype are represented by open squares. Lower limit of quantitation (LLQ) is shown as a dashed line at 2.25 log10 copies per ml.
102
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
Fig. 2. Comparison of HIV-1 seropositive specimens quantified by LCx HIV RNA Quantitative assay (lower limit of quantitation shown as 2.25 log10 copies per ml) and AMPLICOR HIV-1 MONITOR test version 1.0 (lower limit of quantitation shown as 2.6 log10 copies per ml) (n= 278) HIV-1 group M samples are represented as black circles. Group O samples are represented as open circles.
Fig. 3. Comparison of HIV-1 seropositive specimens quantified by LCx HIV RNA Quantitative assay (lower limit of quantitation shown as 2.25 log10 copies per ml) and AMPLICOR HIV-1 MONITOR test version 1.5 (lower limit of quantitation shown as 2.6 log10 copies per ml) (n= 297) HIV-1 group M samples are represented as black circles. Group O samples are represented as open circles.
2). Nine of the 297 (3%) samples were quantitated by the LCx HIV assay but were below the MONITOR version 1.5 LLQ of 400 copies per ml, and included one subtype G from Cameroon, one mosaic from Cameroon (A in gag p24, G in pol IN, and A in en6 gp41 IDR), one mosaic from Uganda (D in gag p24 and pol IN and A in en6 gp41 IDR), and all six group O specimens tested. Seven of the 297 HIV seropositive samples (2.4%) were below the LLQ of all the three assays. These included; 1 Cameroonian G, 1 Ugandan A, 3 Brazilian B and 2 Brazilian specimens for which subtype could not be determined because they were PCR-negative for all the three regions. A comparison of RNA levels as determined by the LCx® HIV assay and AMPLICOR HIV-1 MONITOR version 1.0 is presented in Fig. 2. Correlation of the 187 samples quantitated by both the assays was 0.564 with a slope of 0.512 and intercept of 2.3. Relative to AMPLICOR MONITOR version 1.0, the LCx HIV assay underquantified just 1 sample (subtype B from Cameroon) by more than 1 log10 copies per ml (1.49 logs). Conversely, relative to the LCx HIV assay, version 1.0 detected but underquantified 24 specimens (12.8%) by greater than 1 log10 copies per ml. The underquantitated specimens consisted of 7 A, 2 E, 1 F, and 14 mosaics. Thirteen of the 14 mosaics had gag p24 of subtype A, the other was subtype F. There was an improved correlation of plasma RNA levels obtained by the LCx HIV assay and AMPLICOR HIV-1 MONITOR version 1.5 (Fig. 3). The observed correlation of 281 quantitated specimens was 0.841 with a slope of 0.850 and intercept of 0.45. Notably, viral loads determined by the two assays differed by \1 log10 for only 6 of 281 specimens (2.1%). Relative to version 1.5, the LCx® HIV assay underquantified 1 Cameroonian B, 1 Argentinian F, and 4 Cameroonian A/G mosaics (A gag p24/G pol IN/A en6 gp41 IDR). Upon retest in both the assays, the viral load determined for the subtype F and 2 of the mosaic specimens were within 1 log10 copies per ml between the two assays. Thus, consistent differences in quantitation of \ 1 log10 between the LCx HIV assay and AMPLICOR HIV-1 MONITOR version 1.5 were observed for only three of the 281 specimens examined.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
Average log10 copies per ml for each subtype were compared for the LCx® HIV assay versus both MONITOR tests. Between LCx and version 1.0 assays, mean RNA levels for quantified samples were within 0.5 log10 copies per ml for subtypes B, C, D, G, and the mosaics and were within 0.68, 0.57, and 0.86 log10 copies per ml for subtypes A, E, and F, respectively. Relative to version 1.5, mean RNA values determined by the LCx HIV assay were within 0.22 log10 copies per ml for all the group M subtypes.
3.3. Nucleotide mismatches at primer/probe sites To assess the number of nucleotide mismatches at primer and probe binding sites, the pol IN and gag p24 sequences of each specimen were evaluated (Table 3). Overall, specimens had fewer total primer/probe mismatches within the pol IN target region of the LCx HIV assay than was observed for the gag p24 target regions of AMPLICOR HIV-1 MONITOR versions 1.0 or 1.5. The LCx assay had a mean number of total nucleotide mismatches of
103
1.18 (range of 0–8 mismatches). In contrast, AMPLICOR HIV-1 MONITOR versions 1.0 and 1.5 had four to six times more total nucleotide mismatches: version 1.0 had a mean 6.7 changes (range of 2–24) and version 1.5 had a mean 4.2 changes (range 0–23). For the LCx HIV assay, the greatest number of mismatches was observed for the forward primer relative to group O sequences (mean of 4.0 and range of 3–5). By comparison, forward primers for AMPLICOR HIV-1 MONITOR versions 1.0 and 1.5 had a mean of 9.0 (range 8–11) and 9.7 (range 8–12) mismatches, respectively, versus group O sequences. Of the 290 pol IN sequences examined, 90.5% of samples had two or fewer total nucleotide mismatches at the primer and probe binding sites in the LCx HIV assay. For the LCx HIV assay, two or fewer mismatches were observed in the forward primer in 97.2% of samples and in 99.3% of samples at the reverse primer and probe sites. In contrast, of 292 gag p24 sequences analyzed, only 0.3 and 22.6% of samples had two or fewer total mismatches at primer/probe binding sites in version 1.0 and version 1.5, respectively.
Table 3 Nucleotide mismatches at primer/probe binding sites for LCx HIV and Monitor versions 1.0 and 1.5 HIV-1 group M subtype A
B
LCx HIV HIV-1 forward HIV-1 probe HIV-1 reverse Total
0.3 (0–2)a 0 0.08 (0–1) 0.4 (0–2)
0.2 0.1 0.3 0.6
MONITOR 1.0 SK462 forward SK102 probe SK431 reverse Total
4.9 1.9 1.7 8.5
MONITOR 1.5 SK145 forward SK102 probe SKCC1B reverse Total
3 (2–5) 1.9 (1–3) 0.8 (0–3) 5.7 (4–8)
a
Mean (range).
(4–6) (1–3) (1–3) (7–11)
Group C
D
E
F
(0–1) (0–1) (0–3) (0–3)
1.1 (1–2) 0.06 (0–1) 0.2 (0–1) 1.3 (1–2)
0.2 (0–1) 0 0.1 (0–1) 0.3 (0–2)
1.1 (1–2) 0.03 (0–1) 0.06 (0–1) 1.2 (1–3)
0.8 0.4 0.8 1.9
2.4 0.7 1.3 4.4
(2–4) (0–2) (1–2) (3–7)
2.4 2.6 1.3 6.3
(1–4) (1–5) (1–2) (4–9)
2.1 0.6 2.5 5.2
(0–5) (0–2) (2–4) (2–7)
5.0 1.4 2.1 8.5
0.6 0.7 0.4 1.6
(0–3) (0–2) (0–2) (0–4)
0.6 2.6 0.2 3.3
(0–2) (1–5) (0–1) (2–6)
0.9 0.6 1.2 2.7
(0–3) (0–2) (0–3) (1–7)
3 (2–5) 1.4 (0.5) 0.1 (0–1) 4.5 (3–8)
(4–7) (0–5) (2–3) (7–12)
G
O
(0–4) (0–1) (0–1) (0–5)
1.1 (0–2) 0.6 (0–1) 0.3 (0–1) 2 (0–3)
4.0 (3–5) 0 1.3 (1–3) 5.3 (4–8)
2.3 2.6 4.3 9.2
(2–4) (2–3) (3–5) (8–10)
3.5 (2–5) 4.0 (2–6) 3.0 (2–6) 10.5 (8–17)
9.0 (8–11) 7.0 (6–8) 6.3 (6–7) 22.3 (20–24)
0.6 2.6 1.8 4.9
(0–2) (2–3) (1–2) (4–6)
3 (2–5) 4.0 (2–6) 1.6 (0–3) 8.6 (6–12)
9.7 (8–12) 7.0 (6–8) 4.7 (4–5) 21.3 (19–23)
104
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
4. Discussion It is important that diagnostic assays accurately quantify all the known HIV-1 subtypes, intersubtype recombinants, and emerging variants since viral load is used to monitor drug efficiency in HIV-1 infected patients in many parts of the world. Furthermore, HIV-1 group and subtyperelated sequence differences have been shown to lead to underquantitation in a variety of nucleic acid-based assays including the AMPLICOR HIV-1 MONITOR version 1.0, gag-based NASBA (NucliSens HIV-1 QT assay; Organon Teknika), and the Quantiplex HIV-1 RNA assay (Chiron Corporation; Loussert-Ajaka et al., 1995; Christopherson et al., 1997; Gobbers et al., 1997; Jackson et al., 1997; Respess et al., 1997; Alaeus et al., 1997b; Debyser et al., 1998; De Baar et al., 1999; Triques et al., 1999). To date, the only assays shown to quantify HIV-1 group O are the LTR-based NASBA (De Baar et al., 1999) and the Digene Hybrid Capture® II HIV RNA v1.0 test (Schiltz et al., 2000). In the present study, a panel of 297 HIV-1 seropositive plasma samples was collected from a variety of geographic sites, and the group and subtype assignment of HIV-1 present in each sample was characterized by sequence analysis of the three distinct regions of the genome (gag p24, pol IN and en6 gp41 IDR). This degree of genetic analysis, provides the opportunity to identify the ever-increasing proportion of intersubtype recombinant (mosaic) HIV-1 infections, and is particularly relevant when comparing assay performance between probes-based technologies that target different regions of the viral genome (e.g. pol IN for LCx® HIV assay and gag p24 for AMPLICOR HIV-1 MONITOR tests). Analysis of the panel revealed that 35% of the specimens were infected with mosaic viruses. The majority of the mosaics (66.7%) were collected in Cameroon and have a genomic organization consistent with IbNG isolates (A in gag p24, G in pol IN, A in en6 gp41 IDR (Carr et al., 1998)). It was reported recently that IbNG-like infections predominate in Cameroon (Hackett et al., 1999), a region of Africa where the majority of infections were previously thought to be subtype A viruses (Takehisa
et al., 1998). This confirms the value of analyzing multiple genomic regions to reveal the presence of many infections where the subtype assignment differs between the gag and pol target regions. The LCx HIV RNA Quantitative assay is a semi-automated assay based on nucleic acid amplification and probe detection. The assay was designed to take advantage of the high degree of nucleotide conservation in the pol IN region of the HIV-1 genome. To assess performance on genetically diverse HIV-1 infections, we examined the ability of the LCx® HIV assay to quantify viral RNA levels in a plasma panel composed of HIV-1 group M subtypes A through G, intersubtype mosaics, and group O infections. Of these specimens, 97.6% were quantitated by the LCx HIV assay. No group- or subtype-specific deficiencies in quantification were observed. Seven HIV-1 antibody positive specimens not detected/ quantified by the LCx HIV assay were also below the detectable limits of the AMPLICOR HIV-1 MONITOR version 1.0 and 1.5 tests. As compared with the LCx HIV assay, AMPLICOR HIV-1 MONITOR version 1.0 either failed to detect or underquantitated 43% of the samples tested; 30.2% were below the LLQ of version 1.0 and an additional 12.8% were underquantitated by greater than 1 log10 copies per ml. Notably, 80% of these samples were subtype A in the gag target region. These data are consistent with results of the earlier studies demonstrating deficiencies in detection and accuracy in quantification of subtype A infections by the version 1.0 test (Loussert-Ajaka et al., 1995; Coste et al., 1996; Christopherson et al., 1997; Jackson et al., 1997; Michael et al., 1999; Triques et al., 1999). Similar to others, we also observed significant deficiencies in quantification of subtype E, F and G and group O infections (Respess et al., 1997; Debyser et al., 1998; Michael et al., 1999; Triques et al., 1999). In contrast, for HIV-1 group M subtypes A–G, there was a high degree of correlation between viral loads determined by the LCx® HIV assay and the AMPLICOR HIV-1 MONITOR version 1.5 test. Thus, detection of group M subtype infections (particularly A, E, F and G) by version 1.5 is significantly improved relative to the version
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
1.0 test, and overall sensitivity is similar to the LCx HIV assay. These results are consistent with reports that demonstrate version 1.5 quantifies more reliably and accurately subtypes A through G (Michael et al., 1999; Triques et al., 1999). This improvement in performance is presumably due to both the revised primer selection reducing the number of nucleotide mismatches and to the adjustments in PCR cycling conditions. However, even with these modifications, version 1.5 failed to detect any of the group O samples tested. In some cases, plasma RNA levels obtained by version 1.5 tended to be slightly higher than those measured by the LCx HIV assay. There are data to suggest that the version 1.5 assay may slightly overestimate viral RNA levels (Triques et al., 1999) which could account for the observed difference. Remarkably, reproducible differences of more than 1 log10 copies per ml in viral load determinations for group M infections between the LCx HIV assay and the version 1.5 test were only seen in 1% of cases. None of the samples underquantitated by the LCx assay relative to version 1.5 had more than three mismatches in any primer, and the mismatches did not appear to be in critical positions (e.g. near the 3% end). Based on studies of Christopherson et al., 1997, the efficiency of RT-PCR amplification is not significantly impacted unless there are five or more mismatches in the primer – template duplex. Thus, the molecular basis for the observed difference in viral quantification for these specimens is unclear. Seven seropositive samples were not detected by any of the quantitative assays. Based on the available sequence information, the infections included 1 Cameroonian G, 1 A from Uganda, 3 Brazilian B and 2 Brazilian samples for which subtype could not be determined since they were PCRnegative for all the three regions. We believe that failure to detect viral RNA is due to very low viral loads (below detectable limits of all three assays) in these specimens. Consistent with this interpretation is the difficulty experienced in the molecular characterization of these samples using nested PCR. For only one of these specimens (subtype G) could all three regions (gag, pol, en6) be amplified. Only two regions were successfully amplified from one subtype A (pol and en6) and
105
from one subtype B (gag and en6) infection. Only the gag region could be amplified from the two other B infections. Moreover, analysis of the available gag and pol target regions from these specimens revealed no molecular basis for inefficient or failed detection in the quantitative assays. Analysis of the primer and probe binding sites within gag p24 and pol IN revealed significant differences in the level of nucleotide conservation between the LCx® HIV assay and the AMPLICOR HIV-1 MONITOR tests. The LCx HIV primers and probes had fewer mismatches across all the groups and subtypes of HIV-1 than observed for either the version 1.0 or 1.5 tests. For example, MONITOR version 1.5 was designed to enhance the detection of subtype A infections relative to version 1.0. However, the mean number of total mismatches was only reduced from 8.5 in version 1.0 to 5.7 in version 1.5, which is substantially more than the 0.4 observed for the LCx HIV assay. For the LCx HIV assay, a maximum of five total mismatches were observed for group M subtypes and up to eight mismatches were present in group O samples. In comparison, in the AMPLICOR HIV-1 MONITOR version 1.0 test, there were up to 17 total mismatches in group M specimens and 24 for group O. Although the AMPLICOR HIV-1 MONITOR version 1.5 test had reduced the numbers of mismatches relative to version 1.0, up to 12 total mismatches were observed for group M specimens and 23 in group O. The large number of total mismatches seen for group O isolates is consistent with the inability of both versions of the AMPLICOR HIV-1 MONITOR test to detect group O infections. It has been reported that up to four primer/template mismatches can be tolerated for accurate RNA quantitation (Christopherson et al., 1997). Of interest, only 1 group M specimen out of 284 evaluated had as many as four mismatches within a LCx primer site. In fact, the specimens had two or fewer mismatches in 96, 98 and 100% of cases for the forward primer, reverse primer, and probe, respectively. Although representative subtype H, I and J specimens were not available for evaluation in the LCx® HIV assay, examination of pol IN sequences in the Los Alamos database revealed that
106
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
the primer and probe sites are highly conserved (two or fewer mismatches per primer or probe). None of the observed mismatches were in critical regions of the primer. Therefore, the LCx HIV assay would be expected to accurately quantify subtype H, I, and J infections. Based on these data, the LCx HIV assay offers a desirable alternative to the existing commercial assays for monitoring viral load. It combines a simple and reproducible sample preparation procedure with automated amplicon detection. Moreover, nucleotide conservation within the primer and probe regions results in subtype-independent quantification. This provides a significant advantage for quantitation of non-B subtype specimens and the increasing number of intersubtype recombinant infections. The overall concordance between viral loads as determined by the LCx HIV assay and AMPLICOR HIV-1 MONITOR version 1.5 test will facilitate the use of LCx HIV RNA Quantitative assay in patients who have been tested earlier using the AMPLICOR MONITOR tests. Reliable detection of all HIV-1 infections, regardless of the group or subtype, would also be beneficial to ensure the safety of plasma-derived products. This study demonstrates that the LCx HIV RNA Quantitative assay detects and efficiently quantifies HIV-1 group M subtypes A – G. The high level of nucleotide conservation at the primer and probe binding sites allows the LCx HIV assay to quantify even the most genetically diverse HIV-1 infections, group O.
Acknowledgements The authors would like to thank Janet Winkler, Julie Johanson, Gregor Leckie, Marilyn Vi, and Arthur Martinez for providing LCx technical expertise and reagents, Catherine Brennan, Julie Yamaguchi, Alan Golden, Pierre Bodelle, Ana Vallari and Jennifer Lund for help in molecular characterization of the panel, and Catherine Brennan, John Robinson, Julie Johanson and Sharon Muldoon for critical review of the manuscript.
References Alaeus, A., Leitner, T., Lidman, K., Albert, J., 1997a. Most HIV-1 genetic subtypes have entered Sweden. AIDS 11, 199 – 202. Alaeus, A., Lidman, K., So¨nnerborg, A., Albert, J., 1997b. Subtype-specific problems with quantification of plasma HIV-1 RNA. AIDS 11, 859 – 865. Arnold, C., Barlow, K.L., Parry, J.V., Clewley, J.P., 1995a. At least five HIV-1 sequence subypes (A, B, C, D, A/E) occur in England. AIDS Res. Hum. Retroviruses 11, 427 – 429. Arnold, C., Barlow, K.L., Kaye, S., Loveday, C., Balfe, P., Clewley, J.P., 1995b. HIV type 1 sequence subtype G transmission from mother to infant: failure of variant sequence species to amplify in the Roche Amplicor test. AIDS Res. Hum. Retroviruses 11, 999 – 1001. Barin, F., Courouce, A.-M., Pillonel, J., Buzelay, L., 1997. Increasing diversity of HIV-1m serotypes in French blood donors over a 10-year period (1985 – 1995). AIDS 11, 1503 – 1508. Brennan, C.A., Lund, J.K., Golden, A., Yamaguchi, J., Vallari, A.S., Phillips, J.F., Kataaha, P.K., Jackson, J.B., Devare, S.G., 1997a. Serologic and phylogenetic characterization of HIV-1 subtypes in Uganda. AIDS 11, 1823 – 1832. Brennan, C.A., Hackett, J. Jr, Zekeng, L., Lund, J.K., Vallari, A.S., Hickman, R.K, Gu¨rtler, L., Kaptue, L., Von Overbeck, J., Hampl, H., Devare, S.G., 1997b. Sequence of gp41en6 immunodominant region of HIV type 1 group O from West Central Africa. AIDS Res. Hum. Retroviruses 13, 901 – 904. Brodine, S.K., Mascola, J.R., Weiss, P.J., Ito, S.I., Porter, K.R., Artenstein, A.W., Garland, F.C., McCutchan, F.E., Burke, D.S., 1995. Detection of diverse HIV-1 genetic subtypes in the USA. Lancet 346, 1198 – 1199. Carr, J.K., Salminen, M.O., Albert, J., Sanders-Buell, E., Gotte, D., Birx, D.L., McCutchan, F.E., 1998. Full genome sequences of human immunodeficiency virus type 1 subtypes G and A/G intersubtype recombinants. Virology 247, 22 – 31. Christopherson, C., Sninsky, J., Kwok, S., 1997. The effects of internal primer-template mismatches on RT-PCR: HIV-1 model studies. Nucl. Acids Res. 25, 654 – 658. Coste, J., Montes, B., Reynes, J., Peeters, M., Segarra, C., Vendrell, J.-P., Delaporte, E., Segondy, M., 1996. Comparative evaluation of three assays for the quantitation of human immunodeficiency virus type 1 RNA in plasma. J. Med. Virol. 50, 293 – 302. De Baar, M.P., Van der Schoot, A.M., Goudsmit, J., Jacobs, F., Ehren, R., Van der Horn, K.H.M., Oudshoorn, P., De Wolf, F., De Ronde, A., 1999. Design and evaluation of a human immunodeficiency virus type 1 RNA assay using nucleic acid sequence-based amplification technology able to quantify both group M and O viruses by using the long terminal repeat as target. J. Clin. Microbiol. 37, 1813 – 1818.
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108 Debyser, Z., Van Wungaerden, E., Van Laethem, K., Beuselinck, K., Reynders, M., De Clercq, E., Desmyter, J., Vandamme, A.-M., 1998. Failure to quantify viral load with two of the three commercial methods in a pregnant woman harboring an HIV type 1 subtype G strain. AIDS Res. Hum. Retroviruses 14, 453–459. Dietrich, U., Ruppach, H., Gehring, S., Knechten, H., Knickmann, M., Ja¨ger, H., Wolf, E., Husak, R., Orfanos, C.E., Brede, H.D., Ru¨bsamen-Waigmann, H., Von Briesen, H., 1997. Large proportion of non-B HIV-1 subtypes and presence of zidovudine resistance mutations among German seroconvertors. AIDS 11, 1532–1533. Dunne, A.L., Crowe, S.M., 1997. Comparison of branched DNA and reverse transcriptase polymerase chain reaction for quantifying six different HIV-1 subtypes in plasma. AIDS 11, 126 – 127. Fransen, K., Buve´, A., Nkengasong, J.N., Laga, M., Van der Groen, G., 1996. Longstanding presence in Belgians of multiple non-B HIV-1 subtypes. Lancet (Letter) 347, 1403. Gobbers, E., Fransen, K., Oosterlaken, T., Janssens, W., Heyndrickx, L., Ivens, T., Vereecken, K., Schoones, R., Van de Wiel, P., Van der Groen, G., 1997. Reactivity and amplification efficiency of the NASBA HIV-1 RNA amplification system with regard to different HIV-1 subtypes. J. Virol. Methods 66, 293–301. Hackett, J. Jr, Zekeng, L., Brennan, C.A., Lund, J.K., Vallari, A.S., Hickman, R.K., Gu¨rtler, L., Kaptue´, L., Devare, S.G., 1997. Genetic analysis of HIV type 1 group O p24gag sequences from Cameroon and equatorial Guinea. AIDS Res. Hum. Retroviruses 13, 1155–1158. Hackett, J. Jr, Brennan, C., Yamaguchi, J., Fedosova, V., Swanson, P., Zekeng, L., Kaptue´, L., Gu¨rtler, L., Devare, S., 1999. Predominance of HIV-1 A/G intersubtype recombinants in Cameroon. In: 6th Conference on Retroviruses and Opportunistic Infections, Abstr., p. 120. Jackson, J.B., Piwowar, E.M., Parsons, J., Kataaha, P., Bihibwa, G., Onecan, J., Kabengera, S., Kennedy, S.D., Butcher, A., 1997. Detection of human immunodeficiency virus type 1 (HIV-1) DNA and RNA sequences in HIV-1 antibody-positive blood donors in Uganda by the Roche AMPLICOR assay. J. Clin. Microbiol. 35, 873–876. Janssens, W., Heyndrickx, L., Fransen, K., Motte, J., Peeters, M., Nkengasong, J.N., Ndumbe, P.M., Delaporte, E., Perret, J.-L., Atende, C., Piot, P., Van der Groen, G., 1994. Genetic and phylogenetic analysis of en6 subtypes G and H in Central Africa. AIDS Res. Hum. Retroviruses 10, 877– 879. Johanson, J., Abravaya, K., Caminiti, W., Erickson, D., Flanders, R., Leckie, G., Marshall, E., Mullen, C., Ohhashi, Y., Perry, R., Ricci, J., Salituro, J., Smith, A., Tang, N., Vi, M., Robinson, J., The Abbott LCx HIV RNA quantitative assay: a new ultrasensitive assay for quantitation of HIV-1 RNA in plasma, submitted. Kern, D., Collins, M., Fultz, T., Detmer, J., Hamren, S., Peterkin, J.J., Sheridan, P., Urdea, M., White, R., Yeghiazarian, T., Todd, J., 1996. An enhanced-sensitivity branched-DNA assay for quantification of human im-
107
munodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 34, 3196 – 3202. Kievits, T., Van Gemen, B., Van Strijp, D., Schukkink, R., Dircks, M., Adriaanse, H., Malek, L., Sooknanan, R., Lens, P., 1991. NASBA™ isothermal enzymatic in vitro nucleic acid amplification optimized for the diagnosis of HIV-1 infection. J. Virol. Methods 35, 273 – 286. Korber, B., Kuiken, C., Foley, B., Hahn, B., McCutchan, F., Mellors, J.W., Sodroski, J., 1998. Human retroviruses and AIDS 1998. A compilation and analysis of nucleic acid and amino acid sequences. Theoretical Biology and Biophysics Group T-10, Los Alamos National Laboratory, Los Alamos, New Mexico. Loussert-Ajaka, I., Chaix, M.-L., Korber, B., Letourneur, F., Gomas, E., Allen, E., Ly, T.-D., Brun-Ve´zinet, F., Simon, F., Saragosti, S., 1995. Variability of human immunodeficiency virus type 1 group O strains isolated from Cameroonian patients living in France. J. Virol. 69, 5640 – 5649. McCutchan, F.E., Salminen, M.O., Carr, J.K., Burke, D.S., 1996. HIV-1 genetic diversity. AIDS 10 (suppl 3), S13 – S20. Mellors, J.W., Rinaldo, C.R. Jr, Gupta, P., White, R.M., Todd, J.A., Kingsley, L.A., 1996. Prognosis in HIV-1 infection predicted by the quantity of virus in plasma. Science 272, 1167 – 1170. Michael, N.L., Herman, S.A., Kwok, S., Dreyer, K., Wang, J., Christopherson, C., Spadoro, J.P., Young, K.K.Y., Polonis, V., McCutchan, F.E., Carr, J., Mascola, J.R., Jagodzinski, L.L., Robb, M.L., 1999. Development of calibrated viral load standards for group M subtypes of human immunodeficiency virus type 1 and performance of an improved AMPLICOR HIV-1 MONITOR test with isolates of diverse subtypes. J. Clin. Microbiol. 37, 2557 – 2563. Mulder, J., McKinney, N., Christopherson, C., Sninsky, J., Greenfield, L., Kwok, S., 1994. Rapid and simple PCR assay for quantitation of human immunodeficiency virus type 1 RNA in plasma: application to acute retroviral infection. J. Clin. Microbiol. 32, 292 – 300. Murphy, D.G., Gonin, P., Fauvel, M., 1999. Reproducibility and performance of the second-generation branched-DNA assay in routine quantification of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 37, 812 – 814. Nasioulas, G., Paraskevis, D., Magiorkinis, E., Theodoridou, M., Hatzakis, A., 1999. Molecular analysis of the fulllength genome of HIV type 1 subtype I: evidence of A/G/I recombination. AIDS Res. Hum. Retroviruses 15, 745 – 758. Nolte, F.S., Boysza, J., Thurmond, C., Clark, W.S., Lennox, J.L., 1998. Clinical comparison of an enhanced-sensitivity branched-DNA assay and reverse transcription-PCR for quantitation of human immunodeficiency virus type 1 RNA in plasma. J. Clin. Microbiol. 36, 716 – 720. Peeters, M., Liegeois, F., Torimiro, N., Bourgeois, A., Mpoudi, E., Vergne, L., Saman, E., Delaporte, E., Saragosti, S., 1999. Characterization of a highly replicative
108
P. Swanson et al. / Journal of Virological Methods 89 (2000) 97–108
intergroup M/O human immunodeficiency virus type 1 recombinant isolated from a Cameroonian patient. J. Virol. 73, 7368 – 7375. Rayfield, M.A., Sullivan, P., Bandea, C.I., Britvan, L., Otten, R.A., Pau, C.P., Pieniazek, D., Subbarao, S., Simon, P., Schable, C.A., Wright, A.C., Ward, J., Schochetman, G., 1996. HIV-1 group O virus identified for the first time in the US. Emerg. Infect. Dis. 2, 209–212. Respess, R.A., Butcher, A., Wang, H., Chaowanachan, T., Young, N., Shaffer, N., Mastro, T.D., Biryahwaho, B., Downing, R., Tanuri, A., Schechter, M., Pascu, R., Zekeng, L., Kaptue´, L., Gu¨rtler, L., Eberle, J., Ellenberger, D., Fridlund, C., Rayfield, M., Kwok, S., 1997. Detection of genetically diverse human immunodeficiency virus type 1 group M and group O isolates by PCR. J. Clin. Microbiol. 35, 1284 – 1286. Robertson, D.L., Sharp, P.M., McCutchan, F.E., Hahn, B.H., 1995. Recombination in HIV-1. Nature 374, 124–126. Saag, M.S., Holodniy, M., Kuritzkes, D.R., O’Brien, W.A., Coombs, R., Poscher, M.E., Jacobsen, D.M., Shaw, G.M., Richman, D.D., Volberding, P.A., 1996. HIV viral load markers in clinical practice. Nat. Med. 2, 625–629. Schiltz, H., Wild, C., Kilgore, N., Singh, P., Chorley, M., Garcia-Meijide, M., 2000. Quantification of HIV-1 group O virus isolates using the hybrid capture II HIV RNA v1.0
.
test and other conventional methods. In: 7th Conference on Retroviruses and Opportunistic Infections, Abstr., p. 220. Takehisa, J., Zekeng, L., Ido, E., Mboudjeka, I., Moriyama, H., Miura, T., Yamashita, M., Gu¨rtler, L.G., Hayami, M., Kaptue´, L., 1998. Various types of HIV mixed infections in Cameroon. Virology 245, 1 – 10. Tanuri, A., Swanson, P., Devare, S., Berro, O.J., Savedra, A., Costa, L.J., Telles, J.G., Brindeiro, R., Schable, C., Pieniazek, D., Rayfield, M., 1999. HIV-1 subtypes among blood donors from Rio de Janeiro, Brazil. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 20, 60 – 66. Triques, K., Coste, J., Perret, J.L., Segarra, C., Mpoudi, E., Reynes, J., Delaporte, E., Butcher, A., Dreyer, K., Herman, S., Spadoro, J., Peeters, M., 1999. Efficiencies of four versions of the AMPLICOR HIV-1 MONITOR test for quantification of different subtypes of human immunodeficiency virus type 1. J. Clin. Microbiol. 37, 110 – 116. Vandamme, A.-M., Schmit, J.-C., Van Dooren, S., Van Laethem, K., Gobbers, E., Kok, W., Goubau, P., Witvrouw, M., Peetermans, W., De Clercq, E., Desmyter, J., 1996. Quantification of HIV-1 RNA in plasma: comparable results with the NASBA HIV-1 RNA QT and AMPLICOR HIV monitor test. J. Acquir. Immune Defic. Syndr. Hum. Retrovirol. 13, 127 – 139.