- Email: [email protected]
Rapid identification of Salmonella enterica subsp. arizonae and S. enterica subsp. diarizonae by real-time polymerase chain reaction
Available online at www.sciencedirect.com
Diagnostic Microbiology and Infectious Disease 64 (2009) 452 – 454 www.elsevier.com/locate/diagmicrobio
Rapid identification of Salmonella enterica subsp. arizonae and S. enterica subsp. diarizonae by real-time polymerase chain reaction Katie L. Hopkins⁎, Tansy M. Peters, Andy J. Lawson, Robert J. Owen Department of Gastrointestinal, Emerging and Zoonotic Infections, Health Protection Agency Centre for Infections, NW9 5EQ London, United Kingdom Received 3 February 2009; accepted 21 March 2009
Abstract Reptiles are popular as pets, leading to an increased risk of human infections due to uncommon Salmonella strains including the Arizona group (subspecies arizonae and diarizonae). We present a real-time Arizona-specific polymerase chain reaction demonstrating 100% specificity and 99.6% sensitivity, offering savings in time and labor over traditional identification methods. © 2009 Elsevier Inc. All rights reserved. Keywords: Salmonella enterica subsp. arizonae; Salmonella enterica subsp. diarizonae; 5′ Nuclease real-time PCR
The Arizona group, formerly known as the genus Arizona, has 2 phylogenetically distinct groups: Salmonella enterica subsp. arizonae (IIIa) and S. enterica subsp. diarizonae (IIIb). S. enterica subsp. arizonae and diarizonae are naturally found in reptiles, which have enjoyed increasing popularity as pets in recent years, leading to a concurrent increase in human infections (Sanyal et al., 1997; Schröter et al., 2004). The organisms can be transmitted to humans via direct or indirect contact with reptiles or ingestion of snake meat “folk medicine” products, usually resulting in gastroenteritis but occasionally leading to bacteremia, osteomyelitis, and meningitis (Hoag and Sessler, 2005). Severe infection tends to occur in patients with impaired immunity or in young children and can be difficult to eradicate and require hospitalization. Approximately 1.4 million human cases of Salmonella infection occur annually in the United States, of which 74 000 are estimated to be as a result of exposure to reptiles and amphibians (Mermin et al., 2004). Cases of reptileassociated salmonellosis have also been observed in Europe (Bertrand et al., 2008). In 2007, the Arizona group was featured in the top 25 serotypes of Salmonella isolated in England and Wales (Fisher, personal communication).
⁎ Corresponding author. Tel.: +44-0-208-327-6538; fax: +44-0-208905-9929. E-mail address: [email protected] (K.L. Hopkins). 0732-8893/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.03.022
The Arizona group can be differentiated from most other subspecies of S. enterica based on hydrolysis of Onitrophenyl-β-D-galactopyranoside (ONPG) by β-galactosidase (encoded by lacZ) among other biochemical tests (Bale et al., 2007). The antigenic structure of the Arizona group is often difficult to determine, and isolates are usually sent to a specialist laboratory for identification. Here, we describe a duplex 5′ nuclease (TaqMan®) real-time polymerase chain reaction (PCR) for rapid and reliable identification of the Arizona group. We examined 103 isolates of S. enterica subsp. arizonae and 155 isolates of S. enterica subsp. diarizonae from humans, reptiles, food, and water isolated between January 2004 and August 2008 and previously identified using biochemistry and Kauffmann–White serology (Bale et al., 2007). Isolates of Salmonella from subspecies I, II, IV, V, and VI (37 isolates) and 34 isolates of other enterobacteria (Hafnia, Citrobacter, Enterobacter, Escherichia, or Proteus spp.) served as negative controls. Cell lysates were prepared by emulsifying 1 colony in 100 μL of sterile distilled water and boiling for 10 min. Sequences for the Arizona-specific primer/TaqMan probe set (Table 1) were designed based on the S. enterica subsp. arizonae lacZ sequence (GenBank accession number AY746956). Specificity of the sequences was confirmed by BLASTn search against sequences in the GenBank database and on the Washington University Genome Sequencing Center website (http://genome.wustl.edu/). Salmonella
K.L. Hopkins et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 452–454 Table 1 Primers and probes used in the lacZ/ttr duplex assay Name
Sequence
lacZ-F2 lacZ-R2 ArizLZPr
GCAAAACCTACCGGATTGAT CTCCACCCTTTCATTCACCT Yakima Yellow-CATGGCGAAATGCAGATCGACATCBlack Hole Quencher CTCACCAGGAGATTACAACATGG AGCTCAGACCAAAAGTGACCATC FAM-CACCGACGGCGAGACCGACTTTBlack Hole Quencher
ttr-6 (forward) ttr-4 (reverse) ttr-5 (probe)
bongori and some S. enterica subspecies VI strains are also able to hydrolyse ONPG, but primers were shown to be specific for the S. enterica subsp. arizonae and S. enterica subsp. diarizonae lacZ sequences. A 2nd primer/TaqMan probe set targeting the ttrRSBCA locus (required for tetrathionate respiration) were used to act as an internal amplification control and confirm presence of Salmonella DNA (Malorny et al., 2004). The ttr primer/probe set was previously shown to have a sensitivity and specificity of 100% based on data from 110 Salmonella and 87 non-Salmonella strains (Malorny et al., 2004). The assay was validated in-house on an ABI Prism 7500 Real-Time PCR System (Applied Biosystems, Warrington, UK). Optimized reactions (25-μL volume) contained 1× qPCR Mastermix Plus Low ROX (Eurogentec, Seraing, Belgium), 400 nmol/L each of ttr-6 and ttr-4, 50 nmol/L ttr-5, 900 nmol/L each of lacZ-F2 and lacZ-R2, 200 nmol/L ArizLZPr, and 2.5 μL of boiled cell lysate. “No template” controls that contained 2.5-μL sterile distilled water instead of DNA were included in each run to detect any PCR reagent contamination. PCRs were performed in qPCR 96-well plates sealed with qPCR opti-seals (both Eurogentec). Amplification consisted of a 3-step protocol: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 1 min.
453
All Salmonella were positive for the ttrRSBCA locus with threshold cycle numbers (CT) ranging between 16 and 24 (average 20). CT values for the Arizona-specific target were between 15 and 29 (average 22). Seven of 155 strains previously identified as S. enterica subsp. diarizonae by biochemistry and serotyping were positive for the ttr locus but negative for lacZ. Subsequent repeated biochemistry and serology identified 4 of these as belonging to subspecies I (3 strains), atypical subspecies I contaminated with a non-Salmonella (1 culture), and subspecies IV (1 strain), and 1 isolate was an atypical subspecies II, suggesting that these were initially mixed cultures or misidentified. The remaining strain was confirmed as belonging to S. enterica subsp. diarizonae by biochemistry and serotyping. Failure of the real-time PCR assay was due to lack of amplification from the DNA of this strain with the lacZ primers (data not shown). This was investigated further by type I chaperonin gene cpn60 sequence analysis of this strain using primers H1261 and H1511 ((Hill et al., 2004) (primer sequences available at http://homepage.usask.ca/%7Ejeh369/cpn60_universal_primers.html). An alignment of partial cpn60 DNA sequence from subspecies III strains and other Salmonella subspecies showed that the lacZ-negative strain clustered separately from the clade formed by the S. enterica subsp. diarizonae strains (data not shown), suggesting that this strain is either atypical or not a S. enterica subsp. diarizonae. Other than the 6 misidentified strains, 251 of 252 S. enterica subsp. arizonae and S. enterica subsp. diarizonae were positive for the Arizona-specific target lacZ. The other Salmonella subspecies were negative for the lacZ target, and there was no amplification of either target from Hafnia, Citrobacter, Enterobacter, Escherichia, or Proteus spp. The duplex assay showed 100% specificity and 99.6% sensitivity, with subsp. arizonae or diarizonae only being identified when both ttr and lacZ targets were detected (Table 2). There are numerous potential delays in the traditional process of identification and typing of salmonellae.
Table 2 Salmonella and non-Salmonella isolates used in testing the lacZ/ttr duplex assay and results Genus/Salmonella subspp. Salmonella I (enterica)
II (salamae)
IIIa (arizonae) IIIb (diarizonae) IV (houtenae) V (bongori) VI (indica) Citrobacter Enterobacter Escherichia Hafnia Proteus
Serotype (no. of isolates)
ttr locus result
lacZ result (no. of isolates)
Agona (1), Anatum (1), Braenderup (1), Chailey (1), Dublin (1), Enteritidis (2), Infantis (1), Muenster (1), Newport (1), Typhimurium (2), and Virchow (1) Artis (1), Bloemfontein (2), Dar-es-salaam (2), Degania (1) Locarno (1), Hagenbeck (1), Nairobi (1), Tranaroa (1), Uphill (1), and unnamed (3) 103 155 Chameleon (1), Houten (2), Seminole (1), and unnamed (1) Malawi (1), unnamed (1), Vrindaban (1), and unnamed (2) 10 2 7 9 6
+
−
+
−
+ + + + + − − − − −
+ + (148), − (7) − − − − − − − −
454
K.L. Hopkins et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 452–454
Conventional tube methods of biochemical testing are still the gold standard for reference laboratories and are more reliable than commercial bacterial identification systems, which usually correctly identify subsp. arizonae and diarizonae strains but may occasionally misidentify other organisms such as E. coli and Citrobacter spp. as belonging to the Arizona group (Janda and Abbott, 2005). However, these misidentified isolates would be easily identified by the ttr/lacZ duplex assay as they would be PCR negative for both targets. For the identification of the Arizona group, tube-based methods are laborious and time-consuming procedures because certain biochemical tests require long incubation periods. This may result in a turnaround time for full biochemical and serologic identification of up to 28 days in our laboratory. In contrast, the Arizona-specific PCR assay presented here accurately identified 99.6% of strains in less than 2 h. The assay has the potential for high throughput, enabling 93 samples plus controls to be tested in 1 run. Acknowledgments This study has not received specific funding. International patent application number PCT/GB2009/05617 is pending.
References Bale JA, de Pinna EM, Threlfall EJ, Ward LR (2007) Kauffmann–White Scheme—2007: Salmonella identification—serotypes and antigenic formulae. London: Health Protection Agency. Bertrand S, Rimhanen-Finne R, Weill FX, Rabsch W, Thornton L, Perevoscikovs J, van Pelt W, Heck M (2008) Salmonella infections associated with reptiles: the current situation in Europe. Euro Surveill 13:18902. Hill JE, Penny SL, Crowell KG, Goh SH, Hemmingsen SM (2004) cpnDB: a chaperonin sequence database. Genome Res 14:1669–1675. Hoag JB, Sessler CN (2005) A comprehensive review of disseminated Salmonella arizona infection with an illustrative case presentation. South Med J 98:1123–1129. Janda JM, Abbott SL (2005) Nontyphoidal salmonellae, The Enterobacteria (2nd ed.). ASM Press, pp. 81–104. Malorny B, Paccassoni E, Fach P, Bunge C, Martin A, Helmuth R (2004) Diagnostic real-time PCR for detection of Salmonella in food. Appl Environ Microbiol 70:7046–7052. Mermin J, Hutwagner L, Vugia D, Shallow S, Daily P, Bender J, Koehler J, Marcus R, Angulo FJ (2004) Reptiles, amphibians, and human Salmonella infection: a population-based, case-control study. Clin Infect Dis 38:S253–S261. Sanyal D, Douglas T, Roberts R (1997) Salmonella infection acquired from reptilian pets. Arch Dis Child 77:345–346. Schröter M, Roggentin P, Hofmann J, Speicher A, Laufs R, Mack D (2004) Pet snakes as a reservoir for Salmonella enterica subsp. diarizonae (Serogroup IIIb): a prospective study. Appl Environ Microbiol 70: 613–615.
Diagnostic Microbiology and Infectious Disease 64 (2009) 452 – 454 www.elsevier.com/locate/diagmicrobio
Rapid identification of Salmonella enterica subsp. arizonae and S. enterica subsp. diarizonae by real-time polymerase chain reaction Katie L. Hopkins⁎, Tansy M. Peters, Andy J. Lawson, Robert J. Owen Department of Gastrointestinal, Emerging and Zoonotic Infections, Health Protection Agency Centre for Infections, NW9 5EQ London, United Kingdom Received 3 February 2009; accepted 21 March 2009
Abstract Reptiles are popular as pets, leading to an increased risk of human infections due to uncommon Salmonella strains including the Arizona group (subspecies arizonae and diarizonae). We present a real-time Arizona-specific polymerase chain reaction demonstrating 100% specificity and 99.6% sensitivity, offering savings in time and labor over traditional identification methods. © 2009 Elsevier Inc. All rights reserved. Keywords: Salmonella enterica subsp. arizonae; Salmonella enterica subsp. diarizonae; 5′ Nuclease real-time PCR
The Arizona group, formerly known as the genus Arizona, has 2 phylogenetically distinct groups: Salmonella enterica subsp. arizonae (IIIa) and S. enterica subsp. diarizonae (IIIb). S. enterica subsp. arizonae and diarizonae are naturally found in reptiles, which have enjoyed increasing popularity as pets in recent years, leading to a concurrent increase in human infections (Sanyal et al., 1997; Schröter et al., 2004). The organisms can be transmitted to humans via direct or indirect contact with reptiles or ingestion of snake meat “folk medicine” products, usually resulting in gastroenteritis but occasionally leading to bacteremia, osteomyelitis, and meningitis (Hoag and Sessler, 2005). Severe infection tends to occur in patients with impaired immunity or in young children and can be difficult to eradicate and require hospitalization. Approximately 1.4 million human cases of Salmonella infection occur annually in the United States, of which 74 000 are estimated to be as a result of exposure to reptiles and amphibians (Mermin et al., 2004). Cases of reptileassociated salmonellosis have also been observed in Europe (Bertrand et al., 2008). In 2007, the Arizona group was featured in the top 25 serotypes of Salmonella isolated in England and Wales (Fisher, personal communication).
⁎ Corresponding author. Tel.: +44-0-208-327-6538; fax: +44-0-208905-9929. E-mail address: [email protected] (K.L. Hopkins). 0732-8893/$ – see front matter © 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.diagmicrobio.2009.03.022
The Arizona group can be differentiated from most other subspecies of S. enterica based on hydrolysis of Onitrophenyl-β-D-galactopyranoside (ONPG) by β-galactosidase (encoded by lacZ) among other biochemical tests (Bale et al., 2007). The antigenic structure of the Arizona group is often difficult to determine, and isolates are usually sent to a specialist laboratory for identification. Here, we describe a duplex 5′ nuclease (TaqMan®) real-time polymerase chain reaction (PCR) for rapid and reliable identification of the Arizona group. We examined 103 isolates of S. enterica subsp. arizonae and 155 isolates of S. enterica subsp. diarizonae from humans, reptiles, food, and water isolated between January 2004 and August 2008 and previously identified using biochemistry and Kauffmann–White serology (Bale et al., 2007). Isolates of Salmonella from subspecies I, II, IV, V, and VI (37 isolates) and 34 isolates of other enterobacteria (Hafnia, Citrobacter, Enterobacter, Escherichia, or Proteus spp.) served as negative controls. Cell lysates were prepared by emulsifying 1 colony in 100 μL of sterile distilled water and boiling for 10 min. Sequences for the Arizona-specific primer/TaqMan probe set (Table 1) were designed based on the S. enterica subsp. arizonae lacZ sequence (GenBank accession number AY746956). Specificity of the sequences was confirmed by BLASTn search against sequences in the GenBank database and on the Washington University Genome Sequencing Center website (http://genome.wustl.edu/). Salmonella
K.L. Hopkins et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 452–454 Table 1 Primers and probes used in the lacZ/ttr duplex assay Name
Sequence
lacZ-F2 lacZ-R2 ArizLZPr
GCAAAACCTACCGGATTGAT CTCCACCCTTTCATTCACCT Yakima Yellow-CATGGCGAAATGCAGATCGACATCBlack Hole Quencher CTCACCAGGAGATTACAACATGG AGCTCAGACCAAAAGTGACCATC FAM-CACCGACGGCGAGACCGACTTTBlack Hole Quencher
ttr-6 (forward) ttr-4 (reverse) ttr-5 (probe)
bongori and some S. enterica subspecies VI strains are also able to hydrolyse ONPG, but primers were shown to be specific for the S. enterica subsp. arizonae and S. enterica subsp. diarizonae lacZ sequences. A 2nd primer/TaqMan probe set targeting the ttrRSBCA locus (required for tetrathionate respiration) were used to act as an internal amplification control and confirm presence of Salmonella DNA (Malorny et al., 2004). The ttr primer/probe set was previously shown to have a sensitivity and specificity of 100% based on data from 110 Salmonella and 87 non-Salmonella strains (Malorny et al., 2004). The assay was validated in-house on an ABI Prism 7500 Real-Time PCR System (Applied Biosystems, Warrington, UK). Optimized reactions (25-μL volume) contained 1× qPCR Mastermix Plus Low ROX (Eurogentec, Seraing, Belgium), 400 nmol/L each of ttr-6 and ttr-4, 50 nmol/L ttr-5, 900 nmol/L each of lacZ-F2 and lacZ-R2, 200 nmol/L ArizLZPr, and 2.5 μL of boiled cell lysate. “No template” controls that contained 2.5-μL sterile distilled water instead of DNA were included in each run to detect any PCR reagent contamination. PCRs were performed in qPCR 96-well plates sealed with qPCR opti-seals (both Eurogentec). Amplification consisted of a 3-step protocol: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s, 60 °C for 20 s, and 72 °C for 1 min.
453
All Salmonella were positive for the ttrRSBCA locus with threshold cycle numbers (CT) ranging between 16 and 24 (average 20). CT values for the Arizona-specific target were between 15 and 29 (average 22). Seven of 155 strains previously identified as S. enterica subsp. diarizonae by biochemistry and serotyping were positive for the ttr locus but negative for lacZ. Subsequent repeated biochemistry and serology identified 4 of these as belonging to subspecies I (3 strains), atypical subspecies I contaminated with a non-Salmonella (1 culture), and subspecies IV (1 strain), and 1 isolate was an atypical subspecies II, suggesting that these were initially mixed cultures or misidentified. The remaining strain was confirmed as belonging to S. enterica subsp. diarizonae by biochemistry and serotyping. Failure of the real-time PCR assay was due to lack of amplification from the DNA of this strain with the lacZ primers (data not shown). This was investigated further by type I chaperonin gene cpn60 sequence analysis of this strain using primers H1261 and H1511 ((Hill et al., 2004) (primer sequences available at http://homepage.usask.ca/%7Ejeh369/cpn60_universal_primers.html). An alignment of partial cpn60 DNA sequence from subspecies III strains and other Salmonella subspecies showed that the lacZ-negative strain clustered separately from the clade formed by the S. enterica subsp. diarizonae strains (data not shown), suggesting that this strain is either atypical or not a S. enterica subsp. diarizonae. Other than the 6 misidentified strains, 251 of 252 S. enterica subsp. arizonae and S. enterica subsp. diarizonae were positive for the Arizona-specific target lacZ. The other Salmonella subspecies were negative for the lacZ target, and there was no amplification of either target from Hafnia, Citrobacter, Enterobacter, Escherichia, or Proteus spp. The duplex assay showed 100% specificity and 99.6% sensitivity, with subsp. arizonae or diarizonae only being identified when both ttr and lacZ targets were detected (Table 2). There are numerous potential delays in the traditional process of identification and typing of salmonellae.
Table 2 Salmonella and non-Salmonella isolates used in testing the lacZ/ttr duplex assay and results Genus/Salmonella subspp. Salmonella I (enterica)
II (salamae)
IIIa (arizonae) IIIb (diarizonae) IV (houtenae) V (bongori) VI (indica) Citrobacter Enterobacter Escherichia Hafnia Proteus
Serotype (no. of isolates)
ttr locus result
lacZ result (no. of isolates)
Agona (1), Anatum (1), Braenderup (1), Chailey (1), Dublin (1), Enteritidis (2), Infantis (1), Muenster (1), Newport (1), Typhimurium (2), and Virchow (1) Artis (1), Bloemfontein (2), Dar-es-salaam (2), Degania (1) Locarno (1), Hagenbeck (1), Nairobi (1), Tranaroa (1), Uphill (1), and unnamed (3) 103 155 Chameleon (1), Houten (2), Seminole (1), and unnamed (1) Malawi (1), unnamed (1), Vrindaban (1), and unnamed (2) 10 2 7 9 6
+
−
+
−
+ + + + + − − − − −
+ + (148), − (7) − − − − − − − −
454
K.L. Hopkins et al. / Diagnostic Microbiology and Infectious Disease 64 (2009) 452–454
Conventional tube methods of biochemical testing are still the gold standard for reference laboratories and are more reliable than commercial bacterial identification systems, which usually correctly identify subsp. arizonae and diarizonae strains but may occasionally misidentify other organisms such as E. coli and Citrobacter spp. as belonging to the Arizona group (Janda and Abbott, 2005). However, these misidentified isolates would be easily identified by the ttr/lacZ duplex assay as they would be PCR negative for both targets. For the identification of the Arizona group, tube-based methods are laborious and time-consuming procedures because certain biochemical tests require long incubation periods. This may result in a turnaround time for full biochemical and serologic identification of up to 28 days in our laboratory. In contrast, the Arizona-specific PCR assay presented here accurately identified 99.6% of strains in less than 2 h. The assay has the potential for high throughput, enabling 93 samples plus controls to be tested in 1 run. Acknowledgments This study has not received specific funding. International patent application number PCT/GB2009/05617 is pending.
References Bale JA, de Pinna EM, Threlfall EJ, Ward LR (2007) Kauffmann–White Scheme—2007: Salmonella identification—serotypes and antigenic formulae. London: Health Protection Agency. Bertrand S, Rimhanen-Finne R, Weill FX, Rabsch W, Thornton L, Perevoscikovs J, van Pelt W, Heck M (2008) Salmonella infections associated with reptiles: the current situation in Europe. Euro Surveill 13:18902. Hill JE, Penny SL, Crowell KG, Goh SH, Hemmingsen SM (2004) cpnDB: a chaperonin sequence database. Genome Res 14:1669–1675. Hoag JB, Sessler CN (2005) A comprehensive review of disseminated Salmonella arizona infection with an illustrative case presentation. South Med J 98:1123–1129. Janda JM, Abbott SL (2005) Nontyphoidal salmonellae, The Enterobacteria (2nd ed.). ASM Press, pp. 81–104. Malorny B, Paccassoni E, Fach P, Bunge C, Martin A, Helmuth R (2004) Diagnostic real-time PCR for detection of Salmonella in food. Appl Environ Microbiol 70:7046–7052. Mermin J, Hutwagner L, Vugia D, Shallow S, Daily P, Bender J, Koehler J, Marcus R, Angulo FJ (2004) Reptiles, amphibians, and human Salmonella infection: a population-based, case-control study. Clin Infect Dis 38:S253–S261. Sanyal D, Douglas T, Roberts R (1997) Salmonella infection acquired from reptilian pets. Arch Dis Child 77:345–346. Schröter M, Roggentin P, Hofmann J, Speicher A, Laufs R, Mack D (2004) Pet snakes as a reservoir for Salmonella enterica subsp. diarizonae (Serogroup IIIb): a prospective study. Appl Environ Microbiol 70: 613–615.