Recycling of Ribosomal Complexes Stalled at the Step of Elongation in Escherichia coli

doi:10.1016/j.jmb.2008.05.033

J. Mol. Biol. (2008) 380, 451–464

Available online at www.sciencedirect.com

Recycling of Ribosomal Complexes Stalled at the Step of Elongation in Escherichia coli Nongmaithem Sadananda Singh, Rais Ahmad, Ramachandran Sangeetha and Umesh Varshney⁎ Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore-560012, India Received 18 April 2008; received in revised form 11 May 2008; accepted 15 May 2008 Available online 21 May 2008

Translating ribosomes often stall during elongation. The stalled ribosomes are known to be recycled by tmRNA (SsrA)-mediated trans-translation. Another process that recycles the stalled ribosomes is characterized by peptidyl-tRNA release. However, the mechanism of peptidyl-tRNA release from the stalled ribosomes is not well understood. We used a defined system of an AGA-minigene containing a small open reading frame (ATG AGA AGA). Translation of the AGA-minigene mRNA is toxic to Escherichia coli because it stalls ribosomes during elongation and sequesters tRNAArg4 as a short-chain peptidyl-tRNAArg4 in the ribosomal P-site. We show that a ribosome recycling factor (RRF)-mediated process rescues the host from the AGA-minigene toxicity by releasing the peptidyl-tRNAArg4 from the ribosomes. The growth phenotypes of E. coli strains harboring mutant alleles of RRF and initiation factor 3 (IF3) genes and their consequences on λimmP22 phage replication upon AGA-minigene expression reveal that IF3 facilitates the RRF-mediated processing of the stalled ribosomes. Additionally, we have designed a uracil DNA glycosylase gene construct, ung-stopless, whose expression is toxic to E. coli. We show that the RRF-mediated process also alleviates the ung-stopless construct-mediated toxicity to the host by releasing the ung mRNA from the ribosomes harboring long-chain peptidyl-tRNAs. © 2008 Elsevier Ltd. All rights reserved.

Edited by J. Karn

Keywords: RRF; peptidyl-tRNA; ssrA; minigene; Ung

Introduction Cells have evolved mechanisms to maintain the fidelity and efficiency of each of the steps in protein synthesis. However, due to various reasons, the translating ribosomes often stall during elongation. It is imperative, therefore, for the cell to rescue the stalled ribosomes to maintain the steady-state supply of free tRNAs and ribosomes. The stalled ribosomes containing truncated mRNAs are known to be recycled by tmRNA (SsrA)-mediated transtranslation.1 The process of trans-translation extends the incomplete peptide by translating the short open reading frame (ORF) of the tmRNA, and rescues the stalled ribosomes by subjecting them to a termination codon-dependent translation termination. Ano*Corresponding author. E-mail address: [email protected]. Abbreviations used: ORF, open reading frame; Pth, peptidyl-tRNA hydrolase.

ther process that rescues the stalled ribosomes results in release of the peptidyl-tRNA (drop-off) from them.2–6 Although the mechanism of peptidyltRNA release from the ribosome is not well understood, the dropped-off peptidyl-tRNAs themselves are recycled by peptidyl-tRNA hydrolase (Pth), which cleaves the ester link between the peptide and the tRNA.7,8 The importance of Pth in recycling peptidyl-tRNAs was demonstrated by the essential nature of the pth gene.3 Notably, the free peptidyltRNAs but not those present within ribosomes are substrates for Pth.9 Further, it was observed that the lambda phage fails to grow on an Escherichia coli (rap) isolate.10 The rap isolate was later shown to possess a mutation in pth gene resulting in lower specific activity of the encoded protein.11 Interestingly, when the highly transcribed and translated barI and barII minigenes (ATG ATA TAG and ATG ATA TAA, respectively) present in the phage genome were mutated, the mutant phage could grow on the E. coli (rap) strain.12 The barI and barII minigenes sequester tRNAIle as peptidyl-tRNAIle

0022-2836/$ - see front matter © 2008 Elsevier Ltd. All rights reserved.

452

Recycling of Stalled Ribosomes

and exert their toxic effect on E. coli.13 Subsequently, several minigenes whose expression in E. coli is toxic have been characterized.14,15 A minigene with an ORF ATG AGA AGA stop was shown to seArg (tRNAArg4) as peptidyl-tRNAArg4 quester tRNAUCU on ribosomes and cause toxicity to E. coli. Interestingly, the observation that the translation of the minigene transcripts causes toxicity to E. coli by trapping peptidyl-tRNA on the ribosome offers it as a powerful system for in vivo analysis of the mechanism of peptidyl-tRNA drop-off and recycling of the stalled (pre-termination) ribosomal complexes. The 70 S ribosomes, and the post-termination complexes of ribosomes containing mRNA and tRNA are dissociated into subunits by RRF and EF-G with the participation of IF3.6,16–18 Studies have suggested that RRF, EFG and IF3 are involved in releasing peptidyl-tRNAs from the stalled ribosomes.6,19,20 However, these studies did not allow for a systematic analysis of the process of peptidyl-tRNA release from the ribosome. In this study, we have employed the ATG AGA AGA TGA minigene (AGA-minigene) expressed from an inducible promoter to further our understanding of the involvement of RRF and IF3 in the processing of the stalled ribosomes harboring short-chain peptidyl-tRNA. In addition, an extension of these studies has allowed us to address the issue of whether the stalled ribosomes containing a long-chain peptidyl-tRNA could be processed by RRF. We show that expression of a stopless uracil DNA glycosylase (ung) gene21 leads to ribosome stalling and toxicity to E. coli. However, simultaneous

over-expression of RRF rescues the host growth by releasing the ung mRNA from ribosomes.

Results The AGA-minigene toxicity and its rescue by SsrA It has been shown that expression of the AGAminigene (ATG AGA AGA TGA) in E. coli results in sequestration of tRNAUCUArg (tRNAArg4) as peptidyltRNAArg4 on the ribosomes as well as in its excessive drop-off in the cell.15 Both of these activities result in toxicity to E. coli strains deficient in peptidyl-tRNA hydrolase (Pth). In E. coli strains wild-type for Pth, while the free (dropped-off) peptidyl-tRNAs are recycled rapidly (by Pth) to tRNAs, the accumulation of the stalled ribosomes still results in toxicity to the host. In order to use this defined AGA-minigene system to understand the mechanism of recycling of the stalled ribosomal complexes, we created the ATG AGA AGA TGA minigene sequence in the pTrc99C expression vector downstream of the Shine–Dalgarno sequence (pTrcAGA, Table 1) under the control of an isopropyl-β-D-thiogalactopyranoside (IPTG)-inducible promoter and introduced the construct into E. coli TG1 (a commonly used laboratory strain, wild-type for pth). As expected, induction of the minigene expression from pTrcAGA caused

Table 1. Plasmids and strains used in this study Description A. Plasmids pTrcNdeIsingle

pACDNdeI pACDEcoPth pTrcAGA pTrcEcoRRF (R6R) pACDEcoRRF pACDEcoRRF(R6R) pTrcAGA-ssrA pTrcUng

pTrcUng-stopless B. E. coli Strains TG1 TG1 ssrA∷Kan TG1 frr1 MG1655 MG1655 frr1 MG1655 infC135 MG1655 infC135 frr1

A derivative of pTrc99C wherein the original NdeI site in the backbone of the vector was mutated by digesting it with NdeI and filling in the ends with phage T4 DNA polymerase followed by self-ligation. Subsequently, the NcoI site of the vector (harboring the initiation codon) was converted to an NdeI site A derivative of pACDH38 generated by subcloning the EcoRV-HindIII fragment of pTrcNdeIsingle into the Ecl136II and HindIII sites of pACDH A pACDNdeI-derived expression vector harboring the E. coli pth open reading frame The minigene ATG AGA AGA TGA under the promoter of pTrc99C A derivative of pTrcEcoRRF21 with the R6R silent mutation Same as pACDHEcoRRF wherein the NcoI-HindIII fragment harboring EcoRRF was subcloned from pTrcEcoRRF into the same sites of pACDH NcoI-HindIII fragment harboring EcoRRF(R6R) was subcloned from pTrcEcoRRF(R6R) into the same sites of pACDH A derivative of pTrcAGA generated by subcloning the HindIII fragment of pTrc-ssrA5 into the same sites ung gene ORF and the downstream sequence was PCR amplified with Vent DNA polymerase from pTZUng421 using 5′ cggaattccatggctaacgaattaacc 3′ and 5′ caggaaacagctatgac 3′ primers, digested with NcoI and PstI and cloned within the same sites of pTrc99C, and verified by DNA sequencing A derivative of pTrcUng obtained by mutating the stop codon TAA and the following A nucleotide to AAGC supE hsdΔ5 thiΔ(lac-proAB) F'[traD36 proAB+ lacIq lacZΔM15] A derivative of E. coli TG1 with ssrA gene disrupted with a KanR cassette A derivative of E. coli TG1 harboring a CamR cassette in the promoter region of frr gene F− LAM− rph-1 A derivative of E. coli MG1655 harboring frr1 allele A derivative of E. coli MG1655 harboring infC135 allele linked to Tn10 (TetR) A derivative of E. coli MG1655 frr1 harboring infC135 allele linked to Tn10 (TetR)

Reference This work

This work This work This work This work 6,20 This work This work 39

This work

37 This work 6; this work 40 This work 6; this work 6; this work

Recycling of Stalled Ribosomes

toxicity to the host (Fig. 1a, compare growth of the spotted bacterial dilutions in rows 1 and 3 on plates with no IPTG, 0.1 mM IPTG and 0.2 mM IPTG). To understand the mechanism of ribosome stalling, we analyzed the effect of SsrA overproduction on the AGA-minigene-mediated toxicity. We observed that the cells harboring pTrcAGA-ssrA, which results in over-expression of SsrA (tmRNA), showed better growth when compared with those harboring pTrcAGA alone (Fig. 1a, compare rows 3 and 4). In a converse experiment, disruption of the host ssrA gene with a KanR cassette rendered the cells hypersensitive to the AGA-minigene expression (Fig. 1a, compare rows 5 and 6 with rows 1 and 3, respectively). Also, a Northern blot analysis of the tRNAArg4 for its presence in the ribosomal and the supernatant (S100) fractions revealed that upon induction of the AGA-minigene expression, the level of tRNAArg4 increased in the ribosomal fraction with a concomitant decrease in the supernatant fraction (Fig. 1b, compare lanes 3 and 1 in panels i and ii). However, the levels of the tRNAArg4 distribution were brought to near normal upon over-expression

453 of SsrA (compare lane 4 with lane 1). Analysis for 5 S rRNA in the ribosomal fraction (panel iii) shows that uniform amounts of ribosomal fractions were used for the samples in lanes 1–4. These observations add to the earlier findings,15 and allow us to conclude that the AGA-minigene causes stalling of ribosomes at the step of elongation by sequestering tRNAArg4 as peptidyl-tRNAArg4 on the ribosomal P-site (see also Fig. 4). It may be noted that a small population of 5 S rRNA appears as slowly migrating band in lane 3 as a consequence of the AGA-minigene expression. While the reasons for this observation are not clear, it is not seen in the sample upon simultaneous over-expression of SsrA (lane 4). RRF over-expression rescues the host from the AGA-minigene toxicity We showed earlier that RRF, EFG and IF3 together are able to dissociate stalled ribosomal complexes.6 The phenomenon of AGA-minigene-mediated toxicity to E. coli offered us a defined in vivo model system to investigate the mechanism of RRF-mediated

Fig. 1. AGA-minigene toxicity and its rescue by SsrA. (a) Serial dilutions (10− 1 – 10− 5) of the saturated cultures of E. coli TG1 harboring pTrc99C, pTrc-ssrA, pTrcAGA or pTrcAGA-ssrA (rows 1–4, respectively) and E. coli TG1 ssrA∷Kan harboring pTrc99C or pTrcAGA (rows 5 and 6, respectively) were spotted using a 48-pronged spotter (Sigma) on LB agar containing Amp, and IPTG (as indicated) and incubated overnight at 37 °C. (b) RNA from the supernatant (S100, panel i) or the ribosomal (panel ii) fractions were prepared from 0.2 mM IPTG-induced cultures of E. coli TG1 harboring pTrc99C (lane 1), pTrc-ssrA (lane 2), pTrcAGA (lane 3) or pTrcAGA-ssrA (lane 4), resolved on 1% (w/v) agarose, transferred to nylon membrane, probed with (5′-32P)-labeled DNA oligomer specific to tRNAArg4 (panels i and ii) or 5 S rRNA (panel iii) and detected using BioImager analyzer (FLA5000, Fuji).

454 processing of the ribosomes stalled during elongation. As shown in Fig. 2a, cells harboring pTrcAGA and pACDEcoRRF showed better growth than those harboring pTrcAGA and pACDH vector, indicating that RRF over-expression rescues the host from the minigene toxicity (compare rows 4 and 5 in panels with no IPTG and 0.1 mM or 0.2 mM IPTG). As a control, over-expression of Pth did not rescue the host growth (compare rows 4 and 6). In fact, it seemed to cause some growth inhibition. Nevertheless, these observations suggest that the AGAminigene-mediated toxicity was due to sequestration of peptidyl-tRNAArg4 on the ribosome and not due to its accumulation in the free form in the cell. As noted earlier,15 the cellular levels of Pth in the

Recycling of Stalled Ribosomes

strain wild-type for pth must be adequate to recycle the dropped-off peptidyl-tRNAs. Furthermore, as shown in Fig. 2b, when the ribosome-associated and free tRNAs (S100 fraction) were analyzed, the amount of ribosome-associated tRNAArg4 decreased substantially upon RRF over-expression (panel ii, lanes 3 and 4). And, as was the case in Fig. 1b, overexpression of RRF also resulted in disappearance of the slow migrating band corresponding to 5 S rRNA that appeared upon induction of the AGAminigene expression (Fig. 2b panel iii, compare lanes 3 and 4). However, it may be noted that, in this experiment, for a clear impact of RRF over-expression, frr1 derivative of E. coli TG1 (the frr promoter region of this strain has been disrupted by a Cam

Fig. 2. Rescue of the AGA-minigene toxicity by overexpression of RRF. (a) Serial dilutions (10− 1 – 10− 5) of the saturated cultures of E. coli TG1 harboring pACDH, pACDEcoRRF or pACDEcoPth, along with pTrc99C (rows 1–3, respectively) or pTrcAGA (rows 4–6) were spotted using a 48-pronged spotter (Sigma) on LB agar containing Amp and Tet with different concentrations of IPTG (as indicated above each panel) and incubated overnight at 37 °C. (b) RNA from the supernatant (S100, panel i) or the ribosomal (panel ii) fractions were prepared from 0.2 mM IPTG-induced cultures of E. coli TG1 (frr1) strain harboring pTrc99C and pACDH (lane 1), pTrc99C and pACDEcoRRF (lane 2), pTrcAGA and pACDH (lane 3) or pTrcAGA and pACDEcoRRF (lane 4), resolved on 1% (w/v) agarose gel, transferred to nylon membrane, probed with (5′-32P)-labeled DNA oligomer specific to tRNAArg4 (panels i and ii) or 5 S rRNA (panel iii) and detected using BioImager analyzer (FLA5000, Fuji). (c) Same as (a), except that the strain contained a null mutation in the ssrA (ssrA∷Kan).

Recycling of Stalled Ribosomes

cassette, which results in about half the level of wildtype RRF in the cell4) was used. To further support the role of RRF in alleviating the AGA-minigene toxicity, we examined the effect of RRF in an ssrA∷Kan strain background (Fig. 2c). As in Fig. 2a, overproduction of RRF still resulted in alleviation of the minigene toxicity (Fig. 2c, compare rows 4 and 5). However, it may be noted that the rescue was somewhat less than that seen in the strain wild-type for ssrA (compare Fig. 2a and c) suggesting that in vivo both the RRF and SsrAmediated mechanisms contribute to the rescue of stalled ribosomes. In yet another experiment, we made use of an RRF (R6R) gene containing a silent mutation at its sixth codon in the ORF converting a rare Arg codon (AGA) to a frequently used Arg codon (CGC). As observed before for expression of genes harboring rare codons early in the ORF,22 introduction of this

455 silent mutation in the E. coli RRF gene resulted in an increased production of RRF (data not shown). Interestingly, use of this construct improved the rescue of the host growth from the toxicity of the AGAminigene expression (Fig. 3a panel ii, compare growth curves 4, 5 and 6). As a control, in the absence of induction of the minigene expression, the growth of all the strains was similar (panel i). RRF over-expression mediated rescue of the host from the minigene toxicity suggested that it is involved in the processing of the ribosomes stalled on the AGA-minigene mRNA. For a converse experiment, this meant that a decrease in the cellular level of RRF should result in enhanced toxicity. As shown in Fig. 3b, growth of E. coli MG1655 frr1 strain harboring the AGA-minigene, as expected, was sensitive to a lower level of the inducer (0.05 mM), a concentration that did not affect the growth of E. coli MG1655 parent harboring the AGA-minigene

Fig. 3. Effect of RRF and IF3 on growth of E. coli strains harboring AGA-minigene. (a) Growth of E. coli TG1 containing various plasmids (as indicated) was monitored in a kinetic growth reader (OY Growth) at 37 °C in the absence (panel i) or in the presence of 0.2 mM IPTG (panel ii). (b) Growth of E. coli MG1655 frr1 containing various plasmids (as indicated) in the absence (panel i) or in the presence of 0.05 mM IPTG (panel ii). (c) Growth of E. coli MG1655 and its derivatives, E. coli MG1655 frr1; E. coli MG1655 infC135; and E. coli MG1655 infC135 frr1 harboring either pTrc99C or pTrcAGA at 37 °C in the absence (panel i) or in the presence (panel ii) of 0.05 mM IPTG.

456 (compare growth curve 3 in Fig. 3b panel ii with growth curve 2 in Fig. 3c panel ii, described below). Importantly, as two different backgrounds of commonly used laboratory strains (E. coli TG1 and E. coli MG1655) have been used in these experiments with complementary effects of RRF, it may be emphasized that the role of RRF in alleviation of AGA-minigene toxicity is independent of the strain background. Replacement of the wild-type alleles of infC and frr with infC135 and frr1 renders E. coli hypersensitive to minigene expression To check for the involvement of IF3 in the RRFmediated rescue of the minigene toxicity, we replaced the wild-type copies of the infC and/or frr with the infC135 and the frr1 alleles in E. coli MG1655 by P1-mediated transductions. The infC135-encoded IF3 possesses an R131P mutation. While this IF3 maintains specificity of initiation, it has lost its ability to discriminate against initiation from noncanonical initiation codons.23 In addition, we observed that its activity in supporting RRF function is also compromized.6 Although the introduction of the infC135 allele itself had a small effect on the growth of the parent strain (Fig. 3c panel i, curves 3– 6), it is important to note that a concentration of IPTG at which E. coli MG1655 (wild-type) is insensitive to AGA-minigene expression, the E. coli MG1655 infC135 becomes sensitive (Fig. 3c panel ii, curves 2 and 4). Further, the growth of E. coli MG1655 infC135 frr1 strain was hypersensitive to AGA-minigene expression (curve 6). These observations suggest that, RRF collaborates with IF3 for its function in alleviating the minigene toxicity. RRF over-expression decreases accumulation of peptidyl-tRNA on ribosomes To further understand the mechanism of RRFmediated rescue of the host from the AGA-minigene

Recycling of Stalled Ribosomes

toxicity, we analyzed the status of tRNAArg4 (as tRNAArg4, Arg-tRNAArg4 or peptidyl-tRNAArg4) on ribosomes using acid/urea gels (Fig. 4, panel i). Samples were subjected to treatment with CuSO4, which deacylates aminoacyl-tRNAs but not the peptidyl-tRNAs.24,25 As in an earlier study,15 in our analysis also the peptidyl-tRNAArg4 and ArgtRNAArg4 (represented by the upper group of bands) were not well resolved. Moreover, the free tRNAArg4 itself migrated as a group of bands. Hence, as a control for CuSO4 treatment, the same blot was re-probed for tRNATyr (panel ii). Samples in the even-numbered lanes (+ CuSO4) showed a faster mobility of tRNATyr compared with those in the oddnumbered lanes (– CuSO4 treatment) suggesting that the conditions of CuSO4 treatment were adequate to deacylate aminoacylated forms of tRNAs. In fact, even in the tRNAArg4 blot (panel i), in the samples where tRNAArg4 is expected to exist as ArgtRNAArg4 (lanes 1, 3 and 5), all of the upper group bands collapsed into the lower group bands (lanes 2, 4 and 6, respectively) upon CuSO4 treatment, suggesting that the treatment was similarly adequate to deacylate the tRNAArg4. Notably, in the lanes where samples from the AGA-minigene-expressing cells were analyzed, the CuSO4 treatment did not result in a substantial decrease in the intensity of the upper group of bands (compare lanes 7 and 8 in panel i), suggesting that much of the tRNA in the upper group of bands in these samples consisted of peptidyl-tRNAArg4. More importantly, upon RRF (R6R) over-expression, the relative intensity of the upper group of bands (with respect to the lower group of bands) decreased substantially (compare lanes 8 and 10, panel i) revealing that RRF overexpression decreased the accumulation of peptidyltRNAArg4 on the ribosome. In the supernatant (S100) or the ribosome-bound tRNA samples from the pTrc99C vector control, the upper group of bands consisted entirely of Arg-tRNAArg4 (compare lanes 1, 3 and 5 with lanes 2, 4, and 6, respectively) suggesting that the accumulation of peptidyl-tRNAArg4

Fig. 4. Northern blot analysis of tRNA Arg4 and tRNATyr. E. coli MG1655 frr1 strains harboring various plasmids (as indicated) were grown to an A600 of ∼ 0.6, induced with 0.075 mM IPTG and grown for a further 90 min. The tRNA from the S100 and ribosomal fractions was isolated and either not treated (– CuSO4) or treated with CuSO4 (+CuSO4). The samples were resolved on acid-urea PAGE (6.5% (w/v) polyacrylamide gel), transferred to nylon membrane, probed with (5′-32P)-labeled DNA oligomer specific to tRNAArg4 (panel i) or tRNATyr (panel ii) and detected using BioImage Analyzer (FLA5000, Fuji).

Recycling of Stalled Ribosomes

in the samples in lanes 7 – 10 is a consequence of AGA-minigene expression. RRF and IF3 support λimmP22 hybrid phage growth in the presence of AGA-minigene expression Earlier studies showed that the λimmP22 hybrid phage does not form plaques on the sip (defective in SsrA function) or rap (deficient in Pth activity) mutants of E. coli due to excessive minigene toxicity.10,26 Considering that the AGA-minigene expression resulted in accumulation of peptidyl-tRNAArg on the

457 ribosome, it was of interest to examine the λimmP22 hybrid phage growth in the presence of AGA-minigene expression. We observed that the λimmP22 phage formed smaller plaques on E. coli MG1655 when the minigene was expressed (Fig. 5a, compare panel ii with vi). However, the plaque size morphology was substantially rescued when RRF was overexpressed (compare panel vi with viii). Also, as seen from the magnified plaque images (Fig. 5b), induction of AGA-minigene expression (0.05 mM IPTG) resulted in smaller plaques on E. coli MG1655 (compare panel d with a-c in the top row); the plaque size decreased further on E. coli MG1655 frr1 or E. coli

Fig. 5. Effect of AGA-minigene expression on phage growth. (a) Plaque-forming assays were performed using λimmP22 hybrid phage on E. coli MG1655 uninduced (panels i, iii, v and vii) or induced with 0.05 mM IPTG (panels ii, iv, vi and viii). The plaque morphology was observed after ∼ 7 h at lower magnification under white light with a Leica WILD M3Z microscope. The host harbored various plasmids as indicated: panels i and ii, pTrc99C and pACDH vectors; panels iii and iv, pTrc99C and pACDEcoRRF(R6R); panels v and vi, pTrcAGA and pACDH; panels vii and viii, pTrcAGA and pACDEcoRRF(R6R). (b) Higher magnification images of the plaques on E. coli MG1655 (wild-type) and its frr1, infC135 and infC135 frr1 derivatives harboring pTrc99C or pTrcAGA as indicated in the absence or in the presence of 0.05 mM IPTG. Images were taken in white light with a Leica WILD M3Z microscope.

458

Recycling of Stalled Ribosomes

Table 2. Number of plaques obtained upon infection of E. coli MG1655 and its derivatives with λimmP22 hybrid phages Number of plaques Host E. coli MG1655 + pTrc99C E. coli MG1655 + pTrcAGA E. coli MG1655 frr1 + pTrc99C E. coli MG1655 frr1 + pTrcAGA E. coli MG1655 infC135 + pTrc99C E. coli MG1655 infC135 + pTrcAGA E. coli MG1655 infC135 frr1 + pTrc99C E. coli MG1655 infC135 frr1 + pTrcAGA a

Uninduced

Induceda

892 888 849 891 874 865 827 854

903 895 885 846 820 863 852 –

Induced by 0.05 mM IPTG.

MG1655 infC135 backgrounds (compare panels h and l with d). However, the data in Table 2 reveal that the number of plaque-forming units of λimmP22 hybrid phage on the wild-type, frr1 or infC135 derivatives was the same irrespective of the status of the induction of the AGA-minigene expression, ruling out an effect of the frr1 or the infC135 alleles on the susceptibility of the strains to infection by the phage. Interestingly, when the infC135 and frr1 alleles were combined in a single strain, the strain did not afford any plaque formation upon the AGA-minigene expression (panel p). However, the plating efficiency of the phage was unaffected in this strain when AGA-minigene expression was not induced (Table 2). Taken together, these observations further highlight the importance of both RRF and IF3 in recycling of ribosomal complexes stalled because of the AGA-minigene expression. RRF over-expression rescues the host from pTrcUng-stopless mediated toxicity The experiments described above show a crucial role of RRF in processing the ribosomal complexes harboring short peptidyl-tRNAs. To check if the ribosomal complexes stalled after translating a longchain polypeptide could also be substrates for RRFmediated processing, we generated pTrcUng-stop-

less construct wherein the tetranucleotide sequence TAAC (harboring the termination codon, TAA) of the ung gene in pTrcUng was mutated to AAGC to eliminate the termination codon and to simultaneously generate a HindIII site (Fig. 6a). On the basis of the known transcription termination sites of E. coli ung mRNA,21 this construct would result in a stopless mRNA. More importantly, the presence of an inverted repeat (as indicated by the convergent arrows in Fig. 6a) suggested that the sequence at the end of the ung mRNA could fold into a highly stable structure. We reasoned that the presence of such a structure might slow or stall the translating ribosomes at the end of the ung stopless mRNA. Consistent with this notion, we observed that the presence of pTrcUng-stopless but not pTrcUng was toxic to E. coli TG1 when expression of ung from these constructs was induced with IPTG (Fig. 6b, compare spotted dilutions in row 2 with row 1 in the panels marked –IPTG, 0.05 mM IPTG or 0.2 mM IPTG). The toxicity of the pTrcUng-stopless construct increased in E. coli TG1 ssrA∷Kan strain (Fig. 6b, compare rows 2 and 4 in the panel marked 0.05 mM IPTG) suggesting that the SsrA contributed in diminishing the extent of the toxicity of the ung mRNA from the pTrcUng-stopless construct. This observation suggests also that at least one of the reasons for the observed toxicity of the pTrcUngstopless construct is the stalling of ribosomes. In addition, we observed that over-expression of RRF also resulted in a significant rescue of the host from the toxicity of the pTrcUng-stopless expression (Fig. 6c, compare rows 3 and 4 in the panel with 0.2 mM IPTG). In fact, when we checked the level of the ribosome-associated ung mRNA by semiquantitative PCR, induction of the stopless construct led to accumulation of more ung mRNA on the ribosome (Fig. 6d panel ii, compare lanes 1 or 2 with 3), which is consistent with the hypothesis that the stopless construct leads to stalling of the ribosome at the end of the mRNA. More interestingly, RRF over-expression resulted in a decrease in the level of mRNA on the ribosome (Fig. 6d panel ii, compare lanes 3 and 4). The data in Fig. 6d, panel iii represent a control for the uniformity of the sample amounts

Fig. 6. Analysis of toxicity by pTrcUng-stopless. (a) Representations of the ung gene in pTrcUng and pTrcUng-stopless. Stop codon UAA (TAA) and the following A present in the pTrcUng (panel i) were mutated to AAGC in pTrcUng-stopless (panel ii). Transcription termination sites are indicated by vertical arrows. Convergent horizontal arrows indicate the presence of the inverted repeat sequence just upstream of the transcriptional termination sites. Small circles within the horizontal arrows indicate a mismatch in the inverted repeat. (b) Growth of E. coli TG1 (rows 1 and 2) and E. coli TG1 ssrA∷Kan (rows 3 and 4) harboring pTrcUng (rows 1 and 3) or pTrcUng-stopless (rows 2 and 4). Saturated cultures were serially diluted (10− 1 – 10− 5) and spotted onto LB agar plates containing Amp in the absence (–IPTG) or in the presence of IPTG as indicated, and incubated at 37 °C for ∼ 18 h. (c) Growth of E. coli TG1 harboring pTrcUng (rows 1 and 2) or pTrcUng-stopless (rows 3 and 4) along with pACDH (rows 1 and 3) or pACDEcoRRF (rows 2 and 4). Saturated cultures were serially diluted (10− 1 – 10− 5) and spotted onto LB agar plates containing Amp and Tet in the absence or in the presence of 0.2 mM IPTG as indicated, and incubated at 37 °C for ∼ 18 h. (d) Detection of ung and ung-stopless mRNAs on ribosomes. Total RNA (120 ng) prepared from the ribosomal fraction was used as template in reverse-transcriptase PCR (panel ii) or PCR in the absence of reverse transcriptase (– RT, panel i) along with ung-specific primers. The amplicons thus obtained were resolved by native PAGE (8% (w/v) polyacrylamide gel). The presence of various plasmids in the strains from which total ribosome were isolated is as indicated; E. coli TG1 harboring pTrcUng and pACDH (lane 1); pTrcUng and pACDEcoRRF (lane 2); pTrcUng-stopless and pACDH (lane 3); and pTrcUng-stopless and pACDEcoRRF (lane 4). Lane C in panel i represents a sample spiked with genomic DNA. Panel iii shows analysis of 16 S rRNA in the RNA preparations on agarose gel, indicating the use of equal amounts of templates in the RT-PCR assays.

459

Fig. 6 (legend on previous page)

Recycling of Stalled Ribosomes

460 used in the RT-PCR, and panel i is a no reverse transcriptase (–RT) control where no amplification is seen from the RNA samples used (lanes 1–4) unless the sample is spiked with the genomic DNA (lane C). Taken together, these observations show that RRF facilitates processing of the stalled ribosomes harboring ung mRNA.

Discussion Not all the translating ribosomes reach the stop codon at the end of the mRNA to release a full-length polypeptide. Often, they stall during elongation, for example, due to delays in recruitment of aminoacyltRNAs in response to rare codons or due to the lack of a stop codon in the truncated mRNAs. However, recycling of such stalled ribosomes is vital to cell survival. Ribosomes containing truncated mRNAs are known to be recycled by SsrA.1 Whereas a certain population of ribosomes stalled on the full-length mRNAs may be eventually recycled by SsrA,27,28 alternate mechanisms that recycle the stalled ribosomes (pre-termination complexes) without degrading the mRNAs remain unclear. To study the alternate mechanisms of recycling of the stalled ribosomes, earlier in vivo methods relied on the use of E. coli temperature-sensitive (ts) for Pth, wherein the stalled ribosome population is heterogeneous with respect to the chain length of the peptide moiety in the peptidyl-tRNA. Moreover, in the Pth (ts) strains, the accumulation of peptidyltRNA itself causes toxicity. Thus, to analyze the phenomenon of recycling of the stalled ribosomes better, we employed a strain wild-type for Pth, and the reporter systems of the AGA-minigene and the Ung-stopless construct. The expression of AGAminigene is toxic to the host because it leads to ribosome stalling and sequestration of tRNAArg4 as fMet-Arg-tRNAArg4 on the ribosome.15 And, as discussed below, the ung-stopless mRNA also results in stalling of ribosomes towards the end of the mRNA. RRF (in concert with EFG) was initially reported to mediate the disassembly of the post-termination complexes harboring deacylated tRNA and mRNA.29,30 In these studies, it was observed that RRF and EFG did not mediate recycling of ribosomal complexes harboring peptidyl-tRNA in their P-site. However, the genetic studies6,19,20 have suggested a role of RRF and EFG in recycling the pre-termination ribosomal complexes (harboring peptidyl-tRNA at the P-site and empty A-site) as well. For example, we showed that while the expression of Mycobacterium tuberculosis RRF in E. coli did not result in release of peptidyl-tRNA, its coexpression with M. tuberculosis EFG did, suggesting that RRF functions in concert with EFG to process the pre-termination ribosomal complexes.20 More recently, using a combination of biochemical and genetic approaches, we showed that for recycling of the pre-termination complexes, RRF requires EFG and IF3.6 In the present study, the rescue of the host growth from the toxicity of the AGA-minigene

Recycling of Stalled Ribosomes

expression, by RRF over-expression further highlights its involvement and importance in processing of the stalled ribosomes. Moreover, the hypersensitivity of E. coli to the minigene expression upon replacement of the wild-type infC with the infC135 allele (Figs. 3 and 5) corroborates our earlier observations of an active role of IF3 in dissociating the pretermination ribosomal complexes.6 As shown in Fig. 6, expression of ung mRNA from the pTrcUng-stopless construct causes toxicity to the host. The observation that SsrA has a role in diminishing this toxicity suggests that the toxicity is caused by ribosome stalling. The observation that significantly more ung stopless mRNA but not the ung mRNA are detected on the ribosome by semiquantitative PCR further supports the view that the ung stopless mRNA-mediated toxicity results from ribosome stalling at the end of the mRNA. Interestingly, RRF over-expression decreases the abundance of ung stopless mRNA on the ribosome (Fig. 6d panel ii, lanes 3 and 4). Considering that such a phenomenon is not seen for the pTrc-Ung construct (Fig. 6d panel ii, lanes 1 and 2), the observation provides crucial in vivo evidence of RRF-mediated processing of ribosomes harboring a long-chain polypeptidyl-tRNA. In this context, it may be noted that RRF has already been shown to promote release of a 24 amino acid long peptidyl-tRNA (TnaCpeptidyl-tRNA) from stalled ribosomes.31 Similar to schemes proposed earlier for recycling the post-termination complex,6 RRF-mediated recycling of the pre-termination complexes harboring a short-chain peptidyl-tRNA (Fig. 7a) may begin by binding of RRF and EFG to the complex (step i). Specific interactions and GTP hydrolysis may then result in transient dissociation of the 50 S and 30 S subunits of the ribosome (step ii) to allow IF3 binding and complete disassembly of the complex (step iii). Such a disassembly of the pre-termination complex would be sufficient to release the shortchain peptidyl-tRNAs and the other components of the pre-termination complex (Fig. 7a). The peptidyltRNAs could then be recycled by Pth-mediated hydrolysis of the ester bond between the peptide and the tRNA (step iv). However, our present experiments do not allow us to determine the fate of the long-chain polypeptidyltRNA subsequent to the processing of the ribosomal complexes. In such complexes, the polypeptide moiety would have already progressed through the exit tunnel of the 50 S subunit of the ribosome and folded into secondary/tertiary structures on the exterior of the subunit (Fig. 7b). An extrapolation of the scheme proposed for processing of the pretermination complexes harboring short-chain peptidyl-tRNAs (Fig. 7a) to the processing of those harboring long-chain polypeptides (Fig. 7b) would suggest that such peptidyl-tRNA would be released in a complex with the 50 S subunit (step iii). Subsequently, the peptidyl-tRNA–50 S subunit complex may be exposed to Pth (step iv) to recycle the sequestered ribosomal subunit and the tRNA. Assays to delineate this pathway have yet to be developed.

461

Recycling of Stalled Ribosomes

Fig. 7. Proposed models for RRF mediated processing of pre-termination complexes. (a) Recycling of a pretermination ribosomal complex harboring short-chain peptidyl-tRNA (the peptide moiety is shown by a chain of beads and tRNA is shown as an L-shaped structure in blue) and mRNA (black wavy line). RRF (shown in pink), and EFG (shown in yellow) along with GTP (not shown) bind to the pre-termination complex (step i) and establish specific interactions (shown by a double-headed arrow). These interactions and GTP hydrolysis result in transient separation (step ii) of the large (50 S) and small (30 S) subunits of the ribosome exposing the IF3 binding site on the 30 S subunit. IF3 (shown in red) binding (step iii) results in complete disassembly of the pre-termination complex. A broken arrow between RRF and EFG indicates loss of interactions between the two. The released peptidyl-tRNA is then processed by Pth (step iv) to recycle the tRNA. (b) Recycling of a pre-termination ribosomal complex harboring long-chain peptidyl-tRNA. Various steps are the same as in a, except that at step iii, the long-chained peptidyl-tRNA that would have already come out of the peptide exit tunnel of the 50 S subunit and folded into a structure, would be released in a complex with the 50 S subunit, which can then be acted upon by Pth to recycle the 50 S subunit and the tRNA. (Note that a deacylated tRNA bound to the E-site may be present in these complexes but is not shown for the sake of clarity).

However, the decrease in accumulation of the ung stopless mRNA in response to RRF over-expression (Fig. 6) does provide a strong indication that the subunits are disassembled for mRNA release. How RRF and EFG binding to ribosome leads to transient separation/dissociation of its 50 S and 30 S subunits is unclear. The three-dimensional structures of several bacterial RRFs have shown that these proteins consist of two domains arranged perpendicular to each other in an L-shaped geometry. The RRF domain I establishes an extensive set of interactions with the 50 S subunit.32 On the other hand, the RRF domain II, which establishes specific interactions with EFG,33 is highly flexible and faces the 30 S subunit. Although the mechanistic details are not known, these interactions are important in dissociation of the ribosomal subunits.33 Interestingly, the structural analyses of RRF-bound ribosomes have shown that the tip of the RRF domain I is located near the peptidyltransferase center such that it is incompatible with the P/P-site tRNA binding.32,34 Such a scenario may suggest that binding of the peptidyl-tRNA or the RRF on ribosomes are mutually exclusive. Considering that the RRF concentration in E. coli is high,35 it may be that its (RRF) binding to ribosomes harboring a peptidyltRNA (in P/P-site) and an empty A-site is favored, which in turn would destabilize the peptidyl-tRNA and cause it to be released (in its free form or in

complex with the 50 S subunit) upon dissociation of the pre-termination complexes (Fig. 7). However, it should be noted that the structure of RRF-bound ribosome containing a full-length tRNA or peptidyltRNA on the P-site is still unknown. And, it may well be that the functionally relevant initial binding of RRF, at least in the pre-termination complexes, occurs at a site different from that seen in the available structures of RRF bound to the empty ribosomes32 or those containing the anticodon stem– loop portion of the tRNA in the P-site.34 In conclusion, we have shown that the role of RRF is not limited to the step of termination (post-termination) and its interface with the initiation process, but is a more general one that is relevant even during the elongation step of protein biosynthesis.

Materials and Methods Bacterial strains and growth conditions Bacterial strains are listed in Table 1. P1 phage-mediated transductions were used to transfer genetic material from one strain to another to generate the desired strains.36 Unless specified otherwise, Luria-Bertani liquid (LB) or solid (with 1.5% agar) medium (Difco, USA) were used for growth.37 Media were supplemented with various antibiotics at the following final concentrations: tetracycline

462 (Tet), 7.5 μg/ml; kanamycin (Kan), 25 μg/ml; chloramphenicol (Cam), 30 μg/ml; and ampicillin (Amp), 100 μg/ ml as required. For comparative growth analysis, at least two separate colonies of each strain were inoculated in LB with the indicated amounts of IPTG and the appropriate antibiotic. Saturated cultures were diluted 1000-fold in LB, and 200 μl aliquots were shaken in microtiter plates using a Bioscreen C growth reader (OY Growth, Finland) at 37 °C. The absorbance was recorded at 600 nm, and plotted against time. Representative plots are shown. Plasmids Standard recombinant DNA techniques were employed to generate the plasmids used in this study (Table 1).37 Relevant details are provided as follows. (i) pTrcAGA. PCR amplification was carried out using pTrcNdeIsingle (Table 1) as template, and AGA_fp (5′ AAACAGCAT ATG AGA AGA TGA AGCTCGGTACCC 3′) and rp1 (5′ CGATAGTAAAGG A AT T G C C A A A G C T TA C T G C C A C TA G TAAACTTGGTCTGACAG 3′, of this primer 19 nt from the 3′ end are complementary to positions 1709–1727 in pTrc99C) DNA oligomers. The NdeIPvuI fragment (1 kb) from the 1.5 kb PCR product was used as megaprimer to carry out inverse PCR to generate pTrcAGA having the ATG AGA AGA TGA minigene. Inverse PCR (50 μl) involved 20 cycles of heating at 94 °C for 1 min, 50 °C for 30 s, 55 °C for 30 s and 70 °C for 10 min; and a final incubation at 70 °C for 10 min. The PCR product was digested with DpnI and an aliquot (10 μl) was introduced into E. coli TG1 by transformation. The recombinants were checked by digesting with EcoRI and EcoRV of the mini preparations of plasmids, and confirmed by DNA sequencing. (ii) pTrcAGA-ssrA. The HindIII fragment of pTrc-ssrA was sub-cloned into the HindIII site of pTrcAGA.5 The clones were checked by digesting with EcoRI and EcoRV, and further confirmed by digesting with Bst1107I. (iii) pACDEcoPth. The DNA sequence corresponding to the ORF of the E. coli pth gene was excised as a ∼0.6 kb fragment from an existing construct (pTrcHisEcoPth) by digesting with NdeI and BamHI (NdeI digestion separates the presequence harboring hexahistidine tag present upstream of the Pth ORF in the pTrcHisEcoPth) and subcloned into similarly digested pACDNdeI (Table 1) to generate pACDEcoPth. (iv) pTrcUng-stopless. The pTrcUng-stopless was generated from pTrcUng39 by the Quick Change protocol (Stratagene) to mutate the TAA termination codon to AAG; and the following A to C to facilitate mutant screening by digesting with HindIII (Fig. 6a). PCR (50 μl) carried out on pTrcUng with Pfu DNA polymerase using EcoUng-stopless_fp (5′ CGGCAGAGAGTGAGAAGCTTTGCGGGGAAATG 3′) and EcoUng-stopless_rp (5′ CATTTCCCCGCAAAGCTTCTCACTCTCTGCCG 3′) primers involved 20 cycles of heating at 94 °C for 1 min, 55 °C for 30 s, and 50 °C for 30 s; and a final step of incubation at 70 °C for 11 min. The reaction contents were digested with DpnI, and an aliquot (10 μl) was introduced into E. coli TG1 by transformation. The transformants were screened by restriction digestions of the plasmid mini preparations and confirmed by DNA sequencing.

Recycling of Stalled Ribosomes Determination of plaque-forming units using λimmP22 hybrid phage The λimmP22 hybrid phage (λimmP22 dis)26,41 (kindly provided by Dr Friedman, University of Michigan, MI, USA) lysate was prepared as described and used in the plating assays.42 E. coli cells were grown overnight in LB broth with appropriate antibiotics and sub-cultured with 1% inoculum in 2 ml of LB with appropriate antibiotics in the presence of 10 mM MgSO4 and 1% (w/v) maltose. When required, the cultures (A600 ∼ 0.6) were induced with appropriate concentrations of IPTG. Subsequently, cells from 250 μl of culture were harvested by centrifugation at 5000 rpm (RA-508G, Kubota) for 6 min and suspended in 100 μl of LB containing 2.5 μl of 1 M MgSO4. To this, 100 μl of appropriately diluted λimmP22 hybrid phage was added and mixed. The suspension was then incubated at room temperature for 15 min, mixed with 3 ml of soft agar (LB medium containing 0.7% (w/v) agar) and layered onto LB agar plates. After incubation for 6∼8 h, the number of plaques and plaque sizes were determined. Partitioning of tRNA into S100 and ribosomal fractions, and Northern blot analysis Cultures (25 ml) were grown to an A600 of ∼ 0.6 in LB and incubated further with 0.2 mM IPTG for 40 min when induction with IPTG was required. The cultures were chilled rapidly on a salt/ice mixture and subjected to centrifugation at 5000 rpm (RA-508G, Kubota) for 10 min to harvest cells. The cells were suspended in 1 ml of buffer I (20 mM Hepes buffer (pH 7.6), 10 mM magnesium acetate, 20 mM potassium acetate, 1 mM DTT) containing 0.3 mM tetracycline and lysed by sonication by eight 2 s pulses using a microprobe (Heat Systems-Ultrasonics Inc., USA). The lysate was centrifuged at 12,000 rpm for 15 min and the supernatant was subjected to ultracentrifugation at 100,000g (TLS55Ti, Beckman) for 2 h. The supernatant fraction was extracted once with an equal volume of sodium acetate (pH 5.0)-saturated phenol followed by addition of 0.1 volume of 3 M sodium acetate (pH 5.0) and precipitation by addition of 2.5 volumes of doubledistilled ethanol. Meanwhile, the pellet fraction (from ultracentrifugation) was suspended in 400 μl of 0.3 M sodium acetate (pH 5.0), extracted twice with equal volumes of sodium acetate (pH 5.0)-saturated phenol and precipitated with ethanol. The precipitates were suspended in 300 μl of 0.3 M sodium acetate (pH 5.0) containing 1.5 M NaCl, kept on ice for 6 h and centrifuged at 13,000 rpm (RA-508G, Kubota) for 3 min at 4 °C. The supernatant was transferred to a new tube and the RNA was recovered by precipitation in ethanol for 2 h at – 20 °C and centrifugation at 13,000 rpm for 15 min. The precipitate was dissolved in 100 μl of 10 mM sodium acetate (pH 5.0) containing 1 mM Na2EDTA. Aliquots (20 μl) were frozen in liquid N2 and stored at –70 °C until use. RNA (∼0.1 A260) was electrophoresed on 1% agarose gel, vacuum-blotted onto a nylon membrane and probed with tRNAArg4 and 5 S rRNA-specific (5′-32P) labeled DNA oligomers (5′-CACGACTTAGAAGGTCGTT-3′ and 5′-TACCATCGGCGCTACGGCGTTTC-3′, respectively). To check whether the tRNAArg4 is in the peptidyl, aminoacyl or deacylated forms, the tRNA preparations (∼ 0.1 A260) were either taken directly or after treatment with 10 mM CuSO4 (Li et al., 2000) and separated by acid– urea PAGE (6.5% polyacrylamide gel)43. The portion of the gel between the bromophenol blue and XCFF was electroblotted onto nylon membrane and probed with

463

Recycling of Stalled Ribosomes tRNAArg4 or tRNATyr-specific (5′-32P)-labeled DNA oligomers (5′-CACGACTTAGAAGGTCGTT-3′ and 5′TACAGTCTGCTCCCTTTGGCCGCTC-3′, respectively) and the signals were detected using Bio Image Analyser (FLA5000, Fuji).

3. 4.

Preparation of total ribosomal fraction RNA and semi-quantitative PCR Cells were grown in 25 ml of LB to A600 of ∼ 0.4, supplemented with 0.1 mM IPTG and grown for a further 1 h and 30 min. Cells were chilled rapidly on a salt-ice mixture, harvested by centrifugation at 5000 rpm (RA508G, Kubota) for 10 min and resuspended in 1 ml of buffer I (20 mM Hepes (pH 7.6), 10 mM magnesium acetate, 20 mM potassium acetate, 1 mM DTT) containing 0.3 mM tetracycline. Cells were lysed by sonication of the sample by eight 2 s pulses using a microprobe (Heat Systems-Ultrasonics Inc., USA). The lysate was centrifuged at 12,000 rpm (RA-508G, Kubota) for 15 min and the supernatant was subjected to ultracentrifugation at 100,000g for 2 h (TLS55Ti, Beckman). The pellet (ribosomal) fraction was dissolved in 400 μl of 0.3 M sodium acetate (pH 5.0), extracted twice with equal volumes of sodium acetate (pH 5.0)-saturated phenol and precipitated in ethanol. The precipitate was washed once with 80% (v/v) ethanol, dissolved in 100 μl of 10 mM sodium acetate (pH 5.0). The amount was estimated from measurement of absorbance at 260 nm and diluted to a working concentration of 60 ng/μl in RNase-free water. Semi-quantitative PCR were performed in 20 μl reactions using a one-step real time PCR kit (BioRad, iScript™) with 10 pmol of each primer (EcoungSeq-FP 5′ AGCAACGCCATCATGTAC 3′ and EcoungRT-RP 5′ CTGGCATCCAGTCAATCGGC 3′)44 and 120 ng of total RNA from the ribosomal fraction. PCR involved synthesis of cDNA templates at 50 °C for 10 min, followed by heat-inactivation of the reverse transcriptase at 95 °C for 10 min, and activation of the hot start Taq DNA polymerase. PCR amplification involved 20 cycles of initial denaturation at 95 °C for 10 s, annealing at 50 °C for 10 s and extension at 72 °C for 20 s. An aliquot (10 μl) from the reaction product was resolved by native 8% PAGE.

5.

6.

7.

8.

9. 10.

11.

12. 13.

14.

Acknowledgements We thank our laboratory colleagues for their suggestions on the manuscript. This work was supported by research grants from the Department of Biotechnology (DBT), New Delhi. N.S.S. was supported by a senior research fellowship of the Council of Scientific and Industrial Research, New Delhi.

References 1. Keiler, K. C., Waller, P. R. & Sauer, R. T. (1996). Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science, 271, 990–993. 2. Menninger, J. R. (1978). The accumulation as peptidyl-transfer RNA of isoaccepting transfer RNA families in Escherichia coli with temperature-sensitive

15.

16.

17.

18.

19.

peptidyl-transfer RNA hydrolase. J. Biol. Chem. 253, 6808–6813. Menninger, J. R. (1979). Accumulation of peptidyl tRNA is lethal to Escherichia coli. J. Bacteriol. 137, 694–696. Menninger, J. R., Caplan, A. B., Gingrich, P. K. & Atherly, A. G. (1983). Tests of the ribosome editor hypothesis. II. Relaxed (relA) and stringent (relA+) E. coli differ in rates of dissociation of peptidyl-tRNA from ribosomes. Mol. Gen. Genet. 190, 215–221. Singh, N. S. & Varshney, U. (2004). A physiological connection between tmRNA and peptidyl-tRNA hydrolase functions in Escherichia coli. Nucleic Acids Res. 32, 6028–6037. Singh, N. S., Das, G., Seshadri, A., Sangeetha, R. & Varshney, U. (2005). Evidence for a role of initiation factor 3 in recycling of ribosomal complexes stalled on mRNAs in Escherichia coli. Nucleic Acids Res. 33, 5591–5601. Cuzin, F., Kretchmer, N., Greenberg, R. E., Hurwitz, R. & Chapeville, F. (1967). Enzymatic hydrolysis of N-substituted aminoacyl-TRNA. Proc. Natl Acad. Sci. USA, 58, 2079–2086. Kossel, H. & RajBhandary, U. L. (1968). Studies on polynucleotides. LXXXVI. Enzymatic hydrolysis of N-acylaminoacyl-transfer RNA. J. Mol. Biol. 273, 389–401. Das, G. & Varshney, U. (2006). Peptidyl-tRNA hydrolase and its critical role in protein biosynthesis. Microbiology, 152, 2191–2195. Henderson, D. & Weil, J. (1976). A mutant of Escherichia coli that prevents growth of phage λ and is bypassed by λ mutants in a nonessential region of the genome. Virology, 71, 546–559. Garcia-Villegas, M. R., De la Vega, F. M., Galindo, J. M., Segura, M., Buckingham, R. H. & Guarneros, G. (1991). Peptidyl-tRNA hydrolase is involved in λ inhibition of host protein synthesis. EMBO J. 10, 3549–3555. Guzman, P. & Guarneros, G. (1989). Phage genetic sites involved in λ growth inhibition by the Escherichia coli rap mutant. Genetics, 121, 401–409. Hernández-Sánchez, J., Valadez, J. G., Herrera, J. V., Ontiveros, C. & Guarneros, G. (1998). λ bar minigenemediated inhibition of protein synthesis involves accumulation of peptidyl-tRNA and starvation for tRNA. EMBO J. 17, 3758–3765. Cruz-Vera, L. R., Hernandez-Ramon, E., PerezZamorano, B. & Guarneros, G. (2003). The rate of peptidyl-tRNA dissociation from the ribosome during minigene expression depends on the nature of the last decoding interaction. J. Biol. Chem. 278, 26065–26070. Cruz-Vera, L. R., Magos-Castro, M. A., Zamora-Romo, E. & Guarneros, G. (2004). Ribosome stalling and peptidyl-tRNA drop-off during translational delay at AGA codons. Nucleic Acids Res. 32, 4462–4468. Karimi, R., Pavlov, M. Y., Buckingham, R. H. & Ehrenberg, M. (1999). Novel roles for classical factors at the interface between translation termination and initiation. Mol. Cell, 3, 601–609. Hirokawa, G., Nijman, R. M., Raj, V. S., Kaji, H., Igarashi, K. & Kaji, A. (2005). The role of ribosome recycling factor in dissociation of 70S ribosomes into subunits. RNA, 11, 1317–1328. Seshadri, A. & Varshney, U. (2006). Mechanism of recycling of post-termination ribosomal complexes in eubacteria: a new role of initiation factor 3. J. Biosci. 31, 281–289. Heurgue-Hamard, V., Karimi, R., Mora, L., MacDougall, J., Leboeuf, C., Grentzmann, G. et al. (1998). Ribosome

464

20.

21.

22.

23. 24. 25.

26. 27.

28. 29. 30. 31.

32.

release factor RF4 and termination factor RF3 are involved in dissociation of peptidyl-tRNA from the ribosome. EMBO J. 17, 808–816. Rao, A. R. & Varshney, U. (2001). Specific interaction between the ribosome recycling factor and the elongation factor G from Mycobacterium tuberculosis mediates peptidyl-tRNA release and ribosome recycling in Escherichia coli. EMBO J. 20, 2977–2988. Varshney, U., Hutcheon, T. & van de S, J. H. (1988). Sequence analysis, expression, and conservation of Escherichia coli uracil DNA glycosylase and its gene (ung). J. Biol. Chem. 263, 7776–7784. Olivares-Trejo, J. J., Bueno-Martínez, J. G., Guarneros, G. & Hernández-Sánchez, J. (2003). The pair of arginine codons AGA AGG close to the initiation codon of the lambda int gene inhibits cell growth and protein synthesis by accumulating peptidyl-tRNAArg4. Mol. Microbiol. 49, 1043–1049. Haggerty, T. J. & Lovett, S. T. (1997). IF3-mediated suppression of a GUA initiation codon mutation in the recJ gene of Escherichia coli. J. Bacteriol. 179, 6705–6713. Schofield, P. & Zamecnik, P. C. (1968). Cupric ion catalysis in hydrolysis of aminoacyl-tRNA. Biochim. Biophys. Acta, 155, 410–416. Li, Y., Holmes, W. B., Appling, D. R. & RajBhandary, U. L. (2000). Initiation of protein synthesis in Saccharomyces cerevisiae mitochondria without formylation of the initiator tRNA. J. Bacteriol. 182, 2886–2892. Retallack, D. M., Johnson, L. L. & Friedman, D. I. (1994). Role for 10Sa RNA in the growth of λ-P22 hybrid phage. J. Bacteriol. 176, 2082–2089. Pedersen, K., Zavialov, A. V., Pavlov, M. Y., Elf, J., Gerdes, K. & Ehrenberg, M. (2003). The bacterial toxin RelE displays codon-specific cleavage of mRNAs in the ribosomal A site. Cell, 112, 131–140. Ivanova, N., Pavlov, M. Y., Felden, B. & Ehrenberg, M. (2004). Ribosome rescue by tmRNA requires truncated mRNAs. J. Mol. Biol. 338, 33–41. Hirashima, A. & Kaji, A. (1972). Factor-dependent release of ribosomes from messenger RNA: Requirement for two heat-stable factors. J. Mol. Biol. 65, 43–58. Hirashima, A. & Kaji, A. (1972). Purification and properties of ribosome-releasing factor. Biochemistry, 11, 4037–4044. Gong, M., Cruz-Vera, L. R. & Yanofsky, C. (2007). Ribosome recycling factor and release factor 3 action promotes TnaC-peptidyl-tRNA dropoff and relieves ribosome stalling during tryptophan induction of tna operon expression in Escherichia coli. J. Bacteriol. 189, 3147–3155. Agrawal, R. K., Sharma, M. R., Kiel, M. C., Hirokawa, G., Booth, T. M., Spahn, C. M. et al. (2004). Visualization of ribosome-recycling factor on the Escherichia coli

Recycling of Stalled Ribosomes

33.

34.

35.

36. 37. 38.

39.

40.

41.

42. 43.

44.

70S ribosome: functional implications. Proc. Natl Acad. Sci. USA, 101, 8900–8905. Ito, K., Fujiwara, T., Toyoda, T. & Nakamura, Y. (2002). Elongation factor G participates in ribosome disassembly by interacting with ribosome recycling factor at their tRNA-mimicry domains. Mol. Cell, 9, 1263–1272. Weixlbaumer, A., Petry, S., Dunham, C. M., Selmer, M., Kelley, A. C. & Ramakrishnan, V. (2007). Crystal structure of the ribosome recycling factor bound to the ribosome. Nature Struct. Mol. Biol. 14, 733–737. Andersen, L. D., Moreno, J. M. D., Clark, B. F. C., Mortensen, K. K. & Sperling-Petersen, H. U. (1999). Immunochemical determination of cellular content of translation release factor RF4 in Escherichia coli. IUBMB Life, 48, 283–286. Miller, J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning. A Laboratory Manual, 2nd edit, Cold Spring Harbor Laboratory, Cold Spring Harbor NY. Rao, A. R. & Varshney, U. (2002). Characterization of Mycobacterium tuberculosis ribosome recycling factor (RRF) and a mutant lacking six amino acids from the C-terminal end reveals that the C-terminal residues are important for its occupancy on the ribosome. Microbiology, 148, 3913–3920. Kumar, N. V. (1997). Mechanism of Uracil Excision from Different Structural Contexts of DNA oliGomers by E. coli Uracil DNA Glycosylase and its Applications. PhD thesis, Indian Institute of Science, Bangalore 560012, India. Blattner, F. R., Plunkett, G., 3rd, Bloch, C. A., Perna, N. T., Burland, V., Riley, M. et al. (1997). The complete genome sequence of Escherichia coli K-12. Science, 277, 1453–1474. Strauch, M. A., Baumann, M., Friedman, D. I. & Baron, L. S. (1986). Identification and characterization of mutations in Escherichia coli that selectively influence the growth of hybrid λ bacteriophages carrying the immunity region of bacteriophage P22. J. Bacteriol. 167, 191–200. Kleckner, N., Bender, J. & Gottesman, S. (1991). Uses of transposon with emphasis on Tn10. Methods Enzymol. 204, 139–180. Varshney, U., Lee, C. P. & RajBhandary, U. L. (1991). Direct analysis of aminoacylation levels of tRNAs in vivo: application to studying recognition of Escherichia coli initiator tRNA mutants by glutaminyl-tRNA synthetase. J. Biol. Chem. 266, 24712–24718. Gaur, R., Grasso, D., Datta, P. P., Krishna, P. D. V., Das, G., Spencer, A. et al. (2008). A single mammalian mitochondrial translation initiation factor functionally replaces two bacterial factors. Mol. Cell, 29, 180–190.