Regulation of erythropoiesis by the neuronal transmembrane protein Lrfn2

Experimental Hematology 35 (2007) 724–734

Regulation of erythropoiesis by the neuronal transmembrane protein Lrfn2 Andres Castellanosa,*, Georgina Langa, Jonathan Framptonb, and Kathleen Westona a Institute of Cancer Research, CR-UK Centre for Cell and Molecular Biology, London, UK; Institute of Biomedical Research, The Medical School, University of Birmingham, Edgbaston, Birmingham, UK

b

(Received 28 September 2006; revised 26 January 2007; accepted 7 February 2007)

Objective. The transgenic mouse line MEnTCD2.5 expresses a dominant interfering Myb protein in a T-cell–specific fashion. When MEnTCD2.5 animals are crossed to a second line ubiquitously expressing Myc, they develop a rapid onset, fatal disease characterized by enlarged lymph nodes full of nonlymphoid cells. This study aimed to elucidate the reason for this anomalous non-T–cell phenotype. Materials and Methods. We studied the cells by morphological analysis, surface marker staining, mRNA expression studies and in vitro colony-forming assays. Results. Aberrant cells in MEnTCD2.5 lymph nodes are erythroblasts, and cooperation between MEnTCD2.5 and Myc causes severe erythroblastosis, but not erythroleukemia. MEnTCD2.5:Myc and MEnTCD2.5 animals have pronounced extramedullary erythropoiesis in their lymph nodes, and some increase in bone marrow–derived erythroid progenitors; no other MEnTCD2 transgenic line cooperates in this fashion with Myc, suggesting that the MEnTCD2.5 integration site, in intron 2 of the Lrfn2 gene, is of importance. To confirm this, in in vitro colony-forming assays, expression of wild-type Lrfn2 phenocopies the MEnTCD2.5 defect. Finally, Lrfn2 expression also causes the outgrowth of a bizarre cell type in colony-forming assays that stains positively for both early hematopoietic and fibroblast/fibrocyte surface markers. Conclusions. The Lrfn2 protein, a transmembrane adhesion-type molecule, is able to subvert hematopoietic differentiation to increase erythropoiesis. In cooperation with Myc, this leads to erythroblastosis. Lrfn2 may also be involved in colony forming units-fibroblast regulation. As Lrfn2 expression is detectable in wild-type bone marrow, it likely plays a novel role during normal hematopoiesis. Ó 2007 International Society for Experimental Hematology. Published by Elsevier Inc.

Erythropoiesis is a highly regulated process whereby the red cell component of the bloodstream is modulated through decisions by multipotent and committed erythroid progenitors to divide, differentiate or apoptose. In adult mice, the earliest detectable committed erythroid progenitors occur in bone marrow and spleen, and are defined by in vitro colony-forming assays as the early burst-forming units erythroid (BFU-E) and the more mature colony-forming units erythroid (CFU-E) [1,2]. Following a series of four to five cell divisions, CFUE cells become erythroblasts, and progress through four morphologically distinct stages that can be broadly defined Offprint requests to: Kathleen Weston, Ph.D., Institute of Cancer Research, 237 Fulham Road, London SW3 6JB, UK; E-mail: kathy.weston@ icr.ac.uk *Dr. Castellanos current address: Department de Gene`tica i de Microbiologia, Fac. Ciencies, Campus Bellaterra, Edifici C, Universitat Auto`noma de Barcelona, Barcelona 08030, Spain.

by acquisition of the red cell marker Ter119 and decreasing expression of the transferrin receptor CD71 [3]. Finally, erythroblasts extrude their nuclei to become reticulocytes and then mature circulating erythrocytes. Erythrocyte numbers can be rapidly expanded in response to stresses such as blood loss, hypoxia, or anemia via tight regulation of BFU-E and CFU-E progenitors. This occurs via the cooperation of the stem-cell factor receptor Kit, which is expressed on immature cells up to the CFU-E stage, the erythroid lineage-specific erythropoietin receptor (Epor) and the glucocorticoid receptor, which together regulate expansion, differentiation, and survival of erythroid progenitors [4–6]. The rapid changes in signaling effected by extracellular events are converted into cell fate decisions by activation of networks of transcription factors [7]. In erythroid differentiation, key factors include Tal1/ SCL, important for the commitment and differentiation of

0301-472X/07 $–see front matter. Copyright Ó 2007 International Society for Experimental Hematology. Published by Elsevier Inc. doi: 10.1016/j.exphem.2007.02.004

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

erythroid progenitors [8], Gata1, which is crucial for later stages of development [9–11], Gata2, required for the survival and proliferation of immature cells [12,13], and Klf1(EKLF) [14,15], which regulates activation of the Hbb (b-globin) gene [16]. Conversely, the Ets-family factor PU.1 is an antagonist of Gata-mediated transcription, and its expression blocks erythropoiesis [17–19]. Dysregulation of erythropoiesis is also initiated by surface receptor activation. For example, in Friend disease, the initial stage of uncontrolled erythroid proliferation and erythroblastosis is induced by the viral glycoprotein gp55, which sensitizes the EpoR to activation by erythropoietin, thereby triggering activation of multiple downstream signal transduction pathways [20]. Stress erythropoiesis is targeted by the v-erb-a (thyroid hormone receptor) and v-erb-b (epidermal growth factor receptor) oncoproteins of avian erythroblastosis virus, which simultaneously induce proliferation and block terminal differentiation [21]. We report here the identification of Lrfn2, which encodes a glycosylated transmembrane protein previously described in relation to the neurological synapse, as a gene able to increase erythropoiesis by increasing numbers of progenitors and subsequently erythrocytes. Infection of murine bone marrow with a retrovirally expressed Lrfn2 gene causes an increase in BFU-E and CFU granulocyteerythrocyte-monocyte-megakaryocyte (GEMM) numbers in colony-forming assays, and also generates an aberrant population of cells, which we suggest may arise from hematopoietic-derived fibroblast colony-forming cells (CFU-F).

Materials and methods Mice All mice were maintained in the Institute of Cancer Research animal facility in accordance with local guidelines. Strains used were MEnTCD2.5 [22], H2-K-Myc [23], C57B1/10, and MF1nude (Harlan). Identification of transgene integration site The integration site of the MEnTCD2.5 transgene was determined using the method of Collins and Weissman [24] using the oligonucleotide primers GCAGAAGTCCCAGAATAGCCAA and ATTTCATCGTCTTGTCCAAGCT, specific for the CD2 LCR sequence within the transgene. A 1.3-kb fragment was amplified and sequenced. The sequence not contained within the transgene was screened against the mouse genome using the National Center for Biotechnology Information Basic Local Alignment Search Tool, and the integration was localized to NT_039649, nt 35090040, which corresponds to a position on chromosome 17 39.673kb 50 of exon 2 of Lrfn2. Flow-cytometric analysis and staining Whole cell preparations from lymph node and bone marrow were incubated with fluorescein isothiocyanate (FITC), phycoerythrin

725

(PE), or PC5-conjugated antibodies or with biotinylated antibodies and the appropriate secondary antibody. Live cells were identified by the absence of staining with TO-PRO-3 iodide (Molecular Probes, Carlsbad, CA, USA). Four-color staining was used to analyze the heterogeneity of cell preparations. Antibodies were from BD Pharmingen (San Jose, CA, USA): anti-Ter119 PE (553673), anti-CD2 FITC (01174D), anti-CD11b PE (017158), anti-CD34 FITC (553733), anti-CD44 FITC (553133), anti-CD45R PE (553089), anti-CD71 FITC (553266), anti-CD144 (28091D), from e-Bioscience: anti-Ter119 FITC (11-5921-82), anti-CD14 FITC (11-0141-81), anti-CD31 FITC (11-0311-87), anti-CD45 FITC (11-0451-82), anti-CD48 FITC (11-0481-81), anti-CD54 biotin (13-0541-81), anti-CD117 (11-1171-81), anti-CD90 biotin (13-0900-8), anti-CD105 biotin (13-1051-81), anti-CD106 biotin (11-1061-81), anti-CD133 FITC (11-1331-82), anti-CD140a biotin (13-1401-80), anti-CD140b biotin (13-1402-80), anti-CD150 PE (12-1501-80), AA4.1 FITC (11-5892-81), anti-Sca1 PE (), Serotec: anti-CD13 FICT (MCA2183F). Streptavidin-PE (BD 13025D) or -FITC (BD 554060) were used to visualize the biotin-conjugated antibodies. Rabbit preimmune serum and antiCD248 was a kind gift from C. Isacke, Institute of Cancer Research, London. Samples were run on a BD FACSCalibur or sorted on a BD FACSVantage, and data were analyzed using FlowJo software. May and Grunwald (BDH 350255S) and Wright Giemsa (Sigma WG16) staining was performed following manufacturer’s instructions. Diaminobenzidine staining of cells was performed on methanol fixed cells by incubating preparations for 1.5 minutes in 1% 3,30 dimethoxybenzidine (Sigma D9143) in methanol and 1.5 minutes in 1% H202 in 50% ethanol followed by 30 seconds in H20. Hematoxylin and eosin (Ehrlich, Fluka, 02992) staining was performed following manufacturer’s instructions. Cell-cycle analysis Harvested cells were washed in phosphate-buffered saline (PBS), fixed in cold 70% ethanol, incubated for 30 minutes at 4 C, washed in PBS, incubated in 50 mL 100 mg/mL RNase followed by the addition of 200 mg (50 mg/mL) propidium iodide and analysis by flow cytometry. Reverse transcriptase-polymerase chain reaction of cDNA samples Amplified cDNA bands were produced using gene-specific oligonucleotide sequences and Taq PCR Master Mix (Qiagen, 201445) following manufacturer’s instructions. Oligonucleotide sequences and polymerase chain reaction (PCR) conditions are available upon request. For semi-quantitative reverse transcriptase PCR (SQ-RT-PCR), linearity of PCR reactions was confirmed by sampling and visualization by gel electrophoresis at 15, 20, 25, 30, and 35 cycles. For Q-RT-PCR, amplified cDNA bands were produced using specific oligonucleotide sequences and Quantitect SYBR green PCR master mix (Qiagen 1017340). Samples were amplified for 40 cycles using a Prism 7900HT system (Applied Biosystems), and analyzed using Applied Biosystems software. Preparation of mRNA/cDNA from cell preparations Cell preparations were pelleted, the pellets dissociated, resuspended in Trizol (Gibco BRL, 15596-026), and mRNA prepared following manufacturer’s instructions. cDNA was produced using

726

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

oligo dT (Sigma, C110A) and Moloney murine leukemia virus reverse transcriptase (Invitrogen, 28025-013). CFU assays Cells were plated in M3434 methyl cellulose (Stem Cell Technologies, Vancouver, BC, Canada) following manufacturer’s instructions. Colonies were counted and typed to 14 days. Cloning of Lrfn2 cDNA into MSCV-IRES-GFP Forward and reverse primers specific for 50 (GGTACCGAGCT CGGATCCATGGAGACTCTGCTTGGTGGG) and 30 (GGCCG TTACTAGTGGATCCCTACACAGTACTTTCCATTAC) sequences of Lrfn2 cDNA were used to amplify cDNA produced from wildtype thymus mRNA. DNA was digested with EcoRI (MSCV-IRESGFP) and SacI (Lrfn2), blunt-ended using T4 DNA polymerase and digested with XhoI. Ligation of the fragments produced resulted in the cloning of Lrfn2 downstream of the 50 LTR of MSCV-IRES-GFP and upstream of the 30 IRES sequence in MSCV-IRES-GFP. Production of retrovirus Phoenix-Eco cells were obtained from the laboratory of G Nolan and used to produce and titer virus, and infect bone marrow following the instructions provided (available at: www. stanford-edu/group/nolan/protocols2). Cell culture Unclassifiable (UC) cells were grown in RPMI 1640 media containing 10% fetal calf serum, 2 mM L-glutamine, 1 U mL1 penicillin, and 1 U mL1 streptomycin.

Results Doubly transgenic MEnTCD2.5:H2K-Myc mice develop erythroblastosis MEnTCD2 transgenic mice express a dominant negative Myb construct in a T-cell specific manner [22]. We derived three lines of these mice, all of which display the same Tcell phenotype [22]. However, when one of these lines, MEnTCD2.5 (termed MEnT5 hereafter), was crossed with a second transgenic line, H2K-Myc (termed Myc hereafter) [23], in which the Myc oncogene is ubiquitously expressed, all doubly transgenic MEnT5:Myc offspring developed enlarged lymph nodes (LN) between 4 and 10 weeks of birth. All mice had to be sacrificed before 14 weeks of age because of extreme enlargement of their peripheral LN. Nontransgenic or singly transgenic littermates did not have enlarged LN and their survival was not compromised (data not shown). Postmortem examination of the doubly transgenic MEnT5:Myc animals showed enlarged LN and spleens, with some individual LN being w1 cm in diameter at 8 weeks of age. Total cell numbers in inguinal and axiliary LN had increased to between 5  108 and 25  108 cells, with the greatest increase in older animals (Fig. 1A). The LN consisted of large hematomas with cystic degeneration and diffuse hemorrhage with necrosis, and they appeared to have become a site of extrame-

dullary hematopoiesis. However, injection of MF1 nude animals either intravenously or subcutaneously with cells from MEnT5:Myc LN did not produce tumors, indicating that the abnormal cells were not leukemogenic (data not shown). Blood smears taken from wild-type (wt) littermates, MEnT5 and MEnT5:Myc mice and stained with hematoxylin and eosin and diaminobenzidine showed the presence in both single transgenic MEnT5 and doubly transgenic MEnT5:Myc blood of aberrant target cells, symptomatic of abnormal erythroid development (Fig. 1B, arrowed). Histological examination of MEnT5:Myc LN showed that they contained many nonlymphoid cells. The smaller aberrant cells stained positively with diaminobenzidine, which together with their size and morphology indicated they were a mixture of late-stage erythroblasts, reticulocytes, and mature erythrocytes. Many of the larger cells had morphological characteristics consistent with their representing earlier stages of the erythroid lineage [3] (Fig. 1B, lower left panel). These aberrant cells were also observed to a lesser degree in single transgenic MEnT5 mice (Fig. 1B, center left panel). Taken together with the aberrant blood smear, this suggests that the initial aberration segregates with the MEnT5 rather than the Myc transgene. The spleens of diseased MEnT5:Myc animals showed marked extramedullary hematopoiesis with focally extensive necrosis. To determine whether this phenotype also segregated with the MEnT5 transgene, we performed colony-forming assays using MEnT5 and wt spleens. Cells were plated in methylcellulose supporting the growth of murine CFU-GEMM, BFU-E, and CFU-granulocyte macrophage (CFU-GM) colonies and colonies were counted and typed to 14 days in culture. Total MEnT5 spleenderived colony numbers were 2.5-fold higher than from wt spleen (Fig. 1C, mean total of wt lanes 1, 3, 5, and 7 is 305, compared with MEnT5, where mean total of lanes 2, 4, 6, and 8 is 748), with the proportion of MEnT5 CFU-GEMM (lane 2) increasing to 19% from 10% in wt (lane 1). We also observed novel colonies containing cells unclassifiable by normal criteria (lane 8; UC cells). To further classify the aberrant erythroid cells seen in MEnT5 and MEnT5:Myc mice, samples from wt, Myc, MEnT5, and MEnT5:Myc bone marrow (BM) and LN were stained with antibodies against Ter119 and CD71, which together can be used to distinguish between the different stages of erythroid maturation [3]. Results are shown in Figure 2A. The BM of MEnT5:Myc animals contained 3.5% of cells falling within gate R2, compared with 1.0% in wt controls, and almost twice the normal number of cells in gate R3, indicating an overrepresentation of proerythroblasts (R2) and basophilic erythroblasts (R3). The majority of aberrant cells in the MEnT5:Myc LN were orthochromatophilic erythroblasts or later, but there was a small but significant proportion of cells falling within gates R2 and R4, indicating that all stages of erythroblasts were present. Fewer than 2% of MEnT5:Myc LN cells expressed the

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

A

727

B

3000

lymph node cell number x10e6

2500

blood

2000 1500

wild type

1000 500

MEnT5:Myc 13

MEnT5:Myc 12

MEnT5:Myc 8-9

MEnT5:Myc 6-7

MEnT5 8

Myc 8

wt 8

0

Genotype and age in weeks

C

MEnT5

spleen 600

*

colonies (number)

500

400

300

200

*

MEnT5: Myc

100

* *

0 1

2

3

4

5

6

7

8

colony type/genotype Figure 1. Peripheral phenotypes of MEnT and MEnT:Myc mice. (A) Cell counts from the lymph nodes (LN) of wild-type (wt), MEnT5, Myc, and MEnT5:Myc mice of 6 to 13 weeks of age. (B) Blood (right panels) and LN preparations (left panels) from wt (top panels), MEnT5 (center panels) and MEnT5:Myc (lower panels) mice were stained with hematoxylin and eosin to show morphology, and neutral benzidine to identify erythroid cells. The arrows indicate target cells. Inset: small benzidine positive cells in MEnT5:Myc LN. (C) Colony-forming assays from wt and MEnT spleens. Mean numbers of colonyforming unit granulocyte-erythrocyte-monocyte-megakaryocyte (CFU-GEMM) (lanes 1 and 2), burst-forming unit erythroid (BFU-E) (lanes 3 and 4), CFU-granulocyte macrophage (CFU-GM) (Lanes 5 and 6) and unclassifiable (lanes 7 and 8) are shown for wt spleen (lanes 1, 3, 5, and 7) or MEnT5 spleen (lanes 2, 4, 6, and 8). *Values significantly different to wt (p ! 0.05).

T-cell markers CD4 or CD8, the B-cell marker B220, the macrophage marker MacI or the granulocyte marker Gr1 (data not shown). In MEnT5 animals, changes were less marked, although there was a slight increase in proerythroblasts and basophilic erythroblasts in the BM, and cells falling into the more mature gates R4 and R5 were found in the LN. Myc BM and LN samples were very similar to wt controls. Expression of the erythroid-specific genes Gata1 [9], Klf1 [16], Epor [25], and Hbb (b-globin) was examined using SQ-RT-PCR on RNA samples derived from total and Ter119þ flow-sorted wt BM, or from total and

Ter119þ sorted LN and thymic cells from wt and MEnT5:Myc animals (Fig. 2B). As would be expected, wt total or Ter119þ sorted BM samples expressed Gata1, Klf1, Epor, and Hbb (Fig. 2B, lanes 1 and 2), whereas expression of these genes, with the exception of a low level of expression of Hbb, was absent from wt LN and thymus samples (Fig 2, lanes 3 and 6). In contrast, MEnT5:Myc total and Ter119þ sorted LN and thymus samples expressed Gata1, Klf1, Epor, and Hbb (Fig 2, lanes 4, 5, 7, and 8). Levels of expression looked very similar to that seen in normal BM. Taken together, these data show that the erythroblastosis observed in the

728

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

Figure 2. Increased numbers of erythroid cells in the bone marrow and lymphoid tissues of MEnT and MEnT5:Myc animals. (A) Cells from wild-type (wt), Myc, MEnT, and MEnT5:Myc bone marrow (BM) and lymph nodes (LN) were incubated with anti-CD71 and anti-Ter119 antibodies and analyzed by flow cytometry. The percentage of cells in each of sectors R1–R5 (schematic on right) is shown. (B) Semi-quantitative reverse transcriptase-polymerase chain reaction of erythroid genes Gata1, Klf1, erythropoietin receptor (Epor), and Hbb with Act b as a loading control is shown for: wt BM (lane 1); Ter119þ wt BM (lane 2); wt LN (lane 3); MEnT5:Myc LN (lane 4); Ter119þ MEnT5:Myc LN (lane 5); wt thymus (lane 6); MEnT5:Myc thymus (lane 7), and Ter119þ MEnT5:Myc thymus (lane 8).

periphery of MEnT5:Myc animals is also evident in the BM, and that the peripheral erythroblasts express genes appropriate to their cell type. Increased numbers of erythroid progenitors in MEnT5 and MEnT5:Myc BM Hematopoietic progenitor numbers within the BM of wt, Myc, MEnT5, and MEnT5:Myc animals were determined using colony-forming assays. BM cells were plated in methylcellulose supporting the growth of murine CFUGEMM, BFU-E, and CFU-GM colonies and colonies were counted and typed to 14 days in culture. Total numbers of colonies (expressed as an average) are shown in Figure 3A. MEnT5:Myc BM was able to generate almost twice as many colonies as any other BM type (compare lane 4 with lanes 1–3). Significant biases toward CFUGEMM and BFU-E colony formation were observed in cultures from both MEnT5 and MEnT5:Myc BM (Fig. 3B, top two panels, lanes 3 and 4) compared to wt or Myc BM (Fig. 3B, top two panels, lanes 1 and 2). These data suggest that, as in vivo, in in vitro assays, the Myc transgene can combine with MEnT5 to cause increased proliferation leading to greater colony numbers. However, BM from MEnT5

contains a greater than normal proportion of erythroid progenitors, irrespective of the presence of the Myc transgene. Insertional activation of the Lrfn2 gene in MEnT5:Myc mice The erythroblastosis phenotype in MEnT5:Myc animals was not observed when other lines of MEnTCD2 transgenic animals, or the MTCD2.5 line (which expresses a different Myb dominant negative protein [22]), were crossed with the Myc line. This was not due to a difference in expression of the Myb transgene, as SQ-RT-PCR demonstrated that all transgenes were expressed in Ter119þ cells, albeit at very low levels (data not shown). We therefore investigated the possibility that the MEnT5 transgene had integrated into a locus such that it disrupted a gene involved in erythropoiesis. Cloning, sequencing, and database analysis determined that in the MEnT5 line, the transgene had integrated in the reverse orientation into the first intron of the Lrfn2 gene (GeneID: 70530) on chromosome 17 C, before the translation start site in exon 2 (Fig. 4A). Lrfn2 expression was examined in total and Ter119þ sorted BM, LN, and thymic cells from wt and MEnT5:Myc animals by Q-RT-PCR using primers spanning exons 2 and

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

729

A

Chr 17 STOP

ATG

B

25.1 kb

39.7 kb

95.2 kb exon1

exon 2

exon3

35 30

Lrfn2/Act b

25 20 15 10 5 0 2

1

C

3

4

5

6

7

8

14

Lrfn2/Act b

12

Figure 3. Increased erythroid progenitors and unclassifiable (UC) cells in MEnT5, MEnT5:Myc, or Lrfn2-transduced bone marrow. (A) Mean total colonies from bone marrow (BM) of wild-type (wt) (n 5 15; lane 1); Myc (n 5 7; lane 2); MEnT5 (n 5 13; lane 3); MEnT5:Myc (n 5 5; lane 4); wt transduced with control virus (n 5 10; lane 5); Myc transduced with control virus (n 5 3; lane 6); wt transduced with v-Lrfn2 virus (n 5 11; lane 7); Myc transduced with v-Lrfn2 virus (n 5 3; lane 8),and MEnT5 transduced with v-Lrfn2 virus (n 5 3; lane 9). (B) Percentages of colony-forming unitgranulocyte-erythrocyte-monocyte-megakaryocyte (CFU-GEMM), burstforming unit-erythroid (BFU-E), CFU-granulocyte macrophage (CFUGM) and colonies of unknown type (UC) were determined in colony-forming assays. Numbering as for (A). *Values significantly different to wt (p ! 0.05).

3, which comprise the coding region of the Lrfn2 gene. Lrfn2 mRNA was detected at low levels in wt total and Ter119þ BM relative to an Actb control (Fig. 4B lanes 1 and 2), and was undetectable in wt LN and thymus samples (Fig. 4B, lanes 3 and 6). In contrast, Lrfn2 expression was observed in MEnT5:Myc total LN and thymus (Fig. 4B, lanes 4 and 7), and the level of expression was more than sixfold greater in Ter119þ cells from both MEnT5:Myc LN and thymus than in Ter119þ wt BM (Fig. 4B lanes 5 and 8; compare to lane 2). This increase could be due to insertional activation of Lrfn2, but might reflect the fact that the predominant Ter119þ population in MEnT5:Myc LN is at a later developmental stage than in wt BM (Fig. 2A), and that this population has a naturally higher Lrfn2 expression level. To compare more closely equivalent populations, we also looked by Q-RT-PCR at Lrfn2 expression in Ter119þ sorted BM samples from wt, Myc, MEnT5, and MEnT5:

10 8 6 4 2 0 1

2

3

4

Figure 4. Integration into and anomalous expression of the Lrfn2 gene. (A) Schematic of the insertion point of the MEnT5 transgene. Lrfn2 exons 1, 2, and 3 are depicted by white boxes and the MEnT transgene and direction of insertion by a gray arrow. (B) Quantitative reverse transcriptasepolymerase chain reaction (Q-RT-PCR) comparison of Lrfn2 expression relative to that of Act b for: wild-type (wt) bone marrow (BM) (lane 1); Ter119þ wt BM (lane 2); wt lymph nodes (LN) (lane 3); MEnT5:Myc LN (lane 4); Ter119þ MEnT5:Myc LN (lane 5); wt thymus (lane 6); MEnT5:Myc thymus (lane 7), and Ter119þ MEnT5:Myc thymus (lane 8). (C) Q-RT-PCR comparison of Lrfn2 expression relative to that of Act b for: Ter119þ wt BM (lane 1); Ter119þ Myc BM (lane 2); Ter119þ MEnT5 BM (lane 3), and Ter119þ MEnT5:Myc BM (lane 4).

Myc animals. Relative to wt (Fig. 4C, lane 1), Lrfn2 expression was increased by less than twofold in Myc cells (Fig. 4C, lane 2), by threefold in MEnT5 cells (Fig. 4C, lane 4), and by more than fivefold in MEnT5:Myc cells (Fig. 4C, lane 5). Again, while it is possible that subset differences are responsible, it seems likely that expression of Lrfn2 is increased at least in part because of insertional activation by the MEnT5 transgene. To determine whether insertion of the MEnT5 transgene had resulted in a modified form of Lrfn2 mRNA being produced, we performed on MEnT5 BM and LN cDNAs using primers abutting the start of the coding region of Lrfn2 in exon 2. Several novel bands were observed, all containing

730

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

Figure 5. Subset definition and cell-cycle analysis of v-Lrfn2–infected bone marrow–derived unclassifiable (UC) cells. (A) Flow cytometry plot of side-scatter and forward-scatter characteristics of UC cells. Three subpopulations of cells (P1, P2, and P3) were identified. The percentages of cells in each population is shown. (B) Cells were sorted into populations P1, P2, and P3 by forward and side scatter and the cell cycle of the total culture or each of these populations determined by staining with propidium iodide followed by flow cytometry. The percentage of cells in each stage of the cell cycle is shown.

a fusion product in which sequences from part of the transgenic control region, namely the reverse orientation of HBB exon 3 [22], were joined to the splice acceptor sequence of Lrfn2 exon 2, preserving the Lrfn2 initiating methionine (data not shown). Examination of the sequence at the fusion point showed stop codons in all three frames immediately upstream of the Lrfn2 initiating methionine, strongly suggesting that these fusion mRNAs still translate a normal Lrfn2 protein product. Erythroid phenotype can be replicated by overexpression of normal Lrfn2 To resolve the issues regarding insertional activation and potential mutagenesis of Lrfn2 in MEnT5 transgenics, we

decided to determine whether the expression of normal Lrfn2 alone was sufficient to induce the observed change in erythroid progenitor numbers. Therefore, we cloned a full-length wt Lrfn2 cDNA from mouse thymus, and inserted it into the MSCV-IRES-GFP retroviral vector [26] to make the construct v-Lrfn2. Wt, MEnT5, or Myc BM was transduced with either empty vector or v-Lrfn2. As before, BM cells were plated in methylcellulose supporting the growth of CFU-GEMM, BFU-E, and CFU-GM murine colonies, and colonies were counted and typed to 14 days. We assessed the efficiency of retroviral transduction by making RNA from multiple individual colonies from both empty vector and v-Lrfn2 vector plates, and looking by RT-PCR for GFP expression; for both viruses, approximately 80% of colonies were infected. Mean total colony numbers were increased in v-Lrfn2-infected wt, Myc and MEnT5CD2.5 BM relative to control-infected wt or Myc BM (Fig. 3A, compare lanes 7, 8, and 9 with lanes 5 and 6). Expression of Lrfn2 in wt, Myc, or MEnT5 BM cells (Fig. 3B, top panels, lanes 7, 8, and 9) resulted in significant increases in BFU-E and CFU-GEMM colony formation when compared to empty vector controls (Fig. 3B, top panels, lanes 5 and 6) or uninfected wt BM cells (Fig. 3B, top panels, lane 1). This increase resembled that seen in colony assays using uninfected MEnT5 and MEnT5:Myc BM (Fig. 3B, top panels, lanes 3 and 4). However, transducing MEnT5 BM with the v-Lrfn2 virus (Fig. 3B, top panels, lane 9) did not increase the bias toward an erythroid fate when compared to MEnT5 (Fig. 3B, top panels, lane 3) or MEnT5:Myc BM alone (Fig. 3B, top panels, lane 4), although the ratio of CFU-GEMM to BFU-E was changed in favor of the less mature CFUGEMM colony type. Therefore, in summary, these data show that overexpression of normal Lrfn2 in an in vitro colony-forming assay is sufficient to replicate the in vitro phenotype of MEnT5 and MEnT5:Myc BM, providing strong evidence that the transgenic phenotype is dependent upon insertional activation of the endogenous Lrfn2 gene and overproduction of normal Lrfn2 protein, rather than expression of the MEnTCD2 transgene. Characterization of unclassifiable colonies A significant number of colonies unclassifiable by normal criteria (UC) were observed in colony-forming assays when any of wt, Myc, or MEnT BM were infected with v-Lrfn2, and also in MEnT5 and MEnT5:Myc BM (Fig. 3B, lower right panel, lanes 3,4, 7–9). Growth of MEnT5, MEnT5:Myc BM or normal BM infected with vLrfn2 in unsupplemented (fetal calf serum only) medium resulted in the expansion of UC cells, with this expansion continuing over a period of more than 9 months. However, UC cells injected into nude mice failed to produce tumors (data not shown). We examined the cells derived from wt BM infected with v-Lrfn2 in more detail. All cells were GFP-positive, and hence retrovirally infected (data not

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

731

shown). Flow cytometric analysis showed that the cells could be split into three subsets based on forward and side-scatter parameters (Fig. 5A). When sorted into these three populations, termed P1, P2, and P3, and cultured for 3 days, it was evident from time-lapse studies that the cells were able to interconvert freely between the three states (data not shown). P3 cells were also cycling rapidly (Fig. 5B) with a division time of approximately 10 hours (data not shown), whereas the P1 and P2 populations were not in cycle (Fig. 5B). P3 cells were large adherent stellate cells (Fig. 6A, broad arrow), which did not exhibit contact inhibition and were highly mobile, while P1 and P2 cells were smaller and nonadherent (Fig. 6A, thin arrows). Morphologically, P3 cells seemed to share some of the characteristics of fibroblasts. To further phenotype the cells, we stained them with a variety of antibodies. Figure 6B shows flow cytometry plots gated on P3 cells, demonstrating that O75% of cells stained positively for Sca1, CD44, CD54, and CD105, with 60% of cells also being positive for the fibroblast marker CD248 and approximately 35% to 40% being positive for CD11b, CD34, and CD117. A list of all antibodies used and the staining patterns of all three populations P1-P3 is shown in Table 1. SQ-RT-PCR analysis of the cells also demonstrated that they lacked Gata1 expression, but expressed both Gata2 and Gata3 (Fig. 6C), a combination normally associated in hematopoiesis with the T cell lineage [27] . However, they also expressed Epor, although they did not require erythropoietin for growth. This pattern of marker staining and gene expression does not correspond to any known lineage. However, based on morphology, the presence of the leukocyte marker CD45 [28] and the hematopoietic stem/progenitor cell markers Sca1, CD34, and CD117 [29], and the fibrocyte/fibroblast markers CD11b, CD14, CD54 [30], CD140b, and CD248 [31], we provisionally suggest the cells may be fibroblasts derived from hematopoietic stem cells (HSCs).

Discussion We describe here a novel erythroblastosis whose genesis requires either overexpression or insertional activation of the Lrfn2 gene. Lrfn2, also called SALM1, belongs to a five-member protein family of type 1 glycosylated transmembrane proteins whose highly conserved extracellular

= Figure 6. Morphology and staining profile of v-Lrfn2–infected unclassifiable (UC) cells. (A) UC culture at 40 magnification. Small arrows mark examples of the smaller cells and the large arrows examples of the larger cells in the culture. (B) Surface phenotype of P3 cells analyzed by flow cytometry. The percentage of positive cells is shown in each case. (C) Semiquantitative reverse transcriptase-polymerase chain reaction of Kit, Klf1, erythropoietin receptor (Epor), Sca1, LRFN2, Gata1, Gata2, Gata3 with Act b as a loading control is shown for: wild-type bone marrow (lane 1) and cultured cells shown in A (lane 2).

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

732

Table 1. Surface phenotype of unclassifiable cells % Positive cells Marker

Total

P1

P2

P3

Entrez gene

Sca-1 CD44 CD105 CD54 CD248 CD34 CD117 CD11b CD14 CD45 Ter119 CD31 CD106 CD140b CD133 CD2 CD144 CD140a CD48 CD71 AA4.1 CD45R CD13 CD150 CD90

95.5 88.8 72.7 59.1 41.1 17.5 21.0 18.9 17.6 15.4 12.2 15.2 7.0 9.2 12.5 8.2 8.7 17.3 2.3 2.6 6.9 8.0 2.9 0.1 0.1

93.7 41.7 75.8 67.2 1.9 1.3 0.3 0.7 0.9 0.9 3.3 2.9 0.5 0.2 1.2 5.6 2.8 0 0.2 0 11.1 0 0.2 0 0.1

94.6 62.1 64.0 52.5 2.5 4.4 2.2 3.0 3.7 6.2 9.5 3.0 0.5 0.7 13.7 24.7 9.0 2.8 0.2 0.1 9.6 5.9 4.5 0.6 0

99.9 98.5 97.3 86.0 60.2 41.6 40.0 34.2 29.3 27.6 23.3 18.5 15.4 15.3 14.1 13.1 10.9 9.1 6.2 5.7 3.1 3.1 2.8 1.8 0.1

110454 12505 13805 15894 70445 12490 16590 16409 12475 19264 104231 18613 22329 18596 19126 12481 12562 18595 12506 22042 17064 19264 16790 27218 21838

N-terminal regions all have six leucine-rich repeats (LRRs), an immunoglobulin (Ig) C2-type domain with a cysteinerich flanking region and a fibronectin type 2 (Fn) domain [32]. This combination of structural motifs suggests they are cell-adhesion molecules capable of making multiple protein-to-protein interactions. The LRR-Ig-FN extracellular domain organization of the Lrfn family is common to a number of other protein families, most of which are expressed in the mammalian nervous system (reviewed in [32]). Based on studies of these other proteins the LRRIg-Fn motif has been proposed to provide a molecular anchor for the elongating neurite [33]. However, an additional feature of the Lrfn family is that the cytoplasmic domains of Lrfn1, 2 and 4 terminate in a class 1 PDZ-binding motif, which can interact in vitro with the postsynaptic protein PSD95 [32,33]. A combination of an LRR-Ig extracellular domain together with an intracellular PDZ-binding motif also has precedent in the nervous system, being found in the NGL1 and LRRC4 proteins. NGL1 is the ligand for Netrin G1, and its overexpression forces outgrowth of thalamocortical axons [34], while LRRC4, whose binding partner is currently unknown, is a putative tumor suppressor thought to inhibit proliferation of gliomas by repressing signal transduction through multiple pathways [35]. Lrfn2 itself has been proposed to be involved in formation and maintenance of the neuronal synapse. Lrfn2 can associate with the N-methyl-D-aspartate (NMDA) receptor in neuronal cells both via its cytoplasmic interaction with

PSD95 and also via its extracellular domains, and is able to recruit PSD95 to the cell periphery [32,33]. Like other LRR-Ig-Fn proteins, overexpression of Lrfn2 promotes neurite outgrowth in cultured hippocampal neurons [33]. Recently, the related protein Lrfn1 (SALM2) has also been shown to associate with PSD95 and both the NMDA and AMPA receptors, increasing the number of excitatory synapses and dendritic spines if overexpressed [36]. We show in this article that Lrfn2 transcripts can be detected in total BM and Ter119þ sorted BM cells from normal mice, and that its overexpression affects the differentiation of normal BM, making it likely that Lrfn2 has had, until now, an unreported role in hematopoiesis. Previous studies have focused on expression of the Lrfn gene family in the brain, but analysis of available microarray data shows that in addition to Lrfn2, Lrfn4 is also of particular interest with respect to early hematopoiesis, as it is found at high levels in mouse BM, and in humans, is highly expressed in bone-marrow–derived CD105þ endothelial cells and CD34þ cells [37]. In support of the latter observation, human CD34þCD33CD38Rholokitþ hematopoietic stem/progenitor cells show a 3.5-fold enrichment of LRFN4 mRNA when compared with an HSC-depleted CD34þCD33CD38Rhohikitþ population [38]. While any discussion of the role of these two proteins in hematopoiesis is clearly speculative at this stage, by extrapolation from their proposed function in neuronal development, it seems likely that they are acting as bridging molecules between as yet unidentified extracellular structures and intracellular scaffold proteins, functioning as mediators in the translation of extracellular stimuli into intracellular signaling. It is possible that Lrfn proteins may interact with established molecules such as Epor, Kit, or the glucocorticoid receptor whose dysregulation is known to lead to erythroblastosis (reviewed in [39]), but equally that it is acting in a completely novel way. Interestingly, the erythroblastosis phenotype of MEnT5:Myc mice relies upon cooperation between the MEnT5 integration into the Lrfn2 locus and the ubiquitously expressed Myc transgene, with the latter likely acting in its well-established role as a proliferative agent [40]. However, MEnT5 single transgenic LN already contain a significant proportion of abnormal erythroid cells, and it is not clear how these abnormal cells enter the lymphatic system. A role for Lrfn2 in this aberrant localization, perhaps by means of its function as an adhesion-like molecule, is therefore a possibility. In addition to the in vivo erythroblastosis phenotype, a population of cells that we have been unable to classify unequivocally, and which we have termed UC cells, can be cultured from MEnT5 and MEnT5:Myc BM and lymphoid organs, or from wt BM transduced with Lrfn2. Although they do not correspond to any characterized cell type, the presence of markers for both early hematopoietic cells and fibroblasts leads us to suggest that they may represent a novel intermediate in the differentiation series from

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

an HSC-derived CFU-F to fibrocytes/fibroblasts [41–43]. Whether these cells transiently exist in normal BM, and have been ‘‘frozen’’ by overexpression of Lrfn2, or are an abnormal result of Lrfn2 expression, remains to be defined.

18.

19.

Acknowledgments This work was supported by Cancer Research UK. We thank Demelza Bird and LuAnn McKinney for technical assistance, and Clare Isacke, John MacFadyen, Hugh Paterson and Bob Paulson for protocols and helpful discussions.

20.

References

22.

1. Gregory CJ, Eaves AC. Three stages of erythropoietic progenitor cell differentiation distinguished by a number of physical and biologic properties. Blood. 1978;51:527–537. 2. Gregory CJ, Eaves AC. Human marrow cells capable of erythropoietic differentiation in vitro: definition of three erythroid colony responses. Blood. 1977;49:855–864. 3. Socolovsky M, Nam H, Fleming MD, Haase VH, Brugnara C, Lodish HF. Ineffective erythropoiesis in Stat5a(/)5b(/) mice due to decreased survival of early erythroblasts. Blood. 2001;98:3261–3273. 4. Guillemin K, Krasnow MA. The hypoxic response: huffing and HIFing. Cell. 1997;89:9–12. 5. Broudy VC, Lin NL, Priestley GV, Nocka K, Wolf NS. Interaction of stem cell factor and its receptor c-kit mediates lodgment and acute expansion of hematopoietic cells in the murine spleen. Blood. 1996;88: 75–81. 6. Bauer A, Tronche F, Wessely O, et al. The glucocorticoid receptor is required for stress erythropoiesis. Genes Dev. 1999;13:2996–3002. 7. Cantor AB, Orkin SH. Hematopoietic development: a balancing act. Curr Opin Genet Dev. 2001;11:513–519. 8. Hall MA, Slater NJ, Begley CG, et al. Functional but abnormal adult erythropoiesis in the absence of the stem cell leukemia gene. Mol Cell Biol. 2005;25:6355–6362. 9. Fujiwara Y, Browne CP, Cunniff K, Goff SC, Orkin SH. Arrested development of embryonic red cell precursors in mouse embryos lacking transcription factor GATA-1. Proc Natl Acad Sci U S A. 1996;93: 12355–12358. 10. Suwabe N, Takahashi S, Nakano T, Yamamoto M. GATA-1 regulates growth and differentiation of definitive erythroid lineage cells during in vitro ES cell differentiation. Blood. 1998;92:4108–4118. 11. Takahashi S, Komeno T, Suwabe N, et al. Role of GATA-1 in proliferation and differentiation of definitive erythroid and megakaryocytic cells in vivo. Blood. 1998;92:434–442. 12. Tsai FY, Keller G, Kuo FC, et al. An early haematopoietic defect in mice lacking the transcription factor GATA-2. Nature. 1994;371: 221–226. 13. Kitajima K, Tanaka M, Zheng J, et al. Redirecting differentiation of hematopoietic progenitors by a transcription factor, GATA-2. Blood. 2006;107:1857–1863. 14. Hodge D, Coghill E, Keys J, et al. A global role for EKLF in definitive and primitive erythropoiesis. Blood. 2006;107:3359–3370. 15. Perkins AC, Sharpe AH, Orkin SH. Lethal beta-thalassaemia in mice lacking the erythroid CACCC-transcription factor EKLF. Nature. 1995;375:318–322. 16. Miller IJ, Bieker JJ. A novel, erythroid cell-specific murine transcription factor that binds to the CACCC element and is related to the Kruppel family of nuclear proteins. Mol Cell Biol. 1993;13:2776– 2786. 17. Rao G, Rekhtman N, Cheng G, Krasikov T, Skoultchi AI. Deregulated expression of the PU.1 transcription factor blocks murine er-

21.

23.

24.

25.

26.

27. 28.

29. 30.

31.

32.

33.

34.

35.

36.

37.

733

ythroleukemia cell terminal differentiation. Oncogene. 1997;14:123– 131. Rekhtman N, Choe KS, Matushansky I, Murray S, Stopka T, Skoultchi AI. PU.1 and pRB interact and cooperate to repress GATA-1 and block erythroid differentiation. Mol Cell Biol. 2003;23:7460–7474. Rekhtman N, Radparvar F, Evans T, Skoultchi AI. Direct interaction of hematopoietic transcription factors PU.1 and GATA-1: functional antagonism in erythroid cells. Genes Dev. 1999;13:1398–1411. Zhang J, Randall MS, Loyd MR, et al. Role of erythropoietin receptor signaling in Friend virus-induced erythroblastosis and polycythemia. Blood. 2006;107:73–78. von Lindern M, Deiner EM, Dolznig H, et al. Leukemic transformation of normal murine erythroid progenitors: v- and c-ErbB act through signaling pathways activated by the EpoR and c-Kit in stress erythropoiesis. Oncogene. 2001;20:3651–3664. Badiani P, Corbella P, Kioussis D, Marvel J, Weston K. Dominant interfering alleles define a role for c-Myb in T-cell development. Genes Dev. 1994;8:770–782. Jonkers J, Korswagen HC, Acton D, Breuer M, Berns A. Activation of a novel proto-oncogene, Frat1, contributes to progression of mouse T-cell lymphomas. Embo J. 1997;16:441–450. Collins FS, Weissman SM. Directional cloning of DNA fragments at a large distance from an initial probe: a circularization method. Proc Natl Acad Sci U S A. 1984;81:6812–6816. Longmore GD, Watowich SS, Hilton DJ, Lodish HF. The erythropoietin receptor: its role in hematopoiesis and myeloproliferative diseases. J Cell Biol. 1993;123:1305–1308. Van Parijs L, Refaeli Y, Lord JD, Nelson BH, Abbas AK, Baltimore D. Uncoupling IL-2 signals that regulate T cell proliferation, survival, and Fas-mediated activation-induced cell death. Immunity. 1999;11: 281–288. Burch JB. Regulation of GATA gene expression during vertebrate development. Semin Cell Dev Biol. 2005;16:71–81. Trowbridge IS, Thomas ML. CD45: an emerging role as a protein tyrosine phosphatase required for lymphocyte activation and development. Annu Rev Immunol. 1994;12:85–116. Wognum AW, Eaves AC, Thomas TE. Identification and isolation of hematopoietic stem cells. Arch Med Res. 2003;34:461–475. Quan TE, Cowper S, Wu SP, Bockenstedt LK, Bucala R. Circulating fibrocytes: collagen-secreting cells of the peripheral blood. Int J Biochem Cell Biol. 2004;36:598–606. Macfadyen J, Savage K, Wienke D, Isacke CM. Endosialin is expressed on stromal fibroblasts and CNS pericytes in mouse embryos and is downregulated during development. Gene Expr Patterns. 2007;7:363–369. Morimura N, Inoue T, Katayama K, Aruga J. Comparative analysis of structure, expression and PSD95-binding capacity of Lrfn, a novel family of neuronal transmembrane proteins. Gene. 2006;380:72–83. Wang CY, Chang K, Petralia RS, Wang YX, Seabold GK, Wenthold RJ. A novel family of adhesion-like molecules that interacts with the NMDA receptor. J Neurosci. 2006;26:2174–2183. Lin JC, Ho WH, Gurney A, Rosenthal A. The netrin-G1 ligand NGL-1 promotes the outgrowth of thalamocortical axons. Nat Neurosci. 2003; 6:1270–1276. Wu M, Huang C, Gan K, et al. LRRC4, a putative tumor suppressor gene, requires a functional leucine-rich repeat cassette domain to inhibit proliferation of glioma cells in vitro by modulating the extracellular signal-regulated kinase/protein kinase B/nuclear factor-kappaB pathway. Mol Biol Cell. 2006;17:3534–3542. Ko J, Kim S, Chung HS, et al. SALM synaptic cell adhesion-like molecules regulate the differentiation of excitatory synapses. Neuron. 2006;50:233–245. Su AI, Cooke MP, Ching KA, et al. Large-scale analysis of the human and mouse transcriptomes. Proc Natl Acad Sci U S A. 2002;99:4465– 4470.

734

A. Castellanos et al./ Experimental Hematology 35 (2007) 724–734

38. Eckfeldt CE, Mendenhall EM, Flynn CM, et al. Functional analysis of human hematopoietic stem cell gene expression using zebrafish. PLoS Biol. 2005;3:e254. 39. Dolznig H, Grebien F, Deiner EM, et al. Erythroid progenitor renewal versus differentiation: genetic evidence for cell autonomous, essential functions of EpoR, Stat5 and the GR. Oncogene. 2006;25:2890–2900. 40. Hoffman B, Amanullah A, Shafarenko M, Liebermann DA. The protooncogene c-myc in hematopoietic development and leukemogenesis. Oncogene. 2002;21:3414–3421.

41. Castro-Malaspina H, Gay RE, Resnick G, et al. Characterization of human bone marrow fibroblast colony-forming cells (CFU-F) and their progeny. Blood. 1980;56:289–301. 42. Ebihara Y, Masuya M, Larue AC, et al. Hematopoietic origins of fibroblasts: II. In vitro studies of fibroblasts, CFU-F, and fibrocytes. Exp Hematol. 2006;34:219–229. 43. Perkins S, Fleischman RA. Stromal cell progeny of murine bone marrow fibroblast colony-forming units are clonal endothelial-like cells that express collagen IV and laminin. Blood. 1990;75:620–625.