Regulation of the catalytic behavior of pullulanases chelated onto nickel (II)-modified magnetic nanoparticles

Accepted Manuscript Title: Regulation of the catalytic behavior of pullulanases chelated onto nickel (II)-modified magnetic nanoparticles Authors: Jianfeng Wang, Zhongmei Liu, Zhemin Zhou PII: DOI: Reference:

S0141-0229(17)30035-2 http://dx.doi.org/doi:10.1016/j.enzmictec.2017.02.009 EMT 9048

To appear in:

Enzyme and Microbial Technology

Received date: Revised date: Accepted date:

29-7-2016 13-2-2017 17-2-2017

Please cite this article as: Wang Jianfeng, Liu Zhongmei, Zhou Zhemin.Regulation of the catalytic behavior of pullulanases chelated onto nickel (II)-modified magnetic nanoparticles.Enzyme and Microbial Technology http://dx.doi.org/10.1016/j.enzmictec.2017.02.009 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Regulation of the catalytic behavior of pullulanases chelated onto nickel (II) -modified magnetic nanoparticles

Jianfeng Wang1,2, Zhongmei Liu1, Zhemin Zhou1*

1.

Key Laboratory of Industrial Biotechnology, Ministry of Education, Jiangnan

University, Wuxi 214122, China 2.

Faculty of Biology, East China University of Technology, Nanchang 330013,

China

*Corresponding authors: Zhemin Zhou, Tel.: +86-510-85197551, Fax: +86-510-85197551, E-mail: [email protected].

1

Highlights 

The His6-tagged pullulanase was immobilized on Ni (II)-modified MNPs.



The catalytic properties of the immobilized pullulanases was mainly dependent on the orientation of pullulanase



The reusability of immobilized pullulanases was independent from other catalytic properties.



Fe3O4@PEI-BDDE-PEA400-IDA-Ni+2/H6-PUL retained 60% of initial activity after 18 consecutive cycles with a total reaction time of 9 h.

Abstract Chelating of pullulanases onto nickel (II) -modified magnetic nanoparticles results in one-step purification and immobilization of pullulanase, and facilitates the commercial application of pullulanase in industrial scale. To improve the catalytic behavior, especially the operational stability, of the nanocatalyst

in

consecutive

batch

reactions,

we

prepared

various

iminodiacetic acid-modified magnetic nanoparticles differed in surface polarity and spacer length, on which the His6-tagged pullulanases were chelated via nickel ions, and then studied the correlation between the MNPs surface property and the corresponding catalyst behavior. When pullulanases were chelated onto the surface-modified MNPs, the thermostability of all pullulanase derivatives were lower than that of free counterpart, being not relevant to the protein orientation guided by the locality of the His6-tag, but related to the MNPs basal surface polarity and the grafted spacer length. After chelating of pullulanases onto MNPs, there were changes observed in the pH-activity profile and the apparent Michaelis constant toward pullulan. The changing tendencies were mainly dependent on the His6-tagged pullulanase orientation, and the changing extents were tuned by the spacer length. The reusability of 2

pullulanase immobilized by N-terminal His6-tag was higher than that of pullulanase immobilized by C-terminal His6-tag. Moreover, the reusability of the immobilized pullulanase tested increased till grafting polyether amine-400 as spacer-arm, therefore the N-terminal His6-tagged pullulanase chelating MNPs grafted polyether amine-400 gave the best reusability, which retained 60% of initial activity after 18 consecutive cycles with a total reaction time of 9 h. Additionally, the correlation analysis of the catalyst behaviors indicated that the reusability was independent from other catalytic properties such as thermostability and substrate affinity. All the results revealed that the catalyst behavior can be mainly controlled by the His6-tagged pullulanase orientation than by the MNPs surface property which can tune the catalyst function.

Keywords: His6-tag, Immobilized metal ions affinity, Polyether amine, Pullulanase, Reusability.

1. Introduction Pullulanase(EC 3.2.1.41), an important debranching enzyme, has been widely utilized to hydrolyse the α -1,6 glucosidic linkages in starch, amylopectin, pullulan, and related oligosaccharides, which enables a complete and efficient conversion of the branched polysaccharides into small fermentable sugars during saccharification process. The use of pullulanase has recently been the subject of increased applications in starch-based industries especially those aimed for glucose production [1]. However, the commercial applications of pullulanase were restricted by the disadvantages of easy deactivation at higher temperatures [2], recovery and reusability of free enzymes as catalysts, and product contamination [3]. Immobilization of enzymes is advantageous for commercial application due to convenience in handling, ease of separation, reuse and possible improvement of thermal and pH stability [4], and also offers some other operational advantages over free enzymes, such as choice of 3

batch or continuous process, rapid termination of reactions, controlled product formation, and adaptability to a variety of engineering designs [5]. Therefore, great efforts have been focused on the production of a wide variety of immobilized pullulanases. After immobilization of pullulanases by either combi-cross linked enzyme aggregates (CLEAs) [6] or linking covalently on Duolite XAD761[3, 5], alginate[7], agar gel[8], agarose and casein[9], magnetic chitosan beads [10, 11, 12, 13] , and mesoporous silica[14], the pullulanase derivatives showed significant improvement in the thermal and operational stabilities, but the decreased affinity to substrates [10, 14]. However, the reusability of the supports is limited by the covalent linkages between pullulanases and supports, and thus purification of pullulanases becomes necessary to enhance the immobilization yield of target enzymes, which increases the cost of covalent immobilization of pullulanases. Affinity immobilization of enzymes allows the purification and immobilization of enzymes in the one-step mode, and makes the carrier for immobilization reusable. His-tagged Thermomyces lanuginosus lipase was immobilized via affinity by direct treatment of iron oxide magnetic nanoparticles, which contained long-armed nickel-nitrilotriacetic acid surface groups with the cell culture supernatant of Pichia pastoris (h-TLL). This immobilization of lipase gave high enzyme loading efficiency, specific enzyme loading and activity, and excellent recyclability. The magnetic nanoparticles were easily regenerated from the recycled biocatalyst and reusable for enzyme immobilization [15]. Fe3O4 @SiO2 -poly(ethylene oxide)-maltose nanoparticles used as affinity adsorption carriers directly separate maltose binding protein-fused Hep I from a crude enzyme solution in a magnetic field, and the resulting immobilized Hep I exhibited significantly improved stability and reasonable reusability during enzymatic hydrolysis of macromolecular heparins to low molecular weight heparins [16]. Thus, affinity immobilization of enzymes on magnetic nanoparticles is not only cost-effective but also appropriate for heterogeneous reaction systems and hydrolysis of macromolecules with high-viscosity, and 4

then could be applied for immobilization of pullulanases to hydrolyze pullulan and starchy polysaccharides on industrial scale. But, as the best of our knowledge, there is no report on affinity immobilization of pullulanases. Besides methods for immobilization of enzymes, the catalytic properties of immobilized enzymes are also affected by the orientation of immobilized protein [17] and the crosslinkers between enzymes and supports. [18] Giving mentioned

above,

to

obtain

excellent

performance

of

recombinant

Anoxybacillus sp. WB42 pullulanases (rPulWB42) immobilized on magnetic nanoparticles (MNPs) with nickel-iminodiacetic acid surface groups, we studied the effect of the crosslinking agents and protein orientation at surfaces of MNPs on the catalytic properties of immobilized pullulanases, and developed a simple and efficient method for immobilization of pullulanases with high reusability. 2. Materials and methods 2.1. Materials Pullulan were obtained from Sigma–Aldrich Chemical Co. Polyetheramines (PEA)

were

purchased

from

Huntsman

Corporation.

Branched

polyethylenimines (PEI, average Mw～55,000) were purchased from Gobekie New Materials Science Technology Co.,Ltd (Shanghai, China). FeCl3·6H2O, FeSO4·7H2O, NH3·H2O and ethanol were of analytical grade from Sinopharm Chemical Reagent Co., Ltd (Shanghai, China). Epichlorohydrin (ECH), 1,4 butanediol diglycidyl ether (BDDE), Tetrabutylammonium hydrogen sulfate (TABS), and other chemicals were of chemical grade and available from commercial sources. Anoxybacillus sp.WB42 (CICIM B6902) was isolated from a sample of apple pomace from an apple juice processing plant in Meixian county of Shaanxi Province in China. The nucleotide sequence of pulWB42 (Anoxybacillus sp. WB42 pullulanases) have been submitted to GenBank under the accession number KX576675. Plasmid pHsh was graciously provided by Professor Weilan Shao, Biofuels Institute of Jiangsu University, China. 5

2.2. Preparation and functionalization of iron oxide MNPs Preparation of superparamagnetic nanoparticles coated with pullulan or PEI (Fe3O4@pul or Fe3O4@PEI ) was done as previously described [19, 20]. In brief, a quantity of 1.2 g of high polymers (pullulan or PEI) was dissolved with ultrasound in 200 ml distilled water. FeCl3·6H2O (1.49 g) and FeSO4·7H2O (0.78 g) were added into the solution. An ammonia–water solution (8 M) was added dropwise and a suspension was obtained. The pH of the final mixture was controlled in the range of 10–11. The mixtures were held at 25 oC for 12 h and the suspension was then centrifuged at 12,000 rpm for 15 min. The settled MNPs was washed three times with distilled water to remove by-products and excess polymers. The resulting Fe3O4@pul or Fe3O4@PEI were then washed twice with distilled water and then with ethanol. Grafting PEA onto Fe3O4@PEI with a modified Tongbao Liu’s method [21] was done as follows: the mixture of 8.0 g of humid Fe3O4@PEI, 5.0 g NaCO3, and 200 mg TABS was dispersed in 100 ml distilled water, and mixed with 50 mL BDDE via ultrasonic treatment, following incubation with constant stirring for 24 h at 50 °C to form Fe3O4@PEI-BDDE suspension. The Fe3O4@PEI-BDDE was purified by magnetic separation and washing with ethanol. The formation of Fe3O4@PEI-BDDE-PEA was completed with the protocol described above, in which 8 g PEA were substituted for BDDE. The Fe3O4@PEI-BDDE-PEA-IDA was prepared as previously described [22].Ten milligrams of humid Fe3O4@PEI-BDDE-PEA-IDA were dispersed by ultrasound into the mixture of 2 ml ethanol and 6 ml modifiers composed of 0.23 M ClCH2COONa and 0.23 M NaHCO3, and then incubated at 60 °C for 8 h, following magnetic separation and washing with distilled water. With running this protocol, the Fe3O4@PEI-IDA was produced. Fe3O4@pul-BDDE-IDA

and

Fe3O4@PEI-BDDE-PEG6000-ECH-IDA

were

prepared as the modified method described by Zhang Songping et al [23]. In brief, one gram of humid Fe3O4@pul, 60mg NaOH, and 5 ml BDDE were dispersed in 45 ml DMSO. After incubation under agitation for 12 h at 58 °C, 6

the generated Fe3O4@pul-BDDE was magnetically separated and washed with ethanol to remove the residual BDDE. This protocol was repeated to produce

Fe3O4@PEI-BDDE-PEG6000

with

one

gram

of

humid

Fe3O4@PEI-BDDE dispersed in the 50 ml DMSO solution consisted of 1mmol PEG6000 and 60mg NaOH. The purified Fe3O4@PEI-BDDE-PEG6000 was added to the dispersion of 500 mg NaOH, 50 mg TABS and 30 ml ECH. After incubation with stirring for 2 h at 58 °C and magnetic purification, the resulting Fe3O4@PEI-BDDE-PEG6000-ECH was mixed via ultrasound with the solution containing 1.0 M IDA, 2.0 M Na2CO3, and 0.04 M NaBH4, and reacted under agitation

for

24

h

at

60

°C.

By

running

this

procedure,

the

Fe3O4@pul-BDDE-IDA was produced with Fe3O4@pul-BDDE. For chelating nickel ions of Imido-acetic acid-type MNPs, these MNPs were dispersed by ultrasound into 1M NiSO4 solution, and incubated under agitation for 1 h at 25 °C, following magnetic separation and washing with distilled water. 2.3 Preparation and immobilization of His6-tagged pullulanase Using

the

oligonucleotides

5

–

CCGTCGACAAGAAGGAGATATACCCATGCATCATCATCATCATCATCTAA CGGTTCATCGGACGTTTGAAGC-3

and

5

–

GCGGCCTTCCCAAGCTTATTACTAAGTCAGTCCTTTCACAAGCACGAC-3 as forward and reverse primers, we generated the plasmid pHsh-his6-pul according to MEGAWHOP protocol described by Kentaro Miyazaki [24] and then expressed the recombinant H6-PUL in E. coli JM109 by Wu Huawei's method [25] After 10h of induction, cells were harvested by centrifugation, and lysed by pulsed ultrasonication in an ice-water bath. The modified MNPs were dispersed into the lysates, and incubated with stirring for 1 h at room temperature, following magnetic separation and washing with 100 mM sodium acetate buffer (pH 5.5). 2.4 Enzyme assays 7

The enzyme activity was determined by quantitating reducing sugars released from enzyme–substrate reaction, and the amounts of reducing sugars were determined by the 3,5-dinitrosalicylic acid method [26]. One unit of enzyme is defined as the amount of the enzyme that liberates one μmol of reducing sugars as glucose per minute under the assay conditions. 2.5 Biochemical characterization of the immobilized pullulanase The effects of pH and temperature on enzyme activity were determined by measurement of the enzyme activity of Pul at pHs ranging from 4.5 to 7.5 in 50 mM citric acid ‒ Na2HPO4 buffer as well as at temperatures ranging from 20 to 80 °C. The thermal stability of immobilized enzyme was determined by measuring the residual enzyme activity after a 30-min incubation of the enzyme at different temperatures, and expressed as the temperature (T 5030) at which 50% of enzyme activity is lost following a heat treatment for 30 min. The Km value of immobilized Pul on pullulan was determined in 50 mM citric acid ‒ Na2HPO4 buffer (pH 5.5-5.8) containing 3.0 to 48.0 mg/ml pullulan at 60 °C for 10 min. The experiments were done independently in triplicate, and the data were fitted to the Michaelis-Menten equation by nonlinear regression in GraphPad Prism 5.0. 2.6 Operational stability measurement Immobilized pullulanase was added to 50 mM sodium acetate buffer containing 60 g/l pullulan and incubated under shaking for 30 min at 60 oC. After the completion of each batch, immobilized catalyst was recovered, washed thoroughly with 50 mM sodium acetate buffer and recycled for a new conversion run. Spent broth from each cycle was analyzed for reducing sugars, and the residual activity was defined as the ratio of the quantity of reducing sugars from this run to the amount of reducing sugars from first run which was set to 100%. The reusability of catalyst is expressed as the catalyst half-life defined as the number of recycles for the catalyst retained 50% of the initial activity in catalytic cycles. 2.7 Statistical analysis 8

Experiments were conducted in triplicates and the mean values were calculated. One-way analysis of variance (ANOVA) and pairwise multiple comparison procedures (Duncan’s test) were made by the statistical software DPS, version 7.05 [27]. Values are expressed as the mean ± SEM. The level of significance was set at 0.05. 3. Results and discussion 3.1 The basal surface polarity of MNPs affects the catalytic properties of pullulanases chelated onto nickel (II) -modified MNPs To obtain the high performance of the immobilized pullulanase with C-terminal His6-tag

(PUL-H6),

Fe3O4@PEI-IAA-Ni+2,

we

prepared

three

core-shell

structured

Fe3O4@PEI-BDDE-IDA-Ni+2

MNPs, and

Fe3O4@pul-BDDE-IDA-Ni+2, in which polymers (PEI, pullulan) coating Fe3O4-corn act as the basal surface. According to the previous study [19, 20] on the structure of MNPs prepared as we done, there are differences in the spacer arm and the polarity of basal surface coated on the Fe 3O4 among these MNPs. Comparing with Fe3O4@pul-BDDE-IDA-Ni+2, Fe3O4@PEI derivatives have stronger polarity of basal surface due to the protonation of amidogens distributing widely in PEI molecules. For Fe3O4@PEI-BDDE-IDA-Ni+2, the difunctional agent BDDE acted as linker and then will reduce the electrostatic interaction between pullulanases and the positive charges on the MNPs basal surface. As shown in Fig. 1a, the pH-activity profiles of pullulanases immobilized on PEI-coated MNPs shifted to acidic side compared to that of free counterpart, and the shift extent decrease as the length of spacer arm (BDDE) increased in consistent with the case reported by A.De Maio, et al [28]. On the other hand, when pullulanases were immobilized on pullulan-coated MNPs, its pH-activity profile shifted faintly to alkaline side. Therefore, the polarity of the MNPs basal surface affected the pH dependencies of the immobilized pullulanases activity, and the polarity strength was positively correlated with the extent of pH-shift. These effects of the surface polarity were mainly attributed to the hydrogen ion 9

gradient from the bulk solution to the PEI-protonated surface of MNPs, from which the hydrogen ions were driven away [29, 30]. It can be seen in Fig. 1b that the relative activities of immobilized pullulanases under lower temperature were not higher than that of free counterpart, except that of Fe3O4@PEI-IAA-Ni-PUL, however, the immobilized pullulanases activities were enhanced when the reaction temperature rose to 70 oC, suggesting that pullulanases could be activated via the interfacial interactions between protein and MNPs, and the strong polarity of PEI-coated surface is favorable for activation at lower temperature, but the weak polar pullulan-coated surface enhanced catalytic activity at 70 oC. As reported previously,[ 16, 31, 32] the thermostability of enzymes is usually improved via single-point or multipoint attachment of enzymes to nanoparticles. To evaluate the heat resistance of the immobilized pullulanases, we examined the residual activity of the immobilized pullulanases after incubation for 30 min at a temperature gradient. The results (Fig. 1c) showed exceptionally that the thermal stability of pullulanases after immobilization on MNPs was reduced compared to that of free counterpart and decreased with the increase in polarity strength of the MNPs surface. The decreased thermostability of immobilized enzymes was also observed in lipase immobilized on carbon nanomaterials which brought the specific structural changes upon enzyme molecules [33]. As seen from Fig. 1d, the apparent Km values to pullulan had no significant change after immobilization of pullulanases onto PEI-coated MNPs, while the apparent Km value of pullulanses immobilized on pullulan-coated MNPs increased by 42% compared with that of Fe3O4@PEI-BDDE-IDA-Ni-PUL, which is mainly due to the competitive inhibition of pullulan coated on Fe3O4-core as shell. These observations indicated that the polarity of basal surface on MNPs has no significant influence on the substrate accessibility of pullulanases chelated onto Ni2+-MNPs. 10

For industrial application, the reusability of biocatalyst is the main goal for immobilization of enzymes, and immobilizing enzyme on MNPs would facilitate reusability for easy separation by magnetic field. The reusability of catalyst is expressed as the number of recycles for the catalytic activity retained 50% of the initial activity in catalytic cycles. Fig. 2d demonstrated that the strength of the polarity of basal surface on MNPs was negatively correlated with the reusability of the immobilized pullulanases, and changed the decay mode of the immobilized pullulanases activity with catalyst recycles. The residual activity of Fe3O4@PEI-IAA-Ni-PUL decreased fast followed by slowly, while the activity of Fe3O4@PEI-BDDE-IDA-Ni-PUL reduced slowly first and fast afterwards. However, the activity of Fe3O4@pul-BDDE-IDA-Ni-PUL diminished linearly at a lower rate, this decay pattern may be caused by that the active conformation of immobilized pullulanases was stabilized via the binding of pullulanase to pullulans on the Fe3O4-corn. In view of these results, the catalytic properties of the immobilized pullulanases were significantly affected by the polarity of the basal surface on MNPs, which could be tuned by tailoring of both the spacer arm and the basal surface. Moreover, the better performance of pullulanase was achieved through being adsorbed onto the weak polar surface.

3.2 The protein orientation impacts the catalytic properties of the immobilized pullulanases Given the impacting on catalyst performance of the orientation of enzymes immobilized on the carrier surface [17, 34] as well as the decreased thermal stability of pullulanase immobilized on MNPs via its C-terminal His6-tag (Fig. 1c), in order to improve the catalytic performance of pullulanases chelated onto Ni(II)-modified MNPs , we prepared the N-terminal His6-tagged pullulanase (H6-PUL) , and then chelated it to the Ni (II) surface site in opposite direction compared to the C-terminal His6-tagged pullulanase (PUL-H6). The catalytic properties of H6-PUL were different from that of 11

PUL-H6 (Fig. 2), including the lower pH optimum (pH 5.5) (Fig. 2a), the higher temperature optimum (70 oC ) (Fig. 2b), the decreased thermal stability (T5030 = 69.3 oC) (Fig. 2c), and a Km value of 12.9 ± 1.1 mg/mL versus 10.4 ± 0.9 mg/mL for PUL-H6, but the catalytic efficiencies (kcat/Km) were equal. These results demonstrated that the locality of His6-tag played a critical role in the catalytic performance of pullulanase, which may be attribute to changes in enzyme conformation triggered by hexahistidine , furthermore suggesting that the N-termini of pullulanase had a more important role in the conformational adjustment than the C-termini. It can be seen in Fig. 2a that the pH-activity of H6-PUL immobilized on Fe3O4@PEI-BDDE-IDA-Ni+2 was shifted to alkaline pH, which is opposite to that of the PUL-H6 derivative, but its pH optimum was not changed distinctly comparing to that of free H6-PUL. So it can be supposed that the pH dependence of pullulanase activity after immobilization was attributed not only to the partitioning effect of the interface between protein and support [30] but also to the changes in active conformation of immobilized enzymes driven by the interface interactions. As the result of the changed active conformation of H6-PUL, which was adsorbed on Fe3O4@PEI-BDDE-IDA-Ni+2, the immobilized H6-PUL showed the similar temperature dependency of activity to free counterpart (Fig. 2b), gave the equal thermostability (Fig. 2c) compared with free H6-PUL, and exhibited the increased reusability (Fig. 2d) with a catalyst half-life of 12 cycles than that of 8 cycles for the PUL-H6 immobilized on the same MNPs. Thus, the N-terminal His-tag fused into pullulanase is in favor of improving the catalytic performance of pullulanase chelated Ni (II)–coated MNPs, proving that the immobilized protein orientation has a significant effect on catalyst performance [17, 35]. With immobilization of H6-PUL on Fe3O4@PEI-IAA-Ni+2, the resulting nano-biocatalyst exhibited a lower thermostability (Fig. 2c) and a significantly decreased

avidity

for

pullulans

(Fig.

3d)

compared

to

Fe3O4@PEI-BDDE-IDA-Ni+2/H6-PUL, suggesting that the longer distance 12

between the N-termini of pullulanase and the MNPs surface could improve the thermostability and the avidity for pullulans of immobilized pullulanase. In addition, Fe3O4@PEI-BDDE-IDA-Ni+2/H6-PUL retained about 100% of its initial activity

after

being

operated

for

6

successive

batches,

but

Fe3O4@pul-BDDE-IDA-Ni+2/PUL-H6 retained only 75% (Fig. 2d), indicating the complex nature of factors impacting the catalytic performance of the immobilized enzymes.

3.3 Improving the reusability of immobilized pullulanases When enzymes immobilized onto the support surface via crosslinking, the catalytic behavior of the resultant complex was mainly dependent not only on enzyme orientation [35] but also on the coupling property involved with the crosslinking agent [18] and the spacer-arm length [36,13,16, 28, 37]. To optimize the catalytic performance of pullulanases immobilized on MNPs via His-Ni(II) interactions, we prepared a series of PEA-grafted MNPs with different spacer arm length, to which the His-tagged pullulanases (H6-PUL and PUL-H6) were attached, respectively. As mentioned above (Fig. 1a), when PUL-H6 chelated onto the PEI-coated MNPs, its pH optimum shifted to acidic pH side compared to free counterpart, and the pH-shift extent reduced as the spacer-arm was elongated, resulting from the protonation of PEI. This observation was confirmed by the results that the pH optimum of PUL-H6 immobilized onto MNPs grafted with BDDE-PEA400 or BDDE-PEG6000-ECH was equal to that of free enzyme (Fig. 3a).

It's

also

worth

noting

that

the

relative

activity

of

Fe3O4@PEI-BDDE-PEA400-IDA-Ni+2/PUL-H6 was higher than that of free PUL-H6 at the pH range of 6.5 to 7.0, indicating that the pH-activity profile shifted faintly to the alkaline pH side due in part to the conformational changes in the immobilized PUL-H6 caused by the interface interactions between protein and MNPs. This speculation was supported by the pH-shift in pH-activity profile for H6-PUL chelated onto PEI-coated MNPs with different 13

length spacers (Fig. 3b), as opposed to the immobilized PUL-H6, the pH profile shifted toward alkaline pH side, and the spacer-arm length elongated to BDDE-PEG6000-ECH, the pH-shift did not happen obviously. Fig. 3c showed that the thermostability of pullulanases decreased to varying degrees after immobilization of enzymes on MNPs with spacer-arm of different lengths, and the extent of this decrease was dependent both on the protein orientation and on the spacer-arm length. As H6-PUL was chelated onto MNPs via N-terminal His6-tag, its thermostability reached the highest T5030 value of 69.2 oC when BDDE acted as linker, but for the derivative of PUL-H6 chelated on the same MNPs, its T5030 value decreased to 65.2 oC. For the immobilized PUL-H6, Fe3O4@PEI-BDDE-PEA400-IDA-Ni+2/PUL-H6 showed the highest thermostability with T5030 value of 69.6 oC, while Fe3O4@PEI-IAA-Ni+2/PUL-H6 maintained the lowest thermostability with a T 5030 value of 63.8 oC. When BDDE-PEG6000-ECH used as the longest spacer-arm, the immobilized pullulanases (PUL-H6, H6-PUL) had the reduced T5030 values of 64.0 oC regardless of the location of His6-tag that guided the protein orientation. The decrease in thermostability of immobilized enzymes with the increase of the linker

length

was

also

observed

in

MBP-Hep

I

immobilized

on

Fe3O4@SiO2-PEO-mal, which presumably became more flexible as the length of the PEO linker increased, furthermore caused the unfolding of the immobilized enzyme molecules [16]. As shown in Fig. 3d, the apparent Km values of the immobilized pullulanases for pullulan varied with the spacer-arm length and the protein orientation. For the immobilized PUL-H6, the apparent Km values increased monotonically as the spacer-arm lengthened from PEI-BDDE to PEI-BDDE-PEG6000-ECH, while there was no significant difference in Km values as the spacer changed from PEI to PEI-BDDE. While for the immobilized H6-PUL, the apparent Km values

decreased

as

the

spacer-arm

lengthened

from

PEI

to

PEI-BDDE-PEA400, however, the spacer-arm was elongated further to PEI-BDDE-PEG6000, the apparent Km values increased by 1.4-fold compared 14

with free counterpart. This result suggested that the orientation of the pullulan-binding site of the immobilized pullulanase was tuned synergistically by the protein orientation and the spacer-arm length, and its optimized affinity to pullulans needed appropriate length of spacer-arm but not the longest spacer-arm that makes the immobilized enzyme to have something similar to the soluble enzyme as expected [28, 38]. In the view of practical application, nanocatalysts with much reduced affinity to pullulans are not suitable to apply in industry scale, and then both Fe3O4@PEI-IAA-Ni+2/H6-PUL

and

Fe3O4@PEI-BDDE-PEG6000-ECH-IDA-Ni+2/PUL-H6 are not discussed in the following experiments. Other immobilized pullulanases were further used to evaluate their reusability at the temperature of 60 oC and the optimal pH. The results (Fig. 3e) demonstrated that the reusability of immobilized pullulanases depended largely on the locality of His6-tag, and N-terminal His6-tag was superior to C-terminal His6-tag for enhancement of reusability. As the spacer-arm elongated from BDDE to BDDE-PEA400, the reusability of immobilized H6-PUL increased to maximum with the retained activity of 60% after 18 consecutive cycles, while the spacer lengthened further the reusability decreased. As for the immobilized PUL-H6, its reusability was enhanced monotonically with the increase in the spacer-arm length, but was lower than that of Fe3O4@PEI-BDDE-IDA-Ni+2/H6-PUL. This result suggested that the reusability of the immobilized pullulanases could be improved significantly by optimizing the enzyme orientation and the spacer-arm length. Thus, the H6-PUL chelating Fe3O4@PEI-BDDE-PEA400-IDA-Ni+2 via N-terminal His-tag gave a reusability of hydrolyzing pullulan equivalent to that of the pullulanase cross-linking magnetic chitosan beads with glutaraldehyde [10], while more excellent than the immobilized pullulanases reported previously (Table 1) [6, 11, 12, 13]. The observed high reusability of the immobilized pullulanases is partially due to the easy and almost full recovery of the MNPs. Another reason is the strong affinity of enzyme to MNPs, giving no detectable pullulanase 15

leakage during recycling experiments in consistent with the results observed by Vahidi A K, et al [15]. It was noteworthy that the reusability of the immobilized H6-PUL was positively correlated with its affinity to pullulans whereas the immobilized PUL-H6 showed a positive correlation between the reusability and its thermostability. However, without regard to the protein orientation, the reusability for the immobilized pullulanases showed no correlation with the thermostability and substrate affinity of the catalyst. This observation is consistent with the case reported by Jie Long et al [13], where the reusability of pullulanase immobilized onto

Fe3O4–κ-carrageenan

nanoparticles

is

not

correlated

with

its

thermostablity, activity recovery, and affinity of enzyme to support [13] relating to the leaching of enzyme caused by repeated use [32]. Therefore, the reusability of catalyst, which represents the operational stability of the immobilized enzymes in consecutive batch reactions, might be caused by the resistance of the immobilized enzymes to fluid shear stress in reaction system. Analogously, Landarani-Isfahani A et al proposed that the recurrent encountering of substrate with the active site of immobilized enzyme causes its distortion and the loss of activity [32]. Considering that the interface interactions between enzymes and supports could induce conformational changes and further affect the catalytic behavior of enzymes [33] , we optimized the interactions to maintain the active conformation of pullulanases immobilized on MNPs, further improved the resistance of catalyst to fluid shear, and then the operational stability was enhanced as the H6-PUL immobilized onto Fe3O4@PEI-BDDE-PEA400-IDA-Ni+2 . 4 Conclusions In this study, we systematically discussed the catalytic behavior of pullulanases chelating Ni (II)-modified MNPs via His6-tag, and the results showed that the catalytic properties strongly affected by the specific interface interactions involved in the pullulanase orientation and the surface properties of MNPs, which could lead to significant conformational changes in proteins. 16

Compared to PEI-coated MNPs, BDDE-PEI-MNPs with the weak polar surface were more applicable to immobilize pullulanases. Moreover, the better performance of pullulanase was achieved by using BDDE-pullulan-MNPs as supports, which had a weaker polar surface, suggesting that the elongation of spacer not only reduced the polarity of basal surface of MNPs but also enhanced the flexibility of spacer. With the elongation of spacer-arm grafted onto MNPs, the catalytic properties of the immobilized pullulanases altered, however, tendencies of changes in the apparent Michaelis-Menten constant, pH-activity profile, thermostability, and reusability of catalyst were mostly dependent on the pullulanase orientation, especially, the N-terminal His6-tagged pullulanases have higher reusability than the C-terminal His6-tagged pullulanases regardless of the spacer length. When the recombinant pullulanases chelated onto Ni (II)-modified MNPs, their orientation was guided by the terminal His6-tag, furthermore determined the amino acid residues of pullulanase interacting with the functional groups at the surface of MNPs, and then induced corresponding conformational changes in the immobilized pullulanase. The reusability of enzymes immobilized by nickel affinity was independent from other catalytic properties, such as thermostability and substrate affinity, and was optimized by altering the location of His-tag and modifying the surface of MNPs,

suggesting that

this immobilization

approach

provides great

opportunities to break the limitation of the commercial implementation of other immobilized polysaccharide hydrolases.

Conflict of interests Authors declare no conflict of interest.

Acknowledgements Authors thank Professor Weilan Shao, Biofuels Institute of Jiangsu University, China for the research facilities 17

Author agreement Jianfeng Wang conceived and designed the work that led to the submission. Zhemin Zhou contributed significantly to analysis and manuscript preparation. Zhongmei Liu helped perform the analysis with constructive discussions.

We state that all the authors have no conflicts of interests, and all authors concur with the submission and that the material submitted for publication has not been previously reported.

Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

References [1] S.L. Hii, J.S. Tan, T.C. Ling, A.B. Ariff, Pullulanase: role in starch hydrolysis and potential industrial applications, Enzyme Res. (2012) 921362. [2] R.S. Singh, G.K. Saini, J.F. Kennedy, Maltotriose syrup preparation from pullulan using pullulanase, Carbohydr. Polym. 80((2010) 401-407. [3] R.S. Singh, G.K. Saini, J.F. Kennedy, Continuous hydrolysis of pullulan using covalently immobilized pullulanase in a packed bed reactor, Carbohydr. Polym. 83(2011) 672–675. [4] S.A. Ansari, Q. Husain, Potential applications of enzymes immobilized on/in nano materials: A review, Biotechnol. Adv. 30(2012) 512-523. [5] R.S. Singh, G.K. Saini, J.F. Kennedy, Covalent immobilization and thermodynamic characterization of pullulanase for the hydrolysis of pullulan in batch system, Carbohydr. Polym. 81 (2010) 252-259. [6] S. Talekar, S. Desai, M. Pillai, N. Nagavekar, S. Ambarkar, S. Surnis, M. Ladole, S. Nadara, M. Mullaa, Carrier free co-immobilization of glucoamylase 18

and pullulanase as combi-cross linked enzyme aggregates (combi-CLEAs), RSC Adv.3 (2013) 2265-2271. [7] G. Ali, V. Dulong, S.N. Gasmi, C. Rihouey, L. Picton, D. Le Cerf, Covalent immobilization of pullulanase on alginate and study of its hydrolysis of pullulan, Biotechnol. Prog. 31 (2015) 883-889. [8] T. Kuroiwa, H. Shoda, S. Ichikawa, S. Sato, S. Mukataka, Immobilization and stabilization of pullulanase from Klebsiella pneumoniae by a multipoint attachment method using activated agar gel supports, Process Biochem. 40 (2005) 2637-2642. [9] A.M. Dessouki, G.I. Issa, K.S. Atia, Pullulanase immobilization on natural and synthetic polymers, J. Chem. Technol. Biotechnol. 76 (2001)700-706. [10] L. Zhang, X. Zhu, S. Zheng, H. Sun, Photochemical preparation of magnetic chitosan beads for immobilization of pullulanase, Biochem. Eng. J. 46 (2009) 83-87. [11] J. Long, A. Jiao, B. Wei, Z. Wu, Y. Zhang, X. Xu, Z. Jin, A novel method for pullulanase

immobilized

onto

magnetic

chitosan/Fe3O4

composite

nanoparticles by in situ preparation and evaluation of the enzyme stability, J. Mol. Catal. B Enzym. 109 (2014) 53-61. [12] J. Long, X. Li, Z. Wu, E. Xu, X. Xu, Z. Jin, A. Jiao, Immobilization of pullulanase onto activated magnetic chitosan/Fe3O4 nanoparticles prepared by in situ mineralization and effect of surface functional groups on the stability, Colloids Surf. A. Physicochem. Eng. Asp. 472 (2015) 69-77. [13] J. Long, E. Xu, X. Li, Z. Wu, F. Wang, X. Xu, Z.Y. Jin, A. Jiao, X. Zhan, Effect of chitosan molecular weight on the formation of chitosan– pullulanase soluble complexes and their application in the immobilization of pullulanase onto Fe3O4–κ-carrageenan nanoparticles, Food Chem. 202 (2016) 49-58. [14] R. George, S. Sugunan, Kinetic and thermodynamic parameters of immobilized glucoamylase on different mesoporous silica for starch hydrolysis: A comparative study, J. Mol. Catal. B Enzym. 106 (2014) 81-89. 19

[15] A.K. Vahidi, Y. Yang, T.P.Ngo, Z. Li, Simple and efficient immobilization of extracellular His-tagged enzyme directly from cell culture supernatant as active and recyclable nanobiocatalyst: high-performance production of biodiesel from waste grease, ACS Catal. 5 (2015) 3157-3161. [16] J. Wu, L. Zhou, H. Zhang, J. Guo, X. Mei, C. Zhang, J.Y. Yuan, X.H. Xing, Direct affinity immobilization of recombinant heparinase I fused to maltose binding protein on maltose-coated magnetic nanoparticles, Biochem. Eng. J. 90 (2014) 170-177. [17] T. Cha, A. Guo, X.Y. Zhu, Enzymatic activity on a chip: the critical role of protein orientation, Proteomics 5 (2005) 416-419. [18] N. Aissaoui, J. Landoulsi, L. Bergaoui, S. Boujday, J.F. Lambert, Catalytic activity and thermostability of enzymes immobilized on silanized surface: Influence of the crosslinking agent, Enzyme Microb. Technol. 52 (2013) 336-343. [19] R.Y. Mo, G.Z. Wang, preparation of supermagnetic dextran-coated iron oxide nanoparticles and using for h-22 cells magnetic labeling, Acta Biophysica Sinica 6 (2008) 009. [20] P. R. Chang, J. Yu, X. Ma, D. P. Anderson, Polysaccharides as stabilizers for the synthesis of magnetic nanoparticles, Carbohydr. Polym. 83 (2011) 640-644. [21] T.B. Liu, M.X. Yu, H.T. Zhu, Reaction of amines with epichlorohydrin, Thermosetting Resin 3 (1993) 003. [22] Y.B. Li, B.J. Gao, R.K. Du. Chelating adsorption behavior of imido-acetic acid-type composite chelating adsorption material IAA-PEI/SiO2 for heavy metal ions, Chin. J. Process Eng. 11 (2011) 221-226. [23] S.P. Zhang, R. Ding, Z.G. Su, P. Wang, Activation of sepharose with epichlorohydrin in water-free system for preparation of high capacity immobilized metal ion affinity adsorbent, Chin. J. Process Eng.10 (2010) 971-975. 20

[24] K. Miyazaki, MEGAWHOP cloning: a method of creating random mutagenesis libraries via megaprimer PCR of whole plasmids, Methods Enzymol. 498 (2011) 399-406. [25] H. Wu, J. Pei, Y. Jiang, X. Song, W.L. Shao, pHsh vectors, a novel expression system of Escherichia coli for the large-scale production of recombinant enzymes, Biotechnol. Lett. 32 (2010) 795-801. [26] M.J. Bailey, A note on the use of dinitrosalicylic acid for determining the products of enzymatic reactions, Appl. Microbiol. Biotechnol. 29 (1988) 494-496. [27] Q.Y. Tang, C.X. Zhang, Data Processing System (DPS) software with experimental design, statistical analysis and data mining developed for use in entomological research, Insect Sci. 20 (2013) 254-260. [28] A. De Maio, M.M. El-Masry, M. Portaccio, N. Diano, S. Di Martino, A. Mattei, U. Bencivengaa, D.G. Mita, Influence of the spacer length on the activity of enzymes immobilised on nylon/polyGMA membranes: part 1. Isothermal conditions, J. Mol. Catal. B Enzym. 21 (2003) 239-252. [29] D.S. Wentworth, D. Skonberg, D.W. Donahue, A. Ghanem, Application of chitosan-entrapped beta-galactosidase in a packed-bed reactor system, J. Appl. Polym. Sci. 91 (2004) 1294–1299. [30] J.N. Talbert, J.M. Goddard, Enzymes on material surfaces, Colloids Surf. B Biointerfaces 93 (2012) 8–19. [31] J.E. Gagner, M.D Lopez, J.S Dordick, R.W. Siegel, Effect of gold nanoparticle morphology on adsorbed protein structure and function, Biomaterials 32 (2011) 7241-7252. [32] A. Landarani-Isfahani, A. Taheri-Kafrani, M. Amini, V. Mirkhani, M. Moghadam, A. Soozanipour, A. Razmjou, Xylanase immobilized on novel multifunctional hyperbranched polyglycerol-grafted magnetic nanoparticles: an efficient and robust biocatalyst, Langmuir 31 (2015) 9219-9227. [33] I.V. Pavlidis, T. Vorhaben, D. Gournis, G.K. Papadopoulos, U.T. Bornscheuer, H. Stamatis, Regulation of catalytic behaviour of hydrolases 21

through interactions with functionalized carbon-based nanomaterials, J. Nanopart. Res. 5 (2012) 1-10. [34] S. Ding, A.A. Cargill, I.L. Medintz, J.C. Claussen, Increasing the activity of immobilized enzymes with nanoparticle conjugation, Curr. Opin. Biotechnol. 34 (2015) 242-250. [35] E. Petryayeva, W.R. Algar, I.L. Medintz, Quantum dots in bioanalysis: a review of applications across various platforms for fluorescence spectroscopy and imaging, Appl. Spectrosc. 67 (2013) 215-252. [36] M. Ziegler-Borowska, D. Chełminiak, T. Siódmiak, A. Sikora, M.P. Marszałł, H. Kaczmarek, Synthesis of new chitosan coated magnetic nanoparticles with surface modified with long-distanced amino groups as a support for bioligands binding, Mater. Lett. 132 (2014) 63-65. [37] A. Mehta, A.L. Zydney, Effect of spacer arm length on the performance of charge-modified ultrafiltration membranes, J. Memb. Sci. 313 (2008) 304-314. [38] G. Penzol, P. Armisén, R. Fernández‐Lafuente, L. Rodés, J.M. Guisán, Use of dextrans as long and hydrophilic spacer arms to improve the performance of immobilized proteins acting on macromolecules, Biotechnol. Bioeng. 60 (1998) 518-523.

22

Figure Legends Fig. 1. Effects of pH (a) and temperature (b) on the activity of the free and immobilized PUL-H6. (c) Thermal stability of catalyst. (d) Effect of surface property of MNPs on the Michaelis constant of catalyst.

23

Fig. 2. Effects of pH (a) and temperature (b) on enzyme activity. (c) Thermostability of enzyme. (d) The reusability of the immobilized pullulanase.

24

Fig. 3. Graphs showing effect of pH on activities of the free and immobilized PUL-H6 (a) and H6-PUL (b), respectively, effect of spacer-arm on the thermostability (c) and Michaelis constant (d) of enzyme, and the reusability of the immobilized pullulanases (e) for hydrolysis of pullulan

25

Table 1. Comparison of the reusability of the immobilized pullulanases. Nanosystem Cycles Reaction Residue Reference time (min) activity (%) Fe3O4/CS-GA 7 7×60 75 10 10 10×60 64.8 10 Fe3O4/CS/APTES-GA 5 5×30 65 11 Fe3O4/CS/APTES-GA 4 4×30 65 12 Fe3O4/κ-Carrageenan/ CS 6 6×30 65 13 CLEAs 8 8×30 85 6 Fe3O4/PEI-BDDE-PEA-IDA-Ni 12 12×30 85 This study 16 16×30 75 18 18×30 60 Note: Chitosan is abbreviated to CS, Glutaraldehyde to GA, 3-Aminopropyltriethoxysilane to APTES, and Cross Linked Enzyme Aggregates to CLEAs.

26