Relationship between expression of multiple drug resistance proteins and p53 tumor suppressor gene proteins in human brain astrocytes

Neuroscience 121 (2003) 605– 617

RELATIONSHIP BETWEEN EXPRESSION OF MULTIPLE DRUG RESISTANCE PROTEINS AND p53 TUMOR SUPPRESSOR GENE PROTEINS IN HUMAN BRAIN ASTROCYTES M. MARRONI,a M. L. AGRAWAL,c K. KIGHT,a K. L. HALLENE,a M. HOSSAIN,a L. CUCULLO,a K. SIGNORELLI,a S. NAMURA,a W. BINGAMANa AND D. JANIGROa,b*

Key words: antiepileptic drug levels, pharmacokinetics, blood– brain barrier, pharmacogenomics.

The mechanisms by which cells become drug resistant are numerous and include innate drug resistance that exists before exposure to the chemotherapeutic agent, and acquired pharmacoresistance developed during chemotherapy. At the molecular level, multiple drug resistance (MDR) is mediated by a range of proteins including MDR protein (MDR1), MDR-associated proteins (MRPs), and lung resistance proteins (LRP; Scheper et al., 1993, 1996; Izquierdo et al., 1996b; Schinkel, 1999; Decleves et al., 2000). Drug resistance of the brain has been considered to primarily involve the MDR1 gene (Borst et al., 2000). Blood– brain barrier (BBB) endothelial cells (EC) express the MDR1 gene that encodes P-glycoprotein (Pgp); expression of Pgp has not been observed in neurons or astrocytes in normal human brain (Cordon-Cardo et al., 1989; Thiebaut et al., 1989; Tatsuta et al., 1992; but see Golden and Partridge, 2000). By contrast, glial expression of Pgp has been shown to occur in tumoral or epileptic tissue (Sisodiya et al., 1999, 2001; Tishler et al., 1995; Lazarowski et al., 1999). In addition to MDR1, brain tumors express both MRPs and LRP (Tews et al., 2000). Seizure disorders show a relatively high propensity toward MDR (National Institutes of Health, 1990; Abbott et al., 2002). Drug resistant epilepsy is frequently associated with gross rearrangement of brain cytoarchitecture and variable levels of necrosis. In animal models, limbic seizures induce MDR1 (Rizzi et al., 2002). Human epileptic brain has been shown to express elevated levels of MDR1 and, in addition to normal EC expression, astrocytic and perhaps neuronal localization has been demonstrated. Finally, other MDR-related proteins normally associated with resistance to chemotherapy are expressed in “epileptic” EC, suggesting an overlap with neoplastic pathology (Dombrowski et al., 2001). While data suggest that MDR, MRP and LRP are all involved to some extent in resistance to chemotherapy, many issues remain unresolved. For example, the role of these proteins in drug naive tissue is poorly understood. In addition, their cellular/subcellular localization in non-tumor tissue is virtually unknown. MRD1/MRP are expressed in normal BBB EC, while LRP has been reported to be expressed primarily, even if not exclusively, in neoplasms (Izquierdo et al., 1996a; Sugawara et al., 1997). Finally, the means by which regulation of MDR genes/proteins occurs in non-neoplastic tissue is virtually unknown.

a Division of Cerebrovascular Research, Department of Neurological Surgery, The Cleveland Clinic Foundation, NB20, 9500 Euclid Avenue/NB2–137, Cleveland, OH 44195, USA b Department of Cell Biology, The Cleveland Clinic Foundation, NB20, 9500 Euclid Avenue/NB2–137, Cleveland, OH 44195, USA c

Department of Molecular Biology, The Cleveland Clinic Foundation, NB20, 9500 Euclid Avenue/NB2–137, Cleveland, OH 44195, USA

Abstract—Multiple drug resistance occurs when cells fail to respond to chemotherapy. Although it has been established that the drug efflux protein P-glycoprotein protects the brain from xenobiotics, the mechanisms involved in the regulation of expression of multiple drug resistance genes and proteins are not fully understood. Re-entry into the cell cycle and integrity of the p53 signaling pathway have been proposed as triggers of multiple drug resistance expression in tumor cells. Whether this regulation occurs in non-tumor CNS tissue is not known. Since multiple drug resistance overexpression has been reported in glia and blood vessels from epileptic brain, we investigated the level of expression of multidrug resistance protein, multidrug resistance-associated proteins and lung resistance protein in endothelial cells and astrocytes isolated from epileptic patients or studied in situ in surgical tissue samples by double label immunocytochemistry. Reverse transcriptase–polymerase chain reaction and Western blot analyses revealed that multiple drug resistance, multidrug resistance protein, and lung resistance protein are expressed in these cells. Given that lung resistance proteins have been reported to be preferentially expressed by tumors, we investigated expression of tumor suppressor genes in epileptic cortices. The pro-apoptotic proteins p53 and p21 could not be detected in “epileptic” astrocytes, while endothelial cells from the same samples readily expressed these proteins, as did normal brain astroglia and normal endothelial cells. Other apoptotic markers were also absent in epileptic glia. Our results suggest a possible link between loss of p53 function and expression of multiple drug resistance in nontumor CNS cells. © 2003 IBRO. Published by Elsevier Ltd. All rights reserved. *Corresponding author. Tel: ⫹1-216-445-0561; fax: ⫹1-216-4451466. E-mail address: [email protected] (D. Janigro). Abbreviations: BBB, blood– brain barrier; DAPI, 4⬘,6-diamidino2-phenylindole; EC, endothelial cells; FBS, fetal bovine serum; GFAP, glial fibrillary acidic protein; IgG, immunoglobulin G; LRP, lung resistance proteins; MDR, multiple drug resistance; MDR1, (Pgp) multiple drug resistance protein; MRPs, multiple drug resistance-associated proteins; PBS, phosphate-buffered saline; Pgp, P-glycoprotein; RT-PCR, reverse transcriptase-polymerase chain reaction; TLE, temporal lobe epilepsy.

0306-4522/03$30.00⫹0.00 © 2003 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/S0306-4522(03)00515-3

605

606

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

Table 1. Demographic characteristics of the patient population used for our studies Subject

Age

Sex Classification

TLE 1a

24

M

TLE 2a,b 8 mo. M

TLE 3b

58

F

TLE 4b

37

M

TLE 5b

49

F

TLE 6b

10

F

NE 1a NE 4b NE 5a

48 63 61

M M F

Etiology

Left frontal lobe epilepsy

Cortical Dysplasia Right hemisphere epilepsy Right ParietalOccipital, and Posterior Frontal CD Right focal epilepsy Right Parietal Vascular Malformation Left mesial temporal epilepsy Mesial Temporal Sclerosis Auto motor seizures Left⬎⬎Right TLE ⫹ Hippocampal Atrophy Left temporal lobe epilepsy Left Hippocampal Sclerosis Low-grade astrocytoma Glioblastomamultiforme Aneurysm Right Temporal Aneurysm

a

RT-PCR and Western blot on isolated cells. Immunohistochemistry. NE, non-epileptic; TLE, temporal lobe epilepsy. b

Most cancers lack active p53, the protein responsible for inhibition of cell growth through activation of cell cycle arrest and apoptosis. The most frequently expressed MDR genes, MDR1 and MRPs, occur in human tumors with mutant p53. In striking contrast, epileptic seizures appear, at least in animal models, to increase p53 expression, yet seizures are frequently associated with MDR. We hypothesized that MDR1 expression may not be restricted to neoplasms and that in drug resistant epileptic patients, expression of these genes shifts from endothelial to glial due to failed p53 expression in astrocytes. To test this hypothesis, we took advantage of techniques that allow the isolation of glial cells from tissue resection obtained from surgeries used to relieve drug-resistant seizures. Human astrocytes from non-pathological origin as well as tissues obtained from non-tumor, non-epileptic brain specimens were used as “control.” Cellular and subcellular localization of MDR-related proteins was further demonstrated by immunocytochemical techniques on tissue sections from epileptic or “control” tissue.

EXPERIMENTAL PROCEDURES Cell isolation, characterization and primary culture Human brain cortex astrocyte cells, ACBRI 371, were purchased from Applied Cell Biology Research Institute (Applied Cell Biology Research Institute, Kirkland, WA, USA). Astrocyte and EC cultures were established from human cerebral cortical tissue of patients undergoing temporal lobectomies (n⫽6) to relieve medically intractable seizures, one aneurysm and one astrocytoma (see Table 1). Tissue resections were collected in an ice-cold solution mimicking cerebrospinal fluid composition (120 mM NaCl,

3.1 mM KCl, 1.0 mM MgCl2; 6 H2O, 26.0 mM NaHCO3, 1.25 mM KH2PO4, 10.0 mM dextrose, 1.0 mM CaCl, 2 H2O) and bubbled with 5% CO2/95% O2. Primary cultures of human brain astrocytes were obtained as described by Booher and Sensenbrenner, 1972. Briefly, tissue was homogenized after gentle trituration and incubation in phosphate-buffered saline (PBS) containing trypsin (0.2%)/DNAse (1 mg/ml; Sigma-Aldrich, St Louis, MO, USA) for 20 min at 37 °C. After centrifugation (200⫻g for 5 min) and filtration through 70 ␮m nylon mesh, cells were seeded in appropriate poly-L-lysine-coated flasks or in six- or 24-multiwell plates. The culture medium was Dulbecco’s modified essential medium/ 10% fetal bovine serum (FBS) with 2 mM glutamine, 100 U/ml penicillin and 100 ␮g/ml streptomycin. Astrocytes reaching confluence were agitated overnight at 37 °C and then cytosine arabinoside and L-leucine methyl ester (Sigma-Aldrich) were added in order to obtain a purified astrocytic population (Meyer et al., 1991). A week later, astrocytes reached confluence and represented ⬎95% of the population of cells present in the culture, as previously reported (Decleves et al., 2000). In our experiments, characterization with rabbit polyclonal antibodies against glial fibrillary acidic protein (GFAP; Dako Corporation, Carpinteria, CA, USA) demonstrated that the vast majority of living cells were astrocytes. Immunoblot and reverse transcriptase–polymerase chain reaction (RT-PCR) experiments were performed on confluent passage 3 cultures, which were 100% pure according to morphological criteria and positive staining for GFAP. EC cultures were isolated from blood vessels by manually pulling out a combination of penetrating pial and superficial pial vessels. By comparison, “control” vessels were obtained directly from human aneurysm domes or umbilical vein. Surgically obtained specimens were washed in PBS and incubated in collagenase Type II (2 mg/ml; Worthington Chemicals) at 37 °C for 20 min to dissociate the ECs. Collagenase was then washed off with the medium used for growing ECs (1.5 g/100 ml; MCDB 105 supplemented with endothelial growth supplement, 15 mg/100 ml heparin 800 units/100 ml, 10% FBS, and penicillin/streptomycin, 1%; Sigma Chemicals), and ECs were harvested with a sterile cotton swab soaked in the medium and seeded in appropriate flasks coated with fibronectin (1 ␮g/cm2; Biomedical Technologies, Inc., Stoughton, MA, USA). After ECs reached confluence, they stained positive for von Willebrand factor and negative for GFAP.

RNA isolation of human brain astrocytes and RT-PCR analysis Total RNA was extracted with the TRIzol reagent (Gibco Laboratories–Life Technologies, Rockville, MA, USA). The quantity and purity of RNA were estimated spectrophotometrically and agarose formaldehyde gels confirmed the integrity of the isolated RNA. A single strand of cDNA was synthesized from 1 ␮g total RNA by reverse transcription (Superscript II; Gibco Laboratories–Life Technologies) using random primers (Gibco Laboratories–Life Technologies). The resulting cDNA was then amplified by PCR using targeting primers for human MDR1, MRP1– 6, LRP and ␤-actin genes. Primers designed to amplify human MDR1 sequence were the following: sense primer 5⬘-TGACTACCAGGCTCGCCAA-3⬘, antisense primer 5⬘-TAGCGATCTTCCCAGCACCTT-3⬘. Primers used to amplify MRP1– 6, LRP and ␤-actin genes, were previously described by Baron et al., 2001 (see Table 2). PCR amplification was carried out through 35 cycles of 1 min denaturation at 94 °C, 1 min annealing at 55 °C, and 1 min extension at 72 °C, followed by a final step of 5 min at 72 °C. To optimize the amplification of the fragment specific to MDR1, the annealing temperature was increased to 60 °C. The PCR products were then separated by electrophoresis on 1% agarose gel and visualized by ethidium bromide staining.

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

607

Table 2. Sequence of amplification primers shown in the 5⬘-3⬘ orientation Gene

Primers

Gene bank acc. number

PCR products (bp)

MDR1

Sense primer: 2865-2883 TGACTACCAGGCTCGCCAA; anti-sense primer: 3116-3096 TAGCGATCTTCCCAGCACCTT Sense primer: 241-259 TGGGACTGGAATGTCACG; anti-sense primer: 483-501 AGGAATATGCCCCGACTTC Sense primer: 4072-4091 CTGCCCTCTTCAGAATCTTAG; anti-sense primer: 4294-4312 CCCAAGTTGCAGGCTGGCC Sense primer: 3458-3477 CAGTCAGCCGCTCACCTATC; anti-sense primer: 3747-3766 TCATCCAGTTCAGAGCAAAT Sense primer: 12-30 CCATTGAAGATCTTCCTGG; anti-sense primer: 243-250 GGTGTTCAATCTGTGTGC Sense primer: 3244-3261 GGATAACTTCTCAGTGGG; anti-sense primer: 3624-3605 GGAATGGCAATGCTCTAAAG Sense primer: 3019-3038 CCATTGGGCTGTTTGCCTCC; anti-sense primer: 3237-3255 GGCTGACCTCCAGGAGTCC Sense primer: 1546-1569 GTCTTCGGGCCTGAGCTGGTGTCG; antisense primer: 1762-1785 CTTGGCCGTCTCTTGGGGGTCCTT Sense primer: 488-507 ACCCACACTGTGCCCATCTA; anti-sense primer: 761-777 CGGAACCGCTCATTGCC

M14758

252

NM_000392

261

XM_038000

241

U66686

309

XM_0377577

239

XM_037577

381

NM_001171

237

X79882

240

AB004047

290

MRP1 MRP2 MRP3 MRP4 MRP5 MRP6 LRP ␤Actin

Immunoblot Identification of MDR1, MRPs, and LRP proteins was performed by Western blotting techniques. Briefly, total cell lysates were obtained by scraping off the cells in ice-cold sodium lauryl sulfate buffer (150 mM NaCl, 0.5% deoxycolate, 50 mM Tris–HCl, pH 7.4, 50 ␮g/ml phenylmethylsulphonyl fluoride, 2 ␮g/ml leupeptin and 2 ␮g/ml aprotinin). The cells were lysed by incubation on ice for 30 min with intermittent mixing. Protein concentration was estimated according to the Bradford assay method (Bio-Rad Laboratories, Hercules, CA, USA). Total proteins (40 ␮g/lane) were separated by 6% polyacrilamide gels with sodium dodecyl sulfate–polyacrilamide gel electrophoresis at 80 V and transferred onto a polyvinylidene difluoride membrane (Millipore Corporation, Bedford, MA, USA) by electroblotting overnight at 40 mA constant current. After blocking with Blotto (PBS, 1% milk powder and 0.05% Tween 20) for at least 2 h, the membranes were probed overnight at 4 °C with primary antibodies; we used mouse monoclonal anti-Pgp (1:100; Calbiochem-Novabiochem Corporation, San Diego, CA, USA), mouse monoclonal anti-MRP (1:100; CalbiochemNovabiochem Corporation) and mouse monoclonal anti-LRP (0.2 ␮g/ml; Calbiochem-Novabiochem Corporation, San Diego, CA, USA). After washes, secondary horseradish peroxidase mouse immunoglobulin G (IgG) antibodies were added (1:5000; Gibco Laboratories-Life Technologies) for 2 h. Specific protein bands were visualized by enhanced chemiluminescence reagent (Amerscham Pharmacia Biotech, England, UK). To ensure that the same amount of total protein was electroblotted, PVDF membranes were incubated for 30 min at 50 °C in a “stripping buffer” (100 mM 2-mercaptoethanol, 2% sodium dodecyl sulfate, 62.5 mM Tris–HCl pH 6.7). Non-specific binding was performed as described before and then membranes were reprobed with mouse monoclonal anti-actin antibody (1:15000; Oncogene, Cambridge, MA, USA) or rat monoclonal anti-GFAP antibody (0.5 ␮g/ml, Calbiochem-Novabiochem Corporation) Relative expression of proteins was determined by densitometric analysis using Scion Image Software.

Immunohistochemistry To investigate the expression of multidrug resistance proteins in human tissues, free floating sections of 30 ␮m thickness from frozen brain tissue were first incubated in a blocking solution (3% normal goat serum, 0.1% Triton-X, 1.0% bovine serum albumin in 1⫻ Tris-buffer saline, pH 7.4) for 1 h, to block non specific stain-

ing. Tissue was then incubated overnight at 4 °C with primary antibodies: mouse monoclonal anti-Pgp (1:40; Calbiochem-Novabiochem Corporation), mouse monoclonal anti-MRP (1:40; Calbiochem-Novabiochem Corporation) and mouse monoclonal antiLRP (0.5 ␮g/ml; Calbiochem-Novabiochem Corporation). Sections were rinsed five times in PBS 1⫻ and incubated for 3 h at room temperature in the dark with secondary antibody anti-mouse IgG Texas Red-conjugated (1:75; Jackson Immunoresearch Laboratories Inc., West Grove, PA, USA). After rinsing a second time, sections were incubated overnight at 4 °C with rabbit polyclonal anti-GFAP antibody (1:100; Dako Corporation) or rabbit polyclonal anti-neurofilament antibody (1:300; Chemicon International, Temecula, CA, USA). Sections were rinsed five times in PBS 1⫻ and incubated for 3 h at room temperature in the dark with fluoresceinconjugated secondary antibody anti-rabbit IgG (1:1000; Jackson Immunoresearch Laboratories Inc.). Finally, sections were rinsed in PBS 1⫻ and mounted on glass slides, using Vectashield (Vector, Burlingame, CA, USA) mounting medium with 4⬘,6-diamidino2-phenylindole (DAPI). Bright-field microscopy was used to examine the expression patterns of p53 (DO-7 clone, 1:20; Dako), in brain tissue. All of the immunostaining was performed on the Ventana Benchmark automated system (Ventana, Tucson, AZ, USA). A germ cell tumor was used as positive control for p53 immunoreactivity.

RESULTS MDR1 expression in cultured human astrocytes Our first aim was to test the hypothesis that expression of MDR genes occurs in epileptic brain. In particular, we wished to explore patterns of expression for these genes/ proteins in astrocytes. To this end, we obtained highly purified astrocytic cultures and then performed RT-PCR analysis by using specific primers (see Experimental Procedures and Tables 1 and 2). Commercially available astrocytes of non-pathological origin and astrocytes isolated from a surgically resected low-grade (WHO II) astrocytoma were used as comparison tissue to detect possible differences in MDR1 expression in epileptic brain astrocytes. The astrocytic nature of the cells was confirmed by GFAP immunostaining. The vast majority of the cells (⬎95%)

608

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

Fig. 1. MDR1 mRNA and protein expression in cultured astrocytes isolated from “control” brain astrocytes, glia from TLE, or a low-grade astrocytoma. Expression of MDR1 mRNA was observed in all cultures tested (A). At the protein level, however, quantitative differences become evident, with TLE (patients TLE 1 and TLE 2, Table 1) or astrocytoma cultures (patient NE 1, Table 1) expressing larger amounts of MDR1 protein than that observed in control astrocytes (patient NE 5; B). ␤2-Microglobulin (␤ 2MG) and actin were used as internal control for mRNA and Western blotting respectively. The expression of MDR1 in TLE and in astrocytoma cultures was almost three-fold higher than in “control” astrocytes as demonstrated by densitometric analysis of bands relative to this protein, normalized by actin (C). Morphological characteristics of human astrocytes in culture. D1) Normal human astrocytes, D2) astrocytes isolated from an epileptic patient (TLE 1, Table 1), and D3, D4 a low-grade astrocytoma (NE 1, Table 1). Cells were stained for GFAP immunofluorescence and DAPI. Well over 95% of the cells stained positive for GFAP. The patterns of GFAP staining as well as overall morphology differed between different cell types; see text for details. D2 represents growth observed in “epileptic” glia. Low-density cultures were characterized by growth of sparse GFAP⫹ cells that formed a delicate network. Quasi-confluent cells were characterized by intense GFAP staining and rounded cell bodies with typical astrocytic morphology. Cells isolated from a low-grade astrocytoma were spindle-shaped and faintly GFAP positive (D4).

were GFAP immunopositive in “control” samples, as well as in specimens isolated from temporal lobes of epilepsy patients or low-grade astrocytoma. However, GFAP immunostaining revealed differences in cell shape between “epileptic” or control samples and low-grade astrocytoma cells. While “epileptic” and non-pathologic GFAP positive

cells were characterized by typical astrocytic morphology, cells isolated from a low-grade astrocytoma were spindleshaped and grew in parallel bands (Fig. 1D). RT-PCR analysis revealed MDR1 expression in astrocytic cultures isolated from epileptic brain, astrocytoma and non-pathological astrocytes (Fig. 1A).

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

609

Fig. 2. LRP and MRP1 mRNA and protein expression in cultured astrocytes isolated from “control” brain astrocytes or glia from TLE. A1-A3) RT-PCR data obtained as described for Fig. 1. B, C) Western blotting for MRP1 and LRP protein.

To confirm at the protein level the results obtained by RT-PCR, and in an attempt to quantify the protein levels in these findings, Western blot assays were performed on astrocytic cell cultures isolated from the same cell populations (Fig. 1). Protein analysis demonstrated a higher expression of MDR1 in astrocytes isolated from epileptic brain compared with astrocytes from non-pathological samples. Low-grade astrocytoma isolated cells expressed levels of MDR1 comparable to epileptic specimens. The expression of MDR1 in astrocytes isolated from epileptic brain and in low-grade astrocytoma isolated cells was almost three-fold higher than in “control” astrocytes. This was confirmed by densitometric analysis of the bands relative to these proteins, normalized to actin (Fig. 1C). Taken together, these results suggest that MDR1 expression at the RNA level occurs in cultured cells regardless of their pathological or physiological status, confirming results from other laboratories. However, at the protein level, significant differences exist between “normal” glia and astrocytes of pathological origin. Surprisingly, astrocytoma expressed MDR1 levels comparable to “epileptic” glia sug-

gesting that an overlap between epileptic and neoplastic astrocyte phenotypes may exist. LRP and MRP expression in cultured human astrocytes In experiments performed in parallel to those described above, RT-PCR analysis revealed that mRNA for LRP was expressed in these cells. mRNA encoding MRP1 was also present, but not the other five members of the multidrug resistance-associated protein family (Fig. 2). To confirm the results obtained by RT-PCR, Western blot assays were performed on astrocytic cell cultures selected according to the same criteria as defined for RNA experiments. Cell protein extracts were probed with primary monoclonal antibodies against MRP and LRP as described in the Experimental Procedures section. Astrocytes of non-pathological origin were again used as control. MRP1 and LRP proteins were present at high levels of expression in astrocytes from epileptic brain, even though their expression was much lower than MDR1. Previous work by others has demonstrated expression of LRP and MRP in brain tumors.

610

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

MDR1 expression in situ Isolated cells grown in culture and exposed to serum display variable and sometimes unpredictable levels of specific mRNA and protein. This is particularly true for MDR genes/protein. For example, it has been shown that brain microvascular ECs normally express MDR1, but downregulate expression in culture (Hayashi et al., 1997; el Hafny et al., 1997). Astrocytes, by contrast, normally express undetectable MDR1 levels, but significant amounts of protein/mRNA are expressed by cultured glia. To control for possible tissue culture artifacts in the RT-PCR/Western blot experiments performed on cells isolated and cultured as described above, immunodetection of MDR1 protein was repeated on tissue sections directly immersion-fixed after surgical excision. Samples from five temporal lobe epilepsy (TLE) patients were processed and analyzed for double label immunofluorescence to detect GFAP and MDR1 (Fig. 3). Cortical samples from epileptic specimens were all characterized by variable levels of gliosis. Gliotic regions were readily apparent by GFAP immunocytochemistry (Fig. 3A1, B1, C1). In the specimen shown, as well as in all other TLE samples, regions of marked GFAP positive gliotic cells were situated at the gray/white interface. An abrupt drop in GFAP immunoreactivity was observed at the edge separating the gliotic core from surrounding presumed normal tissue. This was not due to transition toward necrotic regions, since DAPI nuclear stain was still present in areas that were only faintly GFAP immunoreactive. Additional patterns of abnormal cortical organization underlying MDR1/GFAP expression are shown in Fig. 3C. White matter regions were clearly characterized by intense GFAP and MDR1 immunoreactivity, but regional variations organized in a band-like fashion were noted within the gliotic region. Vessels were intensely stained for both immunogens, and marked co-expression of GFAP and MDR1 was again observed in perivascular glia. The coexistence of GFAP and MDR1 immunoreactivity was confirmed by confocal microscopy (Fig. 6). Note that perivascular glial end feet were strongly GFAP/MDR1 immunopositive and that intense MDR1 immunoreactivity was present in ECs (Fig. 3B4). GFAP⫹ cell bodies also contained MDR1 immunoreactivity, sparsely scattered in the cytoplasm and occasionally concentrated in the perinuclear region. MDR1 immunostaining was also found in GFAP positive astrocytes in regions distal to the cell body, but not associated to perivascular specializations (arrowheads in Fig. 3B4). GFAP negative cells also expressed high levels of MDR1 immunoreactivity (Fig. 3A4, B4). Cycles of assembly/disassembly of the intermediate filaments of astrocytes are modulated by the phosphorylation of GFAP (Webster et al., 2001; Takemura et al., 2002a,b). Tissue samples from gliotic regions were probed for phosphorylated GFAP (GFAP*) to confirm expression of this reactive form in astrocytes isolated from epileptic brain (inset, Fig. 3). The results of a typical Western blot experiment are shown in the inset. Similar results were

obtained in samples from other patients. A summary of these immunocytochemical results is provided in Table 3. In situ expression of LRP, MRP and MDR1: relationship with gliosis and neuronal markers Immunocytochemical detection of LRP, MDR1 and MRP1 revealed that these markers of drug resistance were all expressed in reactive astrocytes characterized by elevated GFAP expression. Capillaries also occasionally stained positive for MDR1 and MRP1 (Fig. 4A, 4C). MRP1 staining was also observed in glial cells interspersed with neurofilament positive cells in dysplastic areas (Fig. 4B). Large vessels were also clearly positive for MRP1 (arrows in Fig. 4B). MDR1 immunoreactivity was usually co-localized with regions of enhanced expression of GFAP. Therefore, colocalization of GFAP and MDR1 was a hallmark of gliotic scars typically confined to the white-gray border (Fig. 3). However, in normal appearing regions with clear-cut distinction between gray and white matter, MDR1 and GFAP were clearly segregated, the latter being confined to the gray matter and MDR1 being predominantly expressed in white matter cells (Fig. 4D). By contrast to cytoplasmic staining for MDR1 and MRP, LRP staining was nuclear (Fig. 4D). Gliotic regions as well as various vessels were LRP positive. Taken together, these results suggested that while LRP, MDR1 and MRP1 may be co-expressed in astrocytes in gliotic regions, individual patterns of expression (single proteins) were also present in relatively normal glia. LRP staining appeared mostly in the nucleus, while MDR1 and MRP1 immunoreactivity was widespread in the cytosol. Expression of apoptotic markers in epileptic brain Results from other laboratories have shown induction of p53 expression following epileptic seizures in animal models of epilepsy (Tan et al., 2002a,b). This was linked to post-seizure neuronal cell death and neurodegeneration (Xiang et al., 1996). On the other hand, and in apparent contrast, abnormal expression of multiple drug resistant genes has been explained in the context of failed transcription of p53 (Sampath et al., 2001). We investigated whether the gliotic regions in epileptic brain characterized by abnormal astrocytic expression of MDR1, LRP, and MRP1 also expressed p53 or other markers of pro-apoptotic changes. To this end, we initially applied Western blotting techniques to isolated, cultured EC and astrocytes isolated from epileptic brain or control tissue (Fig. 5). To our surprise, we discovered that while p53 and p21 were readily upregulated by culturing conditions in normal or “epileptic” EC, glia from epileptic brain failed to express measurable amounts of these proteins. By contrast, normal astrocytes readily expressed measurable levels of p53/p21. Work by others reported that p53 immunoreactivity is not limited to astrocytomas, but can be observed in lesions that are often mistaken for glioma (Kurtkaya-Yapicier et al., 2002). Thus, loss of p53 appears an exclusive property of drug resistant, epileptic glia.

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

611

Fig. 3. Immunocytochemical localization of MDR1 protein in GFAP positive cells in TLE specimens. Gliotic regions were found throughout “epileptic” specimens, and were frequently located at the gray-white border (white dotted line). Each letter of the drawing in the bottom right corner corresponds to the regions of the brain slice where the pictures were taken (patient TLE 5, Table 1). Gray matter and white matter are outlined in gray and white respectively. The gliotic region is shown in green. The latter was defined as a region of marked GFAP immunofluorescence. A1–A4) Abrupt changes in immunoreactivity at the margins of the gliotic region. The individual immunosignals are shown in A1 (GFAP) and A2 (MDR1), while A3 emphasizes overlapping expression. DAPI immunofluorescence was combined to give A4. Note that blood vessels were clearly outlined by both GFAP and MDR1 (arrowheads in A1–A3), and that GFAP expression paralleled MDR1 immunoreactivity. The drop in immunosignal for both epitopes in non-gliotic regions was not due to the presence of necrotic tissue, since DAPI positive nuclei were still present at high numbers in the non-gliotic region, as shown in A4. B1–B4) Large vessels in epileptic tissue are immunopositive for GFAP and MDR1. This was due to co-expression at the perivascular interface, where strong MDR1 immunosignal was detected in perivascular end feet. This is emphasized by arrowheads pointing to large vessels and to the perivascular end feet in the enlargement in B4. E.f. refers to glial end feet demonstrating double-label immunostaining and juxtaposed to red MDR1 positive/GFAP negative ECs. C1–C4) Abnormal cytoarchitecture in epileptic cortex corresponds to increased levels of GFAP and MDR1 immunoreactivity. The abnormal banding pattern of GFAP and MDR1 immunoreactivity is highlighted by white arrowheads in C1 and C2. A GFAP/MDR1 positive vessel is indicated by yellow arrowheads in C3. Note that the enlargement in C4 is oriented differently from C1–C3. The Western blot shows expression of phosphorylated GFAP protein in gliotic regions isolated from brain of two temporal lobe epileptic patients (TLE 1, TLE 2). Note absence of signal in control tissue, despite the presence of actin.

612

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

Fig. 4. Immunocytochemical localization of LRP, MDR1 and MRP in epileptic brain. Note the overlap of MDR1, LRP and MRP1 expression with regions of gliosis. Also note that while the predominant staining for MDR1 and MRP1 was cytosolic, LRP expression was most pronounced in the nucleus (inset in D). Large blood vessels stained positive for MRP1 (arrows, B). No obvious neuronal staining was seen (NF, neurofilament antibody) overlapping with MRP (4B). Results were obtained from TLE 2.

DISCUSSION MDR is a complex phenomenon. The molecular mechanisms involved are clearly not exclusively dependent on exposure to chemotherapy, since MDR can be observed in cells never previously exposed to MDR substrates (Rizzi et al., 2002). In normal tissue, MDR1 is typically expressed in cells with a barrier role. Thus, BBB ECs, gut and kidney epithelial cells all express MDR1. Expression of MDR1 is

also upregulated in ECs by exposure to glial factors (Gaillard et al., 2000). Conversely, it is also accepted that MDR is not an exclusive property of tumors, since epileptic brain is also characterized by abnormal expression of MDR, and as shown here, LRP/MRP. Our results demonstrate that MDR is a regional property, restricted to cells in discrete brain regions. Although it has been shown that MDR1 is upregulated under cell culture conditions, our results from immunocytochemistry on human brain sections indeed

M. Marroni et al. / Neuroscience 121 (2003) 605– 617 Table 3. Summary of immunocytochemical (A) and Western blot (B) experiments: expression of multiple drug resistance genes and an apoptotic markera A. In situ immunocytochemical analysis

MDR1 MRP1 LRP P53

Endothelial cells Control Epileptic endothelium endothelium ⫹1 ⫹⫹2 ⫺ ?4 NA NA ⫺5 ⫺5

Astrocytes Control astrocytes ⫺3 ⫺ ⫺ ⫹5

Epileptic astrocytes ⫹12 ⫹11 ⫹13 ⫺5

Astrocytes Control astrocytes ⫹7 ⫺8 ⫺8 ⫹10

Epileptic astrocytes ⫹⫹7 ⫹8 ⫹9 ⫺10

B. In vitro Western blot analysis

MDR1 MRP1 LRP P53

Endothelial cells Control Epileptic endothelium endothelium ⫺6 ⫹3 ⫺ ⫹4 NA NA ⫹10 ⫹10

a Note the upregulation of MDR1 in epileptic endothelial cells and astrocytes. ⫹, present; ⫺, absent; ⫹⫹, upregulation; NA, not applicable. 1 See Cordon-Cardo et al., 1989. 2 See Fig. 3B4, and Dombrowski et al., 2001. 3 For review see Abbott et al., 2002. 4 See Dombrowski et al., 2001. 5 See Fig. 5B. 6 See Results and Dombrowski et al., 2001. 7 See Fig. 1. 8 See Fig. 2B. 9 See Fig. 2C. 10 See Fig. 5A. 11 See Fig. 4. 12 See Figs. 4C and 6. 13 See Fig. 4D.

suggest that MDR in epileptic brain is a property of “epileptic” astrocytes, where p53 expression is impaired. Thus, taken together, our results point to low expression of p53 by “epileptic” glia as a potential trigger for abnormal expression of MDR by these cells. Expression of p53 and MDR1 has been extensively studied in animal models of epileptic seizures. Interestingly, in animal models seizures appear to activate p53 transcription, and ablation of p53 is neuroprotective. Our experiments and analysis of tissue samples from multiple drug resistant epileptic patients demonstrate that loss of p53 is also observed in regions of increased expression of MDR1. Thus, while on the one hand loss of p53 may be beneficial to neurons, glial cells may be forced into a state of “pathobiosis,” where cells are alive, yet permanently diseased and despite of the presence of an injurious environment, apoptotic mechanisms fail. An alternative explanation for our findings may call upon the opposite sequence, i.e. expression of MDR1 preventing expression of p53. Presently, we cannot directly address this issue, but results by others have shown that loss of p53 is causative in respect to expression of MDR1 (Oka et al., 1997; Thottassery et al., 1997).

613

MDR and epilepsy The first indication of Pgp/MDR1 expression at the BBB came from immunocytochemical studies showing that monoclonal antibodies recognizing Pgp specifically stained blood capillaries of the brain (and testis), but not capillaries in other tissues. Studies in MDR1a knockout mice showed a dramatic increase in the brain distribution of compounds known to be MDR1 substrates (Schinkel et al., 1995; de Lange et al., 1998; Allen et al., 2000). In addition to the MDR family, other efflux carriers have been described at the BBB, particularly the family of multidrug resistant-associated protein (MRPs, and the human major vault protein associated with multidrug resistance of tumors; Izquierdo et al., 1995; Schneider et al., 2000). The question remains whether seizures may induce MDR or perhaps more provocatively if conversely MDR may be an etiologic factor in epileptogenesis. The first hypothesis has been recently supported by Rizzi et al., 2002 but these findings are in sharp contrast with clinical reality showing that most of patients affected by seizures respond to antiepileptic drug treatment. The possibility exists that MDR expression is somehow associated with seizure generation. This hypothesis has not been, to the best of our knowledge, tested owing in part to the limited pharmacological tools that one may safely use to block MDR in vivo. There is increasing evidence that the “epileptic” BBB is altered (for a review see (Janigro, 1999). Immunocytochemical methods have shown presence of both Pgp (MDR1) and MRP1 in epilepsy patients, in both brain endothelium and astrocytes, with evidence for up-regulation of Pgp. cDNA gene array analysis applied to brain ECs from patients with medically intractable epilepsy showed overexpression of MDR1, MRP2 and the tumor-associated protein cisplatin resistance ␣ protein. Thus, it appeared that several markers previously associated with chemoresistance of tumor cells are present in epileptic brain, raising the interesting possibility that an overlap exists between tumorigenesis, MDR and epilepsy. The etiology and pathogenesis of epilepsy-associated local lesions remain largely unknown. Histopathologically, the most frequent lesions comprise gangliogliomas and glioneuronal malformations, i.e. hamartias or hamartomas, with significant overlap of markers of tumorigenesis and epileptogenesis observed (Wolf et al., 1993, 1994; Zentner et al., 1997; Blumcke et al., 1999). The findings of the present study further suggest that at least in drug resistant epilepsy, cellular alterations associated with neoplasms may be present. These include expression of tumor markers (such as cisplatin resistant-associated protein and LRP) and loss of functional expression of p53. Regulation of cell cycle and apoptosis in epileptic brain The study of neurogenesis in the adult brain is among the most exciting areas of neuroscience today. Unambiguous evidence for new neurons in normal adult mammals ranging from rodents to primates is confined to the dentate

614

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

Fig. 5. Expression patterns of p53/p21 in brain tissue. The upper panel shows results obtained from isolated glial and ECs. Note that while p53 and p21 expression was induced in ECs and normal astrocytes after in vitro culturing, “epileptic” glia failed to express p53/p21. Lower panel: Immunocytochemical localization of the apoptotic marker p53 in a positive control (germ cell tumor), epileptic brain (TLE 6) and “control” tissue, i.e. non-spiking regions isolated from the same brain samples. For details see Table 3.

gyrus and olfactory bulb (Rakic, 2002). These regions may serve as important model systems from which we can learn methods to introduce new neurons into more resistant brain structures, but may also reveal underlying mechanisms of neurological disorders. In epileptic brain, robust neurogenesis has been described (Scott et al., 1998; Sankar et al., 2000; Parent, 2002) but the opposing phenomenon also seems to play a role, namely a drastic apoptotic reduction in the number of neurons induced by seizures. In fact, p53⫺/⫺ animals displayed reduced post-seizure neuronal cell death. The relative resilience of vulnerable neuronal structures in p53⫺/⫺ animals suggests that loss of neuronal p53 may be a protective mechanism leading to preservation of a normal neuronal phenotype (Fig. 7). Our results suggest that an additional mechanism related to glial cell function may be occurring in parallel, loss of p53mediated glial apoptosis. The latter may be linked, at the molecular level, to expression of MDR1, as demonstrated in other cell types (Schneider et al., 1994; Goldsmith et al., 1995; Kopnin et al., 1995; de Kant et al., 1996; Rafki et al., 1997; Galimberti et al., 1998; Ralhan et al., 1999; Fulci et al., 1999) and be, in contrast to neuronal cell loss of

p53, detrimental in that it may lead to drug resistant epilepsy.

Fig. 6. Confocal examinations of MDR1 and GFAP expression in TLE astrocytes. Pictures were taken from sections characterized by gliosis (same patient as in Fig. 3, TLE 5). Note that A) perivascular glia was intensely immunoreactive for both GFAP and MDR1 while the luminal aspect (L) of the vessel was lined with MDR1 expressing ECs. In B), detailed subcellular distribution of MDR1 is depicted. Both the cytoplasm and distal segments of the astrocyte were characterized by punctuated MDR1 signal (arrows). GFAP negative cells also expressed high levels of MDR1 protein (asterisks).

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

615

Fig. 7. Proposed mechanism of MDR in non-tumoral tissue. See Discussion for details.

Current orthodoxy suggests that cell proliferation and cell death are low in mature mammalian brain. Altered brain homeostasis and brain damage cause a cascade of events that lead to enhanced cell division perhaps as consequence of neuronal cell death. Both parenchymal (neuronal, glial) and vascular cells are involved (Scholz et al., 2001; Parent et al., 2002; Bernier et al., 2002). Regardless of the exact underlying mechanisms, cell cycle reentry and apoptotic cell death are linked by expression of tumor suppressor genes such as p53. Failure to express p53 leads to deleterious, pro-oncogenic changes. Perhaps paradoxically, lack of p53 in the CNS may be “neuroprotective” as suggested by studies performed on knock-out animals. Our results, together with findings by others, suggest an additional influence of p53 loss or mutation (Fig. 7). According to this hypothesis, in brain regions where p53 expression is intact, injury will trigger apoptotic signaling leading to neuronal cell death, and reactive gliosis ultimately leading to apoptosis of damaged astrocytes. The rearrangement of neuronal cells, together with reactive changes in glia may lead to epileptic seizures (McKhann et al., 1997; Janigro et al., 1997; Najm et al., 2001; Dombrowski et al., 2002). Seizures increase expression of MDR1. The latter finding may account for the increased expression observed in epileptic brain. However, seizure-induced overexpression of MDR1 in glia does not appear to be long lasting in experimental in vivo models (Seegers et al., 2002) suggesting that abnormal electrical activity may not be sufficient to regulate MDR expression in astrocytes. Since seizures alone do not cause expression of MDR1 in glia, we hypothesized that loss of p53 may be responsible for coupling of neuronal hyperexcitability to

cell death and ultimately to MDR (Fig. 7). This was supported by direct evidence showing that ECs expressed p53 while astrocytes did not (Table 3). We therefore propose the situation outlined in Fig. 7 leading to multiple drug resistant epilepsy. The possibility that the progression toward an MDR-epileptic phenotype constitutes an initial step toward tumorigenesis is currently being investigated. In conclusion, our results demonstrate that in epileptic brain astrocytic loss of p53 is associated with regions and cell types expressing abnormal levels of MDR proteins. In addition to MDR1, epileptic glia express other MDR proteins, including LRP and MRP1; these are normally found in tumor cells suggesting a possible link between drug resistant epilepsy and low grade tumors. Acknowledgements—This work was supported by NIH-2RO1 HL51614 and NIH-RO1 NS38195 to Damir Janigro and the Yamanouchi Foundation to Shobu Namura.

REFERENCES Abbot NJ, Khan EU, Rollinson C, Reichel A, Janigro D, Dombrowski S, Dobbie MS, Begley DJ (2002) Drug resistance in epilepsy: the role of the blood-brain barrier. In: Mechanisms of drug resistance in epilepsy: lessons from oncology, Novartis Foundation Symposium No. 243 (Ling V, ed), pp 38 – 47. Chicester, UK: John Wiley. Allen JD, Brinkhuis RF, van Deemter L, Wijnholds J, Schinkel AH (2000) Extensive contribution of the multidrug transporters P-glycoprotein and Mrp1 to basal drug resistance. Cancer Res 60:5761– 5766. Baron JM, Holler D, Schiffer R, Frankenberg S, Neis M, Merk HF, Jugert FK (2001) Expression of multiple cytochrome p450 enzymes and multidrug resistance-associated transport proteins in human skin keratinocytes. J Invest Dermatol 116:541–548. Bernier PJ, Bedard A, Vinet J, Levesque M, Parent A (2002) Newly

616

M. Marroni et al. / Neuroscience 121 (2003) 605– 617

generated neurons in the amygdala and adjoining cortex of adult primates. Proc Natl Acad Sci USA 99:11464 –11469. Blumcke I, Lobach M, Wolf HK, Wiestler OD (1999) Evidence for developmental precursor lesions in epilepsy-associated glioneuronal tumors. Microsc Res Tech 46:53–58. Booher J, Sensenbrenner M (1972) Growth and cultivation of dissociated neurons and glial cells from embryonic chick, rat and human brain in flask cultures. Neurobiology 2:97–105. Borst P, Evers R, Kool M, Wijnholds J (2000) A family of drug transporters: the multidrug-resistance associated proteins. J Natl Cancer Inst 92:1295–1302. Cordon-Cardo C, O’Brien JP, Casals D, Rittman-Grauer L, Biedler JL, Melamed MR, Bertino JR (1989) Multidrug-resistance gene (Pglycoprotein) is expressed by endothelial cells at blood-brain barrier sites. Proceedings of the National Academy of Science 86:695– 698. de Kant E, Heide I, Thiede C, Herrmann R, Rochlitz CF (1996) MDR1 expression correlates with mutant p53 expression in colorectal cancer metastases. J Cancer Res Clin Oncol 122:671–675. de Lange EC, de Bock G, Schinkel AH, de Boer AG, Breimer DD (1998) BBB transport and P-glycoprotein functionality using MDR1A (⫺/⫺) and wild-type mice: total brain versus microdialysis concentration profiles of rhodamine-123. Pharm Res 15:1657– 1665. Decleves X, Regina A, Laplanche JL, Roux F, Boval B, Launay JM, Scherrmann JM (2000) Functional expression of P-glycoprotein and multidrug resistance- associated protein (Mrp1) in primary cultures of rat astrocytes. J Neurosci Res 60:594 –601. Dombrowski S, Desai S, Marroni M, Cucullo L, Bingaman W, Mayberg MR, Bengez L, Janigro D (2001) Overexpression of multiple drug resistance genes in endothelial cells from patients with refractory epilepsy. Epilepsia 42:1504 –1507. Dombrowski S, Najm I, Janigro D (2002) CNS microenvironment and neuronal excitability. In: The neuronal environment: brain homeostasis in health and disease (Walz W, ed), pp 3–24. Totowa, NJ: Humana Press Inc. el Hafny B, Chappey O, Piciotti M, Debray M, Boval B, Roux F (1997) Modulation of P-glycoprotein activity by glial factors and retinoic acid in an immortalized rat brain microvessel endothelial cell line. Neurosci Lett 236:107–111. Gaillard PJ, van de SI, Voorwinden LH, Vu D, Nielsen JL, de Boer AG, Breimer DD (2000) Astrocytes increase the functional expression of P-glycoprotein in an in vitro model of the blood-brain barrier. Pharm Res 17:1198 –1205. Galimberti S, Marchetti A, Buttitta F, Carnicelli V, Pellegrini S, Bevilacqua G, Petrini M (1998) Multidrug resistance related genes and p53 expression in human non small cell lung cancer. Anticancer Res 18:2973–2976. Golden PL, Partridge WM (2000) Brain microvascular P-glycoprotein and a revised model of multidrug resistance in brain. Cell Mol. Neurobiol. 20:165–18. Goldsmith ME, Gudas JM, Schneider E, Cowan KH (1995) Wild type p53 stimulates expression from the human multidrug resistance promoter in a p53-negative cell line. J Biol Chem 270:1894 –1898. Hayashi Y, Nomura M, Yamagishi S, Harada S, Yamashita J, Yamamoto H (1997) Induction of various blood-brain barrier properties in non-neural endothelial cells by close apposition to cocultured astrocytes. Glia 19:13–26. Izquierdo MA, Scheffer GL, Flens MJ, Giaccone G, Broxterman HJ, Meijer CJ, Van DV, Scheper RJ (1996a) Broad distribution of the multidrug resistance-related vault lung resistance protein in normal human tissues and tumors. Am J Pathol 148:877–887. Izquierdo MA, Scheffer GL, Flens MJ, Schroeijers AB, Van DV, Scheper RJ (1996b) Major vault protein LRP-related multidrug resistance. Eur J Cancer 32A:979 –984. Izquierdo MA, van der Zee AG, Vermorken JB, Van DV, Belien JA, Giaccone G, Scheffer GL, Flens MJ, Pinedo HM, Kenemans P (1995) Drug resistance-associated marker LRP for prediction of

response to chemotherapy and prognoses in advanced ovarian carcinoma. J Natl Cancer Inst 87:1230 –1237. Janigro D (1999) Blood-brain barrier, ion homeostasis and epilepsy: possible implications towards the understanding of ketogenic diet mechanisms. Epilepsy Res 37:223–232. Janigro D, Gasparini S, D’Ambrosio R, McKhann G, DiFrancesco D (1997) Reduction of K⫹ uptake in glia prevents long-term depression maintenance and causes epileptiform activity. J Neurosci 17: 2813–2824. Kopnin BP, Stromskaya TP, Kondratov RV, Ossovskaya VS, Pugacheva EN, Rybalkina EY, Khokhlova OA, Chumakov PM (1995) Influence of exogenous ras and p53 on P-glycoprotein function in immortalized rodent fibroblasts. Oncol Res 7:299 –306. Kurtkaya-Yapicier MDO, Scheithauer BW, Hebrink D, James CD (2002) p53 In nonneoplastic central nervous system lesions: an immunohistochemical and genetic sequencing study. Neurosurgery 51:1246 –1255. Lazarowski A, Sevlever G, Taratuto A, Massaro M, Rabinowicz A (1999) Tuberous sclerosis associated with MDR1 gene expression and drug- resistant epilepsy. Pediatr Neurol 21:731–734. McKhann GM, D’Ambrosio R, Newell DW, Janigro D (1997) Heterogeneity of astrocyte resting membrane potentials and intercellular coupling revealed by whole-cell and gramicidin-perforated patch recordings from cultured neocortical and hippocampal slice astrocytes. J. Neurosci. 17:6850 – 6893. Meyer J, Tauh J, Galla HG (1991) The susceptibility of cerebral endothelial cells to astroglial induction of blood-brain barrier enzymes depends on their proliferative state. J Neurochem 57:1971– 1977. Najm I, Ying Z, Janigro D (2001) Mechanisms of epileptogenesis. Neurol Clin 19:237–250. National Institutes of Health (1990) National Institutes of Health consensus conference: surgery for epilepsy. JAMA 264:729 –733. Oka M, Kounoura K, Narasaki F, Sakamoto A, Fukuda M, Matsuo I, Ikeda K, Tsurutani J, Ikuno N, Omagari K, Mizuta Y, Soda H, Gudas JM, Kohno S (1997) P-glycoprotein is positively correlated with p53 protein accumulation in human colorectal cancers. Jpn J Cancer Res 88:738 –742. Parent JM (2002) The role of seizure-induced neurogenesis in epileptogenesis and brain repair. Epilepsy Res 50:179 –189. Parent JM, Valentin VV, Lowenstein DH (2002) Prolonged seizures increase proliferating neuroblasts in the adult rat subventricular zone-olfactory bulb pathway. J Neurosci 22:3174 –3188. Rafki N, Liautaud-Roger F, Devy L, Trentesaux C, Dufer J (1997) P53 protein expression in human multidrug-resistant CEM lymphoblasts. Leuk Res 21:147–152. Rakic P (2002) Adult neurogenesis in mammals: an identity crisis. J Neurosci 22:614 –618. Ralhan R, Swain RK, Agarwal S, Kaur J, Nath N, Sarkar G, Mathur M, Shukla NK (1999) P-glycoprotein is positively correlated with p53 in human oral pre-malignant and malignant lesions and is associated with poor prognosis. Int J Cancer 84:80 –85. Rizzi M, Caccia S, Guiso G, Richichi C, Gorter JA, Aronica E, Aliprandi M, Bagnati R, Fanelli R, D’Incalci M, Samanin R, Vezzani A (2002) Limbic seizures induce P-glycoprotein in rodent brain: functional implications for pharmacoresistance. J Neurosci 22:5833–5839. Sampath J, Sun D, Kidd VJ, Grenet J, Gandhi A, Shapiro LH, Wang Q, Zambetti GP, Schuetz JD (2001) Mutant p53 cooperates with ETS and selectively up-regulates human MDR1 not MRP1. J Biol Chem 276:39359 –39367. Sankar R, Shin D, Liu H, Katsumori H, Wasterlain CG (2000) Granule cell neurogenesis after status epilepticus in the immature rat brain. Epilepsia 41 (Suppl6 ):S53-S56.. Scheper RJ, Broxterman HJ, Scheffer GL, Kaaijk P, Dalton WS, van Heijningen TH, van Kalken CK, Slovak ML, de Vries EG, Van DV (1993) Overexpression of a M(r) 110, 000 vesicular protein in non-P-glycoprotein-mediated multidrug resistance. Cancer Res 53: 1475–1479.

M. Marroni et al. / Neuroscience 121 (2003) 605– 617 Scheper RJ, Scheffer GL, Flens MJ, Van DV, Broxterman HJ, Izquierdo MA (1996) Transporter molecules in multidrug resistance. Cytotechnology 19:187–190. Schinkel AH (1999) P-Glycoprotein, a gatekeeper in the blood-brain barrier. Adv Drug Deliv Rev 36:179 –194. Schinkel AH, Wagenaar E, Van DL, Mol CA, Borst P (1995) Absence of the mdr1a P-glycoprotein in mice affects tissue distribution and pharmacokinetics of dexamethasone, digoxin, and cyclosporin A. J Clin Invest 96:1698 –1705. Schneider J, Lucas R, Sanchez J, Ruibal A, Tejerina A, Martin M (2000) Modulation of molecular marker expression by induction chemotherapy in locally advanced breast cancer: correlation with the response to therapy and the expression of MDR1 and LRP. Anticancer Res 20:4373–4377. Schneider J, Rubio MP, Barbazan MJ, Rodriguez-Escudero FJ, Seizinger BR, Castresana JS (1994) P-glycoprotein, HER-2/neu, and mutant p53 expression in human gynecologic tumors. J Natl Cancer Inst 86:850 –855. Scholz D, Cai WJ, Schaper W (2001) Arteriogenesis, a new concept of vascular adaptation in occlusive disease. Angiogenesis 4:247–257. Scott BW, Wang S, Burnham WM, De Boni U, Wojtowicz JM (1998) Kindling-induced neurogenesis in the dentate gyrus of the rat. Neurosci Lett 248:73–76. Seegers U, Potschka H, Loscher W (2002) Expression of the multidrug transporter P-glycoprotein in brain capillary endothelial cells and brain parenchyma of amygdala-kindled rats. Epilepsia 43:675–684. Sisodiya SM, Heffernan J, Squier MV (1999) Over-expression of Pglycoprotein in malformations of cortical development. Neuroreport 10:3437–3441. Sisodiya SM, Lin WR, Squier MV, Thom M (2001) Multidrug-resistance protein 1 in focal cortical dysplasia. Lancet 357:42–43. Sugawara I, Akiyama S, Scheper RJ, Itoyama S (1997) Lung resistance protein (LRP) expression in human normal tissues in comparison with that of MDR1 and MRP. Cancer Lett 112:23–31. Takemura M, Gomi H, Colucci-Guyon E, Itohara S (2002a) Protective role of phosphorylation in turnover of glial fibrillary acidic protein in mice. J Neurosci 22:6972–6979. Takemura M, Nishiyama H, Itohara S (2002b) Distribution of phosphorylated glial fibrillary acidic protein in the mouse central nervous system. Genes Cells 7:295–307. Tan Z, Sankar R, Shin D, Sun N, Liu H, Wasterlain CG, Schreiber SS (2002a) Differential induction of p53 in immature and adult rat brain following lithium-pilocarpine status epilepticus. Brain Res 928:187– 193.

617

Tan Z, Sankar R, Tu W, Shin D, Liu H, Wasterlain CG, Schreiber SS (2002b) Immunohistochemical study of p53-associated proteins in rat brain following lithium-pilocarpine status epilepticus. Brain Res 929:129 –138. Tatsuta T, Naito M, Oh h. T, Sugawara I, Tsuruo T (1992) Functional involvement of P-glycoprotein in blood-brain barrier. J Biol Chem 267:20383–20391. Tews DS, Nissen A, Kulgen C, Gaumann AK (2000) Drug resistanceassociated factors in primary and secondary glioblastomas and their precursor tumors. J Neurooncol 50:227–237. Thiebaut F, Tsuruo T, Hamada H, Gottesman MM, Pastan I, Willingham MC (1989) Immunohistochemical localization in normal tissues of different epitopes in the multidrug transport protein P170: evidence for localization in brain capillaries and crossreactivity of one antibody with a muscle protein. J Histochem Cytochem 37: 159 –164. Thottassery JV, Zambetti GP, Arimori K, Schuetz EG, Schuetz JD (1997) p53-dependent regulation of MDR1 gene expression causes selective resistance to chemotherapeutic agents. Proc Natl Acad Sci USA 94:11037–11042. Tishler DM, Weinberg KI, Hinton DR, Barbaro N, Annett GM, Raffel C (1995) MDR1 gene expression in brain of patients with medically intractable epilepsy. Epilepsia 36:1–6. Webster MJ, Knable MB, Johnston-Wilson N, Nagata K, Inagaki M, Yolken RH (2001) Immunohistochemical localization of phosphorylated glial fibrillary acidic protein in the prefrontal cortex and hippocampus from patients with schizophrenia, bipolar disorder, and depression. Brain Behav Immun 15:388 –400. Wolf HK, Campos MG, Zentner J, Hufnagel A, Schramm J, Elger CE, Wiestler OD (1993) Surgical pathology of temporal lobe epilepsy: experience with 216 cases. J Neuropathol Exp Neurol 52:499 –506. Wolf HK, Muller MB, Spanle M, Zentner J, Schramm J, Wiestler OD (1994) Ganglioglioma: a detailed histopathological and immunohistochemical analysis of 61 cases. Acta Neuropathol (Berl) 88:166 – 173. Xiang H, Hochman DW, Saya H, Fujiwara T, Schwartzkroin PA, Morrison RS (1996) Evidence for p53-mediated modulation of neuronal viability. J Neurosci 16:6753–6765. Zentner J, Hufnagel A, Wolf HK, Ostertun B, Behrens E, Campos MG, Elger CE, Wiestler OD, Schramm J (1997) Surgical treatment of neoplasms associated with medically intractable epilepsy. Neurosurgery 41:378 –386.

(Accepted 24 June 2003)