Relationship between the induction of proteins in the HSP70 family and thermosensitivity in two species of Oryzias (Pisces)

~

Pergamon

Comp. Biochem. PhysioL Vol. 109B,No. 4, pp. 647 654, 1994

Copyright ~ 1994ElsevierScienceLtd Printed in Great Britain.All rights reserved 0305-0491/94$7.00+ 0.00

0305-0491(94)00118-9

Relationship between the induction of proteins in the HSP70 family and thermosensitivity in two species of Oryzias (Pisces) Ayami Arai, Hiroshi Mitani, Kiyoshi Naruse and Akihiro Shima Laboratory of Radiation Biology, Zoological Institute, School of Science, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan A cultured fish cell line, CE, derived from Oryzias celebensis, which lives in a tropical zone, was more heat-resistant than the OL32, which were derived from the Japanese medaka, Oryzias latipes which lives in a temperate zone. Protein synthesis in OL32 cells was also more heat-sensitive than that in CE cells. The relative levels in proteins of the HSP70 family and the ability of cells to tolerate severe heat treatment after a conditioning heat treatment were examined. Twenty-four hours after conditioning heat treatment, both cell lines retained thermotolerance even though three proteins in the HSP70 family had returned to their control levels. Key words: HSP70; HSC70; Stress proteins; Fish; Thermosensitivity.

Comp. Biochem. Physiol. 109B, 647-654, 1994.

Introduction Temperature is one of the major environmental factors that limit the distribution and survival of most organisms. Therefore, there is great interest in the cellular mechanisms that control thermosensitivity. Raaphorst et al. (1979) found that, in general, cultured cells derived from animals whose normal body temperature was high were heat-resistant, while cells derived from animals with a low body temperature were heat-sensitive. These observations led to the hypothesis that some aspects of intrinsic heat-resistance are a genetic reflection of a to : H. Mitani, Laboratory of Radiation Biology, Zoological Institute, School of Science, University of Tokyo, Bunkyo-ku, Tokyo 113, Japan. Tel. 81-3-3812-2111 ext. 4443; Fax 81-3-3816-1965; E-mail [email protected]. Received 21 January 1994; accepted 10 June 1994. Correspondence

647

constitutive level of cellular thermosensitivity, whatever the molecular basis for such resistance. Medaka fish which belong to the genus Oryzias, are widely distributed from the tropics to temperate zones in Asia. Oryzias latipes lives in temperate zones, for example, in Japan, China and Korea, while Oryzias celebensis lives in the tropics, on Sulawesi Island in Indonesia. These two species are closely related but they show differences in thermal sensitivity in vivo (Iwamatsu, 1993). We have examined the differences in thermosensitivity of cultured cells derived from these two species of Oryzias, under identical culture conditions. We focused, in particular, on the induction of heat-shock proteins, as part of our study of mechanisms of thermosensitivity of poikilothermic animals.

648

A. Arai et al.

Materials and Methods Cell culture OL32 cells were derived from fins of the Japanese medaka, Oryzias latipes (Komura et al., 1988), while CE cells were derived from an embryo of O. celebensis (present study). Cells were cultured at 33°C in HEPES-buffered L-15 medium (Irvine, Santa Ana, CA) buffered with 10raM HEPES and supplemented with 15 percent fetal calf serum (FSC, PAA, Linz, Austria) and 60/~g/ml kanamycin.

Measurement of growth rates of cells A total of 1.5 x 105 cells was inoculated in each of a number of 25-cm 2 flasks and flasks were incubated at 33°C. After a 24-hr attachment period, the number of cells per flask was counted in three of the flasks. At this time, the medium in the other flasks was renewed and cell were further incubated at 33 °, 37 ° or 40°C. The number of cells per flask was determined 2 and 4 days later, and the increase in numbers of cells relative to the initial number of cells were determined.

Assay of colony-forming ability From 500 to 5000 cells were inoculated in a 60-mm dish and incubated without a change of a medium at 33 or 37°C, with subsequent fixation and staining of colonies formed. Numbers of colonies with 32 or more cells were counted 10-14 days after inoculation of cells.

Heat treatment of cultured cells Cells attached to dishes were used for heat-shock treatments. The dishes were sealed and submerged in water baths that had pre-warmed to chosen temperatures.

Electrophoresis To analyze the newly synthesized proteins, one-dimensional electrophoresis was performed as described by Laemmli (1970), using 10 percent polyacrylamide-SDS slab gels. Cells were pre-incubated in methionine-free D M E M (Sigma, St Louis, MO) for l hr before heat treatment. After heat treatment, cells were labeled

for 1 hr with Tran 35S-labelTM (a hydrolysate of Escherichia coli cells containing L[3~S]methionine; final specific activity of 35S was 370kBq/ml; ICN, Costa Mesa, CA) at 33°C. The incorporation was terminated by removal of the labeling medium and washing of the cells with phosphatebuffered saline (PBS). The cells were then harvested, suspended in sample buffer (62.5 mM Tris, 2% SDS and 5% fl-mercapteothanol) at a concentration of 3 × 103 cells/ml and solubilized by immersion in boiling water for 3 min. To analyze the total complement of proteins, two-dimensional electrophoresis was performed as described by O'Farrell (1975). To prepare the samples for twodimensional electrophoresis, cells were harvested after heat treatment and suspended in sterilized distilled water at a concentration of 108 cells/ml. They were frozen and thawed three times, and then centrifuged to remove cell debris. The samples were concentrated by the freeze-dry method. The details of two-dimensional electrophoresis was described previously (Wong et al., 1993). After electrophoresis, gels were stained using a silverstaining kit (Daiichi Pure Chemical, Tokyo, Japan).

RNA dot-blot analysis Total cellular R N A was isolated using an R N A Extraction Kit (Pharmacia, Milwaukee, WI) 1 hr after heat-shock treatment of the cells. Total R N A was blotted onto Biodyne nylon membranes (Pall, New York, NY) using a microsample filtration manifold device, l0 mg R N A was blotted in each slot. As a probe, we used part of an hsp70related sequence that had been amplified by the polymerase chain reaction (PCR). For use as the template for PCR, cDNA was prepared from the heat-shocked (41°C; 1 hr) OL32 cells with a Micro-Fast Track m R N A isolation kit (Invitrogen, San Diego, CA) and a cDNA synthesis kit (Boehringer Mannheim Yamanouchi, Tokyo, Japan). Primers for PCR were designed from a comparison of hsp70-related sequences from Xenopus, chick, mouse and human. Two conserved regions were selected as

HSP70 and thermosensitivity of fish cells

primer regions (pl and p2). The sequences of these primers were as follows; p 1, 5'GCCAACGACCAGGGCAACC GCAC-CAY (21 mer); and p2, 5"GAAAGGCCAGTGCTTCATGTC3' (21 mer). The product of PCR was a single DNA fragment of 190bp (190-bp PCR product). Amplification by PCR was performed in a total of 5 ~1 of 10 mM Tris-HC1 buffer (pH 8.3) that contained 1.5raM MgCI2, 50mM KCI, 0.01% gelatin, 0.2mM deoxynucleotide triphosphates, 10pM each primer, 1 # g of template DNA and 1 unit of Taq DNA polymerase (Stratagene, La Jolla, CA). The reaction was carried out by 40 cycles of heating at 93°C for 45 see, annealing at 65°C for 45 see and elongation at 72°C for 60 sec. Products of PCR were labeled with [3:p]-dCTP by the random primer method of Feinberg and Vogelstein (1983). The membrane was prehybridized in hybridization buffer [5 × SSPE, 5% Irish Cream liqueur (Baileys, Dublin, Ireland), 10mg/ml denatured calf thymus DNA, 5% SDS] at 65°C for 1 hr. Then the membrane was allowed to hybridize with a radioactive probe in fresh hybridization buffer at 65°C overnight. After the hybridization, the membrane was washed once with 5 x SSC that contained 1% SDS at room temperature for 1 rain, and twice with 2 x SSC that contained 1% SDS at 65°C for 30 min.

Results Thermosensitivity of the two lines of cultured cells Figure 1 shows the growth rates, in terms of relative numbers of cells, of the OL32 line and the CE line at 33, 37 and 40°C. OL32 cells proliferated at 33°C but not at 37°C. CE cells continued to proliferate even at 40°C for as many as 4 days. The colony-forming ability (plating efficiency) of OL32 cells was 18% at 33°C, but they did not form any colonies at 37°C, while that of CE cells was 4.5% at 33°C, and 1.8% at 37°C.

Induction of heat-shock proteins The difference in terms of the heat-shock response between OL32 cells and CE cells was examined by monitoring the induction of proteins and transcription of mRNA. Figure 2 shows the patterns of proteins that were newly synthesized in cells exposed to various temperatures. The synthesis of proteins in OL32 cells was more sensitive to elevated temperatures than that in CE cells. In both lines, the synthesis of HSP90, HSP70 and HSP28 was induced by heat treatment, but the temperatures for induction differed between the cell lines and among species of HSPs. HSP28 was induced at 37°C both in OL32 cells and in CE cells. HSP90 and HSP70 were induced at 37°C in OL32 cells but at 40°C in CE cells. In OL32 cells, the rate of synthesis of 37 °C

33°C

649

10

40 °C 10

J 1

2

4

1

2

(Da~a~erlnooulmlon)

0.1

0.1

0.1

Fig. 1. Growth rates of OL32 cells and the CE cells at various temperatures. 1.5 × 105 cells were inoculated in each of a number of 25-cm 2 flasks and incubated at 33°C. After a 24-hr attachment period, the number of cells per flask was counted in three flasks in each case. At this time, the medium in the other flasks was renewed and flasks were further incubated at 33, 37 or 40°C. The number of cells per flask was determined 2 and 4 days after the first cell count and the increase in number of cells relative to the initial number of cells was determined ( O OL32 cells, x CE cells). At least three flasks were used for each time point.

650

A. Arai et al. eq

0

eq

t2 0

eq

t~ 0

eq

t2 0

t~

?90 :70

728

Tempernture (°C)

33

37

40

42

Fig. 2. Induction of the synthesis of HSPs in OL32 cells and CE cells. The cells were cultured at 33°C. The heat treatments (at 37 ° to 42°C) for 1 hr were followed by incubation of treated cells with 35S-labelr~, for 1 hr at 33°C for radiolabeling of the newly synthesized proteins (see text).

HSP90 was reduced at 40 and 42°C, but in the CE cells, the rate did not decrease even at 42°C. Accumulation of hsp70 transcripts after various heat-shock treatments was examined by R N A dot-blot analysis (Fig. 3). As probe, we used part of an hsp70-related sequence that had been amplified by PCR (190-bp PCR product). The

template for PCR was cDNA prepared from heat-shocked OL32 cells. Under our experimental conditions, hsp70-related transcripts were not detected at 33°C in cells of either line. The accumulation of hsp70 transcripts increased dramatically after heat-shock treatment at 41°C in OL32 cells, while in CE cells the extent of accumu-

Temperature (°C) 37 38 39 40 41 42 43

OL32 CE Fig. 3. Accumulation of heat-inducible transcripts after various heat-shock treatments in OL32 cells and CE cells. Cells were heat-shocked at each indicated temperature for 1 hr, and then they were further incubated at 33°C for 1 hr. Total RNA isolated and 10/~g of RNA were blotted in each slot. Part of an HSP70-related sequence was used as a probe (see text).

HSP70 and thermosensitivity of fish cells

651

42°C for 1 hr, the percentage survival of CE cells after testing heat treatment of 46°C for 10min was about five times higher than Relationship between members of the HSP 70 that of control CE cells and almost family and thermotolerance constant. The relationship between the relative levels of members of the HSP70 family and Discussion acquisition of thermotolerance in terms of The Japanese medaka O. latipes lives cellular survival was examined (Fig. 4). The cells were treated with conditioning heat in northern habitats and O. celebensis lives treatment which could give maximum in southern habitats. O. latipes is exposed to induction of HSP70 in OL32 cells (at 41°C) a wide range of temperatures in nature and CE cells (at 42°C), as shown in Fig. 3. (eurythermic fish), while O. eelebensis lives Then cells were incubated at 33°C for 1 at a high and almost constant temperature or 24hr, and they were treated severe in its natural habitat (stenothermic fish). It heat treatment (at 46°C for 10min) and was easy to establish cell lines from fin or incubated at 33°C for 10-14 days to exam- embryo tissue of O. celebensis both at 37 ine the induction of thermotolerance by and 33°C but all the cell lines from fin or colony formation assay. The amount of embryo tissue of O. latipes failed to proliferHSP70 family proteins was also analyzed ate at 37°C (data not shown). We used two by two-dimensional gel electrophoresis. In lines of fibroblast-like cells (CE and OL32) OL32 cells, one of HSP70 family proteins with high plating efficiencies, which were was not observed in cells cultured at 33°C, derived from different tissues; OL32 was but it appeared immediately after con- derived from fin tissue of O. latipes and CE ditioning heat treatment at 41°C for 1 hr. It was derived from an embryo of O. celebencould not be observed within 24 hr after sis. We have also established several cell conditioning heat treatment. The other two lines from O. celebensis by the same method proteins of HSP70 family, designated as as that used for establishment of OL32 cells HSC70.1 and HSC70.2 were observed when at 33°C. The other cell lines examined the cells were cultured at 33°C, and these showed very low plating efficiencies and it proteins were also induced by heat-shock was difficult to compare their thermosensitreatment. Their levels returned to original tivity quantitatively in terms of colonylow levels within 24 hr after conditioning forming ability. However, their growth heat treatment. An hour after conditioning temperatures and threshold temperatures heat treatment (at 41°C for 1 hr), the for induction of HSPs were dependent on percentage of survival of OL32 cells after the source species and not on the source testing heat treatment at 46°C for 10 min tissue (data not shown). The different increased to 10 times higher than that thermosensitivity of cells in terms of surof cells without conditioning heat treat- vival between the OL32 and CE lines ment. Moreover, 24 hr after conditioning suggests that each line of cells in culture heat treatment, the abundance of HSP70 retained the cellular thermosensitivity of family proteins returned to the control the intact fish and that they were suitable level, and the percentage of surviving cells materials for quantitative analysis of after same testing heat treatment increased factors that determine the thermosensitivity to about three times higher than that of of cells. control cells. The synthesis of proteins in OL32 cells In CE cells, levels of both HSC70.1 and was more heat-sensitive than that in CE HSC70.2 at 33°C were almost same with cells, and the heat-shock proteins identified those in OL32 cells. After heat treatment at in OL32 and CE cells were induced at 42°C, levels of these proteins also returned different temperatures. The temperatures to original low level within 24hr. The for induction of two major heat-shock proamount of HSP70 by heat treatment at teins, HSP70 and HSP90, but not of 42°C for 1 hr was less than that observed in HSP28, were associated with a difference in OL32 cells at 41°C. Both at 1 and 2 4 h r the thermosensitivity of cell growth and after the conditioning heat treatment of protein synthesis. lation of these transcripts was low even at 42°C and above.

'

1hr{ 24hr

lOmin

°

|Omin 1

• - -

lomi.

....................~

'2;~i

:~

~,#{

{

..............................

2D-PAGE

~

ii!i~i~iiiiiiiiil;ii ¸

~;:>

{

60

20,7

2.3

Survival (%)

aa

42-

42 -

46-

aa

4~-

('CI

11 I[

~--[ =~"' .-

,h~

lhr E-"]

lO,'nin

1

lOmio

Heat Treatment

ZD-PAGE

60.4

66.5

11.9

Survival (%)

s shown in the left hand columns. An asterisk shows the time at which the sample for two-dimensional electrophoresis was prepared. The abundance of HSP70 family ~roteins after 2D-PAGE, obtained just before testing heat treatment at 46°C for 10 min are shown in middle columns (a, HSC70.1; b, HSC70.2; c, HSP70). Survival of cells after testing heat treatment at 46°C for 10 min, is shown in the right hand columns.

Fig.4. The induction of thermotolerance and two-dimensional electrophoretic patterns of proteins from OL32 cells and CE cells. The protocol for conditioning treatment

33

4641-

('C)

(*C)

:13

46-

('C)

Heat Treatment

0L32

CE

2

r,.

>

b,a

HSP70 and thermosensitivity of fish cells

The threshold of temperature for induction of heat-shock proteins in fish is not "hard-wired" genetically but may be subject to thermal acclimatization (Chen et al., 1988; Mitani et al., 1989; Dietz and Somero, 1992; Dietz, 1994). We found that the threshold temperature for induction of the synthesis of HSP90 and HSP70, but not of HSP28, in isolated fins of O. latipes changed from 30 to 37°C as the acclimatization temperature was changed from 4 to 36°C (Oda et al., 1991). Ulmasov et al. (1992) investigated the heat-shock response in lizards. They showed that lizards from southern habitats had a higher level of HSP70 proteins in their cells at normal physiological temperature than lizards from northern habitats. The range of temperature necessary for induction of HSP in cells of lizards from southern habitats was higher than that of lizards from northern habitats. The authors suggested that the higher levels of HSPs in the species from southern habitats, as compared to those from northern habitats and detected under normal non-heat-shock conditions, might reflect a readiness to react to abrupt changes in environmental temperature. Dietz and Somero (1992) also reported similar results for eurythermal goby fishes. They suggested that a heat-shock factor (HSF), namely, a protein that is essential for expression of the hsp 70 gene, is inactive when bound to HSP70 so that the level of HSP70 in cells is an important factor in the control of the rate of transcription of the hsp 70 gene. In eurythermic fish, such as O. latipes, most proteins should be able to function over a wide range of temperatures, and high levels of HSP70 may be adaptive for maintaining native structures of protein under heat stress. In the present study, unlike the above-described results for lizards, the relative amounts of HSC70.1 and HSC70.2 did not differ very much between OL32 and CE cells at both normal and high temperatures, in spite of a difference in induction temperatures. Dietz and Somero (1993) reported that different tissues of fish vary widely in their constitutive levels of HSPs even though HSP threshold temperatures for induction of HSPs vary little among tissues and individuals of a species. We could not find any difference in the level of HSC70.1 CBPB 109/4---J

653

and HSC70.2 between OL32 cells and other embryonic cells from O. latipes (data not shown). Thus, there may be some other key factors that determines the threshold temperature for induction of HSP70 proteins, as well as their constitutive levels. In eukaryotic cells, HSP70 uses the energy from ATP to facilitate a variety of protein-folding, -unfolding, -assembly and -disassembly processes, which may prevent loss of function of heat-denatured proteins, and may protect cells from the toxic effects of heat treatment (Lindquist and Craig, 1988; Rothman, 1989; Solomon et al., 1991). Our results reinforce the hypothesis that HSP70 is very closely related to the protection of cells against thermal damage. More effective induction of HSP70 by conditioning heat treatment was observed in OL32 cells than in CE cells. Thus, HSP70 may be the most important protein among members of the HSP70 proteins for the survival of OL32 cells at high temperature. However, the levels of all proteins in the HSP70 family were less closely correlated with thermotolerance 24 hr after a conditioning heat treatment, especially in the case of CE cells. These results suggest that only temporary induction of members of the HSP70 family might be necessary for acquisition of thermoresistance and thermotolerance in the genus Oryzias; their continued presence may not be essential. Acknowledgements--This work was supported in part by Grants-in-Aid for Fundamental Scientific Research from the Ministry of Education, Science, and Culture, Japan, to A.S. and H.M. It was also supported in part by a grant to A.S. from the Fisheries Agency, Japan.

References Chen J. D., Yew F. H. and Li G. C. (1988) Thermal adaptation and heat shock response of Tilapia ovary cells. J. cell Physiol. 134, 189-199. Dietz T. J. (1994) Acclimation of the threshold induction temperatures for 70-kDa and 90-kDa heat shock proteins in the fish Gillichthys mirabilis. J. exp. Biol. 188, 333-338. Dietz T. J. and Somero G. N. (1992) The threshold induction temperature of the 90-kDa heat shock protein is subject to an acclimatization in eurythermal goby fishes(genus Gillichthys). Proc. natn. Acad. Sci. U.S.A. 89, 3389-3393. Dietz T. J. and Somero G. N. (1993) Species- and tissue-specific synthesis patterns for heat-shock

654

A. Arai et al.

proteins hsp70 and hsp90 in several marine teleost fishes. Physiol. Zool. 66, 863-88. Feinberg A. P. and Vogelstein B. (1983) A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Analyt. Biochem. 132, 6-13. Iwamastu T. (1993). The Biology of the Medaka (in Japanese), pp. 300-301. Scientists Inc., Tokyo. Komura J., Mitani H. and Shima A. (1988) Fish cell culture: establishment of two fibroblast-like cell lines (OL-17 and OL-32) from fins of the Medaka, Oryzias latipes. In Vitro Cell. Devel. Biol. 24, 294-298. Laemmli U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680-685. Lindquist S. and Craig E. A. (1988) The heat shock proteins. A. Rev. Genet 22, 631-677. Mitani H., Naruse K. and Shima A. (1989) Eurythermic and stenothermic growth of cultured fish cells and their thermosensitivity. J. Cell Sci. 93, 731-737. Oda S., Mitani H., Naruse K. and Shima A. (1991) Synthesis of heat shock proteins in the isolated fin of the Medaka, Oryzias latipes, acclimatized to

various temperatures. Comp. Biochem. Physiol. 98B, 587-591. O'Farrell P. H. (1975) High resolution twodimensional electrophoresis of proteins. J. biol. Chem. 250, 4007-4021. Raaphorst G., Romano S., Mitchell J. B., Bedford J. and Dewey W. C. (1979) Intrinsic difference in heat and/or x-ray sensitivity of seven mammalian cell lines cultured and treated under identical conditions. Cancer Res. 39, 396--401. Rothman J. E. (1989) Polypeptide chain binding proteins: catalysts of protein folding and related process in cells. Cell 59, 591-601. Solomon J. M., Rossi J. M., Golic K., McGarry T. and Lindquist S. (1991) Change in hsp70 alter thermotolerance and heat-shock regulation in Drosophila. New Biologist 3, 1106-1120. Ulmasov K. A., Shammakov S. and Evgen'ev M. B. (1992) Heat shock proteins and thermoresistance in lizards. Proc. natn. Acad. Sci. U.S.A. 89, 1666-1670. Wong V. W. T., Naruse K. and Phang S. M (1993) Mini iso-electric focusing device to be used with the Bio-Rad Mini-Protean II system. Analyt. Biochem. 212, 299-301.