Renal endothelin gene expression is increased in remnant kidney and correlates with disease progression

Kidney International, Vol. 43, (1993), pp. 354—358

Renal endothelin gene expression is increased in remnant kidney and correlates with disease progression SILvIA ORislo, ARIELA BENIGN!, ISABELLA BRuzzI, DANIELA CORNA, NORBERTO PERIc0, CARLA ZOJA, LUCA BENATTI, and GIUSEPPE REMUZZI Mario Negri Institute for Pharmacological Research, Bergamo and Biotechnology Department, Farmitalia Carlo Erba, Research Laboratories, Nerviano, Italy

[1—3]. Beside aortic endothelium, cultured bovine glomerular endothelial and human and rat mesangial cells constitutively express pre-pro-endothelin gene and release the corresponding whether the increased urinary endothelin in this model were due to protein in the cell supernatant [4-6]. By virtue of its vasoactive induction of renal pre-pro-endothelin-l gene and whether changes in properties, endothelin may play a major role in the control of endothelin synthetic pathway correlated with the development of renal hemodynamics in normal and, possibly more importantly, glomerulosclerosis. Four groups of rats with renal mass reduction and in disease conditions. Furthermore, the recent observation that four groups of sham-operated control rats were studied 7, 30, 60 and 120 days after the surgical procedure. Urinary protein excretion in renal endothelin induces mesangial cell proliferation and contraction mass ablation animals did not differ from controls at seven days, but [7—9] and increases the expression of extracellular matrix prowas already significantly elevated (P < 0.01) 30 days after surgery. tein mRNA [101 has raised interest in its potential role in renal Then proteinuria progressively increased in rats with remnant kidney at disease progression. We have previously documented [ill that values above 400 mg/day at day 120. Serum creatinine concentration also progressively increased with time in renal mass ablation rats, renal cortical tissue and isolated glomeruli from animals after extensive reduction of renal mass generate significantly more unlike sham-operated animals, and values were significantly different (P < 0.01) at each of the points considered. Rats with renal mass endothelin than the control kidney. This was associated with an Renal endothelin gene expression is increased in remnant kidney and correlates with disease progression. We previously demonstrated that urinary endothelin excretion is increased in rats with extensive renal mass reduction, a model of progressive renal disease. Here we explored

increased urinary excretion of endothelin, which is likely to reflect renal synthesis of the peptide [11] in rats with remnant at day 120, Seven days after renal mass reduction renal pre-proendothelin-l (pre-pro ET) mRNA was comparable to that of sham- kidney as compared to sham-operated animals. The present study was designed to explore whether the operated rats, while a 2.5-, 5- and fourfold increase in 2.3 Kb preproET-l transcript was observed at 30, 60 and 120 days, respectively. increased urinary excretion of endothelin in this model were

reduction, unlike sham-operated animals, developed focal glomerulosclerosis that affected 8% of glomeruli at day 30, and 24% of glomeruli

Urinary excretion of endothelin was significantly elevated (P < 0.01) in

rats with renal mass reduction with respect to sham-operated rats, starting from 30 days after surgery and increased further thereafter. A significant correlation (P < 0.01) was found between urinary endotheljn-l excretion values and the percent of glomeruli affected by glomerulosclerosis. We conclude that the progression of renal disease after surgical ablation of renal mass is associated with an increased renal endothelin-l gene expression together with an excessive urinary excretion of the corresponding protein. It is speculated that endothelin may mediate glomerular structural abnormalities associated with the progression of renal disease in this model.

due to induction of renal pre-pro-endothelin-1 gene and whether

changes in endothelin synthetic pathway correlated with the development of glomerulosclerosis. Methods

Male Sprague-Dawley rats (Charles River Italia S.p.A., Calco, Italy) weighing 290 to 330 g at the start of the experiment were used in these studies. All animals were allowed free access

to standard rat laboratory diet containing 20% protein by weight, and tap water. Experimental design

Endothelin, first isolated and purified from porcine aortic endothelial cells, is a potent vasoconstrictor peptide of 21

Renal mass was reduced by removal of right kidney and amino acids encoded by a single gene [1]. Expression of ligation of two or three branches of the left renal artery under pre-pro-endothelin-l mRNA in porcine aortic endothelium is increased by a variety of chemical and mechanical stimuli including the calcium ionophore A23187, thrombin, epinephrifle, transforming growth factor-p and enhanced shear stress Received for publication February 26, 1992 and in revised form October 10, 1992 Accepted for publication October 10, 1992

© 1993 by the International Society of Nephrology

ether anesthesia according to Olson [121. A preliminary experiment was carried out in seven rats 60 days after the surgical procedure and in seven sham-operated animals. Subsequently, four groups of rats were considered which were studied at 7 (N = 10), 30 (N = 10), 60 (N 8) and 120 (N = 10) days. As controls four groups of five rats each were subjected to sham operation with manipulation of pedicles and followed for 7, 30, 60 and 120 days. At the end of the experimental periods 24-hour urine samples were collected in metabolic cages for determination of protein and endothelin excretion and blood withdrawn

354

355

Orisio et al: Endothelin gene in renal disease

from the tail vein for hematocrit and serum creatinine determiEndothelin extraction and assessment in urine nations. At sacrifice, kidneys were excised and renal tissue was Five milliliter aliquots of each urine collection were extracted processed for RNA extraction and histological evaluation. as previously described [11], lyophilized and stored at —20°C

until use. Extracted samples were resuspended in phosphate Oligonucleotides

Oligos were synthesized in a 380 B automatic DNA synthesizer (Applied Biosystems). The sense-orientation primer (ohgo 1: 5'GACATCGTCGACATGGATFATTTTCCCGTGATC) and the antisense orientation primer (oligo 2:S'GTCAGCGTCGACCTGTAGTCAATGTGCTCGGTT) having Sal I linker at their 5' ends, were based on the published sequence of the rat endothehin-l cDNA [13]. PCR cloning of the rat endothelin-1 cDNA

buffer (pH 7.2) containing 0.1% Triton X-lOO and 0.3% albumin (RIA buffer) immediately before the assay.

After assessment of total recovered radioactivity (range: 75 to 85%), endothelin was assayed by radioimmunoassay at a final

dilution of 1:5. Either standard or unknown samples were mixed with the antiserum (Peninsula, Belmont, California, USA; final dilution 1:72,000) and incubated for 24 hours at 4°C, then 12,000 cpm of 1251-endothelin was added and the incuba-

tion prolonged for 24 hours at 4°C. Separation of free from antibody-bound labeled peptide was achieved by addition of an immunoprecipitating mixture consisting of a sheep anti-rabbit IgG and polyethylene glycol for 30 minutes at room temperature

Ten to 20 ig of rat kidney RNA were incubated, after and subsequent centrifugation at 1700 x g for 20 minutes.

annealing, at 42°C for two hours in a 40-pi reverse transcription Supernatants were removed by aspiration with a vacuum pump mixture containing: 50 mi Tris HC1 pH 8.3; 60mM KCI; 10mM and pellet radioactivity detected by a gamma counter (BeckMgC12; 1 mivi dithiothreitol, 50 tg/ml actinomycin D, 10 units of man, Irvine, California, USA). Results were expressed as

RNasin (Promega), 0.5 mrt dNTPs, 1.6 g oligo d(T) and 20

units of AMW reverse transcriptase (Boehringer). The mixture was then extracted with phenol/chloroform and ethanol precipitated. The resulting cDNA/RNA pellet was resuspended in 40 l H20. PCR was performed at a final concentration of lx PCR buffer (10 mti Tris-HCI pH 8.3; 50 mrvi KCI; 2 mM MgCl2), 50 M dNTP, 0.1 /LM sense and antisense oligos (oligo 1 and oligo 2), 2.5 units of Taq DNA Polymerase (Perkin-Elmer/Cetus) in a total volume of 100 d. Amplification cycle was: one minute at 60°C, 2.5 minutes at 72°C and one minute at 94°C. The cycle was repeated 30 times. The amplified product of the expected

pg/day. The detection limit of the assay was 0.4 pg/tube,

nonspecific binding did not exceed 2% of total radioactivity. Cross reactivity of anti-endothelin antibody was as follows: endothelin-2, 46.9%; endothelin-3, 17%; and Big endothelin-l,

9%. Intra- and interassay variability averaged 9% and 14%. Validation of RIA measurements was performed by comparison with different antisera and by recovery of cold endothehin- 1

added to urine. For the sake of simplicity immunoreactive endothehin will be called endothelin.

Pathological studies size was Sal I digested, gel purified and inserted into pTZl9 Fragments of kidneys were fixed for 12 hours in Dubosqvector (Pharmacia). The sequence of our cDNA fragment was Brazil, dehydrated in alcohol, and embedded in paraffin. Secidentical to the region included between nucleotide 1 and tions (3 Lm) were stained with hematoxylin and eosin, Masnucleotide 615 of rat endothelin-1 cDNA published by Sakurai son's trichrome, periodic acid-Schiff reagent (PAS stain) and et al [13]. This was also confirmed by restriction mapping. RNA isolation from rat kidneys and Northern blot analysis Total RNA from rat kidneys was prepared by isothiocyanate extraction and centrifugation throughout cesium chloride [14], poly(AY RNA was then selected by ohigo(dT)-cellulose column chromatography (Clontech mRNA separator). Previous work

Wilder's reticulin, Sections including superficial and juxtamedullary glomeruli were evaluated. For each animal, at least 150

glomeruli were examined and the percentage of glomeruli presenting focal or global glomerulosclerosis was determined. Analytical

Urinary protein concentration was determined by the

showed the presence of a 2.3 Kb endothelin-l transcript in Coomassie blue dye-binding with BSA as standard [17]. Serum mRNA from rat kidney of very low intensity [13]. Thus, we creatinine was measured by alkaline picrate method [18]. collected and pulled together portions of remnant kidneys of Statistical analysis renal mass ablation animals and, after mRNA extraction, we All results are expressed as means SD. Data were analyzed loaded up to 15 g rat kidney mRNA for each Northern analysis. mRNA (10 to 15 g) from renal mass reduction and by analysis of variance and subsequent multiple comparisons sham-operated rats was fractionated on 1.2% formaldehyde were performed using SAS program [19]. Protein and endotheagarose gel and blotted onto synthetic membranes (Gene un urinary excretion data were log-transformed before statistiScreen Plus, New England Nuclear, Boston, Massachusetts, cal analysis. Urinary endothelin excretion was correlated with USA). Rat endothelin-l cDNA was labeled by a random-primed percent of sclerotic glomeruhi by linear regression analysis.

Statistical significance was defined as P < 0.05. hybridized with 32P-labeled pre-pro-endothelin- 1 probe and Results with mouse a-actin eDNA [16], taken as internal standard of equal loading of the samples on the membrane, and exposed to Table 1 shows results of proteinuria, renal function and X-ray film for autoradiography. Differential expression in renal gtomerulosclerosis in rats with renal mass ablation as compared mass reduction, as compared with sham-operated animals, was to sham-operated animals studied at different time intervals from the surgery. At day 7 urinary protein excretion was calculated using densitometric analysis. labeling method using (alpha-32P)dCTP [15]. Membranes were

356

Cq3

RMR kidney

5

0

RMR kidney

Control kidney

6

Control kidney

Orisio et al: Endothelin gene in renal disease

9.c

Time, days Cl)

Fig. 1. Densitometric analysis of autoradiographic signals showing

pre-pro-endothelin mRNA expression in kidneys of rats studied at d{/ferent time intervals from surgery. The optical density of the auto-

radiographic signals was quantitated and calculated as the ratio of

CD

pre-pro-endothelin to actin mRNA. The mRNA level of each control tissue was assigned the number 1.0 and the intensity of the transcripts of reduction of renal mass kidneys was calculated relative to the mRNA levels of control kidneys of the corresponding time.

n-i

comparable in renal mass reduction and sham-operated animals. Massive proteinuria appeared by day 30 after surgery in animals with renal mass ablation and was significantly (P < 0.01) different from controls. At day 120 a further increase in urinary protein excretion was observed in renal mass reduction rats at values which were significantly higher (P < 0.01) than those observed at days 30 and 60. Serum creatinine concentration was significantly higher in rats with renal mass ablation as compared to sham-operated animals at each time point considered. Within the group of animals with reduction of renal mass

values of serum creatinine concentrations were significantly higher (P < 0.01) at day 30 versus day 7 and progressively increased thereafter. At 30 days after surgery rats with renal mass ablation developed glomerulosclerotic changes which affected an average of 8% of glomeruli. Sham-operated animals

were completely free of sclerosis at that time. At 60 and 120 days after surgery, percent of glomeruli affected by sclerotic changes increased in animals with reduction of renal mass, reaching an average of 19% and 24%, respectively. No glomerulosclerosis developed in sham-operated animals at any time point considered up to the end of the study. The time course of pre-pro-endothelin-1 gene induction during the evolution of the disease in rats with remnant kidney is given in Figure 1. Densitometric analysis of the autoradiographic signals shows that endothelin-1 transcript levels were comparable in rats with renal mass reduction and controls when

studied at seven days. Transcriptional rates of pre-pro-endothelin-1 gene progressively increased at 30 and 60 days after renal ablation, the mRNA levels being 2.5- and fivefold higher than corresponding controls, respectively. No further increase in endothelin-1 transcript was observed in rats 120 days after surgical procedure. Figure 2 shows a representative Northern blot analysis of a single 2.3 Kb endothelin-1 mRNA transcript from kidneys studied 60 days after surgery or sham operation. Consistent with gene expression data, the urinary excretion of endothelin was significantly elevated (P <0.01, Table 1) in rats with renal mass reduction in respect to sham-operated rats,

Fig. 2. Endothelin gene expression in kidney homogenate from shamoperated (control) and renal mass reduction (RMR) rats, Experiments were performed 60 days after the surgical procedure. Messenger RNA (10 g) obtained from kidneys of 7 RMR and 7 control rats was blotted onto synthetic membranes, which were hybridized with rat endothelin-1 and mouse a-actin cDNAs.

starting from 30 days after surgery. Thereafter values progressively increased with time in animals with remnant kidney but

not in sham-operated animals. As it is depicted in Figure 3, linear regression analysis indicates that values for urinary endothelin excretion parallel structural injury, with a significant correlation (P < 0.01) between values for endothelin excretion and percentage of sclerolic glomeruli in individual rats. Discussion

We have found that endothelin gene expression by kidney homogenates from animals with renal mass ablation progressively increased with time in the remnant kidney model up to four- to fivefold as compared to sham-operated animals. More-

over, the results of the present study confirm and extend previous observation that urinary endothelin excretion values

357

Orisio et a!: Endothelin gene in renal disease

Table 1. Renal function parameters, urinary endothelin excretion (U-ET) and focal glomerulosclerosis in rats with renal mass reduction (RMR) and sham-operated (controls) at different times after surgery

Group RMR RMR RMR RMR

Day 7 30 60

29 221

14

238

118C

171a

7 30 60

16

3

18 2 27 16 27 4

120

1.4 1.7 1.5

0.2k

0.6 0.6 0.6 0.7

Glomeruli with sclerotic changes % (range)

U-ET pg/day 31.5 9.6

0.4a

1(0—2) 8 (0—25) 19 (7—37) 24 (6—63)

264.1

0.1 0.1 0.1 0.1

0 0 0 0

28.8 32.5 35.4 37.6

1.9 o.4

465 248

120

Control Control Control Control

Serum creatinine mg/dl

Proteinuria mg/day

88.3 175.8

36.O' 1O4.6

1l6.7' 13.8

6.6 2.9 3.7

Values are expressed as mean SD. a P < 0.01 versus control at corresponding time b P < 0.01 versus RMR at 7 days P < 0.02 versus RMR at 30 days d P < 0.02 versus RMR at 60 days P < 0.01 versus RMR at 60 days

•

50

.

40 a)

E 0 0) 30

0 0 a) 20 0

Of interest to interpret our present findings is the recent evidence that platelets stimulate in a time-dependent manner the expression of gene encoding endothelin- 1 and the release of the mature peptide from endothelial cells. A second possibility that may explain changes in the endothelin synthetic pathway in glomerular diseases starts from the observation that mesangial

.•

cells constitutively express endothelin gene [5, 6]. A recent

progressively increase with time and parallel signs of renal

expression in the kidney of animals with remnant kidney

study [4] has also documented that exposure of mesangial cells to inflammatory mediators such as transforming growth facCl) tor-/3, the thromboxane mimetic U46619 and thrombin increase 0 • specific endothelin mRNA transcripts three- to sixfold over the 10 basal value. Since most renal diseases, including the remnant kidney model, are associated with an influx of inflammatory 0 cells into the kidney, it is conceivable that mediators released 0 100 200 400 500 by infiltrating neutrophils and macrophages act as a stimulus for 300 mesangial cell to increase endothelin synthesis. Actually, in Endoth&in urinary excretion vitro experiments have documented that endothelin stimulates pg/day mitogenesis of cultured rat mesangial cells coupled with the Fig. 3. Correlation between urinary endothelin excretion and % of increased expression of proto-oncogene c-fos and c-myc [7] sclerolic glomeruli in rats (N = 30) with remnant kidney studied at day which normally precedes cell proliferation. Proliferating mesan7,30, 60 and 120 after the surgical procedure. r = 0.76; P < 0.01. gial cells up-regulate extracellular matrix proteins which may favor the development of glomerular scarring [21, 221. Furthermore, data are available that in rat mesangial cells endothelin increases expression of mRNA for collagen type I, III and IV, are enhanced in animals with renal mass reduction and also and laminin [101. Our data that increased endothelin-1 gene injury including proteinuria and glomerulosclerosis [11]. Taken correlates with focal and segmental glomerulosclerosis are quite together, these results seem to consistently indicate that proconsistent with the recent finding of Osada et a! [23] who found gressive renal disease which follows renal mass reduction is increased endothelin- 1 mRNA levels in glomeruli and medulla associated with changes in the regulation of endothelin gene from animals with focal glomerulosclerosis induced by puromyfollowed by an increased renal synthesis of the corresponding cm aminonucleoside. protein which can be measured in the urine. We speculate that in both models increased endothelin gene Several explanations may be provided for such findings: one expression would favor the development of focal glomerulois that extensive ablation of renal mass is associated with major sclerosis and contribute to the progression of glomerular dis-

hemodynamic changes due to blood flow redistribution in ease either by inducing a local vasoconstriction as well as by remnant glomeruli. Increased blood flow is one of the major determinants of shear stress and data are available to indicate stimulating mesangial cell proliferation [7] and excessive synthat shear stress stimulates the expression of endothelin gene thesis of mesangial matrix proteins [101. [31. Moreover, platelet accumulation within the glomerular tuft Acknowledgment occurs at a very early stage of the remnant kidney model [20] The authors are deeply indebted to Dr. Tullio Bertani for studying followed by platelet activation and microvascular thrombosis. renal histology in these animals.

358

Orisio et a!: Endothelin gene in renal disease

Reprint requests to Giuseppe Remuzzi, M.D., Mario Negri Institute for Pharmacological Research, Via Gavazzeni, 11-24100 Bergamo, Italy.

Regulation of mRNA expression for extracellular matrix (ECM) by cultured rat mesangial cells (MCs). (abstract) J Am Soc Nephrol 2:546, 1991

11. BENIGN! A, PERICO N, GASPARI F, ZOJA C, BELLIZZI L,

References 1. YANAGISAWA M, KURIHARA H, K!MURA S, TOMOBE Y, K0BA-

YASHI M, MITSUI Y, YAZAKI Y, GoTo K, MASAKI T: A novel

potent vasoconstrictor peptide produced by vascular endothelial cells. Nature (Lond) 332:411—415, 1988 2. KURIHARA H, YOSHIZUMI M, SUGIYAMA T, TAKAKU F, YANAGISAWA M, MASAKI T, HAMAOKI M, KATO H, YAZAKI Y: Trans-

forming growth factor-/3 stimulates the expression of endothelin mRNA by vascular endothelial cells. Biochem Biophys Res Cornmun 159:1435—1440, 1989 3. Yosrnzurn M, KURIHARA H, SUGIYAMA T, TAKAKU F, YANAGI-

SAWA M, MASAKI T, YAZAKI Y: Hemodynamic shear stress

stimulates endothelin production by cultured endothelial cells. Biochem Biophys Res Commun 161:859—864, 1989 4. MARSDEN PA, DOREMAN DM, COLLINS T, BRENNER BM, OJuCIN

SH, BALLERMANN BJ: Regulated expression of endothelin-1 in glomerular capillary endothelial cells. Am J Physiol 261 :Fl 17— F125, 1991 5. ZOJA C, ORislo S, PERIc0 N, BENIGN! A, MORIGI M, BENATTI L, RAMBALDI A, REMUZZI G: Constitutive expression of endothelin

gene in cultured human mesangial cells and its modulation by transforming growth factor-J3, thrombin, and a thromboxane A2

analogue. Lab Invest 64:16—20, 1991 6. SAKAMOTO H, SA5AKI S, HIRATA Y, IMAI T, ANDO K, IDA T, SAKURAI T, YANAGISAWA M, MASAIU T, MARUMO F: Production

of endothelin-1 by rat cultured mesangial cells. Biochem Biophys Res Commun 169:462—468, 1990

7. Siorso MS, WANN S, MENE P, DUBYAC GR, KESTER M, NAKAZATO Y, SEDOR JR, DUNN MJ: Endothelin stimulates phos-

pholipase C, NaJH exchange, c-fos expression, and mitogenesis in rat mesangial cells. J Clin Invest 83:708—712, 1989 8. SIM0N50N MS, DUNN MJ: Endothelin-1 stimulates contraction of rat glomerular mesangial cells and potentiates /3-adrenergic-mediated cyclic adenosine nionophosphate accumulation. J Clin In vest 85:790—797, 1990 9. BADR KF, MURRAY JJ, BRaYER MD, TAKAHASHI K, INAGAMI T,

GABANELLI M, REMUZZI G: Increased renal endothelin production in rats with reduced renal mass. Am JPhysiol26o:F331—F339, 1991

12. OLSON JL: Role of heparin as a protective agent following reduction of renal mass. Kidney mt 25:376—382, 1984 13. SAICURA! T, YANAGJSAWA M, INUOE A, RYAN US, KIMURA S, MITsuI Y, GoTo K, MASAKI T: eDNA cloning, sequence analysis

and tissue distribution of rat preproendothelin-l mRNA. Biochem

Biophys Res Commun 175:44—47, 1991 14. RAMBALDI A, YOUNG DC, GRIFFIN JD: Expression of the M-CSF (CSF-1) gene by human monocytes. Blood 69: 1409-1413, 1987 15. FEINBERG AP, VOLGESTEIN B: A technique for radiolabeling DNA

restriction endonuclease fragments to high specific activity. Anal Biochem 132:6—13, 1983

16. MINTY A, CARAVATTI M, ROBERT B, COHEN A, DAUBAS P, WEIDERT A, GROS F, BUCKINGAM ME: Mouse actin messenger RNAs. Construction and characterization of a recombinant plasmid

molecule containing a complementary DNA transcript of mouse s-actin mRNA. JBiol Chem 256:1008—1014, 1981

17. READ SM, NORTHCOTE DH: Minimization of variation in the response to different proteins of the Coomassie blue G dye binding assay for protein. Anal Biochem 116:53—64, 1981 18. BONSNES RW, TAUSSKY HA: The colorimetric determination of creatinine by the Jaffè reaction. J Biol Chem 158:581—591, 1945 19. SAS/Stat User's Guide, version 6 (4th ed, vol 2). Cary, NC, SAS Institute Inc., 1989 20. FLOEGE J, BURNS MW, ALPERS CE, YOSHIMURA A, PRITZL P, GORDON K, SEIFERT RA, BowaN-PopE DF, COUSER WG, JOHN-

SON RJ: Glomerular cell proliferation and PDGF expression precede glomerulosclerosis in the remnant kidney model. Kidney mt 41 :297—309, 1992

21. ISHIMURA F, STEEZEL RB, BUDDE K, KASHGARIAN M: Formation

of extracellular matrix by cultured rat mesangial cells. Am J Pathol 134:843—855, 1989 22. STERZEL RB, LOVETT DH, FOELLMER HG, PERFETTO M, BIEMESDERFER D, KASHGARIAN M: Mesangial cells hillocks. Nodular foci

HARRIS RC: Mesangial cell, glomerular and renal vascular re-

of exaggerated growth of cells and matrix in prolonged culture. Am JPathol 125:130—140, 1986

sponses to endothelin in the rat kidney. J Gun Invest 83:336—342,

23. OSADA S, NAKAMURA T, EBIHARA I, SUZUKI S. T0MINO Y, KOIDE

1989 10. IsH!MURA F, SHOUJI S, NISHIZAWA Y, MoRn H, KASHGARIAN M:

H: Endothelin gene expression in glomeruli and medulla from focal glonierulosclerosis (FSG). (abstract) JAm Soc Nephrol 2:4 12, 1991