- Email: [email protected]
reoxygenation
Accepted Manuscript Title: Overexpression of Mitofusin2 decreased the reactive astrocytes proliferation in vitro induced by oxygen-glucose deprivation/reoxygenation Author: Yulong Shi Chengla Yi Xiao Li Jiangpeng Wang Fangyuan Zhou Xiaoqian Chen PII: DOI: Reference:
S0304-3940(16)31000-X http://dx.doi.org/doi:10.1016/j.neulet.2016.12.052 NSL 32521
To appear in:
Neuroscience Letters
Received date: Revised date: Accepted date:
15-9-2016 19-12-2016 20-12-2016
Please cite this article as: Yulong Shi, Chengla Yi, Xiao Li, Jiangpeng Wang, Fangyuan Zhou, Xiaoqian Chen, Overexpression of Mitofusin2 decreased the reactive astrocytes proliferation in vitro induced by oxygen-glucose deprivation/reoxygenation, Neuroscience Letters http://dx.doi.org/10.1016/j.neulet.2016.12.052 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Overexpression of Mitofusin2 decreased the reactive astrocytes proliferation
in
vitro
induced
by
oxygen-glucose
deprivation/reoxygenation
Yulong Shi1, Chengla Yi1,4, Xiao Li2, Jiangpeng Wang1, Fangyuan Zhou1, Xiaoqian Chen3
1
Department of Traumatic Surgery, Tong--ji Hospital, Tongji Medical
College, Huazhong University of Science and Technology, Wuhan, China Jie Fang Avenue 1095, Wuhan, China.Tel.: +86 027 83665346; fax: +86 027 83665346. 2
Department of Neurology, Tongji Hospital, Tongji Medical College,
Huazhong University of Science and Technology, Wuhan, Hubei 430030, China 3
Department of Pathophysiology, School of Basic Medicine, Key Laboratory
of Neurological Diseases, Ministry of Education and Hubei Provincial Key
1
Laboratory of Neurological Diseases, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China 4
Address correspondence and reprint requests to:
Cheng la Yi (E-mail address: [email protected])
Highlights: Astrocytes turned into reactive mitotic cells by cell-cycle translation and Ras-p-Raf1-p-ERK1/2 proteins expression. Mfn2 expression both in mRNA and protein levels was decreased in reactive astrocytes. Overexpression of Mfn2 markedly suppressed the proliferation of astrocytes
The mechanism relies on inhibiting Ras-Raf-ERK signaling pathway and blocking cell cycle translation.
2
Abstract Glia scar is a hallmark in late-stage of brain stroke disease, which hinder axonal regeneration and neuronal repair. Mitofusin2 (Mfn2) is a newly found cellular proliferation inhibitor. This study is to elucidate the role of Mfn2
in
reactive
astrocytes
induced
by
oxygen-glucose
deprivation/reoxygenation(OGD/R) model in vitro. Up-expression in EdU staining and protein level of GFAP, PCNA and CyclinD1, demonstrates the distinct activation and proliferation of astrocytes after the stimulation of OGD/R. Meanwhile, Mfn2 was proved to be down-regulated both in gene and protein levels. Pretreatment of cells with adenoviral vector encoding Mfn2 gene increased Mfn2 expression and subsequently attenuated OGD-induced
astrocyte
proliferation.
Down-regulation
of
Ras-p-Raf1-p-ERK1/2 pathway and cell cycle arrest were found to be relevant. Together, these results suggested that overexpression of Mfn2 can effectively inhibit the proliferation of reactive astrogliosis, which might contribute to a promising therapeutic intervention in cerebral ischemic injury.
3
Keywords:
Mitofusin2; Astrocyte; Ischemia；Proliferation; Cell-cycle;
Ras-p-Raf1-p-ERK1/2
1. Introduction Ischemic stroke is a major cause of death and the primary cause of adult disability worldwide[1]. The occlusion of an artery in the brain is the most common cause of this disorder, which produces localized reductions in blood flow and cause cerebral ischemia[2]. Astrocytes, the most abundant cell type in the central nervous system, comprise the structural architecture of the brain, help organize communication pathways, and modulate neuronal plasticity and support neurons to maintain homeostasis[3]. In response to cerebral ischemia damage, astrocytes acquire characteristic functional and morphological features referred to as reactive gliosis and glial scar[4]. Reactive astrocytes are the main cells consisting the glial scar, although oligodendrocytes and microglia are also included[5]. Upregulation of intermediate filament (IF) proteins, in particular glial fibrillary acidic protein 4
(GFAP) by reactive astrocytes，is the best known hallmark of reactive astrocytes[6]. In central nervous system injury, reactive astrocytes perform both beneficial and detrimental functions. In the acute phase following ischemic damage, glial scar formation is beneficial for sealing the site of injury, remodeling the tissue, and temporally and spatially controlling the local immune response; however, excessive astrogliosis and severe glial scar hamper neurite outgrowth and neurogenesis in the chronic phase[7-9]. Thus, astrocytes have recently garnered attention as a breakthrough target for manipulation in development of effective therapeutic strategies for stroke patients. It is important to explore fundamental molecular and relevant signaling mechanisms of hypertrophy of astrocytes. On one hand, mounts of evidences have demonstrated that MAPKs pathway and Cell cycle progression take part in the activation of astrocytes under ischemic injury[10]. On the other hand, Mfn2 gene, a mitochondrial GTPase located at the mitochondrial outer membrane, is highly expressed in the heart, skeletal muscle and brain[11, 12], in which its downregulation contribute to the proliferative diseases[11-13]. The anti-proliferative effect of Mfn2 was mainly mediated by arresting cell cycle in the G0/G1 phases 5
and inhibiting the Ras-p-Raf1-p-ERK1/2 pathway by binding a negative control point in the Ras pathway[12, 14]. Our previous study demonstrated that overexpression of mitofusin2 inhibited reactive astrogliosis proliferation in vitro, however, the definite mechanism remains further to be elucidated[15]. To mimic ischemia-reperfusion injury in vivo, OGD/R model was established. 2. Materials and Methods 2.1. Primary Cortical Astrocyte Culture Our protocol was approved by the Institutional Animal Care and Use Committee of HUST University College of Medicine and all animals were treated in accordance with their guidelines. Primary cortical astrocyte cultures were prepared from 24-hr postnatal Sprague Dawley rats according to a standard procedure[16]. Cells were plated onto poly-L-lysine-coated (Sigma-Aldrich, Munich, Germany) dishes at a density of 1–2 × 106 cells per cm2 and cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) and 0.5 mg/ml penicillin/streptomycin at 37°C in a 90% humidity and 5% CO2 incubator. Astrocytes were purified 6
by shaking. After two weeks, primary astrocytes were trypsinized and replated onto 35mm dishes at 3×104 cell/cm2 density for subsequent experiments. More than 95% of the cultured cells were astrocytes as identified by immunofluorescence staining for GFAP. 2.2. OGD/R model OGD was achieved as described previously[17]. Briefly, complete growth media were changed to the one free of glucose and serum and then transferred to a closed anaerobic chamber (Thermo Forma, Marietta, OH, USA) with 1% O2 and 37°C. After 6h OGD, cultures were then restored in fresh DMEM/F12 containing 10% FBS and at 37°C, 95% O2/5%CO2 for 6h, 12h and 24h, respectively. 2.3. Adenovirus infection and expression identification Replication-defective adenovirus encoding the complete rat Mfn2 (Ad-Mfn2) and the control adenovirus (Ad-GFP) was constructed by BGI Tech (Shenzhen, China). Astrocytes were infected with control Ad-GFP or Ad-Mfn2 for 24 h at a MOI of 30 pfu/cell and then replaced with complete culture medium. Cells were used to the following experiments after 72 h
7
infection, in which time mfn2 was proved to be significantly overexpressed by western-blotting. 2.4. Edu staining To evaluate cell proliferation [16], 5-ethynyl-29-deoxyuridine (EdU) assay kit (Ribobio, Guangzhou, China) was adopted according to the manufacturer’s instructions. Briefly, cells were incubated with culture medium containing 10M EdU for 24 h. After being fixed with 4% paraformaldehyde for 30 min, the cells were naturalized with 2 mg/ml glycine and permeabilized with 0.2% triton X-100. The template of DNA was chased by Apollo® staining solution for 30 min. Cells were incubated with Hoechst 33342 for nuclei labeling. Finally, three random fields were photographed with a fluorescence microscope to count EdU positive cells. 2.5. Reverse transcription polymerase chain reaction Total RNA was extracted from cells with Trizol Reagent® (Invitrogen). After DNase treatment (Promega), RNA was then reversely transcribed to first strand cDNA using random primers and M-MLVreverse transcriptase (Invitrogen). Real-time quantitative PCR was performed, in duplicate, using an Invitrogen SYBR green kit on an ABI Prism 7500 Sequence Detection 8
System (Applied Biosystems). Gene specific primers were designed using Vector
NTI
(Invitrogen).
The
primers
TGGCTCAAGACTATAAGCTACGG TATGGCGGTGCAGTTCATTC GCAAGAGCGCCTTGACGATA
for
(forward)
-3’ (reverse);
-3’
Mfn2
for
Ras
(forward)
-3’
were:
5‘-
and
5‘-
were:
5‘-
and
5‘-
GTCCCTCATTGCACTGTACTC -3’ (reverse); for β-actin were: 5‘CACGATGGAGGGGCCGGACTCATC TAAAGACCTCTATGCCAACACAGT
-3’ -3
(forward) (reverse).
and
5‘-
Transcription
abundance was expressed as fold increase over a control value calculated by 2-ΔΔCt method. The amplification efficiency was comparable for both genes. 2.6. Western immunoblots Protein was extracted from whole cell lysates, and their concentration was calculated with the BCA protein assay (Thermo Fisher Scientific). Proteins were separated on a 10% sodium dodecyl sulfate-polyacrylamide gel and then transferred onto immobilon-NC membranes (Millipore, Billerica, MA) and incubated overnight with primary antibodies against PCNA (1:1000 CST), Mfn2 (1:1000 CST), GFAP (1:1500 Sigma), Ras(1:20000 Abcam), 9
p-Raf1 (1:500 CST), p-ERK1/2(1:1000 CST)，cyclinD1(1:1000 CST) or β-actin (1:1000 CST). Then the membranes were incubated with Odyssey secondary antibodies (780-conjugated goat anti-rabbit and anti-mouse IgG, 1:15000) for 1 h, then visualized and quantified by Odyssey IR imaging system (Li-COR Bioscience, USA). 2.7. Cell cycle analysis Astrocytes were harvested, washed with PBS and fixed in 70% ice-cold ethanol overnight. Then, cells were treated with 0.5 mg/ml RNase (Invitrogen) for 30 min and finally stained with propidium iodide (PI, Invitrogen) for additional 30 min at room temperature. Flow cytometry analysis (Becton-Dickinson) was performed for the cell cycle analysis. 2.8. Statistical analysis All measurements are done in triplicate and denoted as mean ± SEM. Statistically significant differences (p<0.05) between two groups and among more than two groups were evaluated by one-way ANOVA with Tukey’s post hoc test, respectively.
10
3. Results 3.1. Astrocytes proliferated after OGD/R stimulation with mfn2 being decreased both in mRNA and protein levels GFAP, a basic and specific substance for astrocytes to participate in glial scar formation, increased persistently after hypoxia/reperfusion stimulation (Fig. 1A). To investigate the proliferation level of astrocytes subjected to OGD/R, the biomarkers including PCNA and CyclinD1 were investigated. Western-blot showed that both of PCNA (involved in DNA replication and repair) and CyclinD1 (a key marker indicating the cell cycle through the G1 phase to the S phase) markedly increased with time after OGD/R and reached a plateau at 12h reoxygenation(Fig. 1A). Furthermore, proportion of Edu(+) cells increased gradually after stimulation, with the peak at 12h re-oxygenation (Fig. 1C).
These findings proved that OGD/R model in
vitro successfully activated astrocytes and induced their proliferation in a time-dependent manner. To investigate the possible mechanism of astrocytes proliferation after OGD/R stimulation, the distribution of the different cell cycle phases (G0/G1, S, and G2/M) were then analyzed by flow cytometry. The cell-cycle 11
analysis showed that G0/G1 phase of reactive astrocytes decreased and S, G2/M phases increased, both of which were time-dependent and reached a plateau at 12h reoxygenation(Fig. 1D). Meanwhile, Mfn2 expression both in mRNA and protein levels was found to decrease with time (Fig. 1A and B), negatively correlated with reactive astrocyte proliferation bio-marker. 3.2. The possible mechanism of AS proliferation was through activating Ras-Raf1-ERK1/2 pathway To investigate the possible mechanism of astrocytes proliferation after OGD/R stimulation, the Ras-Raf1-ERK1/2 pathway was analyzed by western-blot. Western-blot showed that Ras-p-Raf1-p-ERK1/2 proteins expression noticeably up-regulated with time after OGD/R and reached a plateau at 12h reoxygenation(Fig. 2).
The above results showed that
reactive astrocytes may be mediated by through the activation of Ras-Raf1-ERK1/2 pathway. 3.3. Overexpression of Mfn2 inhibited the reactive astrocyte proliferation via cell cycle progression and Ras-p-Raf1-p-ERK1/2signal pathway
12
To further elucidate the underlying mechanism revolved in the anti-proliferative
effect
of
Mfn2
on
astrocytes,
as
expected,
adenovirus-Mfn2 infection successfully increased the expression of Mfn2 (Fig. 3A). At the highest proliferative vitality of astrocytes, OGD6h/R12h, overexpression of Mfn2 markedly down-regulated the high level of GFAP, PCNA and cyclinD1 expression (Fig. 3A), as well as Edu positive cells proportion induced (Fig. 3B).
These findings suggested that AdMfn2
significantly inhibited astrocytes proliferation. Flow
cytometry analysis
indicated
that
the
cells
infected
by
adenovirus-Mfn2 showed a sharp increase in the G0/G1 phase, but markedly decrease in S and G2/M fractions compared to the control and Adv-GFP groups, which demonstrated that upregulation of Mfn2 could arrested the cell-cycle progression of astrocytes induced by the OGD/R stimulation(Fig. 3C). To further elucidate the underlying mechanism of Mfn2 induced anti-proliferative effect on astrocytes, the Ras-p-Raf1-p-ERK1/2 proteins expression were compared among Adv-Mfn2 group, Adv-GFP group and control group by western-blot at 12h reoxygenation. Compared with 13
Adv-GFP group and control group, activation of Ras-p-Raf1-p-ERK1/2 pathway was significantly inhibited in the Adv-Mfn2 group, proved by the downregulating expression of relevant proteins (Fig. 3D). To elucidate the exact mechanism of Mfn2 to Ras, RT-PCR was adopted. The results demonstrated that Mfn2 overexpression decreased Ras expression at transcriptional level (Fig. 4). These results indicated that overexpression of Mfn2 inhibited the reactive astrocyte proliferation via cell cycle progression and Ras-p-Raf1-p-ERK1/2signal pathway. 4. Discussion Reactive astrogliosis is a pathologic hallmark of the central nervous system (CNS). Reactive astrocytes contribute to beneficial effects, a defense mechanism to minimize and repair the initial damage at early phases. However, the formation of glia scar is definitely harmful to neuronal repair and axonal outgrowth [9]. Therefore, inhibiting the glia scar and excessive gliosis may contribute to the neuronal repair and axonal outgrowth. Mfn2, also called hyperplasia suppressor gene (HSG), is a novel gene characterized as a cell proliferation inhibitor [12]. Accumulative data have implied that mfn2 possesses potent antiproliferative properties in VSMCs[12], tumor[18], 14
atherosclerosis[13], and hypertension[19]. Our previous study demonstrated for the first time overexpression of mitofusin2 inhibited reactive astrogliosis proliferation in vitro [15]. However, the phosphorylated active forms of ERK1/2 (phospho-ERK1/2) well recognized as the downstream substrate of Mfn2 in controlling cell proliferation, did not show significant changes either in scratch injury or serum stimulation model. The possible failure to observe the change of p-ERK1/2 expression might be these models could not persistently activate the signal pathway. OGD/R model was adapted in the present study to elucidate the definite mechanism of mfn2 in inhibiting reactive astrogliosis. Mounts of evidences demonstrated that quiescent astrocytes acquire characteristic functional and morphological features referred to as reactive gliosis and glial scar in response to cerebral ischemia damage, with GFAP significantly
and specifically upregulated[4]. In our study, GFAP
expression was significantly and consistently increased, which indicated the astrocytes underwent gliosis in response to the in vitro OGD/reoxygenation. PCNA is normally synthesized during the S-phase in the cell cycle, although it is also present at very low levels in quiescent cells[20]. 15
Similarly, CyclinD1, as an important positive regulator for the transition of the cell cycle from the G1 to S phase, is involved in cell proliferation and considered as a general biomarker of mitotic cells[21]. Previous studies indicated that cell cycle-related proteins was markedly elevated in reactive astrocytes, and reactive gliosis was inhibited via reducing cyclinD1and PCNA expression and cell-cycle progression [22, 23], which is similar to our result. We demonstrated that cyclinD1 and PCNA upregulated and reached a plateau at OGD6hR12h. Meanwhile, Mfn2 expression both in mRNA and protein levels was found to decrease with time dependent negatively correlated with reactive astrocyte proliferation bio-marker. The results indicated that there seems to be some relation Mfn2 downregulation and bio-markers upregulation in reactive astrocytes. To further elucidate the hypothesis, Edu staining and cell-cycle analysis were adopted. Cell cycle translation is also involved in astrocytes activation [21, 24]. The results of Edu staining and cell-cycle analysis demonstrated that the quiescent cells changed into reactive mitotic cells and the cell-cycle was transited from the G0/G1 phases to S and G2/M phases and reached a summit at 12 h, which changed synchronously with these biomarkers. The above results also 16
showed that quiescent astrocytes were continuously activated and the proliferation activity reached the summit at 12h reoxygenation, which may be mediated by promoting cell-cycle translation.
Previous studies have
demonstrated that activation the MAPKs pathway trigger quiescent astrocytes into reactive astrocytes； and activation of the MAPK/ERE1/2 pathway under ischemic injury actually protects astrocytes [10]. In the present study, we showed a similar result of Ras-p-Raf1-p-ERK1/2 proteins expression. Previous studies demonstrated that mfn2 is an upstream and negative regulator of Ras protein, and overexpression of mfn2 blocks cell proliferation via blocking Ras-p-Raf1-p-ERK1/2 signaling pathway and cell cycle progression[12, 14]. Summing up our above results, we hypothesize that there may be a link between mfn2 and Ras-Raf-ERK1/2 signaling pathway and cell-cycle translation in astrocytes, and exogenous mfn2 can inhibit reactive gliosis by down-regulating the signal pathway proteins and inhibiting cell-cycle progression. Overexpression of Mfn2 markedly suppressed the proliferation of astrocytes, with the high level of GFAP, PCNA and cyclinD1 expression 17
down-regulated. These results imply that exogenous Mfn2 gene can inhibit the activities of reactive gliosis, which may be helpful to prevent glia scar formation. In this study, we also demonstrated that by overexpression of mfn2 the astrocyte cell-cycle distribution was arrested in G0/G1 phases, coupled with a sharp decline of Edu (+) staining ratio. Meanwhile, exogenous mfn2 significantly inhibited activation of Ras-p-Raf1-p-ERK1/2 pathway, proved by the downregulating expression of relevant proteins. Kuang-Hueih Chen[12] first found that overexpression of Mfn2 markedly inhibited the Ras–Raf–MEK–ERK1/2 signaling cascade and resulted in cell cycle arrest in the G0/G1 phases, thus blocking mitogenic stimuli or injury mediated VSMC proliferation and preventing balloon injury induced restenosis. To dissect the possible mechanistic pathway that links Mfn2 with anti-proliferation, they found that Mfn2 could bind to Ras and subsequently suppress
the
Ras-Raf-ERK1/2
Co-immunoprecipitation
method.
MAPK
signaling
However,
the
pathway
via
result
of
co-immunoprecipitation of Mfn2 protein with Ras was fairly faint [12]. What’s more, neither their work detected nor revealed whether the expression of Ras was affected by Mfn2. To today, studies [25-28] about the 18
relationship between Mfn2 and Ras were directed from the study by Kuang-Hueih Chen. A recent study found Ras could be downregulated and the Ras-Raf-Erk1/2 signaling pathway could be inhibited via upregulating the expression of MFN2 in VMSCs [29]. To study the exact mechanism of Mfn2 to Ras, RT-PCR was adopted. The results demonstrated that Mfn2 overexpression decreased Ras expression at transcriptional level. However, compared with the remarkable result of western-blot of Mfn2 protein with Ras, the result of RT-PCR was fairly faint. We supposed that, although Mfn2 expression regulates Ras at transcriptional levels, it cannot be ruled out the participation of other mechanisms which is our further study to explore. In conclusion, our study confirmed that Mfn2 is a potential hyperplasia suppressor gene in reactive astrocytes. Exogenous mfn2 over-expression, mediated by an adenovirus vector, provided an anti-proliferative effect by down-regulating the expression of PCNA, cyclinD1, GFAP and Edu (+) percentage. And the molecular mechanism of mfn2 blocking the proliferation of astrocytes may be via suppressing Ras-Raf-ERK1/2 pathway and cell cycle retardation. These observations indicate that Mfn2 might be a 19
potential novel hyperplasia suppressor gene for reactive gliosis and possibly an important therapeutic target for the treatment of glia scar. Acknowledgements This study was supported by research grants from the Chinese National Natural Science Foundation (Grant NO. 81271348).
20
References [1] B. Gabryel, D. Kasprowska, A. Kost, K. Labuzek, T. Urbanek, [Astrocytes in ischemic stroke - a potential target for neuroprotective strategies], Postepy higieny i medycyny doswiadczalnej (Online), 69 (2015) 384-397. [2] H. Kawano, A. Bivard, L. Lin, N.J. Spratt, F. Miteff, M.W. Parsons, C.R. Levi, Relationship Between Collateral Status, Contrast Transit, and Contrast Density in Acute Ischemic Stroke, Stroke, 47 (2016) 742-749. [3] M.V. Sofroniew, H.V. Vinters, Astrocytes: biology and pathology, Acta neuropathologica, 119 (2010) 7-35. [4] M. Komitova, E. Perfilieva, B. Mattsson, P.S. Eriksson, B.B. Johansson, Effects of cortical ischemia and postischemic environmental enrichment on hippocampal cell genesis and differentiation in the adult rat, Journal of Cerebral Blood Flow and Metabolism, 22 (2002) 852-860. [5] A. Rolls, R. Shechter, M. Schwartz, NEURON - GLIA INTERACTIONS - OPINION The bright side of the glial scar in CNS repair, Nat. Rev. Neurosci., 10 (2009) 235-U291. [6] M. Pekny, U. Wilhelmsson, M. Pekna, The dual role of astrocyte activation and reactive gliosis, Neuroscience letters, 565 (2014) 30-38. [7] G. Barreto, R.E. White, Y. Ouyang, L. Xu, R.G. Giffard, Astrocytes: targets for neuroprotection in stroke, Central nervous system agents in medicinal chemistry, 11 (2011) 164-173. [8] M.F. Anderson, F. Blomstrand, C. Blomstrand, P.S. Eriksson, M. Nilsson, Astrocytes and stroke: networking for survival?, Neurochemical research, 28 (2003) 293-305. [9] S. Karimi-Abdolrezaee, R. Billakanti, Reactive astrogliosis after spinal cord injury-beneficial and detrimental effects, Molecular neurobiology, 46 (2012) 251-264. [10] Z. Jiang, Y. Zhang, X. Chen, P.Y. Lam, H. Yang, Q. Xu, A.C. Yu, Activation of Erk1/2 and Akt in astrocytes under ischemia, Biochemical and biophysical research communications, 294 (2002) 726-733. [11] D. Bach, S. Pich, F.X. Soriano, N. Vega, B. Baumgartner, J. Oriola, J.R. Daugaard, J. Lloberas, M. Camps, J.R. Zierath, R. Rabasa-Lhoret, H. Wallberg-Henriksson, M. Laville, M. Palacin, H. Vidal, F. Rivera, M. Brand, A. Zorzano, Mitofusin-2 determines mitochondrial network architecture and mitochondrial metabolism. A novel regulatory mechanism altered in obesity, The Journal of biological chemistry, 278 (2003) 17190-17197. [12] K.H. Chen, X. Guo, D. Ma, Y. Guo, Q. Li, D. Yang, P. Li, X. Qiu, S. Wen, R.P. Xiao, J. Tang, Dysregulation of HSG triggers vascular proliferative disorders, Nature cell biology, 6 (2004) 872-883. [13] Y.H. Guo, K. Chen, W. Gao, Q. Li, L. Chen, G.S. Wang, J. Tang, Overexpression of Mitofusin 2 inhibited oxidized low-density lipoprotein induced vascular smooth muscle cell proliferation and reduced atherosclerotic lesion formation in rabbit, Biochemical and biophysical research communications, 363 (2007) 411-417. 21
[14] K.R. Chien, M. Hoshijima, Unravelling Ras signals in cardiovascular disease, Nature cell biology, 6 (2004) 807-808. [15] T. Liu, C.C. Xue, Y.L. Shi, X.J. Bai, Z.F. Li, C.L. Yi, Overexpression of mitofusin 2 inhibits reactive astrogliosis proliferation in vitro, Neuroscience letters, 579 (2014) 24-29. [16] J.P. Schwartz, D.J. Wilson, Preparation and characterization of type 1 astrocytes cultured from adult rat cortex, cerebellum, and striatum, Glia, 5 (1992) 75-80. [17] Q. Yang, E.Y. Wang, X.J. Huang, W.S. Qu, L. Zhang, J.Z. Xu, W. Wang, D.S. Tian, Blocking epidermal growth factor receptor attenuates reactive astrogliosis through inhibiting cell cycle progression and protects against ischemic brain injury in rats, Journal of neurochemistry, 119 (2011) 644-653. [18] G.-E. Zhang, H.-L. Jin, X.-K. Lin, C. Chen, X.-S. Liu, Q. Zhang, J.-R. Yu, Anti-Tumor Effects of Mfn2 in Gastric Cancer, International journal of molecular sciences, 14 (2013) 13005-13021. [19] L. Fang, X.L. Moore, X.M. Gao, A.M. Dart, Y.L. Lim, X.J. Du, Down-regulation of mitofusin-2 expression in cardiac hypertrophy in vitro and in vivo, Life sciences, 80 (2007) 2154-2160. [20] W. Strzalka, A. Ziemienowicz, Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation, Annals of botany, 107 (2011) 1127-1140. [21] Z. Zhu, Q. Zhang, Z. Yu, L. Zhang, D. Tian, S. Zhu, B. Bu, M. Xie, W. Wang, Inhibiting cell cycle progression reduces reactive astrogliosis initiated by scratch injury in vitro and by cerebral ischemia in vivo, Glia, 55 (2007) 546-558. [22] S. Di Giovanni, V. Movsesyan, F. Ahmed, I. Cernak, S. Schinelli, B. Stoica, A.I. Faden, Cell cycle inhibition provides neuroprotection and reduces glial proliferation and scar formation after traumatic brain injury, Proceedings of the National Academy of Sciences of the United States of America, 102 (2005) 8333-8338. [23] J. Qiu, C. Zhang, Y. Lv, Y. Zhang, C. Zhu, X. Wang, W. Yao, Cdh1 inhibits reactive astrocyte proliferation after oxygen-glucose deprivation and reperfusion, Neurochemistry international, 63 (2013) 87-92. [24] H. Kato, A. Takahashi, Y. Itoyama, Cell cycle protein expression in proliferating microglia and astrocytes following transient global cerebral ischemia in the rat, Brain research bulletin, 60 (2003) 215-221. [25] H. Liao, J. Gong, W. Zhang, X. Guo, Valsartan inhibits angiotensin II-induced proliferation of vascular smooth muscle cells via regulating the expression of mitofusin 2, Journal of Huazhong University of Science and Technology. Medical sciences = Hua zhong ke ji da xue xue bao. Yi xue Ying De wen ban = Huazhong keji daxue xuebao. Yixue Yingdewen ban, 32 (2012) 31-35. [26] C. Liu, B. Ge, C. He, Y. Zhang, X. Liu, K. Liu, C. Qian, Y. Zhang, W. Peng, X. Guo, Mitofusin 2 decreases intracellular lipids in macrophages by regulating peroxisome proliferator-activated receptor-gamma, Biochemical and biophysical research communications, 450 (2014) 500-506. 22
[27] W. Zhou, K.H. Chen, W. Cao, J. Zeng, H. Liao, L. Zhao, X. Guo, Mutation of the protein kinase A phosphorylation site influences the anti-proliferative activity of mitofusin 2, Atherosclerosis, 211 (2010) 216-223. [28] Q. Li, G. Li, X. Lan, M. Zheng, K.H. Chen, C.M. Cao, R.P. Xiao, Receptor interacting protein 3 suppresses vascular smooth muscle cell growth by inhibition of the phosphoinositide 3-kinase-Akt axis, The Journal of biological chemistry, 285 (2010) 9535-9544. [29] W. Zhang, C. Shu, Q. Li, M. Li, X. Li, Adiponectin affects vascular smooth muscle cell proliferation and apoptosis through modulation of the mitofusin-2-mediated Ras-Raf-Erk1/2 signaling pathway, Molecular medicine reports, 12 (2015) 4703-4707.
23
[First Authors Last Name] Page 24
Fig. 1. Astrocytes proliferated after OGD/R stimulation with biomarkers upregulation, cell cycle translation, and mfn2 being decreased both in mRNA and protein levels (A) Biomarkers expression of GFAP, PCNA, CyclinD1 was upregulated , and Mfn2 protein was downregulated with time-dependent in reactive astrocytes (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). (B) Mfn2 gene was downregulated in reactive astrocytes (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). (C) EdU (red) and Hoechst 33342 (blue) were double stained to assess astrocytes proliferation in OGDR-stimulation model. Percentages of EdU-positive cells in each group for corresponding time points were statistically analyzed. Scale bars = 200μm. (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). (D)The cell cycle progression of AS was promoted by OGD/R with time-dependent (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test).
[Insert Running title of <72 characters]
[First Authors Last Name] Page 25
Fig. 2. The Ras-p-Raf1-p-ERK1/2 signaling was activated in reactive astrocytes (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). The relative expression level of Ras was normalized to β-actin, while the relative expression levels of p-c-Raf and p-ERK1/2 were normalized to total c-Raf and ERK 1/2.
Fig. 3. Overexpression of Mfn2 inhibited the reactive astrocyte proliferation with biomarkers downregulation, cell cycle translation arrested and signaling pathway inhibition (A) Biomarkers expression of GFAP, PCNA, CyclinD1 was down regulated by overexpression of mfn2 at OGD6hR12h time point (n = 3 for each group, p < 0.05 vs. sham group, one-way ANOVA with Tukey post hoc test). (B) EdU (+) astrocytes were downregulated by overexpression of mfn2. Scale bars = 200 wei'miμm. (n = 3 for each group, p < 0.05 vs. sham group, one-way ANOVA with Tukey post hoc test). (C)The cell cycle progression of AS was arrested by overexpression of mfn2 (n = 3 for each group, p < 0.05 vs. sham group, one-way ANOVA with Tukey post hoc test).
[Insert Running title of <72 characters]
[First Authors Last Name] Page 26
(D)The Ras-p-Raf1-p-ERK1/2 signaling was inhibited by overexpression of mfn2 (n = 3 for each group, p < 0.05 vs. the uninfected group, one-way ANOVA with Tukey post hoc test). The relative expression level of Ras was normalized to β-actin, while the relative expression levels of p-c-Raf and p- ERK 1/2 were normalized to total c-Raf and ERK 1/2.
Fig. 4. Overexpression of Mfn2 inhibited Ras mRNA expression Ras mRNA gene was downregulated in Adv-mfn2 group, compared to Adv-GFP group and control group (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test).
[Insert Running title of <72 characters]
[First Authors Last Name] Page 27
Fig 1
[Insert Running title of <72 characters]
[First Authors Last Name] Page 28
Fig 2
[Insert Running title of <72 characters]
[First Authors Last Name] Page 29
Fig 3
[Insert Running title of <72 characters]
[First Authors Last Name] Page 30
Fig 4
[Insert Running title of <72 characters]
S0304-3940(16)31000-X http://dx.doi.org/doi:10.1016/j.neulet.2016.12.052 NSL 32521
To appear in:
Neuroscience Letters
Received date: Revised date: Accepted date:
15-9-2016 19-12-2016 20-12-2016
Please cite this article as: Yulong Shi, Chengla Yi, Xiao Li, Jiangpeng Wang, Fangyuan Zhou, Xiaoqian Chen, Overexpression of Mitofusin2 decreased the reactive astrocytes proliferation in vitro induced by oxygen-glucose deprivation/reoxygenation, Neuroscience Letters http://dx.doi.org/10.1016/j.neulet.2016.12.052 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Overexpression of Mitofusin2 decreased the reactive astrocytes proliferation
in
vitro
induced
by
oxygen-glucose
deprivation/reoxygenation
Yulong Shi1, Chengla Yi1,4, Xiao Li2, Jiangpeng Wang1, Fangyuan Zhou1, Xiaoqian Chen3
1
Department of Traumatic Surgery, Tong--ji Hospital, Tongji Medical
College, Huazhong University of Science and Technology, Wuhan, China Jie Fang Avenue 1095, Wuhan, China.Tel.: +86 027 83665346; fax: +86 027 83665346. 2
Department of Neurology, Tongji Hospital, Tongji Medical College,
Huazhong University of Science and Technology, Wuhan, Hubei 430030, China 3
Department of Pathophysiology, School of Basic Medicine, Key Laboratory
of Neurological Diseases, Ministry of Education and Hubei Provincial Key
1
Laboratory of Neurological Diseases, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China 4
Address correspondence and reprint requests to:
Cheng la Yi (E-mail address: [email protected])
Highlights: Astrocytes turned into reactive mitotic cells by cell-cycle translation and Ras-p-Raf1-p-ERK1/2 proteins expression. Mfn2 expression both in mRNA and protein levels was decreased in reactive astrocytes. Overexpression of Mfn2 markedly suppressed the proliferation of astrocytes
The mechanism relies on inhibiting Ras-Raf-ERK signaling pathway and blocking cell cycle translation.
2
Abstract Glia scar is a hallmark in late-stage of brain stroke disease, which hinder axonal regeneration and neuronal repair. Mitofusin2 (Mfn2) is a newly found cellular proliferation inhibitor. This study is to elucidate the role of Mfn2
in
reactive
astrocytes
induced
by
oxygen-glucose
deprivation/reoxygenation(OGD/R) model in vitro. Up-expression in EdU staining and protein level of GFAP, PCNA and CyclinD1, demonstrates the distinct activation and proliferation of astrocytes after the stimulation of OGD/R. Meanwhile, Mfn2 was proved to be down-regulated both in gene and protein levels. Pretreatment of cells with adenoviral vector encoding Mfn2 gene increased Mfn2 expression and subsequently attenuated OGD-induced
astrocyte
proliferation.
Down-regulation
of
Ras-p-Raf1-p-ERK1/2 pathway and cell cycle arrest were found to be relevant. Together, these results suggested that overexpression of Mfn2 can effectively inhibit the proliferation of reactive astrogliosis, which might contribute to a promising therapeutic intervention in cerebral ischemic injury.
3
Keywords:
Mitofusin2; Astrocyte; Ischemia；Proliferation; Cell-cycle;
Ras-p-Raf1-p-ERK1/2
1. Introduction Ischemic stroke is a major cause of death and the primary cause of adult disability worldwide[1]. The occlusion of an artery in the brain is the most common cause of this disorder, which produces localized reductions in blood flow and cause cerebral ischemia[2]. Astrocytes, the most abundant cell type in the central nervous system, comprise the structural architecture of the brain, help organize communication pathways, and modulate neuronal plasticity and support neurons to maintain homeostasis[3]. In response to cerebral ischemia damage, astrocytes acquire characteristic functional and morphological features referred to as reactive gliosis and glial scar[4]. Reactive astrocytes are the main cells consisting the glial scar, although oligodendrocytes and microglia are also included[5]. Upregulation of intermediate filament (IF) proteins, in particular glial fibrillary acidic protein 4
(GFAP) by reactive astrocytes，is the best known hallmark of reactive astrocytes[6]. In central nervous system injury, reactive astrocytes perform both beneficial and detrimental functions. In the acute phase following ischemic damage, glial scar formation is beneficial for sealing the site of injury, remodeling the tissue, and temporally and spatially controlling the local immune response; however, excessive astrogliosis and severe glial scar hamper neurite outgrowth and neurogenesis in the chronic phase[7-9]. Thus, astrocytes have recently garnered attention as a breakthrough target for manipulation in development of effective therapeutic strategies for stroke patients. It is important to explore fundamental molecular and relevant signaling mechanisms of hypertrophy of astrocytes. On one hand, mounts of evidences have demonstrated that MAPKs pathway and Cell cycle progression take part in the activation of astrocytes under ischemic injury[10]. On the other hand, Mfn2 gene, a mitochondrial GTPase located at the mitochondrial outer membrane, is highly expressed in the heart, skeletal muscle and brain[11, 12], in which its downregulation contribute to the proliferative diseases[11-13]. The anti-proliferative effect of Mfn2 was mainly mediated by arresting cell cycle in the G0/G1 phases 5
and inhibiting the Ras-p-Raf1-p-ERK1/2 pathway by binding a negative control point in the Ras pathway[12, 14]. Our previous study demonstrated that overexpression of mitofusin2 inhibited reactive astrogliosis proliferation in vitro, however, the definite mechanism remains further to be elucidated[15]. To mimic ischemia-reperfusion injury in vivo, OGD/R model was established. 2. Materials and Methods 2.1. Primary Cortical Astrocyte Culture Our protocol was approved by the Institutional Animal Care and Use Committee of HUST University College of Medicine and all animals were treated in accordance with their guidelines. Primary cortical astrocyte cultures were prepared from 24-hr postnatal Sprague Dawley rats according to a standard procedure[16]. Cells were plated onto poly-L-lysine-coated (Sigma-Aldrich, Munich, Germany) dishes at a density of 1–2 × 106 cells per cm2 and cultured in DMEM (Gibco) supplemented with 10% FBS (Gibco) and 0.5 mg/ml penicillin/streptomycin at 37°C in a 90% humidity and 5% CO2 incubator. Astrocytes were purified 6
by shaking. After two weeks, primary astrocytes were trypsinized and replated onto 35mm dishes at 3×104 cell/cm2 density for subsequent experiments. More than 95% of the cultured cells were astrocytes as identified by immunofluorescence staining for GFAP. 2.2. OGD/R model OGD was achieved as described previously[17]. Briefly, complete growth media were changed to the one free of glucose and serum and then transferred to a closed anaerobic chamber (Thermo Forma, Marietta, OH, USA) with 1% O2 and 37°C. After 6h OGD, cultures were then restored in fresh DMEM/F12 containing 10% FBS and at 37°C, 95% O2/5%CO2 for 6h, 12h and 24h, respectively. 2.3. Adenovirus infection and expression identification Replication-defective adenovirus encoding the complete rat Mfn2 (Ad-Mfn2) and the control adenovirus (Ad-GFP) was constructed by BGI Tech (Shenzhen, China). Astrocytes were infected with control Ad-GFP or Ad-Mfn2 for 24 h at a MOI of 30 pfu/cell and then replaced with complete culture medium. Cells were used to the following experiments after 72 h
7
infection, in which time mfn2 was proved to be significantly overexpressed by western-blotting. 2.4. Edu staining To evaluate cell proliferation [16], 5-ethynyl-29-deoxyuridine (EdU) assay kit (Ribobio, Guangzhou, China) was adopted according to the manufacturer’s instructions. Briefly, cells were incubated with culture medium containing 10M EdU for 24 h. After being fixed with 4% paraformaldehyde for 30 min, the cells were naturalized with 2 mg/ml glycine and permeabilized with 0.2% triton X-100. The template of DNA was chased by Apollo® staining solution for 30 min. Cells were incubated with Hoechst 33342 for nuclei labeling. Finally, three random fields were photographed with a fluorescence microscope to count EdU positive cells. 2.5. Reverse transcription polymerase chain reaction Total RNA was extracted from cells with Trizol Reagent® (Invitrogen). After DNase treatment (Promega), RNA was then reversely transcribed to first strand cDNA using random primers and M-MLVreverse transcriptase (Invitrogen). Real-time quantitative PCR was performed, in duplicate, using an Invitrogen SYBR green kit on an ABI Prism 7500 Sequence Detection 8
System (Applied Biosystems). Gene specific primers were designed using Vector
NTI
(Invitrogen).
The
primers
TGGCTCAAGACTATAAGCTACGG TATGGCGGTGCAGTTCATTC GCAAGAGCGCCTTGACGATA
for
(forward)
-3’ (reverse);
-3’
Mfn2
for
Ras
(forward)
-3’
were:
5‘-
and
5‘-
were:
5‘-
and
5‘-
GTCCCTCATTGCACTGTACTC -3’ (reverse); for β-actin were: 5‘CACGATGGAGGGGCCGGACTCATC TAAAGACCTCTATGCCAACACAGT
-3’ -3
(forward) (reverse).
and
5‘-
Transcription
abundance was expressed as fold increase over a control value calculated by 2-ΔΔCt method. The amplification efficiency was comparable for both genes. 2.6. Western immunoblots Protein was extracted from whole cell lysates, and their concentration was calculated with the BCA protein assay (Thermo Fisher Scientific). Proteins were separated on a 10% sodium dodecyl sulfate-polyacrylamide gel and then transferred onto immobilon-NC membranes (Millipore, Billerica, MA) and incubated overnight with primary antibodies against PCNA (1:1000 CST), Mfn2 (1:1000 CST), GFAP (1:1500 Sigma), Ras(1:20000 Abcam), 9
p-Raf1 (1:500 CST), p-ERK1/2(1:1000 CST)，cyclinD1(1:1000 CST) or β-actin (1:1000 CST). Then the membranes were incubated with Odyssey secondary antibodies (780-conjugated goat anti-rabbit and anti-mouse IgG, 1:15000) for 1 h, then visualized and quantified by Odyssey IR imaging system (Li-COR Bioscience, USA). 2.7. Cell cycle analysis Astrocytes were harvested, washed with PBS and fixed in 70% ice-cold ethanol overnight. Then, cells were treated with 0.5 mg/ml RNase (Invitrogen) for 30 min and finally stained with propidium iodide (PI, Invitrogen) for additional 30 min at room temperature. Flow cytometry analysis (Becton-Dickinson) was performed for the cell cycle analysis. 2.8. Statistical analysis All measurements are done in triplicate and denoted as mean ± SEM. Statistically significant differences (p<0.05) between two groups and among more than two groups were evaluated by one-way ANOVA with Tukey’s post hoc test, respectively.
10
3. Results 3.1. Astrocytes proliferated after OGD/R stimulation with mfn2 being decreased both in mRNA and protein levels GFAP, a basic and specific substance for astrocytes to participate in glial scar formation, increased persistently after hypoxia/reperfusion stimulation (Fig. 1A). To investigate the proliferation level of astrocytes subjected to OGD/R, the biomarkers including PCNA and CyclinD1 were investigated. Western-blot showed that both of PCNA (involved in DNA replication and repair) and CyclinD1 (a key marker indicating the cell cycle through the G1 phase to the S phase) markedly increased with time after OGD/R and reached a plateau at 12h reoxygenation(Fig. 1A). Furthermore, proportion of Edu(+) cells increased gradually after stimulation, with the peak at 12h re-oxygenation (Fig. 1C).
These findings proved that OGD/R model in
vitro successfully activated astrocytes and induced their proliferation in a time-dependent manner. To investigate the possible mechanism of astrocytes proliferation after OGD/R stimulation, the distribution of the different cell cycle phases (G0/G1, S, and G2/M) were then analyzed by flow cytometry. The cell-cycle 11
analysis showed that G0/G1 phase of reactive astrocytes decreased and S, G2/M phases increased, both of which were time-dependent and reached a plateau at 12h reoxygenation(Fig. 1D). Meanwhile, Mfn2 expression both in mRNA and protein levels was found to decrease with time (Fig. 1A and B), negatively correlated with reactive astrocyte proliferation bio-marker. 3.2. The possible mechanism of AS proliferation was through activating Ras-Raf1-ERK1/2 pathway To investigate the possible mechanism of astrocytes proliferation after OGD/R stimulation, the Ras-Raf1-ERK1/2 pathway was analyzed by western-blot. Western-blot showed that Ras-p-Raf1-p-ERK1/2 proteins expression noticeably up-regulated with time after OGD/R and reached a plateau at 12h reoxygenation(Fig. 2).
The above results showed that
reactive astrocytes may be mediated by through the activation of Ras-Raf1-ERK1/2 pathway. 3.3. Overexpression of Mfn2 inhibited the reactive astrocyte proliferation via cell cycle progression and Ras-p-Raf1-p-ERK1/2signal pathway
12
To further elucidate the underlying mechanism revolved in the anti-proliferative
effect
of
Mfn2
on
astrocytes,
as
expected,
adenovirus-Mfn2 infection successfully increased the expression of Mfn2 (Fig. 3A). At the highest proliferative vitality of astrocytes, OGD6h/R12h, overexpression of Mfn2 markedly down-regulated the high level of GFAP, PCNA and cyclinD1 expression (Fig. 3A), as well as Edu positive cells proportion induced (Fig. 3B).
These findings suggested that AdMfn2
significantly inhibited astrocytes proliferation. Flow
cytometry analysis
indicated
that
the
cells
infected
by
adenovirus-Mfn2 showed a sharp increase in the G0/G1 phase, but markedly decrease in S and G2/M fractions compared to the control and Adv-GFP groups, which demonstrated that upregulation of Mfn2 could arrested the cell-cycle progression of astrocytes induced by the OGD/R stimulation(Fig. 3C). To further elucidate the underlying mechanism of Mfn2 induced anti-proliferative effect on astrocytes, the Ras-p-Raf1-p-ERK1/2 proteins expression were compared among Adv-Mfn2 group, Adv-GFP group and control group by western-blot at 12h reoxygenation. Compared with 13
Adv-GFP group and control group, activation of Ras-p-Raf1-p-ERK1/2 pathway was significantly inhibited in the Adv-Mfn2 group, proved by the downregulating expression of relevant proteins (Fig. 3D). To elucidate the exact mechanism of Mfn2 to Ras, RT-PCR was adopted. The results demonstrated that Mfn2 overexpression decreased Ras expression at transcriptional level (Fig. 4). These results indicated that overexpression of Mfn2 inhibited the reactive astrocyte proliferation via cell cycle progression and Ras-p-Raf1-p-ERK1/2signal pathway. 4. Discussion Reactive astrogliosis is a pathologic hallmark of the central nervous system (CNS). Reactive astrocytes contribute to beneficial effects, a defense mechanism to minimize and repair the initial damage at early phases. However, the formation of glia scar is definitely harmful to neuronal repair and axonal outgrowth [9]. Therefore, inhibiting the glia scar and excessive gliosis may contribute to the neuronal repair and axonal outgrowth. Mfn2, also called hyperplasia suppressor gene (HSG), is a novel gene characterized as a cell proliferation inhibitor [12]. Accumulative data have implied that mfn2 possesses potent antiproliferative properties in VSMCs[12], tumor[18], 14
atherosclerosis[13], and hypertension[19]. Our previous study demonstrated for the first time overexpression of mitofusin2 inhibited reactive astrogliosis proliferation in vitro [15]. However, the phosphorylated active forms of ERK1/2 (phospho-ERK1/2) well recognized as the downstream substrate of Mfn2 in controlling cell proliferation, did not show significant changes either in scratch injury or serum stimulation model. The possible failure to observe the change of p-ERK1/2 expression might be these models could not persistently activate the signal pathway. OGD/R model was adapted in the present study to elucidate the definite mechanism of mfn2 in inhibiting reactive astrogliosis. Mounts of evidences demonstrated that quiescent astrocytes acquire characteristic functional and morphological features referred to as reactive gliosis and glial scar in response to cerebral ischemia damage, with GFAP significantly
and specifically upregulated[4]. In our study, GFAP
expression was significantly and consistently increased, which indicated the astrocytes underwent gliosis in response to the in vitro OGD/reoxygenation. PCNA is normally synthesized during the S-phase in the cell cycle, although it is also present at very low levels in quiescent cells[20]. 15
Similarly, CyclinD1, as an important positive regulator for the transition of the cell cycle from the G1 to S phase, is involved in cell proliferation and considered as a general biomarker of mitotic cells[21]. Previous studies indicated that cell cycle-related proteins was markedly elevated in reactive astrocytes, and reactive gliosis was inhibited via reducing cyclinD1and PCNA expression and cell-cycle progression [22, 23], which is similar to our result. We demonstrated that cyclinD1 and PCNA upregulated and reached a plateau at OGD6hR12h. Meanwhile, Mfn2 expression both in mRNA and protein levels was found to decrease with time dependent negatively correlated with reactive astrocyte proliferation bio-marker. The results indicated that there seems to be some relation Mfn2 downregulation and bio-markers upregulation in reactive astrocytes. To further elucidate the hypothesis, Edu staining and cell-cycle analysis were adopted. Cell cycle translation is also involved in astrocytes activation [21, 24]. The results of Edu staining and cell-cycle analysis demonstrated that the quiescent cells changed into reactive mitotic cells and the cell-cycle was transited from the G0/G1 phases to S and G2/M phases and reached a summit at 12 h, which changed synchronously with these biomarkers. The above results also 16
showed that quiescent astrocytes were continuously activated and the proliferation activity reached the summit at 12h reoxygenation, which may be mediated by promoting cell-cycle translation.
Previous studies have
demonstrated that activation the MAPKs pathway trigger quiescent astrocytes into reactive astrocytes； and activation of the MAPK/ERE1/2 pathway under ischemic injury actually protects astrocytes [10]. In the present study, we showed a similar result of Ras-p-Raf1-p-ERK1/2 proteins expression. Previous studies demonstrated that mfn2 is an upstream and negative regulator of Ras protein, and overexpression of mfn2 blocks cell proliferation via blocking Ras-p-Raf1-p-ERK1/2 signaling pathway and cell cycle progression[12, 14]. Summing up our above results, we hypothesize that there may be a link between mfn2 and Ras-Raf-ERK1/2 signaling pathway and cell-cycle translation in astrocytes, and exogenous mfn2 can inhibit reactive gliosis by down-regulating the signal pathway proteins and inhibiting cell-cycle progression. Overexpression of Mfn2 markedly suppressed the proliferation of astrocytes, with the high level of GFAP, PCNA and cyclinD1 expression 17
down-regulated. These results imply that exogenous Mfn2 gene can inhibit the activities of reactive gliosis, which may be helpful to prevent glia scar formation. In this study, we also demonstrated that by overexpression of mfn2 the astrocyte cell-cycle distribution was arrested in G0/G1 phases, coupled with a sharp decline of Edu (+) staining ratio. Meanwhile, exogenous mfn2 significantly inhibited activation of Ras-p-Raf1-p-ERK1/2 pathway, proved by the downregulating expression of relevant proteins. Kuang-Hueih Chen[12] first found that overexpression of Mfn2 markedly inhibited the Ras–Raf–MEK–ERK1/2 signaling cascade and resulted in cell cycle arrest in the G0/G1 phases, thus blocking mitogenic stimuli or injury mediated VSMC proliferation and preventing balloon injury induced restenosis. To dissect the possible mechanistic pathway that links Mfn2 with anti-proliferation, they found that Mfn2 could bind to Ras and subsequently suppress
the
Ras-Raf-ERK1/2
Co-immunoprecipitation
method.
MAPK
signaling
However,
the
pathway
via
result
of
co-immunoprecipitation of Mfn2 protein with Ras was fairly faint [12]. What’s more, neither their work detected nor revealed whether the expression of Ras was affected by Mfn2. To today, studies [25-28] about the 18
relationship between Mfn2 and Ras were directed from the study by Kuang-Hueih Chen. A recent study found Ras could be downregulated and the Ras-Raf-Erk1/2 signaling pathway could be inhibited via upregulating the expression of MFN2 in VMSCs [29]. To study the exact mechanism of Mfn2 to Ras, RT-PCR was adopted. The results demonstrated that Mfn2 overexpression decreased Ras expression at transcriptional level. However, compared with the remarkable result of western-blot of Mfn2 protein with Ras, the result of RT-PCR was fairly faint. We supposed that, although Mfn2 expression regulates Ras at transcriptional levels, it cannot be ruled out the participation of other mechanisms which is our further study to explore. In conclusion, our study confirmed that Mfn2 is a potential hyperplasia suppressor gene in reactive astrocytes. Exogenous mfn2 over-expression, mediated by an adenovirus vector, provided an anti-proliferative effect by down-regulating the expression of PCNA, cyclinD1, GFAP and Edu (+) percentage. And the molecular mechanism of mfn2 blocking the proliferation of astrocytes may be via suppressing Ras-Raf-ERK1/2 pathway and cell cycle retardation. These observations indicate that Mfn2 might be a 19
potential novel hyperplasia suppressor gene for reactive gliosis and possibly an important therapeutic target for the treatment of glia scar. Acknowledgements This study was supported by research grants from the Chinese National Natural Science Foundation (Grant NO. 81271348).
20
References [1] B. Gabryel, D. Kasprowska, A. Kost, K. Labuzek, T. Urbanek, [Astrocytes in ischemic stroke - a potential target for neuroprotective strategies], Postepy higieny i medycyny doswiadczalnej (Online), 69 (2015) 384-397. [2] H. Kawano, A. Bivard, L. Lin, N.J. Spratt, F. Miteff, M.W. Parsons, C.R. Levi, Relationship Between Collateral Status, Contrast Transit, and Contrast Density in Acute Ischemic Stroke, Stroke, 47 (2016) 742-749. [3] M.V. Sofroniew, H.V. Vinters, Astrocytes: biology and pathology, Acta neuropathologica, 119 (2010) 7-35. [4] M. Komitova, E. Perfilieva, B. Mattsson, P.S. Eriksson, B.B. Johansson, Effects of cortical ischemia and postischemic environmental enrichment on hippocampal cell genesis and differentiation in the adult rat, Journal of Cerebral Blood Flow and Metabolism, 22 (2002) 852-860. [5] A. Rolls, R. Shechter, M. Schwartz, NEURON - GLIA INTERACTIONS - OPINION The bright side of the glial scar in CNS repair, Nat. Rev. Neurosci., 10 (2009) 235-U291. [6] M. Pekny, U. Wilhelmsson, M. Pekna, The dual role of astrocyte activation and reactive gliosis, Neuroscience letters, 565 (2014) 30-38. [7] G. Barreto, R.E. White, Y. Ouyang, L. Xu, R.G. Giffard, Astrocytes: targets for neuroprotection in stroke, Central nervous system agents in medicinal chemistry, 11 (2011) 164-173. [8] M.F. Anderson, F. Blomstrand, C. Blomstrand, P.S. Eriksson, M. Nilsson, Astrocytes and stroke: networking for survival?, Neurochemical research, 28 (2003) 293-305. [9] S. Karimi-Abdolrezaee, R. Billakanti, Reactive astrogliosis after spinal cord injury-beneficial and detrimental effects, Molecular neurobiology, 46 (2012) 251-264. [10] Z. Jiang, Y. Zhang, X. Chen, P.Y. Lam, H. Yang, Q. Xu, A.C. Yu, Activation of Erk1/2 and Akt in astrocytes under ischemia, Biochemical and biophysical research communications, 294 (2002) 726-733. [11] D. Bach, S. Pich, F.X. Soriano, N. Vega, B. Baumgartner, J. Oriola, J.R. Daugaard, J. Lloberas, M. Camps, J.R. Zierath, R. Rabasa-Lhoret, H. Wallberg-Henriksson, M. Laville, M. Palacin, H. Vidal, F. Rivera, M. Brand, A. Zorzano, Mitofusin-2 determines mitochondrial network architecture and mitochondrial metabolism. A novel regulatory mechanism altered in obesity, The Journal of biological chemistry, 278 (2003) 17190-17197. [12] K.H. Chen, X. Guo, D. Ma, Y. Guo, Q. Li, D. Yang, P. Li, X. Qiu, S. Wen, R.P. Xiao, J. Tang, Dysregulation of HSG triggers vascular proliferative disorders, Nature cell biology, 6 (2004) 872-883. [13] Y.H. Guo, K. Chen, W. Gao, Q. Li, L. Chen, G.S. Wang, J. Tang, Overexpression of Mitofusin 2 inhibited oxidized low-density lipoprotein induced vascular smooth muscle cell proliferation and reduced atherosclerotic lesion formation in rabbit, Biochemical and biophysical research communications, 363 (2007) 411-417. 21
[14] K.R. Chien, M. Hoshijima, Unravelling Ras signals in cardiovascular disease, Nature cell biology, 6 (2004) 807-808. [15] T. Liu, C.C. Xue, Y.L. Shi, X.J. Bai, Z.F. Li, C.L. Yi, Overexpression of mitofusin 2 inhibits reactive astrogliosis proliferation in vitro, Neuroscience letters, 579 (2014) 24-29. [16] J.P. Schwartz, D.J. Wilson, Preparation and characterization of type 1 astrocytes cultured from adult rat cortex, cerebellum, and striatum, Glia, 5 (1992) 75-80. [17] Q. Yang, E.Y. Wang, X.J. Huang, W.S. Qu, L. Zhang, J.Z. Xu, W. Wang, D.S. Tian, Blocking epidermal growth factor receptor attenuates reactive astrogliosis through inhibiting cell cycle progression and protects against ischemic brain injury in rats, Journal of neurochemistry, 119 (2011) 644-653. [18] G.-E. Zhang, H.-L. Jin, X.-K. Lin, C. Chen, X.-S. Liu, Q. Zhang, J.-R. Yu, Anti-Tumor Effects of Mfn2 in Gastric Cancer, International journal of molecular sciences, 14 (2013) 13005-13021. [19] L. Fang, X.L. Moore, X.M. Gao, A.M. Dart, Y.L. Lim, X.J. Du, Down-regulation of mitofusin-2 expression in cardiac hypertrophy in vitro and in vivo, Life sciences, 80 (2007) 2154-2160. [20] W. Strzalka, A. Ziemienowicz, Proliferating cell nuclear antigen (PCNA): a key factor in DNA replication and cell cycle regulation, Annals of botany, 107 (2011) 1127-1140. [21] Z. Zhu, Q. Zhang, Z. Yu, L. Zhang, D. Tian, S. Zhu, B. Bu, M. Xie, W. Wang, Inhibiting cell cycle progression reduces reactive astrogliosis initiated by scratch injury in vitro and by cerebral ischemia in vivo, Glia, 55 (2007) 546-558. [22] S. Di Giovanni, V. Movsesyan, F. Ahmed, I. Cernak, S. Schinelli, B. Stoica, A.I. Faden, Cell cycle inhibition provides neuroprotection and reduces glial proliferation and scar formation after traumatic brain injury, Proceedings of the National Academy of Sciences of the United States of America, 102 (2005) 8333-8338. [23] J. Qiu, C. Zhang, Y. Lv, Y. Zhang, C. Zhu, X. Wang, W. Yao, Cdh1 inhibits reactive astrocyte proliferation after oxygen-glucose deprivation and reperfusion, Neurochemistry international, 63 (2013) 87-92. [24] H. Kato, A. Takahashi, Y. Itoyama, Cell cycle protein expression in proliferating microglia and astrocytes following transient global cerebral ischemia in the rat, Brain research bulletin, 60 (2003) 215-221. [25] H. Liao, J. Gong, W. Zhang, X. Guo, Valsartan inhibits angiotensin II-induced proliferation of vascular smooth muscle cells via regulating the expression of mitofusin 2, Journal of Huazhong University of Science and Technology. Medical sciences = Hua zhong ke ji da xue xue bao. Yi xue Ying De wen ban = Huazhong keji daxue xuebao. Yixue Yingdewen ban, 32 (2012) 31-35. [26] C. Liu, B. Ge, C. He, Y. Zhang, X. Liu, K. Liu, C. Qian, Y. Zhang, W. Peng, X. Guo, Mitofusin 2 decreases intracellular lipids in macrophages by regulating peroxisome proliferator-activated receptor-gamma, Biochemical and biophysical research communications, 450 (2014) 500-506. 22
[27] W. Zhou, K.H. Chen, W. Cao, J. Zeng, H. Liao, L. Zhao, X. Guo, Mutation of the protein kinase A phosphorylation site influences the anti-proliferative activity of mitofusin 2, Atherosclerosis, 211 (2010) 216-223. [28] Q. Li, G. Li, X. Lan, M. Zheng, K.H. Chen, C.M. Cao, R.P. Xiao, Receptor interacting protein 3 suppresses vascular smooth muscle cell growth by inhibition of the phosphoinositide 3-kinase-Akt axis, The Journal of biological chemistry, 285 (2010) 9535-9544. [29] W. Zhang, C. Shu, Q. Li, M. Li, X. Li, Adiponectin affects vascular smooth muscle cell proliferation and apoptosis through modulation of the mitofusin-2-mediated Ras-Raf-Erk1/2 signaling pathway, Molecular medicine reports, 12 (2015) 4703-4707.
23
[First Authors Last Name] Page 24
Fig. 1. Astrocytes proliferated after OGD/R stimulation with biomarkers upregulation, cell cycle translation, and mfn2 being decreased both in mRNA and protein levels (A) Biomarkers expression of GFAP, PCNA, CyclinD1 was upregulated , and Mfn2 protein was downregulated with time-dependent in reactive astrocytes (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). (B) Mfn2 gene was downregulated in reactive astrocytes (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). (C) EdU (red) and Hoechst 33342 (blue) were double stained to assess astrocytes proliferation in OGDR-stimulation model. Percentages of EdU-positive cells in each group for corresponding time points were statistically analyzed. Scale bars = 200μm. (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). (D)The cell cycle progression of AS was promoted by OGD/R with time-dependent (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test).
[Insert Running title of <72 characters]
[First Authors Last Name] Page 25
Fig. 2. The Ras-p-Raf1-p-ERK1/2 signaling was activated in reactive astrocytes (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test). The relative expression level of Ras was normalized to β-actin, while the relative expression levels of p-c-Raf and p-ERK1/2 were normalized to total c-Raf and ERK 1/2.
Fig. 3. Overexpression of Mfn2 inhibited the reactive astrocyte proliferation with biomarkers downregulation, cell cycle translation arrested and signaling pathway inhibition (A) Biomarkers expression of GFAP, PCNA, CyclinD1 was down regulated by overexpression of mfn2 at OGD6hR12h time point (n = 3 for each group, p < 0.05 vs. sham group, one-way ANOVA with Tukey post hoc test). (B) EdU (+) astrocytes were downregulated by overexpression of mfn2. Scale bars = 200 wei'miμm. (n = 3 for each group, p < 0.05 vs. sham group, one-way ANOVA with Tukey post hoc test). (C)The cell cycle progression of AS was arrested by overexpression of mfn2 (n = 3 for each group, p < 0.05 vs. sham group, one-way ANOVA with Tukey post hoc test).
[Insert Running title of <72 characters]
[First Authors Last Name] Page 26
(D)The Ras-p-Raf1-p-ERK1/2 signaling was inhibited by overexpression of mfn2 (n = 3 for each group, p < 0.05 vs. the uninfected group, one-way ANOVA with Tukey post hoc test). The relative expression level of Ras was normalized to β-actin, while the relative expression levels of p-c-Raf and p- ERK 1/2 were normalized to total c-Raf and ERK 1/2.
Fig. 4. Overexpression of Mfn2 inhibited Ras mRNA expression Ras mRNA gene was downregulated in Adv-mfn2 group, compared to Adv-GFP group and control group (n = 3 for each group, p < 0.05 vs. OGD6h/R0h group, one-way ANOVA with Tukey post hoc test).
[Insert Running title of <72 characters]
[First Authors Last Name] Page 27
Fig 1
[Insert Running title of <72 characters]
[First Authors Last Name] Page 28
Fig 2
[Insert Running title of <72 characters]
[First Authors Last Name] Page 29
Fig 3
[Insert Running title of <72 characters]
[First Authors Last Name] Page 30
Fig 4
[Insert Running title of <72 characters]