- Email: [email protected]
reperfusion injury partially by CGRP expression
European Journal of Pharmacology 671 (2011) 61–69
Contents lists available at SciVerse ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Neuropharmacology and Analgesia
Leptin attenuates cerebral ischemia/reperfusion injury partially by CGRP expression Jin-ying Zhang a, Guang-tao Yan a,⁎, Jie Liao b, Zi-hui Deng a, Hui Xue a, Lu-huan Wang a, Kai Zhang a a b
Research Laboratory of Biochemistry, Basic Medical Institute, Chinese General Hospital of PLA, 28 Fuxing Road, Beijing 100853, PR China Research Laboratory of Medical Experiment and Test Center, Basic Medical Institute, Chinese General Hospital of PLA, 28 Fuxing Road, Beijing 100853, PR China
a r t i c l e
i n f o
Article history: Received 27 May 2011 Received in revised form 14 September 2011 Accepted 15 September 2011 Available online 28 September 2011 Keywords: Leptin Calcitonin gene-related peptide CGRP8-37 Cerebral ischemia/reperfusion Hypoxia/reoxygenation Neuroprotection
a b s t r a c t Ischemic stroke is a medical emergency triggered by a rapid reduction in blood supply to localized portions of the brain, usually because of thrombosis or embolism, which leads to neuronal dysfunction and death in the affected brain areas. Leptin is generally considered to be a strong and quick stress mediator after injuries. However, whether and how peripherally administered leptin performs neuroprotective potency in cerebral stroke has not been fully investigated. It has been reported that CGRP8-37, an antagonist of the CGRP receptor, could reverse the protective effect of leptin on rats with CIP (caerulein-induced pancreatitis). However, the question remains: are leptin and CGRP associated in cerebral ischemia/reperfusion injury? The present study attempted to evaluate the relationship between CGRP expression and leptin neuroprotective effects (1 mg/kg in 200 μL normal saline, i.p.) on focal cerebral ischemia/reperfusion injury in mice and the protective effect of leptin (500 μg/L) on neurons during hypoxia/reoxygenation injury. Peripheral administration of leptin alleviated injury-evoked brain damage by promoting CGRP expression, improving regional cerebral blood flow, and reducing local infarct volume and neurological deficits. Furthermore, leptin also promoted bcl-2 expression and suppressed caspase-3 in vivo and vitro after injury. Administration of CGRP8-37 (4 × 10 −8 mol/L) partly abolished the beneficial effects of leptin, and restored the normal expression levels of bcl-2 and caspase-3 in neurons, which indicated that leptin-induced protection of neurons was correlated with release of CGRP. These results indicate that the neuroprotective effect of leptin against cerebral ischemia/reperfusion injury may be strongly relevant to the increase of CGRP expression. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Cerebral stroke is the major leading cause of death and disability, and it is estimated that it is responsible for nearly 50% of the patients hospitalized for acute neurological disorders (Nakka et al., 2008). Stroke is usually characterized by ischemia/reperfusion of cerebral blood vessels, resulting in decreased blood flow and neurocyte cellular (both neuronal and non-neuronal) damage (Li et al., 2009; Woitzik et al., 2008). Therefore, improving blood flow and neurocyte function are keys to protecting the brain from ischemia/reperfusion injury. Leptin has been identified as an ob gene-expression protein, mainly secreted by adipose tissue, with roles of inhibiting food intake, modulating weight balance, and regulating energy metabolism (Fruhbeck, 2006). As a peripherally-derived and centrally-synthesized molecule, leptin is involved in the normal functions and abnormal processes of the brain (Signore et al., 2008; Yan et al., 2009). Previous studies showed that leptin could protect the cerebral ischemia tissues from injury (Zhang and Chen, 2008; Zhang et al., 2007); however, the identity of the signaling molecules downstream of leptin that protect against cerebral ischemic injury remains unclear. Calcitonin gene-related peptide
⁎ Corresponding author. Tel.: + 86 10 66937072; fax: + 86 10 68176512. E-mail address: [email protected] (G. Yan). 0014-2999/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2011.09.170
(CGRP) is known to play an important role in the control of intracranial blood flow and protection of neurons (Denekas et al., 2006). Administration of CGRP in laboratory animals has been shown to increase cerebral blood flow significantly, decrease focal cerebral infarction volume inducing protective of ischemic neurons and reverse ischemia injury in brain (Kobari et al., 1995; Zhang et al., 2007). It has been reported that CGRP8-37 administration to rats with CIP (caerulein-induced pancreatitis) that were pretreated with leptin resulted in the partial reversal of pancreato protective effect of leptin. This study demonstrates that CGRP is involved in the protective effects of leptin on the caeruleinoverstimulated pancreas (Jaworek et al., 2002). However, whether peripherally-administered leptin could protect brain from ischemic injury by inducing CGRP expression has not been reported. Thus, in this article, we try to identify that CGRP mediates the protective role of leptin against cerebral ischemia/reperfusion injury in vivo and vitro. 2. Materials and methods 2.1. Animals Male Kunming mice (age 30.2 ± 1.6 days, weight 25 ± 0.2 g) and one SD pregnant rat (pregnancy 17–18 days) was supplied by the experimental animal center in our hospital. Mice were maintained in a room at 22–25 °C under a constant day/night rhythm and given
62
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
food and water ad libitum. All animal experiments were carried out in accordance with the NIH Guide for Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committee at our hospital. 2.2. Model of focal cerebral ischemia/reperfusion injury Fifty-seven mice were divided randomly into three groups of 19 mice each, including sham-operation (Sham), ischemia/reperfusion (Vehicle) and leptin injection (Leptin) groups. Mice were deprived of food 12 h prior to the start of experiment, while drinking water was available ad libitum. The model of focal cerebral ischemia/reperfusion injury was performed by unilateral middle cerebral artery (MCA) occlusion as described previously (Xu et al., 2006). Briefly, mice were anesthetized with pentobarbital sodium (60 mg/kg, i.p.), and their skin was then sterilized. The common carotid artery, the external carotid artery and the internal carotid artery on the right side were exposed through a ventral midline neck incision. A 6–0 nylon monofilament coated with silicon resin was introduced into the right common carotid artery and advanced until faint resistance was felt. After ischemia for 2 h, reperfusion was achieved by withdrawing the monofilament to restore blood supply to the MCA territory for 24 h. The common carotid artery, the external carotid artery and the internal carotid artery on the right side were exposed but not occluded in the Sham group. Mice in the leptin injection group were given leptin (1 mg/kg in 200 μL normal saline, i.p.) immediately after occlusion, and mice in the Sham and Vehicle groups were given 200 μL normal saline (i.p.) at the same time. The incision was closed in layers, and resuscitation with isotonic saline (30 ml/kg, i.p.) was supplied. Then, mice were sterilized with iodophor on their suture sites and released back to cages, where drinking water was available ad libitum. Body temperature was maintained at 36.5–37.5 °C throughout the procedure. Ten mice from each group were randomly chosen for evaluation of neurological function, blood flow and local infarct volume; another three mice from each group were randomly selected for detection of mRNA expression of CGRP, bcl-2 and activated caspase-3 in the ischemic cortex; while the remaining six mice were used to investigate histological alterations, CGRP expression and neuronal apoptosis in the ischemic cortex.
probe was steadied throughout the recording period, and the velocity spectrum was translated by a software-implemented subroutine. Ten measurements of the peak velocity of MCA were taken to represent the regional cerebral blood flow. Mice in the Leptin group were given leptin (1 mg/kg in 200 μL normal saline, i.p.) immediately after occlusion, and mice of Sham and Vehicle groups were given 200 μL normal saline (i.p.) at the same time. 2.5. Measurement of local infarct volume Mice were sacrificed 24 h after reperfusion, and their brains were isolated for estimation of infarct volume (n = 10/group). In brief, the mice were sacrificed under deep anesthesia, brains were removed and immediately frozen in isopentane cooled with dry ice, and serial sections from anterior to posterior were prepared as 2-mm slices. Samples were placed in 2% 2,3,5-triphenyl tetrazolium chloride (TTC; Sigma, USA) stain for 20 min at 37 °C and then fixed in 10% buffered formaldehyde for 24 h. The stained brain sections were digitally photographed. Cerebral infarct volumes were measured using microscope image-analysis software (Image-Pro plus, USA). The data were expressed as the percentage of infarct volume/ipsilateral hemisphere volume at the coronal slices. 2.6. Investigation of histopathology and neuronal apoptosis
a) Death within 24 h after reperfusion b) Subarachnoid hemorrhage (as macroscopically assessed during brain sampling) c) Bederson score = 0 (24 h after reperfusion).
Mice were perfusion-fixed with 4% paraformaldehyde in 0.1 mol/L pH 7.4 PBS under anesthesia after 24 h reperfusion. The brains were immediately removed, further fixed in 10% paraformaldehyde overnight at 4 °C and embedded in paraffin. Serial coronal sections (5-μm thick) obtained 1.5 mm behind the bregma were stained with hematoxylin and eosin. The normal morphology and the presence and nature of ischemic of damage in the frontoparietal cortex were verified by two neuropathologists who were unaware of the experimental design or the results of TTC staining. The coronal sections were deparaffinized, hydrated sequentially and examined by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling assay (TUNEL assay) according to established protocols. TUNEL-positive cells displayed brown staining within the nucleus of apoptotic cells. DNA fragmentation was quantified by an investigator blinded to the study. Neuronal apoptosis in the ischemic cortex was expressed as the percentage of apoptotic neurons/total neurons. Protein expression of CGRP in the ischemic cortex was detected by immunohistochemistry. Briefly, the coronal sections were collected on 0.1% poly-lysine coated slides, deparaffinized by the xylene-ethanol sequence, rehydrated in a graded ethanol scale and in phosphate buffered saline (PBS). After prior antigen retrieval by heating in a pressure cooker in citrate buffer, the slides were incubated sequentially with the CGRP antibody, biotinylated anti-rabbit IgG and peroxidase-conjugated streptavidin for 1 h at 37 °C, using respective dilution of 1:200 in PBS. Diaminobenzidine chromogenic kits were used to develop the color. Negative controls were set simultaneously by replacing the first antibody with PBS. The images were visualized with Leica® DC300F Digital Camera Systems, and 10 microscopic fields in each group were randomly selected. Image-Pro Plus® 6.0 software was chosen to analyze the ratio of accumulated optical density of specific positive staining/specific tissue area in each image.
2.4. Evaluation of regional cerebral blood flow (rCBF)
2.7. RNA isolation and PCR studies
Blood flow in the MCA territory on the ischemic side was monitored at a preoperative time point, 2 h after the occlusion of the middle cerebral artery (I2h), and again 5 min (I2hR5min) and 24 h (I2hR24h) after the removal of the filament (reperfusion) by a Laser–Doppler blood flowmeter (Perimed® Periflux 5010, Sweden) positioned 1 mm posterior and 3 mm lateral to the bregma. The
The levels of gene expression for CGRP, bcl-2, caspase-3 and betaactin in the ischemic cortex and in neurons were semi-quantified. After 24 h reperfusion, isolated total RNA from the ischemic cortex separated from the preserved cerebrum samples, using TRIzol reagent (Gibco RL, Grand Islan, NY, USA) according to the manufacturer's instructions. Total RNA (2.5 μg) was subsequently transcribed into
2.3. Evaluation of neurological deficit Twenty-four hours after reperfusion the Longa's “5 Law” (Longa et al., 1989) was used to determine global neurological function according to the following scoring system: 0, no deficit; 1, forelimb flexion; 2, decreased resistance to lateral push; 3, unidirectional circling; 4, longitudinal spining; 5, no movement. Rating was performed in a blinded manner. The neurological function was scored twice, initially after full recovery from anesthesia during the reperfusion period and later after completion of 24 h reperfusion. The exclusion criteria were as follows:
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
cDNA and amplified separately with specific primers for CGRP, bcl-2, caspase-3 and beta-actin using SuperScript One-Step RT-PCR System. The primer sequences used for PCR were as the following: beta-actin (5′CTGTCCCTGTATGCCTCTG 3′; 5′ATGTCACGCACGATTTCC3′), mouse CGRP (5′AGTTCTTTCCT TTTCTGG3′; 5′ACACGGGAGCCCTTAGTC3′), rat CGRP (5′TCCTGG TTGTCAGCATCT3′; 5′CTCAGCCTCCTGTTCCTC3′), caspase-3 (5′A GGGGTCATTTATGGGACA3′; 5′TACACGGGATCTGGTTTCTTT3′), and bcl-2 (5′-AGCCGGGAGAACAGGGTA-3′; 5′-TGAAGAGTTCCT CCACCACC-3′). The following PCR conditions were used for beta-actin: 36 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. The following PCR conditions were used for mouse CGRP and rat CGRP: 36 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, and extension at 72 °C for 30 s. The following PCR conditions were used for caspase-3 and bcl-2: 36 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. The PCR products were resolved in 1.5% agarose gel containing 0.5 mg/L ethidium bromide, and the intensity of each band was analyzed by using spot densitometry analysis software of Gel-Pro® Analyzer 3.0. 2.8. Rat primary neuronal culture and hypoxia/reoxygenation Primary cultures of rat cortical neurons were prepared from 17day-old SD rat embryos as previously described (Cao et al., 2003). Cells were cultured at 37 °C in 95% humidified atmosphere on day 2 and replaced with fresh medium containing cytosine arabinoside (10 μmol/L) to inhibit excessive proliferation of non-neurons. Cell cultures were routinely observed under a phase-contrast inverted microscope. For the following experiments, neurons and glia were identified with anti-NSE and anti-GFAP antibodies respectively; the ratio of neurons was greater than 90%. Cells were plated onto poly-D-lysine (10 μg/ml) precoated 96-well plates (about 5 × 10 5 cells/well) for the analysis of cellular viability of injured to neurons and 24-well plates (about 3 × 10 6 cells/well) for detecting CGRP and apoptosis-related gene expression. For the studies of leptin-mediated neuroprotection, the cultures were replaced with glucose-deprivation cultures. The CGRP inhibition studies were performed in some experiments with the CGRP8-37 at concentrations of 4 × 10 −8 mol/L, according to experimental conditions. Neurons were treated with this inhibitor for 30 min, and leptin was then added to the medium to reach a final concentration of 500 μg/L. To model ischemia-like conditions in vitro, primary cultures were exposed to oxygen–glucose deprivation (OGD) (Cao et al., 2003). In brief, the culture medium was replaced with serum- and glucose-free medium. The cultures were put into an air tight box, and 95% N2 and 5% CO2 mixed gas was continually aerated into the box for 5 min to completely replace the air in the box. The box was placed in a water-jacketed incubator at 37 °C for 90 min and then returned to 95% air, 5% CO2, and glucose-containing medium for 3 h (hypoxia for 90 min and reoxygenation for 3 h, H90min/R3h). Control glucose-containing cultures were incubated for the same periods of time at 37 °C in humidified 95% air and 5% CO2. The cells and supernatants were collected for analysis. 2.9. Detected cell viability by MTT assay For MTT assay, cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 2 days. Then cells were divided into six groups: control group, Vehicle group, Leptin group, CGRP8-37 + Leptin group, CGRP group and CGRP8-37 + CGRP group. After hypoxia 90 min, cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 3 h. In brief, 10 μL MTT solution (5 mg/ml) was added to each well, then the cells were cultured for another 4 h at 37 °C, and 100 μL DMSO was added to each well and mixed vigorously to solubilize colored crystals produced within the living cells. The reaction product was analyzed at 570 nm with a microplate spectrophotometer (Spectra max plus, Molecular Devices, CA).
63
2.10. RIA of CGRP levels in culture supernatant Culture supernatant CGRP was measured by self-produced radioimmunoassay (RIA) according to our previous report (Yan et al., 2009). The first elution peak of Sephadex G-25 chromatography column was collected at the rate of one tube per minute, and those 125 I-labeled CGRP with high specific binding rate and low fault binding rate were taken as successful iodinated CGRP. They were mixed with equal volumes of 1.5% bovine serum albumin and stored at −20 °C. After reoxygenation for 3 h, cell culture medium was collected. The standard sample or CGRP was seized with a certain amount of 125 I and CGRP antiserum solution together, mixing at 4 °C and then incubated for 24 h. After incubation, the immune separating agent was added. CGRP and the antibody complex precipitated and then centrifuged at 3500 rpm for 15 min at 4 °C. Total radioactivity (T) and precipitation radioactivity (B) were determined after discarding the supernatant. The standard point value (B/B0%) was calculated and used to produce a standard curve. The concentration of CGRP in samples was acquired from the B/B0% binding used to obtain the CGRP standard curve concentration. CGRP concentrations were expressed as ng/ml. 2.11. Statistical analysis All data were expressed as mean ± S.D. Stata 7.0 software was used to process the data. For all data except the grading of neurological deficits, one-way analysis of variance and Student's t tests were applied. For the grading of neurological deficits, Wilcoxon signedrank test was used. A P value of less than 0.05 was chosen as the threshold for statistical significance. 3. Results 3.1. Leptin improves mouse regional cerebral blood flow after injury Blood flow of the branch of the middle cerebral artery was observed under an optical microscope after 24 h reperfusion (plus cold light source for medical purposes). Branch blood vessels linear flow phenomenon could be seen clearly in the Sham group. After cerebral
Fig. 1. Leptin increases rCBF in the branches of middle cerebral artery after cerebral ischemia/reperfusion injury at different time points in each group. Mice in the leptintreated group were given leptin (1 mg/kg in 200 μL normal saline, i.p.) immediately after occlusion, and mice of Sham and Vehicle were given 200 μL normal saline (i.p.) at the same time. Determination of preoperative regional cerebral blood flow (rCBF), 2 h after the occlusion of the middle cerebral artery (ischemia, I2h), 5 min after the removal of the filament (reperfusion, I2hR5min) and 24 h after reperfusion (I2hR24h). Regional blood flow of the MCA territory on the ischemic side was monitored by a Laser–Doppler blood flowmeter positioned 1 mm posterior and 3 mm lateral to the bregma. A decrease in regional blood flow was observed in the branches of the middle cerebral artery in the model, and it was partially rehabilitated in leptin. Twenty-four hours after reperfusion, regional blood flow in the model further restored to the 2/3 of preoperative level. Obviously, the recovery of blood flow in the Leptin treatment group improved significantly. *P b 0.01 vs. Vehicle. All data are presented as mean ± S.D., n = 10/group.
64
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
ischemia/reperfusion, regional blood flow velocity in this model was significantly decreased, and particle flow was clearly observed in the branches of MCA. Blood flow velocity and linear flow were recovered in the Leptin (1 mg/kg; i.p.) group, and particle flow was no longer detectable (Fig. 1).
Regional cerebral blood flow of the infarction zone in mice was monitored by LDF (Laser–Doppler blood flowmeter). The results showed that blood flow after ischemia fell by approximately 67%, suggesting successful establishment of the model. After reperfusion, regional blood flow recovered to half of that before operation (1.49 ±
Fig. 2. TTC staining (A), histopathological alterations in the cerebral cortex (B), neurological deficit scores (C) and infarct volume (D) in mice after ischemia/reperfusion injury. Cerebral infarct volumes were measured using microscope image-analysis software (Image-Pro plus, USA). The data were expressed as the percentage of infarct volume/ipsilateral hemisphere volume at the coronal slices (A, n = 10/group). ⁎P b 0.01 vs. Sham group, #P b 0.01 vs. Vehicle group. Neurological function scores in the Leptin group were lower than that in Vehicle (C, n = 10/group). In the representative coronal brain slices, infarct volume was observed in Vehicle, while about 67% reduced infarct size was found in Leptin (D, n = 10/group). Histopathological alterations in the cerebral cortex (B, n = 6/group) after injury were detected by HE staining. The normal morphology and the presence and nature of ischemic of damage in the frontoparietal cortex were verified by two neuropathologists unaware of the experimental design or the results of TTC staining. Disorderly arranged neurocytes with loosened cytoplasm and karyopyknosis, vacuolization and interstitial edema were found in Vehicle, while significantly minor alterations were observed in Leptin group. All data were presented as mean ± S.D.
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
0.02 vs. 3.09 ± 0.04). Twenty-four hours after reperfusion, regional blood flow in this model was further restored to 73% of preoperative flow (2.27 ± 0.03 vs. 3.09 ± 0.06). Furthermore, regional blood flow with leptin treatment improved to 88% preoperative flow (2.78 ± 0.05 vs. 3.16 ± 0.03) (P b 0.01) (Fig. 1). 3.2. Leptin decreases infarct volume, neurological defect and alleviates histological alterations Two hours after reperfusion, mice presented various degrees of neurological deficit when regaining consciousness. Neurological deficit scores in the Leptin group were significantly lower than in the Vehicle group (P b 0.01), as shown in Fig. 2C. After TTC staining, infarcted brain was visualized as an area of unstained (white) tissue in a surrounding background of viable
65
(brick red) tissue. TTC staining showed that all of the Sham brain slices were stained red, and the right frontal cortex and striatum infarct of the Vehicle were seen clearly in white (Fig. 2A). After 24 h reperfusion infarct volume was detected in each group. Infarct volume of mice in the Leptin group was clearly smaller than in Vehicle mice (P b 0.01), as shown in Fig. 2D. Normal morphology and the presence and nature of ischemic damage in the frontoparietal cortex were verified by two neuropathologists who were unaware of the experimental design or the results of TTC staining. Compared to histological alterations in the ischemic frontoparietal cortex in Sham, the neurocytes in Vehicle group were arranged in a disorderly fashion, with loosened cytoplasm and karyopyknosis, while diffuse vacuolization and edema in the interstitial spaces was also observed. Similar but significantly minor alterations were observed in the Leptin group (Fig. 2B).
Fig. 3. Neuronal apoptosis (A and C, TUNEL assay), bcl-2 and caspase-3 mRNA expression (B, D, E, RT-PCR) in the ischemic cortex after injury. The percentage of apoptotic neurons in the Vehicle and Leptin groups was higher than in Sham, but the percentage of apoptotic neurons in the Leptin group was lower than in the Vehicle. mRNA expression of bcl-2 in the Vehicle and Leptin groups was significantly higher than in Sham, but the level of bcl-2 in Vehicle was lower than in Leptin. mRNA expression of caspase-3 in Vehicle and Leptin was also higher than in Sham, but the level of caspase-3 in Leptin was lower than in Vehicle. Data are presented as mean ± S.D., n = 6/group. *P b 0.001 vs. Sham; #P b 0.001 vs. Vehicle.
66
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
3.3. Leptin alleviates neuronal apoptosis, upregulates apoptosis-related gene bcl-2 and downregulates caspase-3 mRNA expression after injury To investigate neuronal apoptosis after cerebral ischemia/ reperfusion injury, TUNEL assay was used in this study. Compared to the percentage of apoptotic neurons in the ischemic cortex in Sham, the percentage of apoptotic neurons in Vehicle and Leptin were significantly higher (P b 0.001), but the percentage of apoptotic neurons in Leptin was significantly lower than in Vehicle (Fig. 3A and C). Compared to mRNA expression of bcl-2 in the ischemic cortex in Sham, the levels in Vehicle and Leptin were significantly higher (P b 0.001); while the level in Vehicle was significantly lower than in Leptin (P b 0.001) (Fig. 3B and D). Compared to mRNA expressions of caspase-3 in Sham, the levels in Vehicle and Leptin were significantly higher (P b 0.001), but the level in Leptin was significantly lower than in Vehicle (P b 0.001) (Fig. 3B and E).
3.4. Local CGRP decreases in brain after cerebral ischemic injury Compared to Sham, local CGRP level after injury was significantly decreased (P b 0.01), but could be partly recovered after leptin treatment, to lower levels than in Vehicle group (Pb 0.01). Therefore, these data indicate that the level of CGRP was decreased after ischemia/reperfusion injury and leptin can enhance CGRP synthesis in the Vehicle brain (Fig. 4A and B). To further investigate the effect of leptin on CGRP, the RT-PCR assay was used to detect CGRP mRNA expression with leptin treatment in vitro experiment. Bands of each group for optical density analysis showing that CGRP gene expression in cerebral neurons after ischemia/reperfusion injury was significantly lower than in Sham (P b 0.01), mRNA expression of CGRP in leptin was significantly higher than in Vehicle group (P b 0.01) but still lower than which in Sham (P b 0.05). Those results were similar to those in the CGRP measurement by immunohistochemistry (Fig. 4C and D).
Fig. 4. CGRP expression (A and B) and mRNA expression of CGRP (C and D) in the ischemic cortex after injury. Protein expressions of CGRP in ischemic cortex were detected by immunohistochemistry. The images were visualized with Leica® DC300F Digital Camera Systems, and 10 microscopic fields in each group were randomly selected. Image-Pro Plus® 6.0 software was chosen to analyze the ratio of accumulated optical density of specific positive staining/specific tissue area in each image (A and B). Furthermore, the level of gene expression of CGRP was semi-quantified using RT-PCR. The intensity of each band was analyzed by using spot densitometry analysis software of Gel-Pro® Analyzer 3.0 (C and D). Data are presented as mean ± S.D. ⁎P b 0.01 vs. Sham group; ##P b 0.01 vs. Vehicle group; %%P N 0.05 vs. Sham group. Protein and mRNA expression of CGRP in the Leptin group was significantly higher than in Vehicle, but lower than that in Sham, but did not reach significance.
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
67
Fig. 5. Leptin protects rat cortical neurons from hypoxia/reoxygenation-induced cell death. After hypoxia/reoxygenation injury, the survival rate of neurons was significantly increased. *P b 0.01 vs. the control group; the survival rate of neurons in Leptin intervention group was higher than that of the Vehicle group, **P b 0.01. The neurons treated with leptin and CGRP8-37, however, led to significantly reduction of the survival rate of neurons (***P b 0.01), but the rate was also higher than the Vehicle. After hypoxia/reoxygenation injury, the survival rate of neurons with CGRP intervention was enhanced, ****P b 0.01 vs. Vehicle, but was still lower than the Leptin treatment group. Furthermore, the role of CGRP in increasing the neuronal survival rate disappeared because of CGRP8-37 intervention. Data are presented as mean ± S.D., n = 10/group.
3.5. Through CGRP releasing leptin protects primary cortical neurons from cell death induced by hypoxia/reoxygenation To investigate the effect of leptin on neuron survival rate in vitro, the MTT assay was utilized to verify the possibility. Cerebral neurons with hypoxia/reoxygenation injury were prepared from the fetal SD rats (17–18 days). Neuronal culture was incubated either with leptin, leptin + CGRP8-37, CGRP and CGRP + CGRP8-37 for 3 h. All incubations were followed by 90 min of hypoxia. The neuron survival rate was detected by MTT assay (neuron survival rate = Absorbance of different groups/Absorbance of the normal group*100%) (Gunasekar et al., 1996). As shown in Fig. 5, after hypoxia/reoxygenation injury, the survival rate was reduced to 1/3 of normal level, but the survival rate was evidently increased because of leptin intervention. Pretreatment with CGRP8-37 given together with leptin reduced the neuron survival rate after hypoxia/reoxygenation injury. Culturing the neurons with leptin and CGRP8-37 simultaneously, however, led to a significant reduction of neuron survival rate, indicating that CGRP8-37 may bind to CGRP receptor in neurons, blocking CGRP from biological function. CGRP8-37 reversed the beneficial effects of leptin administration on the neurons after hypoxia/reoxygenation injury. This result supports the hypothesis that CGRP may be an important molecule in neuron hypoxia/reoxygenation injury, and leptin improves neuron survival rate through CGRP. Taken together, these results suggest that leptin can protect cultured rat cortical neurons from hypoxia/ reoxygenation-induced cell death in a CGRP-dependent manner.
3.7. Leptin elevates CGRP mRNA expression in neurons To further evaluate the enhancement of leptin on CGRP expression in neurons, RT-PCR assays were utilized to examine the expression of CGRP. After hypoxia/reoxygenation injury, CGRP was rarely expressed but was significantly increased in the Leptin treatment group, nearly recovering to that control levels (Fig. 7A and B). This result demonstrated clearly that leptin can augment the expression of CGRP in neurons. However, CGRP8-37 could compete with CGRP receptor and block its signal transduction, leading to negative feedback regulation and depression of CGRP mRNA expression. 3.8. CGRP antagonist abolishes the effect of leptin on bcl-2 and caspase-3 mRNA expression To further evaluate the relationship between leptin and CGRP, the RT-PCR assays was utilized to examine the expression of bcl-2 and caspase-3 mRNA. The results clearly showed that leptin enhanced the expression of bcl-2 and depressed the expression of caspase-3
3.6. Leptin increases CGRP concentration in culture supernatant According to the result of MTT test, we suppose that the protection of leptin on H90min/R3h injury is relevant to the level of CGRP. To explore the possible pathways that mediate an increase of neuron survival rate, we designed the following experiment to compare the level of CGRP between the Leptin group and the Leptin + CGRP8-37 group (Fig. 6). We detected the level of CGRP in cell culture medium by radioimmunity (RIA) assay. In accordance with our expectation, the level of CGRP in the culture supernatant of the Vehicle group was significantly lower than that in the control group, but the level was restored in the Leptin treatment group, showing that leptin attenuates neuron hypoxia/reoxygenation injury partially by CGRP expression.
Fig. 6. Leptin promotes CGRP release in culture supernatant. Cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 2 days. The cells were then divided into three groups: control group, Vehicle group and Leptin group. After reoxygenation for 3 h, the cell cultures were used to detect the concentration of CGRP. Culture supernatant CGRP was measured by self-produced radioimmunoassay according to our precious report (Yan et al., 2009). CGRP concentrations were expressed in ng/ml. After hypoxia/reoxygenation injury, the level of CGRP excreted by neuron was significantly reduced, *P b 0.01 vs. the control. In the Leptin group, the expression of CGRP was clearly enhanced, **P b 0.01 vs. the Vehicle group, but was similar to the control group (P N 0.05). Data are presented as mean ± S.D., n = 6/group.
68
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
in neurons after hypoxia/reoxygenation injury (P b 0.001). However, this role of leptin on bcl-2 and caspase-3 can be abolished by CGRP8-37 (P b 0.001), which strongly indicates that the effect of leptin is mediated in part by CGRP (Fig. 7A, C and D). 4. Discussion Leptin, as a peripherally-derived and centrally-synthesized molecule, is involved in the normal functions and abnormal processes of the brain (Signore et al., 2008). Our results suggested that peripherallyadministered leptin exerted a similar neuroprotective effect by improving the neurological deficit and increasing regional cerebral blood flow. These findings are consistent with other reports (Avraham et al., 2010; Valerio et al., 2009; Zhang et al., 2007). Our studies indicated that leptin promoted CGRP expression in the ischemic brain. CGRP is mainly expressed in the central nervous system (Lange et al., 2009). CGRP is one of the most powerful vasodilators in vivo, with a strong effect of cerebral vascular expansion (Omeis et al., 2008). A previous study found that exogenous CGRP could increase the cerebral blood flow significantly and protect the ischemic neurons (Zhang et al., 2010). We propose that CGRP plays an important role in neuroprotection of leptin. In our study, despite of the distinct histological damage and neuronal apoptosis observed in Vehicle, peripherally-administered leptin effectively attenuated tissue damage and the percentage of apoptotic neurons. Meanwhile, as the injury triggered increased levels of bcl-2 and activated caspase-3, peripherally-administered leptin partially reversed these alterations. This evidence indicated that leptin can protect brain tissue from cerebral ischemia/reperfusion injury. In our study, the level of CGRP was significantly reduced after ischemia/reperfusion injury, which was not conducive to the repair of damaged tissue, while CGRP expression was significantly enhanced in Leptin treatment group. CGRP, mainly expressed in the central nervous system, is one of the most powerful vasodilators in vivo, with a strong effect of cerebral vascular expansion (Lange et al., 2009; Omeis et al., 2008). Many studies have suggested that CGRP intervention early in the brain injury can significantly reduce neurocyte apoptosis and nervous system
damage and maintain nerve regeneration (Macdonald et al., 2007). Exogenous CGRP can increase the cerebral blood flow significantly and protect the ischemic neurons (Zhang et al., 2010). We propose that exogenous leptin increases the content of CGRP in the injured brain, dilating cerebral vessels, resulting in ischemic neurons receiving adequate blood supply and promoting the survival of ischemic neurons. Furthermore, CGRP might be involved in leptin-mediated protection against cerebral ischemia/reperfusion injury. Neurons surrounding cerebral vessels are rich in CGRP expression, and they directly protect of brain cells during hypoxic injury via maintenance of intracellular calcium homeostasis. Previous studies have suggested that CGRP intervention early in brain injury can significantly reduce neurocyte apoptosis and nervous system damage and maintain nerve regeneration (Macdonald et al., 2007). Therefore, the reduction of CGRP in cerebral ischemia is not conducive to the repair of damaged tissue, and endogenous CGRP release may be a helpful method to repair brain ischemia. A previous study has shown that α-CGRP8-37 attenuated the CGRP neuroprotective effect on remote mesenteric ischemic preconditioning (Rehni et al., 2007). It has been reported CGRP8-37 administration to rats with CIP (caerulein-induced pancreatitis) that were pretreated with leptin resulted in the partial reversal of the pancreato protective effect of leptin, and demonstrated that CGRP was involved in the protective effects of leptin on the pancreas subjected to caerulein overstimulation (Jaworek et al., 2002). This led us to ask: do leptin and CGRP interact in cerebral ischemia/reperfusion injury? We designed the experiments with CGRP receptor antagonists to counteract the protective effect of leptin on neurons during neuronal hypoxia/reoxygenation injury. In this vitro study, leptin markedly stimulated the release of neuropeptide CGRP from neurons, which significantly augmented the survival rate of neurons, upregulated bcl-2 and inhibited caspase-3 expression after hypoxia/reoxygenation injury. However, the protection of leptin on hypoxia/reoxygenation was partially abolished by CGRP8-37, resulting in a decrease in the survival rate of neurons, which was associated with a marked reduction of bcl2 and increased caspase-3 levels. In vitro studies have found that
Fig. 7. CGRP antagonist abolishes the effect of leptin on bcl-2 and caspase-3 mRNA expression. Cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 2 days. The cells were then divided into four groups: control group, Vehicle group, Leptin group and CGRP8-37 + Leptin group. CGRP, bcl-2 and caspase-3 expression was detected by RTPCR. The PCR products were resolved in a 1.5% agarose gel containing 0.5 mg/L ethidium bromide, and the molecular weight Marker DL2000 as the standard reference. Images were acquired with Gel-Pro Image Kit imaging system in UV light. The cumulative product of optical density (OD) was analyzed using spot densitometry analysis software of Gel-Pro® Analyzer 3.0. After hypoxia/reoxygenation injury, neuronal apoptosis was increased severely, which may be relative to the level of CGRP. *P b 0.001 vs. Sham; #P b 0.001 vs. Vehicle; &P b 0.001 vs. Leptin. Data are presented as mean ± S.D., n = 3/group.
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
CGRP reduces the mortality rate of hypoxic hippocampal neurons, protecting and restoring cultured hippocampal neurons after hypoxia injury (Dragunow et al., 1992). Our data indicates that leptin could augment the expression of CGRP in brain and cultured neurons after injury. We confirmed that CGRP8-37 can compete with CGRP receptor and block its signal transduction, leading to negative feedback regulation and depression of CGRP mRNA expression. As a result, the effect of leptin on bcl-2 and caspase-3 was partly abolished. These results indicate that CGRP takes part in the apoptosis process of nerve cells after ischemia and hypoxia injury. CGRP-promoted survival of ischemic neurons may be conducted by two ways. On one hand, CGRP is a potent dilator of cerebral vessels so the ischemic neurons can receive ample blood supply quickly; on the other hand, CGRP participates in the regulation of body homeostasis. In summary, our results suggest that peripherally-administered leptin exerts neuroprotective effects partially by promoting CGRP expression which results in improving neurological deficits, increasing regional cerebral blood flow, and decreasing infarct volume, neuronal apoptosis and necrosis. It suggests for the first time that CGRP may be a potential mediator of leptin neuroprotective actions after ischemia/reperfusion and hypoxia/reoxygenation injury. In conclusion, leptin may protect brain tissue after cerebral ischemia/reperfusion and neuron hypoxia/reoxygenation injury partially by promoting CGRP expression. In the future, we plan to investigate the role of CGRP using a CGRP knockout mouse and db/db mouse and search for more evidence to demonstrate the role of CGRP in leptin-mediated protection after cerebral ischemia/reperfusion injury. Acknowledgments This work was supported by the National Natural Science Foundation of China (no. 30670821), the National Key Technology R&D Program (no. 2006BAF07B01) and the Nursery Fund of Chinese PLA General Hospital (no. 06MP83). The authors' work was independent of funding sources. We thank Mr. Li Ning for his help with using the microscopes and Mr. Sun Sheng for the help with using the Laser– Doppler blood flowmeter. References Avraham, Y., Davidi, N., Porat, M., Chernoguz, D., Magen, I., Vorobeiv, L., Berry, E.M., Leker, R.R., 2010. Leptin reduces infarct size in association with enhanced expression of CB2, TRPV1, SIRT-1 and leptin receptor. Curr. Neurovasc. Res. 7, 136–143. Cao, G., Clark, R.S., Pei, W., Yin, W., Zhang, F., Sun, F.Y., Graham, S.H., Chen, J., 2003. Translocation of apoptosis-inducing factor in vulnerable neurons after transient cerebral ischemia and in neuronal cultures after oxygen–glucose deprivation. J. Cereb. Blood Flow Metab. 23, 1137–1150. Denekas, T., Tröltzsch, M., Vater, A., Klussmann, S., Messlinger, K., 2006. Inhibition of stimulated meningeal blood flow by a calcitonin gene-related peptide binding mirrorimage RNA oligonucleotide. Br. J. Pharmacol. 148, 536–543.
69
Dragunow, M., Sirimanne, E., Lawlor, P.A., Williams, C., Gluckman, P., 1992. Accumulation of calcitonin-gene related peptide-like immunoreactivity after hypoxicischeamic brain injury in the infant rat. Brain Res. Mol. Brain Res. 14, 267–272. Fruhbeck, G., 2006. Intracellular signalling pathways activated by leptin. Biochem. J. 393, 7–20. Gunasekar, P.G., Sun, P.W., Kanthasamy, A.G., Borowitz, J.L., Isom, G.E., 1996. Cyanideinduced neurotoxicity involves nitric oxide and reactive oxygen species generation after N-methyl-D-aspartate receptor activation. J. Pharmacol. Exp. Ther. 277, 150–155. Jaworek, J., Bonio, J., Leja-Szpa, A., Nawrot, K., Tomaszewska, M.R., Stachura, J., Pawlik, W.W., Konturek, S.J., 2002. Sensory nerves in central and peripheral control of pancreatic integrity by leptin and melatonin. J. Physiol. Pharmacol. 53, 51–74. Kobari, M., Fukuuchi, Y., Tomita, M., Tanahashi, N., Takeda, H., Yokoyama, M., 1995. Calcitonin gene-related peptide (CGRP) and the regulation of cerebral parenchymal vessels. Brain Res. 689, 95–99. Li, Q., Zhang, R., Guo, Y.L., Mei, Y.W., 2009. Effect of neuregulin on apoptosis and expressions of STAT3 and GFAP in rats following cerebral ischemic reperfusion. J. Mol. Neurosci. 37, 67–73. Longa, E.Z., Weinstein, P.R., Carlson, S., Cummins, R., 1989. Reversible middle cerebral artery occlusion without craniotomy in rats. Stroke 20, 84–91. Lange, M., Enkhbaatar, P., Traber, D.L., Cox, R.A., Jacob, S., Mathew, B.P., Hamahata, A., Traber, L.D., Herndon, D.N., Hawkins, H.K., 2009. Role of calcitonin gene-related peptide (CGRP) in ovine burn and smoke inhalation injury. J. Appl. Physiol. 107, 176–184. Macdonald, R.L., Pluta, R.M., Zhang, J.H., 2007. Cerebral vasospasm after subarachnoid hemorrhage: the emerging revolution. Nat. Clin. Pract. Neurol. 3, 256–263. Nakka, V.P., Gusain, A., Mehta, S.L., Raghubir, R., 2008. Molecular mechanisms of apoptosis in cerebral ischemia: multiple neuroprotective opportunities. Mol. Neurobiol. 37, 7–38. Omeis, I., Neil, J.A., Murali, R., Abrahams, J.M., 2008. Treatment of cerebral vasospasm with biocompatible controlled-release systems for intracranial drug delivery. Neurosurgery 63, 1011–1019. Rehni, A.K., Singh, N., Jaggi, A.S., 2007. Possible involvement of insulin, endogenous opioids and calcitonin gene related peptide in remote ischaemic preconditioning of brain. Yakugaku Zasshi 127, 1013–1020. Signore, A.P., Zhang, F., Weng, Z., Gao, Y., Chen, J., 2008. Leptin neuroprotection in the CNS: mechanisms and therapeutic potentials. J. Neurochem. 106, 1977–1990. Valerio, A., Dossena, M., Bertolotti, P., Boroni, F., Sarnico, I., Faraco, G., Chiarugi, A., Frontini, A., Giordano, A., Liou, H.C., De Simoni, M.G., Spano, P., Carruba, M.O., Pizzi, M., Nisoli, E., 2009. Leptin is induced in the ischemic cerebral cortex and exerts neuroprotection through NF-kappaB/c-Rel-dependent transcription. Stroke 40, 610–617. Woitzik, J., Back, T., Thome, C., 2008. Flow-dependent versus spreading-like impairment of brain tissue integrity during focal cerebral ischemia and its consequences for neuroprotective strategies. Front. Biosci. 13, 1500–1506. Xu, X., Chua, C., Gao, J., Hamdy, R.C., Chua, B.H., 2006. Humanin is a novel neuroprotective agent against stroke. Stroke 37, 2613–2619. Yan, G.T., Lin, J., Hao, X.H., Xue, H., Zhang, K., Wang, L.H., 2009. Heart-type fatty acidbinding protein is a useful marker for organ dysfunction and leptin alleviates sepsis-induced organ injuries by restraining its tissue levels. Eur. J. Pharmacol. 616, 244–250. Zhang, F., Chen, J., 2008. Leptin protects hippocampal CA1 neurons against ischemic injury. J. Neurochem. 107, 578–587. Zhang, Z.H., Fang, X.B., Xi, G.M., Li, W.C., Ling, H.Y., Qu, P., 2010. Calcitonin gene-related peptide enhances CREB phosphorylation and attenuates tau protein phosphorylation in rat brain during focal cerebral ischemia/reperfusion. Biomed. Pharmacother. 64, 430–436. Zhang, F., Wang, S., Signore, A.P., Chen, J., 2007. Neuroprotective effects of leptin against ischemic injury induced by oxygen–glucose deprivation and transient cerebral ischemia. Stroke 38, 2329–2336.
Contents lists available at SciVerse ScienceDirect
European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar
Neuropharmacology and Analgesia
Leptin attenuates cerebral ischemia/reperfusion injury partially by CGRP expression Jin-ying Zhang a, Guang-tao Yan a,⁎, Jie Liao b, Zi-hui Deng a, Hui Xue a, Lu-huan Wang a, Kai Zhang a a b
Research Laboratory of Biochemistry, Basic Medical Institute, Chinese General Hospital of PLA, 28 Fuxing Road, Beijing 100853, PR China Research Laboratory of Medical Experiment and Test Center, Basic Medical Institute, Chinese General Hospital of PLA, 28 Fuxing Road, Beijing 100853, PR China
a r t i c l e
i n f o
Article history: Received 27 May 2011 Received in revised form 14 September 2011 Accepted 15 September 2011 Available online 28 September 2011 Keywords: Leptin Calcitonin gene-related peptide CGRP8-37 Cerebral ischemia/reperfusion Hypoxia/reoxygenation Neuroprotection
a b s t r a c t Ischemic stroke is a medical emergency triggered by a rapid reduction in blood supply to localized portions of the brain, usually because of thrombosis or embolism, which leads to neuronal dysfunction and death in the affected brain areas. Leptin is generally considered to be a strong and quick stress mediator after injuries. However, whether and how peripherally administered leptin performs neuroprotective potency in cerebral stroke has not been fully investigated. It has been reported that CGRP8-37, an antagonist of the CGRP receptor, could reverse the protective effect of leptin on rats with CIP (caerulein-induced pancreatitis). However, the question remains: are leptin and CGRP associated in cerebral ischemia/reperfusion injury? The present study attempted to evaluate the relationship between CGRP expression and leptin neuroprotective effects (1 mg/kg in 200 μL normal saline, i.p.) on focal cerebral ischemia/reperfusion injury in mice and the protective effect of leptin (500 μg/L) on neurons during hypoxia/reoxygenation injury. Peripheral administration of leptin alleviated injury-evoked brain damage by promoting CGRP expression, improving regional cerebral blood flow, and reducing local infarct volume and neurological deficits. Furthermore, leptin also promoted bcl-2 expression and suppressed caspase-3 in vivo and vitro after injury. Administration of CGRP8-37 (4 × 10 −8 mol/L) partly abolished the beneficial effects of leptin, and restored the normal expression levels of bcl-2 and caspase-3 in neurons, which indicated that leptin-induced protection of neurons was correlated with release of CGRP. These results indicate that the neuroprotective effect of leptin against cerebral ischemia/reperfusion injury may be strongly relevant to the increase of CGRP expression. © 2011 Elsevier B.V. All rights reserved.
1. Introduction Cerebral stroke is the major leading cause of death and disability, and it is estimated that it is responsible for nearly 50% of the patients hospitalized for acute neurological disorders (Nakka et al., 2008). Stroke is usually characterized by ischemia/reperfusion of cerebral blood vessels, resulting in decreased blood flow and neurocyte cellular (both neuronal and non-neuronal) damage (Li et al., 2009; Woitzik et al., 2008). Therefore, improving blood flow and neurocyte function are keys to protecting the brain from ischemia/reperfusion injury. Leptin has been identified as an ob gene-expression protein, mainly secreted by adipose tissue, with roles of inhibiting food intake, modulating weight balance, and regulating energy metabolism (Fruhbeck, 2006). As a peripherally-derived and centrally-synthesized molecule, leptin is involved in the normal functions and abnormal processes of the brain (Signore et al., 2008; Yan et al., 2009). Previous studies showed that leptin could protect the cerebral ischemia tissues from injury (Zhang and Chen, 2008; Zhang et al., 2007); however, the identity of the signaling molecules downstream of leptin that protect against cerebral ischemic injury remains unclear. Calcitonin gene-related peptide
⁎ Corresponding author. Tel.: + 86 10 66937072; fax: + 86 10 68176512. E-mail address: [email protected] (G. Yan). 0014-2999/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2011.09.170
(CGRP) is known to play an important role in the control of intracranial blood flow and protection of neurons (Denekas et al., 2006). Administration of CGRP in laboratory animals has been shown to increase cerebral blood flow significantly, decrease focal cerebral infarction volume inducing protective of ischemic neurons and reverse ischemia injury in brain (Kobari et al., 1995; Zhang et al., 2007). It has been reported that CGRP8-37 administration to rats with CIP (caerulein-induced pancreatitis) that were pretreated with leptin resulted in the partial reversal of pancreato protective effect of leptin. This study demonstrates that CGRP is involved in the protective effects of leptin on the caeruleinoverstimulated pancreas (Jaworek et al., 2002). However, whether peripherally-administered leptin could protect brain from ischemic injury by inducing CGRP expression has not been reported. Thus, in this article, we try to identify that CGRP mediates the protective role of leptin against cerebral ischemia/reperfusion injury in vivo and vitro. 2. Materials and methods 2.1. Animals Male Kunming mice (age 30.2 ± 1.6 days, weight 25 ± 0.2 g) and one SD pregnant rat (pregnancy 17–18 days) was supplied by the experimental animal center in our hospital. Mice were maintained in a room at 22–25 °C under a constant day/night rhythm and given
62
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
food and water ad libitum. All animal experiments were carried out in accordance with the NIH Guide for Care and Use of Laboratory Animals and were approved by the Animal Care and Use Committee at our hospital. 2.2. Model of focal cerebral ischemia/reperfusion injury Fifty-seven mice were divided randomly into three groups of 19 mice each, including sham-operation (Sham), ischemia/reperfusion (Vehicle) and leptin injection (Leptin) groups. Mice were deprived of food 12 h prior to the start of experiment, while drinking water was available ad libitum. The model of focal cerebral ischemia/reperfusion injury was performed by unilateral middle cerebral artery (MCA) occlusion as described previously (Xu et al., 2006). Briefly, mice were anesthetized with pentobarbital sodium (60 mg/kg, i.p.), and their skin was then sterilized. The common carotid artery, the external carotid artery and the internal carotid artery on the right side were exposed through a ventral midline neck incision. A 6–0 nylon monofilament coated with silicon resin was introduced into the right common carotid artery and advanced until faint resistance was felt. After ischemia for 2 h, reperfusion was achieved by withdrawing the monofilament to restore blood supply to the MCA territory for 24 h. The common carotid artery, the external carotid artery and the internal carotid artery on the right side were exposed but not occluded in the Sham group. Mice in the leptin injection group were given leptin (1 mg/kg in 200 μL normal saline, i.p.) immediately after occlusion, and mice in the Sham and Vehicle groups were given 200 μL normal saline (i.p.) at the same time. The incision was closed in layers, and resuscitation with isotonic saline (30 ml/kg, i.p.) was supplied. Then, mice were sterilized with iodophor on their suture sites and released back to cages, where drinking water was available ad libitum. Body temperature was maintained at 36.5–37.5 °C throughout the procedure. Ten mice from each group were randomly chosen for evaluation of neurological function, blood flow and local infarct volume; another three mice from each group were randomly selected for detection of mRNA expression of CGRP, bcl-2 and activated caspase-3 in the ischemic cortex; while the remaining six mice were used to investigate histological alterations, CGRP expression and neuronal apoptosis in the ischemic cortex.
probe was steadied throughout the recording period, and the velocity spectrum was translated by a software-implemented subroutine. Ten measurements of the peak velocity of MCA were taken to represent the regional cerebral blood flow. Mice in the Leptin group were given leptin (1 mg/kg in 200 μL normal saline, i.p.) immediately after occlusion, and mice of Sham and Vehicle groups were given 200 μL normal saline (i.p.) at the same time. 2.5. Measurement of local infarct volume Mice were sacrificed 24 h after reperfusion, and their brains were isolated for estimation of infarct volume (n = 10/group). In brief, the mice were sacrificed under deep anesthesia, brains were removed and immediately frozen in isopentane cooled with dry ice, and serial sections from anterior to posterior were prepared as 2-mm slices. Samples were placed in 2% 2,3,5-triphenyl tetrazolium chloride (TTC; Sigma, USA) stain for 20 min at 37 °C and then fixed in 10% buffered formaldehyde for 24 h. The stained brain sections were digitally photographed. Cerebral infarct volumes were measured using microscope image-analysis software (Image-Pro plus, USA). The data were expressed as the percentage of infarct volume/ipsilateral hemisphere volume at the coronal slices. 2.6. Investigation of histopathology and neuronal apoptosis
a) Death within 24 h after reperfusion b) Subarachnoid hemorrhage (as macroscopically assessed during brain sampling) c) Bederson score = 0 (24 h after reperfusion).
Mice were perfusion-fixed with 4% paraformaldehyde in 0.1 mol/L pH 7.4 PBS under anesthesia after 24 h reperfusion. The brains were immediately removed, further fixed in 10% paraformaldehyde overnight at 4 °C and embedded in paraffin. Serial coronal sections (5-μm thick) obtained 1.5 mm behind the bregma were stained with hematoxylin and eosin. The normal morphology and the presence and nature of ischemic of damage in the frontoparietal cortex were verified by two neuropathologists who were unaware of the experimental design or the results of TTC staining. The coronal sections were deparaffinized, hydrated sequentially and examined by terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling assay (TUNEL assay) according to established protocols. TUNEL-positive cells displayed brown staining within the nucleus of apoptotic cells. DNA fragmentation was quantified by an investigator blinded to the study. Neuronal apoptosis in the ischemic cortex was expressed as the percentage of apoptotic neurons/total neurons. Protein expression of CGRP in the ischemic cortex was detected by immunohistochemistry. Briefly, the coronal sections were collected on 0.1% poly-lysine coated slides, deparaffinized by the xylene-ethanol sequence, rehydrated in a graded ethanol scale and in phosphate buffered saline (PBS). After prior antigen retrieval by heating in a pressure cooker in citrate buffer, the slides were incubated sequentially with the CGRP antibody, biotinylated anti-rabbit IgG and peroxidase-conjugated streptavidin for 1 h at 37 °C, using respective dilution of 1:200 in PBS. Diaminobenzidine chromogenic kits were used to develop the color. Negative controls were set simultaneously by replacing the first antibody with PBS. The images were visualized with Leica® DC300F Digital Camera Systems, and 10 microscopic fields in each group were randomly selected. Image-Pro Plus® 6.0 software was chosen to analyze the ratio of accumulated optical density of specific positive staining/specific tissue area in each image.
2.4. Evaluation of regional cerebral blood flow (rCBF)
2.7. RNA isolation and PCR studies
Blood flow in the MCA territory on the ischemic side was monitored at a preoperative time point, 2 h after the occlusion of the middle cerebral artery (I2h), and again 5 min (I2hR5min) and 24 h (I2hR24h) after the removal of the filament (reperfusion) by a Laser–Doppler blood flowmeter (Perimed® Periflux 5010, Sweden) positioned 1 mm posterior and 3 mm lateral to the bregma. The
The levels of gene expression for CGRP, bcl-2, caspase-3 and betaactin in the ischemic cortex and in neurons were semi-quantified. After 24 h reperfusion, isolated total RNA from the ischemic cortex separated from the preserved cerebrum samples, using TRIzol reagent (Gibco RL, Grand Islan, NY, USA) according to the manufacturer's instructions. Total RNA (2.5 μg) was subsequently transcribed into
2.3. Evaluation of neurological deficit Twenty-four hours after reperfusion the Longa's “5 Law” (Longa et al., 1989) was used to determine global neurological function according to the following scoring system: 0, no deficit; 1, forelimb flexion; 2, decreased resistance to lateral push; 3, unidirectional circling; 4, longitudinal spining; 5, no movement. Rating was performed in a blinded manner. The neurological function was scored twice, initially after full recovery from anesthesia during the reperfusion period and later after completion of 24 h reperfusion. The exclusion criteria were as follows:
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
cDNA and amplified separately with specific primers for CGRP, bcl-2, caspase-3 and beta-actin using SuperScript One-Step RT-PCR System. The primer sequences used for PCR were as the following: beta-actin (5′CTGTCCCTGTATGCCTCTG 3′; 5′ATGTCACGCACGATTTCC3′), mouse CGRP (5′AGTTCTTTCCT TTTCTGG3′; 5′ACACGGGAGCCCTTAGTC3′), rat CGRP (5′TCCTGG TTGTCAGCATCT3′; 5′CTCAGCCTCCTGTTCCTC3′), caspase-3 (5′A GGGGTCATTTATGGGACA3′; 5′TACACGGGATCTGGTTTCTTT3′), and bcl-2 (5′-AGCCGGGAGAACAGGGTA-3′; 5′-TGAAGAGTTCCT CCACCACC-3′). The following PCR conditions were used for beta-actin: 36 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s. The following PCR conditions were used for mouse CGRP and rat CGRP: 36 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 s, and extension at 72 °C for 30 s. The following PCR conditions were used for caspase-3 and bcl-2: 36 cycles of denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s. The PCR products were resolved in 1.5% agarose gel containing 0.5 mg/L ethidium bromide, and the intensity of each band was analyzed by using spot densitometry analysis software of Gel-Pro® Analyzer 3.0. 2.8. Rat primary neuronal culture and hypoxia/reoxygenation Primary cultures of rat cortical neurons were prepared from 17day-old SD rat embryos as previously described (Cao et al., 2003). Cells were cultured at 37 °C in 95% humidified atmosphere on day 2 and replaced with fresh medium containing cytosine arabinoside (10 μmol/L) to inhibit excessive proliferation of non-neurons. Cell cultures were routinely observed under a phase-contrast inverted microscope. For the following experiments, neurons and glia were identified with anti-NSE and anti-GFAP antibodies respectively; the ratio of neurons was greater than 90%. Cells were plated onto poly-D-lysine (10 μg/ml) precoated 96-well plates (about 5 × 10 5 cells/well) for the analysis of cellular viability of injured to neurons and 24-well plates (about 3 × 10 6 cells/well) for detecting CGRP and apoptosis-related gene expression. For the studies of leptin-mediated neuroprotection, the cultures were replaced with glucose-deprivation cultures. The CGRP inhibition studies were performed in some experiments with the CGRP8-37 at concentrations of 4 × 10 −8 mol/L, according to experimental conditions. Neurons were treated with this inhibitor for 30 min, and leptin was then added to the medium to reach a final concentration of 500 μg/L. To model ischemia-like conditions in vitro, primary cultures were exposed to oxygen–glucose deprivation (OGD) (Cao et al., 2003). In brief, the culture medium was replaced with serum- and glucose-free medium. The cultures were put into an air tight box, and 95% N2 and 5% CO2 mixed gas was continually aerated into the box for 5 min to completely replace the air in the box. The box was placed in a water-jacketed incubator at 37 °C for 90 min and then returned to 95% air, 5% CO2, and glucose-containing medium for 3 h (hypoxia for 90 min and reoxygenation for 3 h, H90min/R3h). Control glucose-containing cultures were incubated for the same periods of time at 37 °C in humidified 95% air and 5% CO2. The cells and supernatants were collected for analysis. 2.9. Detected cell viability by MTT assay For MTT assay, cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 2 days. Then cells were divided into six groups: control group, Vehicle group, Leptin group, CGRP8-37 + Leptin group, CGRP group and CGRP8-37 + CGRP group. After hypoxia 90 min, cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 3 h. In brief, 10 μL MTT solution (5 mg/ml) was added to each well, then the cells were cultured for another 4 h at 37 °C, and 100 μL DMSO was added to each well and mixed vigorously to solubilize colored crystals produced within the living cells. The reaction product was analyzed at 570 nm with a microplate spectrophotometer (Spectra max plus, Molecular Devices, CA).
63
2.10. RIA of CGRP levels in culture supernatant Culture supernatant CGRP was measured by self-produced radioimmunoassay (RIA) according to our previous report (Yan et al., 2009). The first elution peak of Sephadex G-25 chromatography column was collected at the rate of one tube per minute, and those 125 I-labeled CGRP with high specific binding rate and low fault binding rate were taken as successful iodinated CGRP. They were mixed with equal volumes of 1.5% bovine serum albumin and stored at −20 °C. After reoxygenation for 3 h, cell culture medium was collected. The standard sample or CGRP was seized with a certain amount of 125 I and CGRP antiserum solution together, mixing at 4 °C and then incubated for 24 h. After incubation, the immune separating agent was added. CGRP and the antibody complex precipitated and then centrifuged at 3500 rpm for 15 min at 4 °C. Total radioactivity (T) and precipitation radioactivity (B) were determined after discarding the supernatant. The standard point value (B/B0%) was calculated and used to produce a standard curve. The concentration of CGRP in samples was acquired from the B/B0% binding used to obtain the CGRP standard curve concentration. CGRP concentrations were expressed as ng/ml. 2.11. Statistical analysis All data were expressed as mean ± S.D. Stata 7.0 software was used to process the data. For all data except the grading of neurological deficits, one-way analysis of variance and Student's t tests were applied. For the grading of neurological deficits, Wilcoxon signedrank test was used. A P value of less than 0.05 was chosen as the threshold for statistical significance. 3. Results 3.1. Leptin improves mouse regional cerebral blood flow after injury Blood flow of the branch of the middle cerebral artery was observed under an optical microscope after 24 h reperfusion (plus cold light source for medical purposes). Branch blood vessels linear flow phenomenon could be seen clearly in the Sham group. After cerebral
Fig. 1. Leptin increases rCBF in the branches of middle cerebral artery after cerebral ischemia/reperfusion injury at different time points in each group. Mice in the leptintreated group were given leptin (1 mg/kg in 200 μL normal saline, i.p.) immediately after occlusion, and mice of Sham and Vehicle were given 200 μL normal saline (i.p.) at the same time. Determination of preoperative regional cerebral blood flow (rCBF), 2 h after the occlusion of the middle cerebral artery (ischemia, I2h), 5 min after the removal of the filament (reperfusion, I2hR5min) and 24 h after reperfusion (I2hR24h). Regional blood flow of the MCA territory on the ischemic side was monitored by a Laser–Doppler blood flowmeter positioned 1 mm posterior and 3 mm lateral to the bregma. A decrease in regional blood flow was observed in the branches of the middle cerebral artery in the model, and it was partially rehabilitated in leptin. Twenty-four hours after reperfusion, regional blood flow in the model further restored to the 2/3 of preoperative level. Obviously, the recovery of blood flow in the Leptin treatment group improved significantly. *P b 0.01 vs. Vehicle. All data are presented as mean ± S.D., n = 10/group.
64
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
ischemia/reperfusion, regional blood flow velocity in this model was significantly decreased, and particle flow was clearly observed in the branches of MCA. Blood flow velocity and linear flow were recovered in the Leptin (1 mg/kg; i.p.) group, and particle flow was no longer detectable (Fig. 1).
Regional cerebral blood flow of the infarction zone in mice was monitored by LDF (Laser–Doppler blood flowmeter). The results showed that blood flow after ischemia fell by approximately 67%, suggesting successful establishment of the model. After reperfusion, regional blood flow recovered to half of that before operation (1.49 ±
Fig. 2. TTC staining (A), histopathological alterations in the cerebral cortex (B), neurological deficit scores (C) and infarct volume (D) in mice after ischemia/reperfusion injury. Cerebral infarct volumes were measured using microscope image-analysis software (Image-Pro plus, USA). The data were expressed as the percentage of infarct volume/ipsilateral hemisphere volume at the coronal slices (A, n = 10/group). ⁎P b 0.01 vs. Sham group, #P b 0.01 vs. Vehicle group. Neurological function scores in the Leptin group were lower than that in Vehicle (C, n = 10/group). In the representative coronal brain slices, infarct volume was observed in Vehicle, while about 67% reduced infarct size was found in Leptin (D, n = 10/group). Histopathological alterations in the cerebral cortex (B, n = 6/group) after injury were detected by HE staining. The normal morphology and the presence and nature of ischemic of damage in the frontoparietal cortex were verified by two neuropathologists unaware of the experimental design or the results of TTC staining. Disorderly arranged neurocytes with loosened cytoplasm and karyopyknosis, vacuolization and interstitial edema were found in Vehicle, while significantly minor alterations were observed in Leptin group. All data were presented as mean ± S.D.
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
0.02 vs. 3.09 ± 0.04). Twenty-four hours after reperfusion, regional blood flow in this model was further restored to 73% of preoperative flow (2.27 ± 0.03 vs. 3.09 ± 0.06). Furthermore, regional blood flow with leptin treatment improved to 88% preoperative flow (2.78 ± 0.05 vs. 3.16 ± 0.03) (P b 0.01) (Fig. 1). 3.2. Leptin decreases infarct volume, neurological defect and alleviates histological alterations Two hours after reperfusion, mice presented various degrees of neurological deficit when regaining consciousness. Neurological deficit scores in the Leptin group were significantly lower than in the Vehicle group (P b 0.01), as shown in Fig. 2C. After TTC staining, infarcted brain was visualized as an area of unstained (white) tissue in a surrounding background of viable
65
(brick red) tissue. TTC staining showed that all of the Sham brain slices were stained red, and the right frontal cortex and striatum infarct of the Vehicle were seen clearly in white (Fig. 2A). After 24 h reperfusion infarct volume was detected in each group. Infarct volume of mice in the Leptin group was clearly smaller than in Vehicle mice (P b 0.01), as shown in Fig. 2D. Normal morphology and the presence and nature of ischemic damage in the frontoparietal cortex were verified by two neuropathologists who were unaware of the experimental design or the results of TTC staining. Compared to histological alterations in the ischemic frontoparietal cortex in Sham, the neurocytes in Vehicle group were arranged in a disorderly fashion, with loosened cytoplasm and karyopyknosis, while diffuse vacuolization and edema in the interstitial spaces was also observed. Similar but significantly minor alterations were observed in the Leptin group (Fig. 2B).
Fig. 3. Neuronal apoptosis (A and C, TUNEL assay), bcl-2 and caspase-3 mRNA expression (B, D, E, RT-PCR) in the ischemic cortex after injury. The percentage of apoptotic neurons in the Vehicle and Leptin groups was higher than in Sham, but the percentage of apoptotic neurons in the Leptin group was lower than in the Vehicle. mRNA expression of bcl-2 in the Vehicle and Leptin groups was significantly higher than in Sham, but the level of bcl-2 in Vehicle was lower than in Leptin. mRNA expression of caspase-3 in Vehicle and Leptin was also higher than in Sham, but the level of caspase-3 in Leptin was lower than in Vehicle. Data are presented as mean ± S.D., n = 6/group. *P b 0.001 vs. Sham; #P b 0.001 vs. Vehicle.
66
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
3.3. Leptin alleviates neuronal apoptosis, upregulates apoptosis-related gene bcl-2 and downregulates caspase-3 mRNA expression after injury To investigate neuronal apoptosis after cerebral ischemia/ reperfusion injury, TUNEL assay was used in this study. Compared to the percentage of apoptotic neurons in the ischemic cortex in Sham, the percentage of apoptotic neurons in Vehicle and Leptin were significantly higher (P b 0.001), but the percentage of apoptotic neurons in Leptin was significantly lower than in Vehicle (Fig. 3A and C). Compared to mRNA expression of bcl-2 in the ischemic cortex in Sham, the levels in Vehicle and Leptin were significantly higher (P b 0.001); while the level in Vehicle was significantly lower than in Leptin (P b 0.001) (Fig. 3B and D). Compared to mRNA expressions of caspase-3 in Sham, the levels in Vehicle and Leptin were significantly higher (P b 0.001), but the level in Leptin was significantly lower than in Vehicle (P b 0.001) (Fig. 3B and E).
3.4. Local CGRP decreases in brain after cerebral ischemic injury Compared to Sham, local CGRP level after injury was significantly decreased (P b 0.01), but could be partly recovered after leptin treatment, to lower levels than in Vehicle group (Pb 0.01). Therefore, these data indicate that the level of CGRP was decreased after ischemia/reperfusion injury and leptin can enhance CGRP synthesis in the Vehicle brain (Fig. 4A and B). To further investigate the effect of leptin on CGRP, the RT-PCR assay was used to detect CGRP mRNA expression with leptin treatment in vitro experiment. Bands of each group for optical density analysis showing that CGRP gene expression in cerebral neurons after ischemia/reperfusion injury was significantly lower than in Sham (P b 0.01), mRNA expression of CGRP in leptin was significantly higher than in Vehicle group (P b 0.01) but still lower than which in Sham (P b 0.05). Those results were similar to those in the CGRP measurement by immunohistochemistry (Fig. 4C and D).
Fig. 4. CGRP expression (A and B) and mRNA expression of CGRP (C and D) in the ischemic cortex after injury. Protein expressions of CGRP in ischemic cortex were detected by immunohistochemistry. The images were visualized with Leica® DC300F Digital Camera Systems, and 10 microscopic fields in each group were randomly selected. Image-Pro Plus® 6.0 software was chosen to analyze the ratio of accumulated optical density of specific positive staining/specific tissue area in each image (A and B). Furthermore, the level of gene expression of CGRP was semi-quantified using RT-PCR. The intensity of each band was analyzed by using spot densitometry analysis software of Gel-Pro® Analyzer 3.0 (C and D). Data are presented as mean ± S.D. ⁎P b 0.01 vs. Sham group; ##P b 0.01 vs. Vehicle group; %%P N 0.05 vs. Sham group. Protein and mRNA expression of CGRP in the Leptin group was significantly higher than in Vehicle, but lower than that in Sham, but did not reach significance.
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
67
Fig. 5. Leptin protects rat cortical neurons from hypoxia/reoxygenation-induced cell death. After hypoxia/reoxygenation injury, the survival rate of neurons was significantly increased. *P b 0.01 vs. the control group; the survival rate of neurons in Leptin intervention group was higher than that of the Vehicle group, **P b 0.01. The neurons treated with leptin and CGRP8-37, however, led to significantly reduction of the survival rate of neurons (***P b 0.01), but the rate was also higher than the Vehicle. After hypoxia/reoxygenation injury, the survival rate of neurons with CGRP intervention was enhanced, ****P b 0.01 vs. Vehicle, but was still lower than the Leptin treatment group. Furthermore, the role of CGRP in increasing the neuronal survival rate disappeared because of CGRP8-37 intervention. Data are presented as mean ± S.D., n = 10/group.
3.5. Through CGRP releasing leptin protects primary cortical neurons from cell death induced by hypoxia/reoxygenation To investigate the effect of leptin on neuron survival rate in vitro, the MTT assay was utilized to verify the possibility. Cerebral neurons with hypoxia/reoxygenation injury were prepared from the fetal SD rats (17–18 days). Neuronal culture was incubated either with leptin, leptin + CGRP8-37, CGRP and CGRP + CGRP8-37 for 3 h. All incubations were followed by 90 min of hypoxia. The neuron survival rate was detected by MTT assay (neuron survival rate = Absorbance of different groups/Absorbance of the normal group*100%) (Gunasekar et al., 1996). As shown in Fig. 5, after hypoxia/reoxygenation injury, the survival rate was reduced to 1/3 of normal level, but the survival rate was evidently increased because of leptin intervention. Pretreatment with CGRP8-37 given together with leptin reduced the neuron survival rate after hypoxia/reoxygenation injury. Culturing the neurons with leptin and CGRP8-37 simultaneously, however, led to a significant reduction of neuron survival rate, indicating that CGRP8-37 may bind to CGRP receptor in neurons, blocking CGRP from biological function. CGRP8-37 reversed the beneficial effects of leptin administration on the neurons after hypoxia/reoxygenation injury. This result supports the hypothesis that CGRP may be an important molecule in neuron hypoxia/reoxygenation injury, and leptin improves neuron survival rate through CGRP. Taken together, these results suggest that leptin can protect cultured rat cortical neurons from hypoxia/ reoxygenation-induced cell death in a CGRP-dependent manner.
3.7. Leptin elevates CGRP mRNA expression in neurons To further evaluate the enhancement of leptin on CGRP expression in neurons, RT-PCR assays were utilized to examine the expression of CGRP. After hypoxia/reoxygenation injury, CGRP was rarely expressed but was significantly increased in the Leptin treatment group, nearly recovering to that control levels (Fig. 7A and B). This result demonstrated clearly that leptin can augment the expression of CGRP in neurons. However, CGRP8-37 could compete with CGRP receptor and block its signal transduction, leading to negative feedback regulation and depression of CGRP mRNA expression. 3.8. CGRP antagonist abolishes the effect of leptin on bcl-2 and caspase-3 mRNA expression To further evaluate the relationship between leptin and CGRP, the RT-PCR assays was utilized to examine the expression of bcl-2 and caspase-3 mRNA. The results clearly showed that leptin enhanced the expression of bcl-2 and depressed the expression of caspase-3
3.6. Leptin increases CGRP concentration in culture supernatant According to the result of MTT test, we suppose that the protection of leptin on H90min/R3h injury is relevant to the level of CGRP. To explore the possible pathways that mediate an increase of neuron survival rate, we designed the following experiment to compare the level of CGRP between the Leptin group and the Leptin + CGRP8-37 group (Fig. 6). We detected the level of CGRP in cell culture medium by radioimmunity (RIA) assay. In accordance with our expectation, the level of CGRP in the culture supernatant of the Vehicle group was significantly lower than that in the control group, but the level was restored in the Leptin treatment group, showing that leptin attenuates neuron hypoxia/reoxygenation injury partially by CGRP expression.
Fig. 6. Leptin promotes CGRP release in culture supernatant. Cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 2 days. The cells were then divided into three groups: control group, Vehicle group and Leptin group. After reoxygenation for 3 h, the cell cultures were used to detect the concentration of CGRP. Culture supernatant CGRP was measured by self-produced radioimmunoassay according to our precious report (Yan et al., 2009). CGRP concentrations were expressed in ng/ml. After hypoxia/reoxygenation injury, the level of CGRP excreted by neuron was significantly reduced, *P b 0.01 vs. the control. In the Leptin group, the expression of CGRP was clearly enhanced, **P b 0.01 vs. the Vehicle group, but was similar to the control group (P N 0.05). Data are presented as mean ± S.D., n = 6/group.
68
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
in neurons after hypoxia/reoxygenation injury (P b 0.001). However, this role of leptin on bcl-2 and caspase-3 can be abolished by CGRP8-37 (P b 0.001), which strongly indicates that the effect of leptin is mediated in part by CGRP (Fig. 7A, C and D). 4. Discussion Leptin, as a peripherally-derived and centrally-synthesized molecule, is involved in the normal functions and abnormal processes of the brain (Signore et al., 2008). Our results suggested that peripherallyadministered leptin exerted a similar neuroprotective effect by improving the neurological deficit and increasing regional cerebral blood flow. These findings are consistent with other reports (Avraham et al., 2010; Valerio et al., 2009; Zhang et al., 2007). Our studies indicated that leptin promoted CGRP expression in the ischemic brain. CGRP is mainly expressed in the central nervous system (Lange et al., 2009). CGRP is one of the most powerful vasodilators in vivo, with a strong effect of cerebral vascular expansion (Omeis et al., 2008). A previous study found that exogenous CGRP could increase the cerebral blood flow significantly and protect the ischemic neurons (Zhang et al., 2010). We propose that CGRP plays an important role in neuroprotection of leptin. In our study, despite of the distinct histological damage and neuronal apoptosis observed in Vehicle, peripherally-administered leptin effectively attenuated tissue damage and the percentage of apoptotic neurons. Meanwhile, as the injury triggered increased levels of bcl-2 and activated caspase-3, peripherally-administered leptin partially reversed these alterations. This evidence indicated that leptin can protect brain tissue from cerebral ischemia/reperfusion injury. In our study, the level of CGRP was significantly reduced after ischemia/reperfusion injury, which was not conducive to the repair of damaged tissue, while CGRP expression was significantly enhanced in Leptin treatment group. CGRP, mainly expressed in the central nervous system, is one of the most powerful vasodilators in vivo, with a strong effect of cerebral vascular expansion (Lange et al., 2009; Omeis et al., 2008). Many studies have suggested that CGRP intervention early in the brain injury can significantly reduce neurocyte apoptosis and nervous system
damage and maintain nerve regeneration (Macdonald et al., 2007). Exogenous CGRP can increase the cerebral blood flow significantly and protect the ischemic neurons (Zhang et al., 2010). We propose that exogenous leptin increases the content of CGRP in the injured brain, dilating cerebral vessels, resulting in ischemic neurons receiving adequate blood supply and promoting the survival of ischemic neurons. Furthermore, CGRP might be involved in leptin-mediated protection against cerebral ischemia/reperfusion injury. Neurons surrounding cerebral vessels are rich in CGRP expression, and they directly protect of brain cells during hypoxic injury via maintenance of intracellular calcium homeostasis. Previous studies have suggested that CGRP intervention early in brain injury can significantly reduce neurocyte apoptosis and nervous system damage and maintain nerve regeneration (Macdonald et al., 2007). Therefore, the reduction of CGRP in cerebral ischemia is not conducive to the repair of damaged tissue, and endogenous CGRP release may be a helpful method to repair brain ischemia. A previous study has shown that α-CGRP8-37 attenuated the CGRP neuroprotective effect on remote mesenteric ischemic preconditioning (Rehni et al., 2007). It has been reported CGRP8-37 administration to rats with CIP (caerulein-induced pancreatitis) that were pretreated with leptin resulted in the partial reversal of the pancreato protective effect of leptin, and demonstrated that CGRP was involved in the protective effects of leptin on the pancreas subjected to caerulein overstimulation (Jaworek et al., 2002). This led us to ask: do leptin and CGRP interact in cerebral ischemia/reperfusion injury? We designed the experiments with CGRP receptor antagonists to counteract the protective effect of leptin on neurons during neuronal hypoxia/reoxygenation injury. In this vitro study, leptin markedly stimulated the release of neuropeptide CGRP from neurons, which significantly augmented the survival rate of neurons, upregulated bcl-2 and inhibited caspase-3 expression after hypoxia/reoxygenation injury. However, the protection of leptin on hypoxia/reoxygenation was partially abolished by CGRP8-37, resulting in a decrease in the survival rate of neurons, which was associated with a marked reduction of bcl2 and increased caspase-3 levels. In vitro studies have found that
Fig. 7. CGRP antagonist abolishes the effect of leptin on bcl-2 and caspase-3 mRNA expression. Cells were cultured at 37 °C in 95% humidified atmosphere with 5% CO2 for 2 days. The cells were then divided into four groups: control group, Vehicle group, Leptin group and CGRP8-37 + Leptin group. CGRP, bcl-2 and caspase-3 expression was detected by RTPCR. The PCR products were resolved in a 1.5% agarose gel containing 0.5 mg/L ethidium bromide, and the molecular weight Marker DL2000 as the standard reference. Images were acquired with Gel-Pro Image Kit imaging system in UV light. The cumulative product of optical density (OD) was analyzed using spot densitometry analysis software of Gel-Pro® Analyzer 3.0. After hypoxia/reoxygenation injury, neuronal apoptosis was increased severely, which may be relative to the level of CGRP. *P b 0.001 vs. Sham; #P b 0.001 vs. Vehicle; &P b 0.001 vs. Leptin. Data are presented as mean ± S.D., n = 3/group.
J. Zhang et al. / European Journal of Pharmacology 671 (2011) 61–69
CGRP reduces the mortality rate of hypoxic hippocampal neurons, protecting and restoring cultured hippocampal neurons after hypoxia injury (Dragunow et al., 1992). Our data indicates that leptin could augment the expression of CGRP in brain and cultured neurons after injury. We confirmed that CGRP8-37 can compete with CGRP receptor and block its signal transduction, leading to negative feedback regulation and depression of CGRP mRNA expression. As a result, the effect of leptin on bcl-2 and caspase-3 was partly abolished. These results indicate that CGRP takes part in the apoptosis process of nerve cells after ischemia and hypoxia injury. CGRP-promoted survival of ischemic neurons may be conducted by two ways. On one hand, CGRP is a potent dilator of cerebral vessels so the ischemic neurons can receive ample blood supply quickly; on the other hand, CGRP participates in the regulation of body homeostasis. In summary, our results suggest that peripherally-administered leptin exerts neuroprotective effects partially by promoting CGRP expression which results in improving neurological deficits, increasing regional cerebral blood flow, and decreasing infarct volume, neuronal apoptosis and necrosis. It suggests for the first time that CGRP may be a potential mediator of leptin neuroprotective actions after ischemia/reperfusion and hypoxia/reoxygenation injury. In conclusion, leptin may protect brain tissue after cerebral ischemia/reperfusion and neuron hypoxia/reoxygenation injury partially by promoting CGRP expression. In the future, we plan to investigate the role of CGRP using a CGRP knockout mouse and db/db mouse and search for more evidence to demonstrate the role of CGRP in leptin-mediated protection after cerebral ischemia/reperfusion injury. Acknowledgments This work was supported by the National Natural Science Foundation of China (no. 30670821), the National Key Technology R&D Program (no. 2006BAF07B01) and the Nursery Fund of Chinese PLA General Hospital (no. 06MP83). The authors' work was independent of funding sources. We thank Mr. Li Ning for his help with using the microscopes and Mr. Sun Sheng for the help with using the Laser– Doppler blood flowmeter. References Avraham, Y., Davidi, N., Porat, M., Chernoguz, D., Magen, I., Vorobeiv, L., Berry, E.M., Leker, R.R., 2010. Leptin reduces infarct size in association with enhanced expression of CB2, TRPV1, SIRT-1 and leptin receptor. Curr. Neurovasc. Res. 7, 136–143. Cao, G., Clark, R.S., Pei, W., Yin, W., Zhang, F., Sun, F.Y., Graham, S.H., Chen, J., 2003. Translocation of apoptosis-inducing factor in vulnerable neurons after transient cerebral ischemia and in neuronal cultures after oxygen–glucose deprivation. J. Cereb. Blood Flow Metab. 23, 1137–1150. Denekas, T., Tröltzsch, M., Vater, A., Klussmann, S., Messlinger, K., 2006. Inhibition of stimulated meningeal blood flow by a calcitonin gene-related peptide binding mirrorimage RNA oligonucleotide. Br. J. Pharmacol. 148, 536–543.
69
Dragunow, M., Sirimanne, E., Lawlor, P.A., Williams, C., Gluckman, P., 1992. Accumulation of calcitonin-gene related peptide-like immunoreactivity after hypoxicischeamic brain injury in the infant rat. Brain Res. Mol. Brain Res. 14, 267–272. Fruhbeck, G., 2006. Intracellular signalling pathways activated by leptin. Biochem. J. 393, 7–20. Gunasekar, P.G., Sun, P.W., Kanthasamy, A.G., Borowitz, J.L., Isom, G.E., 1996. Cyanideinduced neurotoxicity involves nitric oxide and reactive oxygen species generation after N-methyl-D-aspartate receptor activation. J. Pharmacol. Exp. Ther. 277, 150–155. Jaworek, J., Bonio, J., Leja-Szpa, A., Nawrot, K., Tomaszewska, M.R., Stachura, J., Pawlik, W.W., Konturek, S.J., 2002. Sensory nerves in central and peripheral control of pancreatic integrity by leptin and melatonin. J. Physiol. Pharmacol. 53, 51–74. Kobari, M., Fukuuchi, Y., Tomita, M., Tanahashi, N., Takeda, H., Yokoyama, M., 1995. Calcitonin gene-related peptide (CGRP) and the regulation of cerebral parenchymal vessels. Brain Res. 689, 95–99. Li, Q., Zhang, R., Guo, Y.L., Mei, Y.W., 2009. Effect of neuregulin on apoptosis and expressions of STAT3 and GFAP in rats following cerebral ischemic reperfusion. J. Mol. Neurosci. 37, 67–73. Longa, E.Z., Weinstein, P.R., Carlson, S., Cummins, R., 1989. Reversible middle cerebral artery occlusion without craniotomy in rats. Stroke 20, 84–91. Lange, M., Enkhbaatar, P., Traber, D.L., Cox, R.A., Jacob, S., Mathew, B.P., Hamahata, A., Traber, L.D., Herndon, D.N., Hawkins, H.K., 2009. Role of calcitonin gene-related peptide (CGRP) in ovine burn and smoke inhalation injury. J. Appl. Physiol. 107, 176–184. Macdonald, R.L., Pluta, R.M., Zhang, J.H., 2007. Cerebral vasospasm after subarachnoid hemorrhage: the emerging revolution. Nat. Clin. Pract. Neurol. 3, 256–263. Nakka, V.P., Gusain, A., Mehta, S.L., Raghubir, R., 2008. Molecular mechanisms of apoptosis in cerebral ischemia: multiple neuroprotective opportunities. Mol. Neurobiol. 37, 7–38. Omeis, I., Neil, J.A., Murali, R., Abrahams, J.M., 2008. Treatment of cerebral vasospasm with biocompatible controlled-release systems for intracranial drug delivery. Neurosurgery 63, 1011–1019. Rehni, A.K., Singh, N., Jaggi, A.S., 2007. Possible involvement of insulin, endogenous opioids and calcitonin gene related peptide in remote ischaemic preconditioning of brain. Yakugaku Zasshi 127, 1013–1020. Signore, A.P., Zhang, F., Weng, Z., Gao, Y., Chen, J., 2008. Leptin neuroprotection in the CNS: mechanisms and therapeutic potentials. J. Neurochem. 106, 1977–1990. Valerio, A., Dossena, M., Bertolotti, P., Boroni, F., Sarnico, I., Faraco, G., Chiarugi, A., Frontini, A., Giordano, A., Liou, H.C., De Simoni, M.G., Spano, P., Carruba, M.O., Pizzi, M., Nisoli, E., 2009. Leptin is induced in the ischemic cerebral cortex and exerts neuroprotection through NF-kappaB/c-Rel-dependent transcription. Stroke 40, 610–617. Woitzik, J., Back, T., Thome, C., 2008. Flow-dependent versus spreading-like impairment of brain tissue integrity during focal cerebral ischemia and its consequences for neuroprotective strategies. Front. Biosci. 13, 1500–1506. Xu, X., Chua, C., Gao, J., Hamdy, R.C., Chua, B.H., 2006. Humanin is a novel neuroprotective agent against stroke. Stroke 37, 2613–2619. Yan, G.T., Lin, J., Hao, X.H., Xue, H., Zhang, K., Wang, L.H., 2009. Heart-type fatty acidbinding protein is a useful marker for organ dysfunction and leptin alleviates sepsis-induced organ injuries by restraining its tissue levels. Eur. J. Pharmacol. 616, 244–250. Zhang, F., Chen, J., 2008. Leptin protects hippocampal CA1 neurons against ischemic injury. J. Neurochem. 107, 578–587. Zhang, Z.H., Fang, X.B., Xi, G.M., Li, W.C., Ling, H.Y., Qu, P., 2010. Calcitonin gene-related peptide enhances CREB phosphorylation and attenuates tau protein phosphorylation in rat brain during focal cerebral ischemia/reperfusion. Biomed. Pharmacother. 64, 430–436. Zhang, F., Wang, S., Signore, A.P., Chen, J., 2007. Neuroprotective effects of leptin against ischemic injury induced by oxygen–glucose deprivation and transient cerebral ischemia. Stroke 38, 2329–2336.