Response of intestine microbiota, digestion, and immunity in Pacific white shrimp Litopenaeus vannamei to dietary succinate

Journal Pre-proof Response of intestine microbiota, digestion, and immunity in Pacific white shrimp Litopenaeus vannamei to dietary succinate

Yafei Duan, Yun Wang, Xian Ding, Dalin Xiong, Jiasong Zhang PII:

S0044-8486(19)31391-2

DOI:

https://doi.org/10.1016/j.aquaculture.2019.734762

Reference:

AQUA 734762

To appear in:

aquaculture

Received date:

2 June 2019

Revised date:

6 October 2019

Accepted date:

20 November 2019

Please cite this article as: Y. Duan, Y. Wang, X. Ding, et al., Response of intestine microbiota, digestion, and immunity in Pacific white shrimp Litopenaeus vannamei to dietary succinate, aquaculture (2019), https://doi.org/10.1016/j.aquaculture.2019.734762

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

© 2019 Published by Elsevier.

Journal Pre-proof

Response of intestine microbiota, digestion, and immunity in Pacific white shrimp Litopenaeus vannamei to dietary succinate Yafei Duana,b, Yun Wanga, Xian Dinga, Dalin Xionga, Jiasong Zhanga,c,* a

Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of Agriculture and Rural Affairs,

Guangdong Provincial Key Laboratory of Fishery Ecology and Environment, South China Sea Fisheries Research Institute,

Shenzhen Base of South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Shenzhen 518121, PR

ro

b

of

Chinese Academy of Fishery Sciences, Guangzhou 510300, PR China

China

College of Landscape Architecture and Life Science, Chongqing University of Arts and Sciences, Yongchuan, Chongqing

-p

c

lP na

Abstract

re

402160, PR China

Succinate (SA) is the precursor of propionate that influence the intestine physiological function of

Jo ur

animals. In this study, we investigated the microbiome, digestive, and immune responses in the intestines of Pacific white shrimp Litopenaeus vannamei fed diets containing different levels of SA: 0 g/kg (Control), 2.5 g/kg (SA1), 5.0 g/kg (SA2), and 10.0 g/kg (SA3) for 56 days. The results showed that dietary SA improved the intestine mucosa morphology, increased the short-chain fatty acids contents, and altered the intestine microbiota composition. Specifically, SA increased the abundances of Proteobacteria and decreased the abundance of Bacteroidetes. The beneficial bacteria including Ruegeria, Lutimonas, Mameliella, and Sphingomonas were enriched in response to dietary SA; these genus might be involved in nutrient metabolism and the degradation of toxic compounds and pollutants. Additionally, dietary SA also improved the activity of digestive enzymes (amylase, lipase, trypsin, and

1

Journal Pre-proof

pepsin) and immune enzymes (total antioxidant capacity, phenoloxidase, total nitric oxide synthase, and

nitric

oxide),

and

the

expression

of

immune-related

genes

(prophenoloxidase,

anti-lipopolysaccharide factor, lysozyme, heat shock protein 70, thioredoxin, mucin-1, mucin-2, mucin-5AC, mucin-5B, and mucin-19) in the intestine of the shrimp. These results revealed that dietary SA had a positive effect on the intestine health of L. vannamei by modulating the microbial

of

composition and SCFA contents, and enhancing the digestive and immune response in the shrimp

ro

intestine.

Keywords: Litopenaeus vannamei, succinate, short-chain fatty acids, intestine microbiota, digestive,

re

-p

immune

lP

1. Introduction

na

The Pacific white shrimp Litopenaeus vannamei is an important species to the global economy. Shrimp aquaculture can suffer large-scale economic losses caused by diseases. Shrimp habitats are a

Jo ur

pathogen-rich water environment; thus, intestine health affects the overall health of shrimp (Duan et al., 2018a). The intestine barrier of animals is associated with structural integrity, immune proteins, and a stable microbiota (Levy et al., 2017). Intestine microbiota have co-metabolisms with its host. Healthy intestine microbiota can produce beneficial metabolites to promote the host health, for example, short-chain fatty acids (SCFA) can provide nutrition for intestine mucosa (Koh et al., 2016), and improve intestine micro-ecological environment (Barczynska et al., 2015). While an unhealthy or unbalanced intestine microbiota will further impairs host immunity, and increase the susceptibility to diseases (Hsiao et al., 2013). Therefore, it is essential to improve the intestine immunity and microbiota composition of shrimp.

2

Journal Pre-proof

Intestine microbiota can produce large amounts of succinate (SA) by resolving dietary fibres (De Vadder et al., 2016). SA is a dicarboxylic acid produced mainly in the citric acid cycle and classically described as an intermediate in propionate synthesis (Cummings et al., 1987). SA can accumulate in immune cells, act as a signal in cancer and have both protumor and antitumor effects, including blocking the growth and proliferation of colon cancer cells (Haraguchi et al. 2014), inhibiting necrosis

of

and apoptosis (Tang et al., 2013), and reducing the formation of serum IgE antibody (Ke et al., 1983).

ro

SA can also serve as an acidulant and antimicrobial agent (Cong et al., 2009; Kumar et al., 2015). Furthermore, SA plays an important role in intestine-brain signalling properties such as modulating

-p

intestine gluconeogenesis (De Vadder et al., 2016; De Vadder and Mithieux, 2018) and inflammation

re

(Rubic et al. 2008). Dietary SA can improve plasma glucose and body weight (De Vadder et al., 2016),

lP

promotes heat production and calorie burning in brown fat in mice (Hui and Rabinowitz, 2018), and

na

control the activation of adipose tissue thermogenesis (Mills et al., 2018). Thus it can be seen SA plays an important role in intestine physiological homeostasis.

Jo ur

In our previous studies, we found that dietary SA promoted growth and induced the digestive and immune responses of L. vannamei, which enabled their defense against ammonia-induced stress (Duan et al., 2018b). However, to date, no study has focused on the role of SA in shrimp intestine health. To characterize the roles of SA in intestine health, and develop a new potential immunostimulant for shrimp, in this study, we investigated the effects of dietary SA on the intestine histological structure, the composition and metabolite SCFA contents of intestine microbiota, and the digestive and immune indexes of L. vannamei. Our results provide information to enhance the understanding of the role of SA in the regulation of intestine health in shrimp.

2. Materials and Methods 3

Journal Pre-proof

2.1. Diet preparation The source of SA (S108852) was purchased from Aladdin (Shanghai, China), which is matrix material for MatriX AssistedLaser Desorption Ionization - Mass Spectrum (MALDI-MS), the purity ≥ 99.5%. A white fish meal based diet containing 398.2 g/kg crude protein (of dry matter) and 74.6 g/kg crude lipid was used as the basal diet of the present experiment. Four experimental diets were

of

prepared those differed only in SA content: 0 g/kg (Control), 2.5 g/kg (SA1), 5.0 g/kg (SA2), and 10.0

ro

g/kg (SA3). The SA was added to the test diets at levels of 2.5, 5.0, and 10.0 g/kg with a corresponding decrease in the amount of wheat flour. The formulation and proximate composition of experimental

-p

diets is given in Table S1. Diet preparation was performed per the method of Duan et al. (2018b).

re

Moisture, crude protein, crude lipid and ash of the experimental diets were determined using a standard

na

differences among the four diets.

lP

method of Association of Official Analytical Chemists (AOAC) (1995), and there were no significant

2.2. Shrimp and culture conditions

Jo ur

Healthy juvenile L. vannamei, with an average weight of 3.13 ± 0.07 g, were collected from a semi-intensive culture pond at Shenzhen Base, South China Sea Fisheries Research Institute of Chinese Academy of Fishery Sciences (Shenzhen, China). They were acclimatized in filtered, aerated seawater (salinity 30, pH 8.4, temperature 30 ± 0.5 ℃) for one week before the experiment and fed a formulated pellet feed (Haida Feed, Jieyang, China) daily at 5% of their body weight. One-third of the water was changed daily. Water quality parameters including salinity, pH, dissolved oxygen, and temperature were continually measured throughout the experiment using a portable multiparameter meter (YSI, USA).

4

Journal Pre-proof

After acclimation, the shrimp were divided into four groups (Control, SA1, SA2, and SA3), and each group was fed with the corresponding experimental feed. Each group included three replicate 500 L fibreglass tanks. There were 40 shrimp per tank. Each tank was covered with a plastic mesh lid to prevent the shrimp from jumping out of the tank. The water was continuously aerated with two air stones in each tank. The shrimp were fed the four diets at a ratio of 5% of body weight, and feed was

of

given three times per day (07:00, 12:00 and 18:00). The light regime was set at a fixed 14-h light/10-h

ro

dark schedule. There was a feeding tray at the bottom of each tank, and feed particles was put on the tray. During the feeding trial, the shrimp were fed close to satiation; after feeding 1 h, uneaten feed

-p

particles were removed from the tray, then dried and weighed to correct the feed intake. The feeding

re

trial lasted for 56 days. At 56 days, the intestine of the shrimp of each tank were sampled individually

lP

and were snap-frozen in liquid nitrogen for microbiome, SCFA contents, biochemical, and gene

2.3. Histological analysis

na

expression analyses.

Jo ur

The intestines of three shrimp from each tank were randomly sampled at 56 d and stored in Davidson solution (330 mL 95% ethanol, 220 mL formalin, 115 mL acetic acid, and 335 mL H2O) for 24 h. After being rinsed with running water for 8 h, the tissues were dehydrated in a series of ethanol solutions (70%, 80%, 90%, and 100%), made transparent with xylene, embedded in paraffin, and sectioned in a microtome (Leica, RM2016, Wetzlar, Germany) to a 4 μm thickness. After staining with haematoxylin and eosin (HE), stained sections were observed and photographed under light microscopy (Olympus, Tokyo, Japan). 2.4. Intestine microbiota analysis

5

Journal Pre-proof

Intestine microbiota DNA of six shrimp from each tank was extracted using a PowerSoil™ DNA Isolation Kit (Mo Bio Laboratories, Inc., Carlsbad, CA) according to the manufacturer’s protocol and analysed in 1.0% agarose electrophoresis. The purity was quantitated at 260 nm, and all OD 260/OD280 ratios were between 1.8 and 2.0. The amplification of the V4 region of the bacterial 16S rRNA gene was obtained using the barcoded fusion primers 515F and 806R (Table S2). The 20 μL PCR reactions contained the template DNA 10 ng, 5 × FastPfu buffer 4 μL, dNTPs (2.5 mM) 2 μL, primer 515F (5

of

μM) 0.8 μL, primer 806R (5 μM) 0.8 μL, FastPfu polymerase 0.4 μL, and ddH 2O added to reach a total

ro

volume of 20 μL. The PCR reaction conditions were 1 cycle of 95 ℃ for 5 min, 27 cycles of 95 ℃ for

-p

30 s, 55 ℃ for 30 s, and 72 ℃ for 45 s, followed by 72 ℃ for 10 min. The PCR fragments were

re

subjected to electrophoresis on 1.5% agarose gels to determine length differences, and the target band

lP

was purified by a PCR purification kit (Qiagen). The amplicons were pooled in equimolar

na

concentrations and sequenced with an Illumina HiSeq platform. The raw sequences were processed using the BIPES pipeline. Chimaeric sequences were determined

Jo ur

by UCHIME (Edgar et al., 2011). The operational taxonomy units (OTUs) were defined with a threshold of 97% identity by UPARSE (Edgar, 2013). Taxonomies were assigned with uclust for each OUT, and alpha and beta diversity analyses were determined for each library using QIIME. The heatmap was constructed by using the heatmap 2 function of the R g-plots package based on the top 50 genera of the samples. 2.5. Intestine SCFA contents analysis Intestine SCFA contents, including acetic acid (AA), propionic acid (PA), and butyric acid (BA) of six shrimp from each tank were measured by gas chromatography, using the method of Weitkunat et al. (2015).

6

Journal Pre-proof

2.6. Biochemical analysis Intestines of three shrimp from each tank were homogenized with sterile 0.9% saline solution at a ratio of 10% as m (tissue, g) : V (saline solution, mL). The homogenates were centrifuged at 3500 rpm for 10 min at 4 ℃, and then, the suspension was immediately analysed for biochemical parameters using a microplate reader (Bio-Rad, USA). Amylase (AMS), lipase (Lip), trypsin (Tryp), pepsin (Pep),

of

total antioxidant capacity (T-AOC), phenoloxidase (PO), total nitric oxide synthase (T-NOS), and nitric

ro

oxide (NO) were measured using related commercial assay kits (Nanjing Jiancheng Institute, China) according to the manufacturer's protocol. The assays were all run in three replicate samples.

-p

2.7. Gene expression analysis

re

Total RNA was extracted from the intestine of three shrimp in each tank using TRIzol Reagent

lP

(Invitrogen, USA), and the contaminant DNA was removed from RNA samples using RQ1 RNase-Free

na

DNase (Promega, USA). Total RNA (8 μg) was reverse transcribed to first-strand cDNA using M-MLV reverse transcriptase (Promega, USA). Real-time quantitative RT-qPCR was performed by

Jo ur

using the SYBR® Premix Ex Taq™ II Kit (TaKaRa, Japan) with a LightCycler480 System to investigate the expression of target genes. qPCR specific primer sequences were designed based on the open reading frame (ORF) of the target genes using Primer Premier 5.0 software (Table S2). The β-actin gene of L. vannamei was used as an internal control to verify successful reverse transcription and calibrate the cDNA template. The specific primers efficiency was evaluated with amplification plot and melt curve. RT-qPCR was carried out using the method of Duan et al. (2018b). The relative gene expression level is shown as the fold-change in expression, relative to the β-actin gene, calculated by the 2-△△ CT comparative CT method. 2.8. Statistical analysis

7

Journal Pre-proof

The value of each variable was expressed as the mean ± SE. Statistical analysis was performed using a one-way analysis of variance (ANOVA) followed by Duncan multiple range tests (SPSS Ver 22.0). Significance was set at P < 0.05. Correlations among the groups, key intestine bacterial at the phylum level, and biochemical parameters were determined on t-value analysis obtained from the canonical correspondence analysis (CCA) using Canoco 4.5 (Biometrics, Wageningen, Netherlands).

of

3. Results

ro

3.1. Intestine histological structure

After shrimp were fed SA-supplemented diets for 56 d, the intestine tissue of the three SA groups

-p

showed histological health characteristics. Health parameters included close connection of the intestine

re

epithelial cells, epithelium height increases, and dense microvilli in neat rows. In addition, the intestine

lP

epithelium had no signs of necrotic enterocytes or cell damage (Fig. 1).

na

3.2. Intestine microbial richness and diversity

A total of 664,739 sequences were obtained from the intestine microbiota of L. vannamei using 16S

Jo ur

rDNA gene V4 region Illumina sequencing, with an average of 55,394 sequences per sample; after optimization and quality control, the percent obtained was 98.15%. The average sequence length was 316 bp. After rarefaction curve analysis, the observed species per sample was sufficient (Fig. 2A). A total of 586 (96.43%) OTUs were shared by the four groups with Venn diagram analysis, and the number of unique OTUs in the three SA groups was higher than that of the control (Fig. 2B). The alpha diversity analysis showed that the Chao1, ACE, Shannon, and Simpson indexes of the three SA groups were all higher than those of the control (Table 1). 3.3. Changes in the intestine bacterial composition

8

Journal Pre-proof

A total of 34 different bacterial phylum were identified. Bacteroidetes and Proteobacteria were two of the dominant phylum in the four clustered groups. Compared with the control group, the relative abundance of Bacteroidetes was decreased in the three SA groups, while that of Proteobacteria was increased. Additionally, the relative abundances of Verrucomicrobia, Actinobacteria, and Firmicutes were increased in the SA1 and SA2 groups (Fig. 2C). At the class level, Flavobacteriia,

of

Alphaproteobacteria, and Gammaproteobacteria were the primary intestine bacteria in all of the groups

ro

assessed. The relative abundance of Flavobacteriia was decreased in the three SA groups, while those of Alphaproteobacteria and Gammaproteobacteria were increased (Fig. 2D). At the genus level,

-p

heatmap analysis showed that the abundances of certain dominant genera, Ruegeria, Lutimonas,

re

Mameliella, and Sphingomonas, were increased in the three SA groups, while that of Formosa was

lP

decreased (Fig. 2E).

na

The linear discriminant analysis (LDA) effect size (Lefse) package was used to determine the differential abundances of microbial taxa between the four groups. The LDA scores of Lefse showed

Jo ur

that the abundances of 39, 9 and 3 taxa were increased while that of 15, 15 and 15 taxa were decreased in the SA1, SA2, and SA3 groups respectively (Fig. 3A). There were 15 bacterial taxa distinguishing the four groups by LDA value, with 3, 8, 4, and 0 taxa in the control, SA1, SA2, and SA3 groups respectively (Fig. 3B). In detail, 5 classes, 8 orders, and 8 families were enriched in the SA1 group, including Actinobacteria (from class to family levels), Spartobacteria (from class to family levels), Syntrophobacterales (from class to family levels), Planctomycetes (from class to family levels), Clostridia (from class to order levels), Ignavibacteria (from class to order levels), Nitrospiraceae (from family levels), and GOUTB8 (from family levels). One class, 2 orders, and 3 families were enriched in the SA2 group, including Acidimicrobiia (from class to order levels), Corynebacteriales (from order to

9

Journal Pre-proof

family levels), Rikenellaceae (from family levels), and Cellvibrionaceae (from family levels). In the control group, 2 classes, 3 orders, and 3 families were enriched, including Bacteroidetes (from class to family levels), Tenericutes (from class to family levels), and Desulfarculales (from order to family levels). 3.4. Changes in the intestine microbial metabolism Based on random forest KEGG classification, “galactose metabolism”, “starch and sucrose

of

metabolism”, “protein kinases”, “xylene degradation”, “sulfur relay system”, “chlorocyclohexane and

ro

chlorobenzene degradation”, and “environmental adaptation” were increased in the three SA groups

re

3.5. Digestive and immune enzymes activity

-p

(Fig. 4). The SCFA content including AA, PA, and BA was increased in the three SA groups (Table 2).

lP

After shrimp were fed SA-supplemented diets for 56 d, AMS activity was increased in the three SA

na

groups, and the highest was in the SA2 and SA3 groups. LPS activity was increased in the SA1 and SA3 groups, and the highest was in the SA3 group. Tryp and Pep activity were both increased in the

Jo ur

three SA groups, and the highest was in the SA3 group. PO activity was increased in the SA2 and SA3 groups, and the highest was in the SA3 group. T-AOC activity was increased in all three SA groups, and the highest was in the SA2 and SA3 group. T-NOS activity and NO content were both increased in the three SA groups, and the highest was in the SA3 group (Fig. 5). 3.6. Immune-related genes expression After shrimp were fed SA-supplemented diets for 56 d, the expression levels of the prophenoloxidase (proPO) gene were increased in all three SA groups; the levels were statistically the same. The expression levels of the anti-lipopolysaccharide factor (ALF) gene were increased in the SA2 and SA3 groups; the levels were statistically the same. The expression levels of the lysozyme

10

Journal Pre-proof

(Lys), heat shock protein 70 (HSP70) and thioredoxin (Trx) genes of all three SA groups were increased, and the highest values were in the SA1 group. The expression levels of the mucin-1 (Muc-1), Muc-2, and Muc-5AC genes of the three SA groups were increased; the highest level of the Muc-1 gene was in the SA1 group, while the highest levels of the Muc-2 and Muc-5AC genes were in the SA2 and SA3 groups. The expression levels of the Muc-5B and Muc-19 genes were increased in the SA2 and

of

SA3 groups; the values were statistically the same (Fig. 6).

ro

3.7. Correlations between Intestine Bacterial and Biochemical Parameters

CCA was to used to explore the correlations between intestine bacterial at the phylum level and

-p

biochemical parameters. In digestive enzymes and SCFA, CCA explained 80.52% and 6.39% of the

re

total variance, respectively (Fig. 7A). AA, PA, Tryp, and LPS were positively correlated with the

lP

abundance of Bacteroidetes. Pep, AMS, and BA were positively correlated with the abundance of

na

Proteobacteria, Acidobacteria, Spirochaetae, and Firmicutes. In immune enzymes and genes, CCA explained 83.46% and 8.19% of the total variance, respectively (Fig. 7B). T-AOC, HSP70, Trx, T-NOS,

Jo ur

Lys, proPO, Muc-1, Muc-2, and Muc-5AC were positively correlated with the abundance of Actinobacteria, Chlorobi, Firmicutes, Proteobacteria, Acidobacteria, and Spirochaetae. ALF was positively correlated with the abundance of Proteobacteria, Acidobacteria, and Spirochaetae. Muc-5B was positively correlated with the abundance of Bacteroidetes. 4. Discussion Diet strongly alters the composition of the intestine microbiota, thus potentially altering the production of microbiota metabolites (Turnbaugh et al., 2008; Wu et al., 2011; David et al., 2014). SA is the precursor of propionate in the microbiota metabolism, produced in response to dietary fibre, which can be efficiently used by the intestine mucosa (De Vadder and Mithieux, 2018). Although SA

11

Journal Pre-proof

has been shown to decrease the proliferation rate in the colonic mucosa of rats (Inagaki et al., 2007), so far, no study has reported the effect of SA on intestine health regulation of shrimp. Here, we examined the effect of SA on intestine microbiota composition, and the host digestion and immune parameters. The results showed that dietary SA increased the epithelium height, SCFA content, and digestive enzyme activity in the intestine of shrimp. Hence forecasts the increase of SCFA content not only could

of

provide energy to intestine epithelial cells and promotes intestine development, but also slightly acidify

ro

the intestine environment (Dobrowolska Iwanek et al., 2016), which is likely to benefit digestive enzymes. Combined with our previous research results (Duan et al., 2018b), SA also improves the

-p

growth performance and of L. vannamei, which is in agreement with the digestive enzymes activity.

re

Thus, the increase of the epithelium height and digestive enzymes activity can promote the digestion of

lP

nutritional material and improve the growth of L. vannamei.

na

The intestine mucosa serves as the front-line of host defence against pathogen invasion, and its barrier function is related to its mucus components and immune molecules (Levy et al., 2017). Mucus

Jo ur

is present at the interface between the epithelial surfaces of the intestine and its internal environment, representing the principal immune response of the intestine mucosa (Johansson and Hansson, 2016). Mucs are the major organic components of the intestine mucus layer that contribute to the mucosal barrier against enteric pathogens (Derrien et al., 2010; Ogata et al., 2017). In this study, the expression levels of the Muc-1, Muc-2, and Muc-5AC genes were increased in the three SA groups, and the expression levels of Muc-5B and Muc-19 were increased in the SA2 and SA3 groups, which suggests that dietary SA could improve the intestine mucus homeostasis of the host towards resisting pathogenic infection.

12

Journal Pre-proof

Antibacterial molecules play vital roles in the immune homeostasis of shrimp. As an important antibacterial peptide, ALF can bind to LPS and function as a strong antibacterial force against pathogenic microbes (de la Vega et al., 2008). proPO, the function of which has been extensively studied in immunity in shrimp, can reduce the risk of pathogen infection by increasing PO activity (Xie et al., 2015). Lys is an antibacterial protein with bacteriolytic effects including bacterial splitting and

of

destroying peptidoglycan support of pathogenic bacteria (Saurabh and Sahoo, 2008). NOS is

ro

responsible for the synthesis of nitric oxide (NO), which can be induced by bacterial LPS and cytokines and plays an indispensable role in many immunologic processes (Yao et al., 2010). In this study,

-p

T-NOS activity, NO content, and the expression levels of the propO and Lys genes were increased in

re

the three SA groups, and the expression levels of ALF were increased in the SA2 and SA3 groups.

lP

These results suggest that dietary SA could improve the antibacterial capacity of the host intestines.

na

The antioxidant system is crucial to prevent oxidative stress in shrimp. Shrimp mainly rely on their antioxidant enzymes to eliminate the reactive oxygen species (ROS) produced by oxidative stress, and

Jo ur

T-AOC activity can reflect the antioxidant status of an organism (Wu et al., 2014). In addition, HSPs are molecular stress protein that can release and increase directly endogenous peroxidase activity for catalysing the conversion of ROS (Shi et al., 2016). Trx acts as a substrate of peroxiredoxin and antioxidant protein, which is involved in cell redox homeostasis (Ren et al., 2010). Du et al. (2018) reported that SA could bind to and activate TrxR2 to maintain chemotherapy resistance. In this study, T-AOC activity and the expression levels of the HSP70 and Trx genes were all increased in the intestines of experimental group shrimp, suggesting that dietary SA could enhance the intestine antioxidant function, which might contribute to the regulation of the redox status of the intestines.

13

Journal Pre-proof

The functional activity and stability of the intestine microbiota is important for shrimp health, as it performs many functions related to immunity and pathogen resistance (Duan et al., 2018a). The intestine microbiota contains various opportunistic pathogens, which are capable of causing disease if the host’s resistance is lowered or the intestine microbiota is imbalanced. SCFA can slightly reduce the pH of the intestines, promote the growth of probiotic bacteria, and inhibit the growth of pathogenic

of

bacteria (Duan et al., 2018a). Here, we showed that the intestine microbiota composition of shrimp was

ro

altered in response to dietary SA and that the bacterial richness and diversity were increased.

including that of galactose, starch, and sucrose.

-p

Additionally, the microbiota nutrient metabolism was improved, particularly carbon source metabolism,

re

After shrimp were fed with dietary SA, the abundance of the dominant bacterial phylum

lP

Proteobacteria was increased in the three SA groups, while the Bacteroidetes abundance was decreased.

na

Additionally, Actinobacteria and Firmicutes abundance were also increased in the SA1 and SA2 groups. Proteobacteria and Bacteroidetes are normally dominant in the intestines of shrimp at all growth stages

Jo ur

(Zhang et al., 2014; Huang et al., 2016). Actinobacteria are considered excellent elaborators of pharmaceutical products such as antibiotics, antimicrobial agents, and industrial enzymes (Zothanpuia et al., 2018). Firmicutes bacteria provide a good index regarding the state of the intestine, including SCFA and prebiotics (Barczynska et al., 2015). In this study, The correlation analysis of the bacterial phylum and its host health indicators showed that Proteobacteria had a positive correlation with Pep and AMS, and Bacteroidetes had a positive correlation with Tryp and LPS, indicating that these phylum bacterial contributed to the intestine digestive function of the shrimp. Furthermore, Proteobacteria, Actinobacteria and Firmicutes were also positively correlated with the immune

14

Journal Pre-proof

parameters (T-AOC, HSP70, Trx, T-NOS, Lys, proPO, Muc-1, Muc-2, and Muc-5AC), revealing that these phylum bacterial might contribute to the immune response of the shrimp. At the genus level, Ruegeria, Mameliella, Sphingomonas, and Lutimonas abundances were increased in the three SA groups. Ruegeria have high phosphodiesterase and phosphomonoesterase activities (Achbergerová and Nahálka, 2014; Yamaguchi et al., 2016) and may contribute to the degradation of

of

phosphate triester compounds in aquatic environments. Mameliella and Sphingomonas play important

ro

roles in the degradation of aromatic compounds (Danish-Daniel et al., 2016; Zhao et al., 2017). Lutimonas is a strictly aerobic heterotrophic nitrifying bacterium for the degradation of ammonia (Fu et

-p

al., 2009). Interestingly, based on the KEGG pathway analysis, “xylene degradation”, “sulfur relay

re

system”, “chlorocyclohexane and chlorobenzene degradation”, and “environmental adaptation”

lP

signalling were increased in the three SA groups, which indicated that SA stimulated the growth of the

na

bacterial involved the in degradation of toxic compounds and pollutants. Additionally, Sphingomonas can produce alginate lyases that degrade alginate to produce oligosaccharides (MOS) (He et al., 2018).

Jo ur

Mameliella can accumulate poly-β-hydroxybutyrate (PHB) granules in cells (Zheng et al., 2010). MOS and PHB have a beneficial effect on the immunity of L. vannamei (Li et al., 2018; Duan et al., 2017). Thus, the dominance of these genera suggested that additional SA in the diet modulated the growth of beneficial bacteria in the intestines of L. vannamei, which might be involved in degrading toxic and producing prebiotics. In conclusion, the results of this study showed that dietary SA improved the intestine mucosa morphology, enhanced the intestine digestive and immune response, and modulated the composition and SCFA contents of the intestine microbiome in L. vannamei. Furthermore, our previous study also showed that dietary SA induced the immune responses in hepatopancreas and ammonia stress

15

Journal Pre-proof

resistance capabilities of L. vannamei (Duan et al., 2018b). These results further showed that SA is a potential immunostimulant for shrimp within a certain dose range. Further studies will be carried out to explore how SA-induced changes in the intestine microbial affect the host immune system in shrimp.

Acknowledgments

of

This study was supported by the earmarked fund for National Natural Science Foundation of China

ro

(31902343), Central Public-interest Scientific Institution Basal Research Fund, South China Sea Fisheries Research Institute, CAFS (2019TS18), Guangzhou Rural Science and Technology

-p

Commissioner Project, Central Public-interest Scientific Institution Basal Research Fund, CAFS

re

(2019CY0103), Guangdong Natural Science Foundation (2017A030313147), Guangdong Provincial

lP

Special Fund for Marine Fisheries Technology (A201701B09), Chongqing Social Undertakings and

na

Livelihood Security Science and Technology Innovation Project (cstc2017shms-xdny80087). The authors are grateful to the laboratory staff for technical assistance, and also thank the anonymous

interests.

Jo ur

reviewers for their helpful suggestions to the manuscript. The authors declare no competing or financial

References Achbergerová, L., Nahálka, J., 2014. Degradation of polyphosphates by polyphosphate kinases from Ruegeria pomeroyi. Biotechnol. Lett. 36(10), 2029-2035. Barczynska, R., Slizewska, K., Litwin, M., Szalecki, M., Zarski, A., Kapusniak, J., 2015. The effect of dietary fibre preparations from potato starch on the growth and activity of bacterial strains belonging to the phyla Firmicutes, Bacteroidetes, and Actinobacteria. J. Funct. Foods 19, 661-668.

16

Journal Pre-proof

Cong, H.Q., Yue, W., Yang, Z.H., Qian, Q.H., Chi, H.F., 2009. Investigation of phloroglucinol succinic acid dendrimer as antimicrobial agent against Staphylococcus aureus, Escherichia coli and Candida albicans. Chinese J. Neuroanatimy 25(1), 6-10. Cummings, J.H., Pomare, E.W., Branch, W.J., Naylor, C.P., 1987. Macfarlane, G.T. Short chain fatty acids in human large intestine, portal, hepatic and venous blood. Gut 28, 1221-1227.

of

Danish-Daniel, M., Han Ming, G., Noor, M.E., Yeong, Y.S., Usup, G., 2016. Draft genome sequence

ro

of Mameliella alba strain UMTAT08 isolated from clonal culture of toxic dinoflagellate Alexandrium tamiyavanichii. Genomics Data 10, 12-14.

-p

David, L.A., Maurice, C.F., Carmody, R.N., Gootenberg, D.B., Button, J.E., Wolfe, B.E., Ling, A.V.,

re

Devlin, A.S., Varma, Y., Fischbach, M.A., et al., 2014. Diet rapidly and reproducibly alters the

lP

human gut microbiome. Nature 505, 559-563.

na

de la Vega, E., O'Leary, N.A., Shockey, J.E., Robalino, J., Payne, C., Browdy, C.L., Warr, G.W., et al., 2008. Anti-lipopolysaccharide factor in Litopenaeus vannamei (LvALF): a broad spectrum

Jo ur

antimicrobial peptide essential for shrimp immunity against bacterial and fungal infection. Mol. Immunol. 45(7), 1916-1925.

Derrien, M., Passel, M.W., Bovenkamp, J.H., Schipper, R., Vos, W.M., et al., 2010. Mucin bacterial interactions in the human oral cavity and digestive tract. Gut Microb. 1(4) 254-268. De Vadder, F., Kovatcheva-Datchary, P., Zitoun, C., Duchampt, A., Bäckhed, F., Mithieux, G., 2016. Microbiota-produced succinate improves glucose homeostasis via intestinal gluconeogenesis. Cell Metab. 24, 151-157. De Vadder, F., Mithieux, G., 2018. Gut-brain signaling in energy homeostasis: the unexpected role of microbiota-derived succinate. J. Endocrinol. 236, R105-R108.

17

Journal Pre-proof

Dobrowolska Iwanek, J., Zagrodzki, P., Woźniakiewicz, M., Woźniakiewicz, A., Zwolińska Wcisło, M., Winnicka, D., et al., 2016. Procedure optimization for extracting short-chain fatty acids from human faeces. J. Pharm. Biomed. Anal. 124, 337-340. Duan, Y.F., Zhang, Y., Dong, H.B., Zheng, X.T., Wang, Y., Li, H., et al, 2017. Effect of dietary poly-β-hydroxybutyrate (PHB) on growth performance, intestinal health status and body

of

composition of Pacific white shrimp Litopenaeus vannamei (Boone, 1931). Fish. Shellfish

ro

Immunol. 60, 520-528.

Duan, Y.F., Wang, Y., Dong, H.B., Ding, X., Liu, Q.S., Li, H., et al., 2018a. Changes in the

-p

intestine microbial, digestive, and immune-related genes of Litopenaeus vannamei in

re

response to dietary probiotic Clostridium butyricum supplementation. Front. Microbiol. 9,

lP

2191.

na

Duan, Y.F., Wang, Y., Zhang, J.S., Sun, Y.X., Wang, J., 2018b. Dietary effects of succinic acid on the growth, digestive enzymes, immune response and resistance to ammonia stress of Litopenaeus

Jo ur

vannamei. Fish. Shellfish Immunol. 78, 10-17. Du, Z., Liu, X., Chen, T., Gao, W., Wu, Z., Hu, Z., Wei, D., Gao, C., Li, Q., 2018. Targeting a Sirt5-positive subpopulation overcomes multidrug resistance in wild-type kras colorectal carcinomas. Cell Rep. 22(10), 2677-2689. Edgar, R.C., Haas, B.J., Clemente, J.C., Quince, C., Knight, R., 2011. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27, 2194-2200. Edgar, R.C., 2013. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat. Meth. 10, 996-998.

18

Journal Pre-proof

Fu, S.Z., Fan, H.X., Liu, S.J., Liu, Y., Liu, Z.P., 2009. A bioaugmentation failure caused by phage infection and weak biofilm formation ability. J. Environ. Sci. 21, 1153-1161. Haraguchi, T., Kayashima, T., Okazaki, Y., Inoue, J., Mineo, S., Matsubara, K., Sakaguchi, E., Yanaka, N., Kato, N., 2014. Cecal succinate elevated by some dietary polyphenols may inhibit colon cancer cell proliferation and angiogenesis. J. Agr. Food Chem. 62, 5589-5594.

of

Hsiao, E.Y., McBride, S.W., Hsien, S., Sharon, G., Hyde, E.R., McCue, T., et al., 2013. Microbiota

ro

modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders. Cell 155, 1451-1463.

-p

He, M., Guo, M., Zhang, X., Chen, K., Yan, J., Irbis, C., 2018. Purification and characterization of

re

alginate lyase from Sphingomonas sp. ZH0. J. Biosci. Bioeng. 126, 310-316.

lP

Huang, Z.B., Li, X.Y., Wang, L.P., Shao, Z.Z., 2016. Changes in the intestinal bacterial community

na

during the growth of white shrimp, Litopenaeus vannamei. Aquac. Res. 47(6), 1737-1746.

38-39.

Jo ur

Hui, S., Rabinowitz, J.D., 2018. An unexpected trigger for calorie burning in brown fat. Nature 560,

Inagaki, A., Ichikawa, H., Sakata, T., 2007. Inhibitory effect of succinic acid on epithelial cell proliferation of colonic mucosa in rats. J. Nutr. Sci. Vitaminol., Tokyo 53, 377-379. Johansson, M.E., Hansson, G.C., 2016. Immunological aspects of intestinal mucus and mucins. Nat. Rev. Immunol. 16(10), 639-649. Ke, J., Zhang, G.Q., Wong, S.A., Li, L.B., Yang, Y.H., Wang, J.K., 1983. Effects of succinic acid on immune function. J. Zhengzhou Univ. (Med Sci) 3, 20-24. Koh, A., De Vadder, F., Kovatcheva-Datchary, P., Backhed, F., 2016. From dietary fiber to host physiology: short-chain fatty acids as key bacterial metabolites. Cell 165, 1332-1345.

19

Journal Pre-proof

Kumar, M.S., Karthikeyan, S., Ramprasad, C., Aruna, P.R., Mathivanan, N., Velmurugan, D., et al., 2015. Investigation of phloroglucinol succinic acid dendrimer as antimicrobial agent against Staphylococcus aureus, Escherichia coli and Candida albicans. Nano Biomed. Eng. 7(2), 62-74. Levy, M., Blacher, E., Elinav, E., 2017. Microbiome, metabolites and host immunity. Curr. Opin. Microbiol. 35, 8-15.

of

Li, Y., Liu, H., Dai, X., Li, J., Ding, F., 2018. Effects of dietary inulin and mannan oligosaccharide on

ro

immune related genes expression and disease resistance of Pacific white shrimp, Litopenaeus vannamei. Fish. Shellfish Immunol. 76, 78-92.

-p

Mills, E.L., Pierce, K.A., Jedrychowski, M.P., Garrity, R., Winther, S., Vidoni, S., et al., 2018.

re

Accumulation of succinate controls activation of adipose tissue thermogenesis. Nature 560,

lP

102-106.

na

Ogata, S., Shimizu, K., Tominaga, S., Nakanishi, K., 2017. Immunohistochemical study of mucins in human intestinal spirochetosis. Hum. Pathol. 62, 126-133.

Jo ur

Ren, Q., Zhang, R.R., Zhao, X.F., Wang, J.X., 2010. A thioredoxin response to the WSSV challenge on the Chinese white shrimp, Fenneropenaeus chinensis. Comp. Biochem. Physiol. C 151, 92-98. Rubic, T., Lametschwandtner, G., Jost, S., Hinteregger, S., Kund, J., CarballidoPerrig, N., Schwärzler, C., Junt, T., Voshol, H., Meingassner, J.G., et al., 2008. Triggering the succinate receptor GPR91 on dendritic cells enhances immunity. Nat. Immunol. 9, 1261-1269. Saurabh, S., Sahoo, P.K., 2008. Lysozyme: an important defence molecule of fish innate immune system. Aquac. Res. 39, 223-239.

20

Journal Pre-proof

Shi, J.X., Fu, M.J., Zhao, C., Zhou, F.L., Yang, Q.B., Qiu, L.H., 2016. Characterization and function analysis of Hsp60 and Hsp10 under different acute stresses in black tiger shrimp, Penaeus monodon. Cell Stress Chaperon. 21, 295-312. Tang, X.L., Liu, J.X., Peng, L., Dong, W., Lei, L., Zheng, Y.Q., Hou, J.C., 2013. Protective effect of succinic acid on primary cardiomyocyte hypoxia/reoxygenation injury. China J. Chinese Material

of

Med. 38(21), 41-45.

ro

Turnbaugh, P.J., Bäckhed, F., Fulton, L., Gordon, J.I., 2008. Diet-induced obesity is linked to marked but reversible alterations in the mouse distal gut microbiome. Cell Host Microbe 3, 213-223.

-p

Weitkunat, K., Schumann, S., Petzke, K.J., Blaut, M., Loh, G., Klaus, S., 2015. Effects of dietary inulin

lP

mice. J. Nutr. Biochem. 26, 929-937.

re

on bacterial growth, short-chain fatty acid production and hepatic lipid metabolism in gnotobiotic

na

Wu, F.J., Xue, Y., Liu, X.F., Xue, C.H., Wang, J.F., Du, L., et al., 2014. The protective effect of eicosapentaenoic acid-enriched phospholipids from sea cucumber Cucumaria frondosa on

Jo ur

oxidative stress in PC12 cells and SAMP8 mice. Neurochem. Int. 64, 9-17. Wu, G.D., Chen, J., Hoffmann, C., Bittinger, K., Chen, Y.Y., Keilbaugh, S.A., Bewtra, M., Knights, D., Walters, W.A., Knight, R., et al., 2011. Linking longterm dietary patterns with gut microbial enterotypes. Science 334, 105-108. Xie, S.W., Tian, L.X., Li, Y.M., Zhou, W.W., Zeng, S.L., Yang, H.J., Liu, Y.J., 2015. Effect of proline supplementation on anti-oxidative capacity, immune response and stress tolerance of juvenile Pacific white shrimp, Litopenaeus vannamei. Aquaculture 448, 105-111.

21

Journal Pre-proof

Yamaguchi, H., Arisaka, H., Seki, M., Adachi, M., Kimura, K., Tomaru, Y., 2016. Phosphotriesterase activity in marine bacteria of the genera Phaeobacter, Ruegeria, and Thalassospira. Int. Biodeter. Biodegr. 115, 186-191. Yao, C.L., Ji, P.F., Wang, Z.Y., Li, F.H., Xiang, J.H., 2010. Molecular cloning and expression of NOS in shrimp, Litopenaeus vannamei. Fish. Shellfish Immunol. 28, 453-460.

of

Zhang, D.M., Wang, X., Xiong, J.B., Zhu, J.L., Wang, Y.N., Zhao, Q.F., et al., 2014. Bacterioplankton

ro

assemblages as biological indicators of shrimp health status. Ecol. Indic. 38, 218-224. Zhao, Q., Yue, S., Bilal, M., Hu, H., Wang, W., Zhang, X., 2017. Comparative genomic analysis of 26

-p

Sphingomonas and Sphingobium strains: dissemination of bioremediation capabilities,

re

biodegradation potential and horizontal gene transfer. Sci. Total Environ. 609, 1238-1247.

lP

Zheng, Q., Chen, C., Yan, X.J., Wang, Y.N., Zeng, Y.H., Hao, L.K., He, W.H., Jiao, N.Z., 2010.

na

Mameliella alba gen. nov., sp. nov., a marine bacterium of the Roseobacter clade in the order Rhodobacterales. Int. J. Syst. Evol. Microbiol. 60(4), 953-957.

Jo ur

Zothanpuia, Passari, A.K., Leo, V.V., Chandra, P., Kumar, B., Nayak, C., Hashem, A., Abd Allah, E.F., Alqarawi, A.A., Singh, B.P., 2018. Bioprospection of Actinobacteria derived from freshwater sediments for their potential to produce antimicrobial compounds. Microb. Cell Fact. 17, 68.

22

Journal Pre-proof

Fig. 1. Intestine tissue of L. vannamei stained with HE that were fed the control and SA diets for 56 days. (A) the control group, × 400; (B) the SA1 group, × 400; (C) the SA2 group, × 400; (D) the SA3 group, × 400. The letters in the figure indicated that: (a) brush border, (b) epithelium, (c) nuclei, (d) lumen, (e) epithelium height (EH), (f) wall thickness (WT). Bars show the mean ±SE (N = 5). The

of

different letters (a-d) indicate significant differences (P < 0.05) among the groups.

ro

Fig. 2. Intestine microbe composition of L. vannamei that were fed the control and SA diets for 56 days. (A) Rarefaction curves. (B) Venn diagram. (C) phylum level. (D) class level. Bars show the mean ± SE

-p

(N = 3). The different letters (a, b, c) indicate significant differences (P < 0.05) among groups. (E)

re

Heatmap analysis of intestine microbial on the top 50 genera. The redder colour show the higher

na

lP

abundance of the genera, and the black colour is the lower abundance.

Fig. 3. Inter-group variation in the relative abundance of the intestine microbiota communities between

Jo ur

different groups. (A) LDA score of Lefse-PICRUSt. The length of column represented the effect size of bacterial lineages. (B) Lefse cladogram. The bacterial groups from family to class level are listed from center to outside. Each circle’s diameter is proportional to the bacterial taxa’s abundance. Red: bacterial taxa enriched in Control; green: bacterial taxa enriched in SA1; blue: bacterial taxa enriched in SA2; purple: bacterial taxa enriched in SA3; yellow: no significant differences. Only the taxa that linear discriminate analysis (LDA) value above 2.5 are shown.

Fig. 4. Intestine microbiota metabolism of L. vannamei based on KEGG pathways analysis.

23

Journal Pre-proof

Fig. 5. Digestive and immune enzymes activity in the intestine of L. vannamei that were fed the control and SA diets for 56 days. (A) AMS; (B) LPS; (C) Tryp; (D) Pep; (E) PO; (F) T-AOC; (G) T-NOS; (H) NO. Vertical bars represented the mean ± SE (N = 3). Data marked with different letters were significantly different (P < 0.05) among groups.

Fig. 6. Immune-related genes expression level in the intestine of L. vannamei that were fed the control

ro

of

and SA diets for 56 days. The reference gene is β-actin. Vertical bars represented the mean ± SE (N =

-p

3). Data marked with different letters were significantly different (P < 0.05) among groups.

re

Fig. 7. Canonical correspondence analysis (CCA) of the bacterial at the phylum level (purple triangle)

lP

and biochemical parameters (red arrows) in the intestine samples of shrimps of the four groups. (A) the

na

correlations among the bacterial, digestive enzymes, and SCFA. (B) the correlations among the bacterial and immune enzymes and genes. The angle between the bacterial phylum and biochemical

Jo ur

parameters represented the correlation between them (acute angle: positive correlation; obtuse angle: negative correlation; right angle: no correlation).

24

Journal Pre-proof

Supplementary materials

Response of intestine microbiota, digestion, and immunity in Pacific white shrimp Litopenaeus vannamei to dietary succinate Yafei Duana,b, Yun Wanga, Xian Dinga, Dalin Xionga, Jiasong Zhanga,c,* a

Key Laboratory of South China Sea Fishery Resources Exploitation & Utilization, Ministry of

of

Agriculture and Rural Affairs, Guangdong Provincial Key Laboratory of Fishery Ecology and

ro

Environment, South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences,

Shenzhen Base of South China Sea Fisheries Research Institute, Chinese Academy of Fishery

c

lP

Sciences, Shenzhen 518121, PR China

re

b

-p

Guangzhou 510300, PR China

College of Landscape Architecture and Life Science, Chongqing University of Arts and Sciences,

na

Yongchuan, Chongqing 402160, PR China

Jo ur

*Corresponding author: [email protected] (J.S. Zhang) South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 231 Xingangxi Road, Guangzhou 510300, PR China.

25

Journal Pre-proof

Table S1 Formula ingredients and nutrient values of the experimental dietsGroup

Control

SA1

SA2

SA3

White fish meala

250

250

250

250

Soybean mealb

180

180

180

Peanut bran

164

164

164

164

Wheat flourb

230

227.5

225

220

50

50

50

50

50

50

50

50

Soybean lecithin

10

10

10

10

Fish oild

10

10

10

10

10

10

10

10

Choline chloride (50%)

5

5

5

5

Ca(H2PO4)2

10

10

10

10

VC-phosphate estere

1

1

1

1

Vitamin premixf

10

10

10

10

Mineral premixg

10

10

10

10

0

2.5

5

10

10

10

10

10

1000

1000

1000

1000

398.2

405.1

395.8

396.0

74.6

74.3

74.5

74.2

119

119

120

119

105

104

99.6

109

Krill mealb c

re

lP

Soybean oil

b

Succinateh Sodium alginate

na

Total

-p

Beer yeast

b

ro

180

b

of

Ingredients (% dry matter)

Nutrient value (g/kg dry weight)i

Lipid Ash Moisture

Jo ur

Crude protein

a

Imported from N.E.L.T.O. Australia Pty Ltd.

b

Zhuhai Shihai Feed Corporation Ltd., Zhuhai, China.

c

Kemin Industries (Zhuhai) Ltd., Zhuhai, China.

d

Imported from New Zealand (Bakels Edible Oils Ltd, Mt Macnganui).

e

Guangzhou Chengyi Company Ltd., Guangzhou, China.

f

Vitamin premix (g kg-1): retinyl acetate, 2.5; cholecalciferol, 6.25; all-rac-atocopheryl acetate, 75; menadione, 2.5; thiamin, 0.25;

riboflavin, 1; D-calcium pantothenate, 5; pyridoxine HCl, 0.75; cyanocobalamin, 2.5; niacin, 2.5; folic acid 0.25; biotin 2.5; meso-inositol, 379; cellulose, 500. g

Mineral premix (g kg-1): KCl, 90; KI, 0.04; NaCl, 40; CuSO4-5H2O, 3; ZnSO4-7H2O, 4; CoSO4-7H2O, 0.02; FeSO4-7H2O, 20;

MnSO4-H2O, 3; MgSO4-7H2O, 124; CaHPO4-2H2O, 500; CaCO3, 215. h

Succinate was purchased from Aladdin (Shanghai, China).

i

Measured values.

26

Journal Pre-proof Table S2 Primer sequence used in this study. Sequence (5'-3')

515F

GTGYCAGCMGCCGCGGTAA

806R

GGACTACNVGGGTWTCTAAT

proPO-F

CAATGACCAGCAGCGTCTTC

proPO-R

CACGGAAGGAGGCGTATCAT

ALF-F

GGTGTTCCTGGTGGCACTCT

ALF-R

AGCTCCGTCTCCTCGTTCCT

Lys-F

GTTCCGATCTGATGTCCGATG

Lys-R

AAGCCACCCAGGCAGAATAG

HSP70-F

CAACGATTCTCAGCGTCAGG

HSP70-R

ACCTTCTTGTCGAGGCCGTA

Trx-F

TTCCTGAAGGTGGATGTGGA

Trx-R

AGTTGGCACCAGACAAGCTG

Muc-1-F

GGCTCGGAAGTTGGCGATGATG

Muc-1-R

CGATGGCTCAATGGCGAAGAGG

Muc-2-F

TGCCAGCCACGTCCTCCTTG

Muc-2-R

CCGCAGCCGAGGCAGTCC

Muc-5AC-F

AGCAGGACTTCAACGACTACAACAG

Muc-5AC-R

GCGCGACGCCGATGATGG

Muc-5B-F

CTTGACGCATACGCTCAGGTTCC

Muc-5B-R

TCCGCCGCCTTCATCCTCTG

Muc-19-F

GAAGAGGAGGAAGAGGACGAGGAG

β-actin-R

ro

-p

re

lP

na

β-actin-F

GGACCACCAGGCACAAGAACATC GCCCTGTTCCAGCCCTCATT ACGGATGTCCACGTCGCACT

Jo ur

Muc-19-R

of

Primer name

proPO, prophenoloxidase; ALF, anti-lipopolysaccharide factor 1; Lys, lysozyme; HSP70, heat shock protein 70; Trx, thioredoxin 1; Muc-1, mucin-1; Muc-2, mucin-2; Muc-5AC, mucin-5AC; Muc-5B, mucin-5B; Muc-19, mucin-19.

27

Journal Pre-proof Table 1 Richness and diversity index of intestine microbial of L. vannamei that were fed the control and SA diets for 56 days. Group

Observed a

Chao1

ACE

805.93 ± 44.03

a

Shannon

875.07 ± 17.20

a

2.61 ± 0.22

Simpson a

0.68 ± 0.08a

Control

598 ± 39

SA1

859 ± 56b

1248.64 ± 47.68b

1325.60 ±19.90b

4.16 ± 0.31b

0.94 ± 0.12b

SA2

821 ± 18b

1372.55 ± 75.20b

1446.09 ± 23.04b

3.73 ± 0.19b

0.88 ± 0.14b

SA3

740 ± 62b

1288.67 ± 64.55b

1347.50 ± 21.77b

3.97 ± 0.26b

0.93 ± 0.06b

ACE: abundance-based coverage estimator. Values represent the mean ± SE (N = 3). Data indicate with different letters were significantly different (P < 0.05) among groups. Table 2

Control

SA1 a

SA2

70.88 ± 0.14

73.07 ± 0.17

Propionic acid

2.90 ± 0.05a

3.63 ± 0.11b

Butyric acid

1.43 ± 0.07a

3.06 ± 0.13b

SA3

c

97.57 ± 0.81d

12.41 ± 0.42c

18.42 ± 0.36d

79.28 ± 0.23

-p

Acetic acid

b

ro

Parameters

of

Intestine SCFA contents (μg/g) of L. vannamei that were fed the control and SA diets for 56 days.

4.13 ± 0.27d

3.56 ± 0.19c

re

Values represent the mean ± SE (N = 3). Data indicate with different letters were significantly different

Jo ur

na

lP

(P < 0.05) among treatments.

28

Journal Pre-proof

Conflict of Interest

The authors (Yafei Duan, Yun Wang, Xian Ding, Dalin Xiong, and Jiasong Zhang) declare that the research was conducted in the absence of any commercial or financial relationships that could be

of

construed as a potential conflict of interest.

ro

Jiasong Zhang Ph.D

Tel.: +86 020 84451349; fax: +86 020 84451442

-p

Email: [email protected]

re

Address: South China Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, 231

Jo ur

na

lP

Xingangxi Road, Guangzhou 510300, PR China

29

Journal Pre-proof

Highlights

► Effects of dietary succinate (SA) on the intestine health of Litopenaeus vannamei was studied. ► Dietary SA increased intestine mucosa morphology. ► Dietary SA altered the microbiota composition and increased the intestine SCFA contents. ► Dietary SA induced digestive and immune response in

of

the intestines of L. vannamei. ► The changes of biochemical parameters were correlated with the

Jo ur

na

lP

re

-p

ro

bacterial abundance.

30

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7