- Email: [email protected]
Response of the submerged macrophytes Vallisneria natans to snails at different densities
Ecotoxicology and Environmental Safety 194 (2020) 110373
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Response of the submerged macrophytes Vallisneria natans to snails at different densities
T
Hao Zhanga, Xin Luoa, Qi Lia, Suzhen Huanga, Ning Wanga, Denghua Zhangb, Jibiao Zhanga,∗∗, Zheng Zhenga,∗ a b
Department of Environmental Science and Engineering, Fudan University, Shanghai, 200433, PR China Jiangsu Sentay Environmental Science and Technology Co., Ltd, Nanjing, 211106, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Snail Submerged macrophyte Water quality Biofilm Microbial diversity
The study investigated the responses of the submerged macrophyte Vallisneria natans (V. natans) to snails (Bellamya aeruginosa) at different densities, with changes in physiological parameters, morphology, leaf-epiphytic bacteria community and water quality parameters examined. The changes of water quality parameters (pH, total nitrogen (TN), total phosphorus (TP) and total organic carbon (TOC)) indicated that snails secreted nutrients into water. Changes in morphological and physiological parameters (fresh weight, root length, shoot height, chlorophyll, malondialdehyde (MDA), activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD)) demonstrated that the presence of snails were beneficial to the growth of submerged macrophytes. Microbial diversity analyses indicated that snails could decrease microbial community richness and diversity. At medium densities (340 ind. m−2), an increase in snail density was beneficial to the growth of submerged macrophytes. The results of this study provide theoretical guidance and technical support for the maintenance and restoration of submerged macrophytes.
1. Introduction Due to the rapid industrial development in China, large amounts of nitrogen and phosphorous flow into waterbodies such as lakes, along with sewage, resulting in widespread eutrophication (Chen et al., 2014; Zhao et al., 2010). Eutrophication causes lakes to change from grass or diatom dominated lakes with multiple algal types to blue-green algae dominated lakes, resulting in the ecological balance of lakes being destroyed (Xiao et al., 2009). As primary producers in aquatic ecosystems, submerged macrophytes play an important role in regulating lake function and maintaining ecological balance (Hough et al., 1989; Zhao et al., 2016). Submerged macrophytes absorb nitrogen, phosphorus and other nutrients from the waterbody (Huang et al., 2005) while releasing allelochemicals to inhibit the growth of algae (Gao et al., 2016; Gross et al., 2007; Hilt and Gross, 2008; Zhu et al., 2010). In addition, submerged macrophytes can provide a surface for algae, bacteria, and other microorganisms to settle, forming biofilm or periphyton communities (Michael et al., 2008). Submerged macrophytes can suppress harmful algal bloom formation (Zhu et al., 2010), and planting submerged macrophytes have been widely used to restore the ecological
∗
environments in eutrophic waterbodies (Pan et al., 2011; Seto et al., 2013). The maintenance and restoration of submerged macrophytes have been recognized as one of the best choices for eutrophic shallow lake management for the improvement of water quality (Song et al., 2017). However, the maintenance of submerged macrophytes might be influenced by various environmental factors including water depth, light exposure, water temperature and nutrient content, among other factors. Furthermore, biofilms on the surface of macrophytes can also affect the growth of submerged macrophytes (Jones et al., 2002). Benthic animal species promote the circulation of nutrients in the waterbody through absorption and excretion, affecting the growth of macrophytes by grazing on submerged macrophyte biofilms (Zheng et al., 2008). The biofilms on submerged macrophyte surfaces play an important role in the interactions between benthic animals and macrophytes. Excess biofilm formation may have negative effects on the host macrophytes, by decreasing light conditions and nutrient utilization (Drake and Dobbs, 2003; Phillips et al., 1978; Zhao et al., 2018). However, excessive grazing by benthic animals, such as snails, potentially has a modulating effect on biofilm formation (Zheng et al., 2008; Zhu et al., 2013). Some studies have shown that snails can feed on
Corresponding author. Corresponding author. E-mail addresses: [email protected] (J. Zhang), [email protected] (Z. Zheng).
∗∗
https://doi.org/10.1016/j.ecoenv.2020.110373 Received 17 December 2019; Received in revised form 9 February 2020; Accepted 24 February 2020 0147-6513/ © 2020 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
periphyton layers on the surface of macrophytes, improving the ability of macrophytes to absorb light and nutrients, while promoting the growth of macrophytes by regulating the local water environment through metabolism (Zheng et al., 2008). However, some studies have also shown that snail grazing on macrophytes restricts macrophyte growth and causes damage to macrophytes (Li et al., 2009b). The existence of snails can reduce competition between the periphyton layer and submerged macrophytes for nutrients and light, which is beneficial to the growth of submerged macrophytes. In addition, snails graze on submerged macrophytes, hindering their growth and which role is dominant is not currently clear. Previous studies have mainly focused on the growth of macrophytes (He et al., 2012; Wang et al., 2017), with less research focus on the biofilms present on the surface of macrophyte leaves. The grazing of snails and the release of nutrients exert an important effect on submerged macrophytes and their surface biofilms, inhibiting or promoting the growth of submerged macrophytes. At present, there have been few studies assessing the interaction between snails and biofilms and their effects on the growth of submerged macrophytes. Therefore, a comprehensive study is required on the response of submerged macrophytes and periphyton biofilms to snail grazing, as a potential tool for aquatic ecosystem restoration. This study assessed the effect of different densities of snails on the photosynthesis and bacterial community structure of biofilms on submerged macrophytes. These interactions were studied using V. natans, which is a common submerged macrophyte in China and has a good capacity for nitrogen and phosphorus removal (Li et al., 2018). This study aimed to test: (1) whether snails were beneficial to the growth of submerged macrophytes; (2) which density range of snails were most favorable for submerged macrophytes growth; and (3) whether snails could alter the bacterial communities and biofilm structure of the V. natans leaves.
Table 1 Description of the treatment conditions on V. natans. Treatment
Snail density (ind. m−2)
V. natans weight (g)
Snails weight (g)
CT T1 T2 T3
0 170 340 680
10.13 10.13 10.27 10.23
0.00 11.10 ± 0.51 22.73 ± 1.13 49.70 ± 0.75
± ± ± ±
0.05 0.12 0.05 0.05
3 mm (Fig. S1). Each container contained 4.5 L of water from Rihu lake in Jiangwan campus, Fudan University (N31°20′, E121°30′, Shanghai, China) and 50 mm of sediments (silica sand, Aqua Design Amano Company, Japan). High TP concentration (0.213 ± 0.003 mg L−1) eutrophic water was combined with about 10 g fresh weight (FW) plants in each experimental system. Plants were incubated at 28 ± 2 °C under continuous light of 90 μmol quanta m−2 s−1 (PPFD) with a 12 h:12 h light: dark cycle in a container. Leaf biofilm samples were collected on the 24th day of culture, in order to allow biofilms to form and stabilize. 2.3. Measurements of aquatic parameters, total chlorophyll, enzyme activity and malondialdehyde content Aquatic parameters, including pH, TOC and the concentrations of TN and TP, were measured every four days during the exposure period. The pH was examined using a portable instrument (YSI, Weiss instrument, Ohio, U.S.). The TP concentration was analyzed using the molybdenum blue colorimetric method on a Hach DR6000 at a wavelength of 700 nm after digestion with K2S2O8 to orthophosphate. The concentrations of TN and TOC were measured using a TOC-L analyzer (Shimadzu, Japan). The Fv/Fm ratios (maximum quantum yield of photosystem Ⅱ (PSⅡ)) of leaves were examined in the middle and at the end of the experimental period using a portable PAM fluorometer (AquaPen-C, Photo Systems Instruments, Czech Republic) adopting the methods for submerged macrophytes reported by Dr. Jiang group (Jiang et al., 2019). To measure chlorophyll a and chlorophyll b concentrations, 0.2 g of fresh leaf samples were extracted using 96% ethanol and chlorophyll content was determined using a spectrophotometer at 649 nm and 665 nm. The contents of chlorophyll a and chlorophyll b were calculated according to the method reported by Dr. Wang group (Wang et al., 2008). To measure the MDA content, 0.5 g of fresh leaf samples were placed in liquid nitrogen and then homogenized in 5 mL of 10% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 15,000×g at 4 °C for 5 min and then 2 mL of 20% TCA containing 0.65% (w/v) 2-thiobarbituric acid (TBA) was added to 0.5 mL of the supernatant. The mixture was heated in 95 °C hot water for 80 min and then immediately cooled under flowing water. The absorbance of the supernatant was read at 532 nm and 600 nm. MDA equivalence was calculated according to the methods reported by Dr. Hodges group (Hodges et al., 1999). To extract enzymes, 0.5 g of plant leaf sample was ground in liquid nitrogen and mixed with 5 mL of 50 mm potassium phosphate buffer (PBS, pH of 7.0) containing 1 mM EDTA and 1% polyvinylpyrrolidone (w/v). The mixture was centrifuged at 4 °C for 20 min at 10,000×g, and then the supernatants were used to determine CAT, POD and SOD enzymatic activity using the respective assay kits (XYb science, China) following the manufacturer's instructions. The total chlorophyll, MDA content, and enzyme activities were determined at the end of the experimental period.
2. Materials and methods 2.1. Cultivation of snails and V. natans The snails, Bellamya aeruginosa, were purchased from the Dachang market in Baoshan, Shanghai. Prior to experiments, the snails were cultivated in tap water in the laboratory for 7 days. Snails were maintained without food for 48 h prior to experiments. Before being added into experimental tanks, the snails were washed carefully and then wiped dry with paper and fresh weight was determined. V. natans was purchased from Pudong Tiancun Horticultural Company (Shanghai, China) and cultivated in a container under adaptive conditions of 1/10 Hoagland solution medium. After 10 days of adaptation, most plants exhibited optimum-states. Prior to experiments, healthy plants were selected and cleaned with deionized water. 2.2. Experimental design The experiment was conducted over 24 days in the laboratory from June to July in 2019 under climate-controlled conditions at 28 ± 2 °C between 70 and 90% relatively humidity. Daily 12 h–12 h light-dark cycles were applied at 90 μmol quanta m−2 s−1, measured as photosynthetic photon flux density (PPFD) using a quantum meter (Spectrum Technology, Inc., USA). The experiment was performed with 3 different snail densities of 170 ind. m−2 (low density), 340 ind. m−2 (medium density) and 680 ind. m−2 (high density)), as well as a control group without any added snails (Table 1). The medium density treatment used in this study was comparable to the reported snail density range in natural habitats (Zhu et al., 2013). Newborn snails were removed from the tanks daily and dead snails were also removed from the tank and replaced with new snails. Each treatment was performed in triplicate and therefore, the experiment involved 12 plexiglass containers in total. The plexiglass treatment containers were cylindrical vessels with a height of 400 mm, an outer diameter of 150 mm and wall thickness of
2.4. Observation of biofilm surface 2.4.1. Scanning electron microscopy (SEM) SEM was used to observe the distribution of bacteria and algae in 2
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
growth of submerged macrophytes, which was consistent with the findings of previous studies (Li et al., 2009a; Zheng et al., 2008). Snails can promote the growth of submerged macrophytes through grazing of the periphyton on the surface of macrophytes. In addition, snails can release nutrients into the water, especially nitrogen, improving the concentration of nutrients for the promotion of growth of submerged macrophytes. However, because the sediment applied was silica sand without sufficient organic debris, snails may have occasionally grazed on the roots of submerged macrophytes, resulting in the root length in the treatment groups (T1, T2, T3) decreasing, although there was no significant difference observed among them. The shoot height of submerged macrophytes was slightly reduced during the experiment.
biofilms on the leaf surface. In order to analyze the biofilm, 2.0 cm long sections of V. natans leaves were carefully sampled from middle part of the leaves, cut into 0.8 × 0.8 cm pieces and then fixed in glutaraldehyde (2.5% in 50 mmol/L sodium cacodylate). After rinsing twice with 0.1 M PBS (pH of 7.4), the leaf samples were dehydrated using a series of concentrations of ethanol (20, 40, 60, 80 and 90%) for 15 min and with 100% ethanol twice for 15 min, before the dry samples were observed under SEM. 2.4.2. DNA extraction and the high-throughput sequencing Leaf samples were collected from all three replicate treatments and mixed together. Then 0.5 g fresh leaf samples were collected at the end of the experiment and 20 mL 0.1 mol L−1 PBS solution was added, with the mixture then ultrasonicated for 1 min. Then, the suspension was shaken for 5 min at 25 °C and centrifuged at 10,000×g for 5 min. Sediments were collected and stored at −80 °C for further DNA isolation and analysis. The bacterial DNA on leaf surface was extracted using a Soil DNA Kit (Omega E.Z.N.A, Omega Bio-Tech, Georgia, USA) and high-throughput sequencing was conducted by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China). In this study, the V3–V4 hypervariable region of the 16 S rRNA gene was targeted for amplification using a universal barcoded primer set, 338 F (ACTCCTACGGGAGGCAGCAG) and 806 R (GGACTACHVGGGTWTCTAAT) provided by Majorbio Bio-pharm Technology Co.,Ltd (Shanghai, China). To understand the number of strains and genera in the sequence results per sample, the sequences were clustered into operational taxonomic unit (OTU) groups based on their similarity at the 97% similarity level. Then the taxonomic information was annotated using the SILVA database after subsampling based on the lowest number of reads. These sequences were classified into 876 OTUs. The sequencing data was flattened before conducting species diversity analysis, to ensure that the analysis was carried out on the same data volume and avoid bias due to the difference in the number of sample sequences, increasing the statistical significance of data. The read number in each sample was 28, 843 after flattening. After high-throughput sequencing on the Illumina PE300, microbial community composition and difference analysis and subsequent bioinformatic analysis were performed on the Illumina MiSeq platform. Bioinformatic analysis was used to describe the diversity of microbial communities and to verify the microbial species present (Li et al., 2020b).
3.2. Bacterial communities in V. natans leaf-associated biofilms 3.2.1. SEM images of the leaf surface Most microorganisms exist in the form of biofilms in aquatic environments (Sutherland, 2001). To characterize the morphology of biofilms attached to the leaf surfaces of V. natans, SEM images of the leaf surface were assessed (Fig. 2). Many particles such as bacillus, coccus, other forms of bacteria and organic matter can be observed on the surface of V. natans leaves, which was consistent with previous reports (Li et al., 2020a). The main components of each biofilm were very similar. The biofilms of the CT group visually had more coccus than the groups containing snails, while the groups with snails contained more bacillus than the CT group. 3.2.2. Microbial diversity analysis There is a complex interrelationship between biofilms and the biofilm host. The microbes in biofilms can be affected by both environmental parameters and the distributions of biofilms on the leaves of submerged macrophytes (Zhang et al., 2016). To analyze the microbial diversity in biofilms, the Alpha diversity was employed, referring to the diversity within a particular region or ecosystem, including a series of statistical analysis indexes to estimate species richness and diversity of environmental communities to study microbial diversity in the environment. Several Alpha diversity measures were evaluated using the MiSeq platform including the abundance based coverage estimator (ACE), the Shannon index, Simpson index, the observed richness (sobs), terminal richness estimation (Chao 1) and the Good's coverage estimation (Table S1). The sobs, ACE and Chao 1 values showed that the community richness of microbes in the CT group was higher than in samples from the treatment groups (T1, T2 and T3) and that the community richness of T2 was slightly higher than in T1 or T3. High coverage index values mean a high probability of being measured generally. In this study, the coverage was greater than 0.99 after subsampling based on the lowest number of reads, indicating that these samples reflected the actual community. The Shannon and Simpson index reflect community diversity. The Simpson index value is negatively correlated with community diversity and the Shannon index value is positively correlated with community diversity. The results of this study indicated that the community diversities in CT and T1 groups were higher than that in T2 and T3 groups, with the T2 group being the lowest. So, the grazing of snails decreased the microbial community richness and diversity of biofilms on the surface of macrophytes. Previous experiments have demonstrated that the amount of biofilms on the surface of macrophytes in the presence of snails was lower than that of the absence of snails (Bai et al., 2007; Cao et al., 2014). The result of this study was consistent with the previous experiments.
2.5. Statistical analysis The T test uses the t-distribution theory to infer the probability of differences, to compare whether the difference between the two average values is significant. One-way analysis of variance (ANOVA) was used to compare differences between multiple groups (n ≥ 3) using SPSS 18.0 (IBM, USA). The difference was considered statistically significant at p < 0.05. 3. Results and discussion 3.1. Effect of snail presence and density on growth of V. natans During the experimental period, all of the V. natans specimens remained alive. The fresh weight of V. natans in CT, T2 and T3 groups significantly increased (p < 0.05, Fig. 1(a)) during the experimental period. The fresh weight of V. natans in T1 did not differ significantly. The root length of V. natans in the CT group exhibited a significant increase (p < 0.05, Fig. 1(b)), while the root length in treatment groups (T1, T2 and T3) exhibited a different degree of reduction. The shoot height of V. natans decreased to different degrees (Fig. 1(c)) with shoot height of V. natans in the T1 group significantly decreasing, while shoot height of V. natans in T2 exhibited the least decrease. This study showed that the presence of snails can promote the
3.2.3. Phylum-level and genus-level taxonomic distribution The V3–V4 hypervariable region was assessed to establish the diversity and structure of microbial communities in biofilms on the leaves of submerged macrophytes. The Venn diagram analysis showed that the 3
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 1. Variations of fresh weight (a), root length (b), shoot height (c) of V. natans in four groups. * indicates significant differences at p < 0.05.
4
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 2. SEM images of biofilms attached to leaves of V. natans of CT, T1, T2 and T3groups. ①, cocci aggregates; ②, bacillus aggregates; ③, organic matter or extracellular polymers.
indicated that Proteobacteria was the most common phylum in all groups. But Proteobacteria in the CT group were less abundant than in treatment groups, with the T2 group containing the highest abundance among the four groups. However, Cyanobacteria abundance in T2 and T3 groups were much lower than in the CT group. Snails can reduce biofilms on the surface of the submerged macrophytes, especially Cyanobacteria, due to grazing. Snails have been reported to exhibit feeding preferences to different types of bacteria phyla (Guariento et al., 2009) and snails may have a preference for feeding on cyanobacteria, although this requires further investigation. The decline in Cyanobacteria led to a relative increase in the proportion of Proteobacteria and overall, the grazing of snails changed the composition
biofilm samples contained more than 82.2% of the same bacterial phyla (Fig. S2(a)). Obviously, there was a similar microbial composition in these samples. The community bar plot analysis diagram showed the composition distribution of the 7 most dominant phyla for all samples (Fig. 3(a)). The dominant bacterial phyla in the biofilm samples included Proteobacteria (52.34–84.17%), Cyanobacteria (7.26–31.76%), Bacteroidetes (4.09–5.20%) and Actinobacteria (0.92–5.68%). These bacterial phyla were consistent with the major phyla reported in leadassociated biofilms on submerged macrophytes (Han et al., 2018; Jiang et al., 2019; Li et al., 2020b). In addition, other phyla just occupied a minor percentage (< 5.00%). The stability of biofilms was determined by the main microorganisms on the biofilms (Lv et al., 2014). This study 5
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 3. Microbial community analysis: (a) Percent of community abundance on phylum level; (b) Heatmaps of the bacterial community in top 50 genera based on attached surface.
6
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 4. MDA contents of V. natans in different experiments. The horizontal line in the middle of each box indicates the median value, whiskers that protrude out of the box represent the minimum and maximum values.
distribution of biofilms. Microbial composition analysis was performed at the genus level. A heatmap of the 50 most abundant genera was established, with blue representing high abundance and red representing low abundance genera (Fig. 3(b)). Rhodobacter (11.15%–31.21%) was the most abundant genera in every sample. Norank_f_Leptolyngbyaceae (2.26%–10.47%), Pseudorhodobacter (4.07%–8.39%) and unclassified_f_Sphingomonadaceae (2.85%–4.57%) were also major genera. The proportion of Cyanobium in sample CT was relatively large (11.92%), while in treatment groups its abundance was close to zero. The existence of snails exerted a subtle effect on the microbial community composition. According to the clustering tree, the bacterial composition in samples CT and T1 was generally different from the samples T2 and T3, indicating that the density of snails can influence the microbial community composition. The results of hierarchical clustering analysis also supported the finding that the existence of snails altered the structure of the microbial community of biofilms on V. natans leaves. A distance heatmap showed that the higher densities of snail populations in the treatment group, resulted in a greater deviation from the control group (Fig. S2(b)). Moreover, the distance between T2 and CT was very close to the distance between T3 and CT, indicating that the influence of medium density and high density snail populations on the structure of the microbial community of biofilms was highly similar. Fig. 5. Antioxidant responses of V. natans in different experiment. (a) CAT activity, (b) POD activity, and (c) SOD activity. Columns denote by a different lowercase letter differ significantly by ANOVA at p < 0.05.
3.3. PCoA analysis based on OTUs Beta diversity represents a comparison of the composition of microbial communities and evaluates the difference between microbial communities. The basic output of the comparison is a distance matrix representing the differences between each two samples in the community. The Beta diversity was evaluated by PCA and the results are illustrated in Fig. S3. The principal components PC1 and PC2 explained 49.49% and 27% of variation in microbial community composition, respectively. The closer the two sample points are, the more similar the species composition is and the samples were divided into three distinct groups (group A: CT, group B: T1 and T2, group C: T3). The existence of snails (group A vs group B and group C) had a major influence on the microbial community structure. The separation of group B and C indicated that the density of the snail populations can also influence the microbial community.
3.4. Effect of snails on membrane lipid peroxidation and the antioxidant defense system of V. natans leaves Various stress factors can induce reactive oxygen species in plant leaves, while MDA can be produced from polyunsaturated fatty acid oxidation as a secondary end product, due to an excess of reactive oxygen species (Gunes et al., 2007; Janero, 1990). The MDA content in treatment groups was slightly lower than that in the control group, indicating that the existence of snails did not cause oxidative damage within the leaves of submerged macrophytes (Fig. 4). SOD dismutase superoxide generates H2O2, which can be decomposed to water and oxygen by the activities of CAT and POD (Wang et al., 2008). The CAT and POD content in the T2 group were slightly lower than in other groups, while there were no significant differences 7
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 6. Effects of snails of different densities on Fv/Fm and Chlorophyll of V. natans leaves. Different characters indicate significant difference (p < 0.01).
such as microcystin-LR to inhibit photosynthesis of V. natans leaves (Jiang et al., 2019; Pflugmacher, 2002; Yin et al., 2005). The total chlorophyll content (chlorophyll a + b) can represent the absorption of light energy by plants. The total chlorophyll content of the V.natans in T2 group was the highest, meaning they could absorb most light energy. It was consistent with the conclusion that the reduction of biofilm and cyanobacteria on the surface of V.natans promoted the absorption of light energy. There was no significant difference in chlorophyll a and Fv/Fm between the groups, indicating that there was no significant difference in light energy conversion efficiency. The grazing of snails could reduce the biofilm and decrease cyanobacteria proportion on leaf surface. The decrease in competitive pressure results in an increase in chlorophyll content in leaves and the enhancement of photosynthetic capacity.
in SOD, CAT and POD between groups (Fig. 5). Overall, these results indicate that the existence of snails did not induce more oxidative stress in submerged macrophytes, causing them to consume more energy for biosynthesis of these enzymes. 3.5. Effect of snails on photosynthesis of V. natans The Fv/Fm ratio of V. natans leaves was remained generally stable in the middle and late stage of the experimental period and different densities of snails did not affect the Fv/Fm ratio of V. natans (Fig. 6(a)). However, the chlorophyll content in leaves varied different under different treatment conditions. At the end of the experimental period, the chlorophyll contents of the leaves in the treatment groups (T1, T2, T3) were higher than the control group and the chlorophyll content was highest in the T2 group (Fig. 6(b)). The growth of biofilms can have negative impacts on plant cells (Gong et al., 2018). For example, the increase in biofilm area can directly lead to a decrease in the intensity of light available on the leaves (Phillips et al., 1978) and the cyanobacteria can release allelochemicals
3.6. Changes of water quality parameters PH, TOC, TN and TP concentrations under different treatment conditions were shown in Fig. S3. During the experimental period, the 8
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Acknowledgements
pH value in every treatment was increased slowly. The pH value in water varied with the density of snail populations, with higher the densities of the snail populations, resulting in the lower water pH values. However, the pH value in all treatment groups was greater than 7.0. The initial concentrations of TP and TN in all treatment groups were 0.213 ± 0.004 mg L−1 and 2.03 ± 0.07 mg L−1 respectively. At the end of experimental period, the concentrations of TP in CT, T1, T2, and T3 were 0.022, 0.031, 0.047 and 0.064 mg L−1, respectively, while the TP removal efficiencies were 89.7%, 85.4%, 77.9% and 70.0%, respectively. After the fourth day of the experimental period, the concentration of TN in different treatment groups decreased slowly. At the end of the experiment, the concentrations of TN in CT, T1, T2 and T3 were 0.39, 0.54, 1.05 and 2.57 mg L−1. After 24 days, the removal efficiencies of TN in CT, T1 and T2 were 80.8%, 73.4% and 48.3% respectively, while the concentration of TN in T3 was higher than the initial concentration. Snails can exchange nutrients with the water environment through metabolism and release nutrients into water, which is consistent with the findings of previous studies (Li et al., 2009a; Wang et al., 2017). This study showed that a higher density of snail population, resulted in a lower the pH value and higher TP and TN concentrations. V. natans could effectively absorb nitrogen, phosphorus and other nutrients from the water, reducing the content of nutrients in water, while the presence of snails will reduce the removal rate of nutrients in water by secreting and excreting substances. To further evaluate this point, the TOC concentration in water was measured, showing that the TOC concentration in the control group remained almost unchanged. In contrast, the TOC concentration in T1 increased slowly over time, while the TOC concentrations in T2 and T3 groups were significantly increased. This demonstrated that snails released material into water during the experimental period. In the treatment groups, the rate of TP decrease was lower than that of TP, because the content of phosphorus in the nutrients released by snails was very low, while the content of nitrogen was relatively high. These experimental results were consistent with the reported findings of two references (Li et al., 2009b; Zheng et al., 2008).
The study was supported by the Major Science and Technology Program for Water Pollution Control and Treatment (2012ZX07103004, 2017ZX07204005). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2020.110373. References Bai, X., Gu, X., Zhang, Y., 2007. The effects of Bellamya sp. on the growth of two submerged macrophytes in Lake Taihu. J. Lake Sci. 19 (1), 98–102. Cao, Y., Li, W., Jeppesen, E., 2014. The response of two submerged macrophytes and periphyton to elevated temperatures in the presence and absence of snails: a microcosm approach. Hydrobiologia 738 (1), 49–59. Chen, X., Chuai, X., Yang, L., 2014. Historical evolution and causes of eutrophication in lakes in typical lake regions of China. J. Ecol. Rural Environ. 30 (4), 438–443. Drake, L.A., Dobbs, F.C., 2003. Effects of epiphyte load on optical properties and photosynthetic potential of the seagrasses Thalassia testudinum Banks ex Konig and Zostera marina L. Limnol. Oceanogr. 48 (1), 456–463. Gao, Y., Dong, J., He, Y., Ge, F., Liu, B., Wu, Z., 2016. Research advances on the modes of action for allelopathic algal inhibition by submerged macrophytes based on the release characteristics of allelochemicals. Acta Hydrobiol. Sin. 40 (6), 1287–1294. Gong, L., Zhang, S., Chen, D., Liu, K., Lu, J., 2018. Response of biofilms-leaves of two submerged macrophytes to high ammonium. Chemosphere 192, 152–160. Gross, E.M., Hllt, S., Lombardo, P., Mulderij, G., 2007. Searching for allelopathic effects of submerged macrophytes on phytoplankton—state of the art and open questions. Hydrobiologia 584 (1), 77–88. Guariento, R.D., Caliman, A., Esteves, F.A., Bozelli, R.L., Enrich-Prast, A., Farjalla, V.F., 2009. Substrate influence and temporal changes on periphytic biomass accrual and metabolism in a tropical humic lagoon. Limnologica 39 (3), 209–218. Gunes, A., Guneri, E., Bagci, E.G., Coban, S., Sahin, O., 2007. Silicon increases boron tolerance and reduces oxidative damage of wheat grown in soil with excess boron. Biol. Plantarum 51 (3), 571–574. Han, B., Zhang, S.H., Wang, P.F., Wang, C., 2018. Effects of water flow on submerged macrophyte-biofilm systems in constructed wetlands. Sci. Rep. 8 (1). He, H., He, Y., Ji, Y., Guo, L., Liu, Z., Li, K., 2012. Effects of cyanobacterial accumulation and snail grazing on the growth of Vallisneria natans. Acta Hydrobiol. Sin. 32 (17), 5562–5567. Hilt, S., Gross, E.M., 2008. Can allelopathically active submerged macrophytes stabilise clear-water states in shallow lakes? Basic Appl. Ecol. 9 (4), 422–432. Hodges, D.M., Delong, J.M., Forney, C.F., Prange, R.K., 1999. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207 (4), 604–611. Hough, R.A., Fornwall, M.D., Negele, B.J., Thompson, R.L., Putt, D.A., 1989. Plant community dynamics in a chain of lakes principal factors in the decline of rooted macrophytes with eutrophication. Hydrobiologia 173 (3), 199–217. Huang, Y., Fu, Y., Zhao, J., 2005. Research progress on mechanisms of phytoremediation for eutrophic water. Journal of Agro-Environment Science 24, 379–383. Janero, D.R., 1990. Malondialdehyde and thiobarbituric acid-reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radic. Biol. Med. 9 (6), 515–540. Jiang, M., Zhou, Y., Wang, N., Xu, L., Zheng, Z., Zhang, J., 2019. Allelopathic effects of harmful algal extracts and exudates on biofilms on leaves of Vallisneria natans. Sci. Total Environ. 655, 823–830. Jones, J.I., Young, J.O., Eaton, J.W., Moss, B., 2002. The influence of nutrient loading, dissolved inorganic carbon and higher trophic levels on the interaction between submerged plants and periphyton. J. Ecol. 90, 12–24. Li, F., Chu, S., Cui, L., Xiao, J., 2018. Research advances on the influence mechanisms of submerged plants growth and decomposition on nitrogen and phosphorus in eutrophic water. Ecological Science 37, 225–230. Li, H., Li, Q., Luo, X., Fu, J., Zhang, J., 2020a. Responses of the submerged macrophyte Vallisneria natans to a water depth gradient. Sci. Total Environ. 701, 134944. Li, K., Liu, Z., Gu, B., 2009a. Density-dependent effects of snail grazing on the growth of a submerged macrophyte, Vallisneria spiralis. Ecol. Complex. 6 (4), 438–442. Li, K., Liu, Z., Hu, Y., Yang, H., 2009b. Snail herbivory on submerged macrophytes and nutrient release: implications for macrophyte management. Ecol. Eng. 35 (11), 1664–1667. Li, Q., Gu, P., Zhang, H., Luo, X., Zhang, J., Zheng, Z., 2020b. Response of submerged macrophytes and leaf biofilms to the decline phase of microcystis aeruginosa: Antioxidant response, ultrastructure, microbial properties, and potential mechanism. Sci. Total Environ. 699, 134325. Lv, Y., Wan, C., Lee, D., Liu, X., Tay, J., 2014. Microbial communities of aerobic granules: granulation mechanisms. Bioresour. Technol. 169, 344–351. Michael, T.S., Shin, H.W., Hanna, R., Spafford, D.C., 2008. A review of epiphyte community development surface interactions and settlement on seagrass. J. Environ. Biol. 29, 629–638. Pan, G., Yang, B., Wang, D., Chen, H., Tian, B., Zhang, M., Yuan, X., Chen, J., 2011. Inlake algal bloom removal and submerged vegetation restoration using modified local
4. Conclusions The response of V. natans to snail populations of different densities was investigated in this study. The existence of snails could affect V. natans growth status including fresh weight, shoot height, root length and chlorophyll content. Snails effectively changed the microbial community structure in biofilms of leaves, and the influence of different density snail populations on the structure varied. The existence of snails was beneficial to the growth of submerged macrophytes. Under the medium density populations, the increase in snail density was beneficial to the growth of submerged macrophytes. The change in snail density from the medium density to high density populations had no significant effect on the growth of submerged plants. This study provides useful information for understanding how snails affect the growth of submerged macrophytes. CRediT authorship contribution statement Hao Zhang: Investigation, Data curation, Formal analysis, Writing original draft. Xin Luo: Investigation, Resources. Qi Li: Data curation, Writing - review & editing. Suzhen Huang: Formal analysis. Ning Wang: Writing - review & editing. Denghua Zhang: Resources. Jibiao Zhang: Conceptualization, Methodology. Zheng Zheng: Supervision. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. 9
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Yin, L., Huang, J., Li, D., Liu, Y., 2005. Microcystin-RR uptake and its effects on the growth of submerged macrophyte Vallisneria natans (lour.) Hara. Environ. Toxicol. 20 (3), 308–313. Zhang, S., Pang, S., Wang, P., Wang, C., Guo, C., Addo, F.G., Li, Y., 2016. Responses of bacterial community structure and denitrifying bacteria in biofilm to submerged macrophytes and nitrate. Sci. Rep. 6. Zhao, J., Yang, Y., Zhong, S., Li, K., Chen, X., 2016. Simulation on rural water purification effect and mechanism with submerged macrophytes' sink. J. Lake Sci. 28, 1274–1282. Zhao, Y., Deng, X., Zhan, J., Xi, B., Lu, Q., 2010. Progress on preventing and controlling strategies of lake eutrophication in China. Environ. Sci. Technol. 33, 92–98. Zhao, Z., Qin, Z., Xia, L., Zhang, D., Hussain, J., 2018. Dissipation characteristics of pyrene and ecological contribution of submerged macrophytes and their biofilmsleaves in constructed wetland. Bioresour. Technol. 267, 158–166. Zheng, Y., Wen, M., Li, K., Wang, H., 2008. Effects of Bellamya sp. on the growth of Vallisneria natans in lake taihu. Res. Environ. Sci. 21 (4), 94–98. Zhu, J., Liu, B., Wang, J., Gao, Y., Wu, Z., 2010. Study on the mechanism of allelopathic influence on cyanobacteria and chlorophytes by submerged macrophyte (Myriophyllum spicatum) and its secretion. Aquat. Toxicol. 98 (2), 196–203. Zhu, J., Lu, K., Liu, X., 2013. Can the freshwater snail Bellamya aeruginosa (Mollusca) affect phytoplankton community and water quality? Hydrobiologia 707 (1), 147–157.
soils. Ecol. Eng. 37 (2), 302–308. Pflugmacher, S., 2002. Possible allelopathic effects of cyanotoxins, with reference to microcystin-LR, in aquatic ecosystems. Environ. Toxicol. 17 (4), 407–413. Phillips, G.L., Eminson, D., Moss, B., 1978. A mechanism to account for macrophyte decline in progressively eutrophicated freshwaters. Aquat. Bot. 4, 103–126. Seto, M., Takamura, N., Iwasa, Y., 2013. Individual and combined suppressive effects of submerged and floating-leaved macrophytes on algal blooms. J. Theor. Biol. 319, 122–133. Song, X., Wang, Z., Xiao, B., Li, E., Wang, X., 2017. Growth of Potamogeton crispus L. from turions in darkness: implications for restoring submerged plants in eutrophic lakes. Ecol. Eng. 101 255-230. Sutherland, I.W., 2001. The biofilm matrix – an immobilized but dynamic microbial environment. Trends Microbiol. 9 (5), 222–227. Wang, C., Zhang, S., Wang, P., Hou, J., Li, W., Zhang, W., 2008. Metabolic adaptations to ammonia-induced oxidative stress in leaves of the submerged macrophyte Vallisneria natans (Lour.) Hara. Aquat. Toxicol. 87 (2), 88–98. Wang, Q., Zhi, Y., Jiang, H., Cao, Y., Li, W., 2017. Effects of different initial snail densities on submerged macrophyte Vallisneria spinulosa Yan and its epiphyton. Plant Sci. J. 35 (5), 741–749. Xiao, X., Lou, L., Li, H., Chen, Y., 2009. Algal control ability of allelopathically active submerged macrophytes: a review. Chinese J. Appl. Eccol 20 (3), 705–712.
10
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv
Response of the submerged macrophytes Vallisneria natans to snails at different densities
T
Hao Zhanga, Xin Luoa, Qi Lia, Suzhen Huanga, Ning Wanga, Denghua Zhangb, Jibiao Zhanga,∗∗, Zheng Zhenga,∗ a b
Department of Environmental Science and Engineering, Fudan University, Shanghai, 200433, PR China Jiangsu Sentay Environmental Science and Technology Co., Ltd, Nanjing, 211106, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Snail Submerged macrophyte Water quality Biofilm Microbial diversity
The study investigated the responses of the submerged macrophyte Vallisneria natans (V. natans) to snails (Bellamya aeruginosa) at different densities, with changes in physiological parameters, morphology, leaf-epiphytic bacteria community and water quality parameters examined. The changes of water quality parameters (pH, total nitrogen (TN), total phosphorus (TP) and total organic carbon (TOC)) indicated that snails secreted nutrients into water. Changes in morphological and physiological parameters (fresh weight, root length, shoot height, chlorophyll, malondialdehyde (MDA), activities of superoxide dismutase (SOD), catalase (CAT) and peroxidase (POD)) demonstrated that the presence of snails were beneficial to the growth of submerged macrophytes. Microbial diversity analyses indicated that snails could decrease microbial community richness and diversity. At medium densities (340 ind. m−2), an increase in snail density was beneficial to the growth of submerged macrophytes. The results of this study provide theoretical guidance and technical support for the maintenance and restoration of submerged macrophytes.
1. Introduction Due to the rapid industrial development in China, large amounts of nitrogen and phosphorous flow into waterbodies such as lakes, along with sewage, resulting in widespread eutrophication (Chen et al., 2014; Zhao et al., 2010). Eutrophication causes lakes to change from grass or diatom dominated lakes with multiple algal types to blue-green algae dominated lakes, resulting in the ecological balance of lakes being destroyed (Xiao et al., 2009). As primary producers in aquatic ecosystems, submerged macrophytes play an important role in regulating lake function and maintaining ecological balance (Hough et al., 1989; Zhao et al., 2016). Submerged macrophytes absorb nitrogen, phosphorus and other nutrients from the waterbody (Huang et al., 2005) while releasing allelochemicals to inhibit the growth of algae (Gao et al., 2016; Gross et al., 2007; Hilt and Gross, 2008; Zhu et al., 2010). In addition, submerged macrophytes can provide a surface for algae, bacteria, and other microorganisms to settle, forming biofilm or periphyton communities (Michael et al., 2008). Submerged macrophytes can suppress harmful algal bloom formation (Zhu et al., 2010), and planting submerged macrophytes have been widely used to restore the ecological
∗
environments in eutrophic waterbodies (Pan et al., 2011; Seto et al., 2013). The maintenance and restoration of submerged macrophytes have been recognized as one of the best choices for eutrophic shallow lake management for the improvement of water quality (Song et al., 2017). However, the maintenance of submerged macrophytes might be influenced by various environmental factors including water depth, light exposure, water temperature and nutrient content, among other factors. Furthermore, biofilms on the surface of macrophytes can also affect the growth of submerged macrophytes (Jones et al., 2002). Benthic animal species promote the circulation of nutrients in the waterbody through absorption and excretion, affecting the growth of macrophytes by grazing on submerged macrophyte biofilms (Zheng et al., 2008). The biofilms on submerged macrophyte surfaces play an important role in the interactions between benthic animals and macrophytes. Excess biofilm formation may have negative effects on the host macrophytes, by decreasing light conditions and nutrient utilization (Drake and Dobbs, 2003; Phillips et al., 1978; Zhao et al., 2018). However, excessive grazing by benthic animals, such as snails, potentially has a modulating effect on biofilm formation (Zheng et al., 2008; Zhu et al., 2013). Some studies have shown that snails can feed on
Corresponding author. Corresponding author. E-mail addresses: [email protected] (J. Zhang), [email protected] (Z. Zheng).
∗∗
https://doi.org/10.1016/j.ecoenv.2020.110373 Received 17 December 2019; Received in revised form 9 February 2020; Accepted 24 February 2020 0147-6513/ © 2020 Elsevier Inc. All rights reserved.
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
periphyton layers on the surface of macrophytes, improving the ability of macrophytes to absorb light and nutrients, while promoting the growth of macrophytes by regulating the local water environment through metabolism (Zheng et al., 2008). However, some studies have also shown that snail grazing on macrophytes restricts macrophyte growth and causes damage to macrophytes (Li et al., 2009b). The existence of snails can reduce competition between the periphyton layer and submerged macrophytes for nutrients and light, which is beneficial to the growth of submerged macrophytes. In addition, snails graze on submerged macrophytes, hindering their growth and which role is dominant is not currently clear. Previous studies have mainly focused on the growth of macrophytes (He et al., 2012; Wang et al., 2017), with less research focus on the biofilms present on the surface of macrophyte leaves. The grazing of snails and the release of nutrients exert an important effect on submerged macrophytes and their surface biofilms, inhibiting or promoting the growth of submerged macrophytes. At present, there have been few studies assessing the interaction between snails and biofilms and their effects on the growth of submerged macrophytes. Therefore, a comprehensive study is required on the response of submerged macrophytes and periphyton biofilms to snail grazing, as a potential tool for aquatic ecosystem restoration. This study assessed the effect of different densities of snails on the photosynthesis and bacterial community structure of biofilms on submerged macrophytes. These interactions were studied using V. natans, which is a common submerged macrophyte in China and has a good capacity for nitrogen and phosphorus removal (Li et al., 2018). This study aimed to test: (1) whether snails were beneficial to the growth of submerged macrophytes; (2) which density range of snails were most favorable for submerged macrophytes growth; and (3) whether snails could alter the bacterial communities and biofilm structure of the V. natans leaves.
Table 1 Description of the treatment conditions on V. natans. Treatment
Snail density (ind. m−2)
V. natans weight (g)
Snails weight (g)
CT T1 T2 T3
0 170 340 680
10.13 10.13 10.27 10.23
0.00 11.10 ± 0.51 22.73 ± 1.13 49.70 ± 0.75
± ± ± ±
0.05 0.12 0.05 0.05
3 mm (Fig. S1). Each container contained 4.5 L of water from Rihu lake in Jiangwan campus, Fudan University (N31°20′, E121°30′, Shanghai, China) and 50 mm of sediments (silica sand, Aqua Design Amano Company, Japan). High TP concentration (0.213 ± 0.003 mg L−1) eutrophic water was combined with about 10 g fresh weight (FW) plants in each experimental system. Plants were incubated at 28 ± 2 °C under continuous light of 90 μmol quanta m−2 s−1 (PPFD) with a 12 h:12 h light: dark cycle in a container. Leaf biofilm samples were collected on the 24th day of culture, in order to allow biofilms to form and stabilize. 2.3. Measurements of aquatic parameters, total chlorophyll, enzyme activity and malondialdehyde content Aquatic parameters, including pH, TOC and the concentrations of TN and TP, were measured every four days during the exposure period. The pH was examined using a portable instrument (YSI, Weiss instrument, Ohio, U.S.). The TP concentration was analyzed using the molybdenum blue colorimetric method on a Hach DR6000 at a wavelength of 700 nm after digestion with K2S2O8 to orthophosphate. The concentrations of TN and TOC were measured using a TOC-L analyzer (Shimadzu, Japan). The Fv/Fm ratios (maximum quantum yield of photosystem Ⅱ (PSⅡ)) of leaves were examined in the middle and at the end of the experimental period using a portable PAM fluorometer (AquaPen-C, Photo Systems Instruments, Czech Republic) adopting the methods for submerged macrophytes reported by Dr. Jiang group (Jiang et al., 2019). To measure chlorophyll a and chlorophyll b concentrations, 0.2 g of fresh leaf samples were extracted using 96% ethanol and chlorophyll content was determined using a spectrophotometer at 649 nm and 665 nm. The contents of chlorophyll a and chlorophyll b were calculated according to the method reported by Dr. Wang group (Wang et al., 2008). To measure the MDA content, 0.5 g of fresh leaf samples were placed in liquid nitrogen and then homogenized in 5 mL of 10% (w/v) trichloroacetic acid (TCA). The homogenate was centrifuged at 15,000×g at 4 °C for 5 min and then 2 mL of 20% TCA containing 0.65% (w/v) 2-thiobarbituric acid (TBA) was added to 0.5 mL of the supernatant. The mixture was heated in 95 °C hot water for 80 min and then immediately cooled under flowing water. The absorbance of the supernatant was read at 532 nm and 600 nm. MDA equivalence was calculated according to the methods reported by Dr. Hodges group (Hodges et al., 1999). To extract enzymes, 0.5 g of plant leaf sample was ground in liquid nitrogen and mixed with 5 mL of 50 mm potassium phosphate buffer (PBS, pH of 7.0) containing 1 mM EDTA and 1% polyvinylpyrrolidone (w/v). The mixture was centrifuged at 4 °C for 20 min at 10,000×g, and then the supernatants were used to determine CAT, POD and SOD enzymatic activity using the respective assay kits (XYb science, China) following the manufacturer's instructions. The total chlorophyll, MDA content, and enzyme activities were determined at the end of the experimental period.
2. Materials and methods 2.1. Cultivation of snails and V. natans The snails, Bellamya aeruginosa, were purchased from the Dachang market in Baoshan, Shanghai. Prior to experiments, the snails were cultivated in tap water in the laboratory for 7 days. Snails were maintained without food for 48 h prior to experiments. Before being added into experimental tanks, the snails were washed carefully and then wiped dry with paper and fresh weight was determined. V. natans was purchased from Pudong Tiancun Horticultural Company (Shanghai, China) and cultivated in a container under adaptive conditions of 1/10 Hoagland solution medium. After 10 days of adaptation, most plants exhibited optimum-states. Prior to experiments, healthy plants were selected and cleaned with deionized water. 2.2. Experimental design The experiment was conducted over 24 days in the laboratory from June to July in 2019 under climate-controlled conditions at 28 ± 2 °C between 70 and 90% relatively humidity. Daily 12 h–12 h light-dark cycles were applied at 90 μmol quanta m−2 s−1, measured as photosynthetic photon flux density (PPFD) using a quantum meter (Spectrum Technology, Inc., USA). The experiment was performed with 3 different snail densities of 170 ind. m−2 (low density), 340 ind. m−2 (medium density) and 680 ind. m−2 (high density)), as well as a control group without any added snails (Table 1). The medium density treatment used in this study was comparable to the reported snail density range in natural habitats (Zhu et al., 2013). Newborn snails were removed from the tanks daily and dead snails were also removed from the tank and replaced with new snails. Each treatment was performed in triplicate and therefore, the experiment involved 12 plexiglass containers in total. The plexiglass treatment containers were cylindrical vessels with a height of 400 mm, an outer diameter of 150 mm and wall thickness of
2.4. Observation of biofilm surface 2.4.1. Scanning electron microscopy (SEM) SEM was used to observe the distribution of bacteria and algae in 2
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
growth of submerged macrophytes, which was consistent with the findings of previous studies (Li et al., 2009a; Zheng et al., 2008). Snails can promote the growth of submerged macrophytes through grazing of the periphyton on the surface of macrophytes. In addition, snails can release nutrients into the water, especially nitrogen, improving the concentration of nutrients for the promotion of growth of submerged macrophytes. However, because the sediment applied was silica sand without sufficient organic debris, snails may have occasionally grazed on the roots of submerged macrophytes, resulting in the root length in the treatment groups (T1, T2, T3) decreasing, although there was no significant difference observed among them. The shoot height of submerged macrophytes was slightly reduced during the experiment.
biofilms on the leaf surface. In order to analyze the biofilm, 2.0 cm long sections of V. natans leaves were carefully sampled from middle part of the leaves, cut into 0.8 × 0.8 cm pieces and then fixed in glutaraldehyde (2.5% in 50 mmol/L sodium cacodylate). After rinsing twice with 0.1 M PBS (pH of 7.4), the leaf samples were dehydrated using a series of concentrations of ethanol (20, 40, 60, 80 and 90%) for 15 min and with 100% ethanol twice for 15 min, before the dry samples were observed under SEM. 2.4.2. DNA extraction and the high-throughput sequencing Leaf samples were collected from all three replicate treatments and mixed together. Then 0.5 g fresh leaf samples were collected at the end of the experiment and 20 mL 0.1 mol L−1 PBS solution was added, with the mixture then ultrasonicated for 1 min. Then, the suspension was shaken for 5 min at 25 °C and centrifuged at 10,000×g for 5 min. Sediments were collected and stored at −80 °C for further DNA isolation and analysis. The bacterial DNA on leaf surface was extracted using a Soil DNA Kit (Omega E.Z.N.A, Omega Bio-Tech, Georgia, USA) and high-throughput sequencing was conducted by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China). In this study, the V3–V4 hypervariable region of the 16 S rRNA gene was targeted for amplification using a universal barcoded primer set, 338 F (ACTCCTACGGGAGGCAGCAG) and 806 R (GGACTACHVGGGTWTCTAAT) provided by Majorbio Bio-pharm Technology Co.,Ltd (Shanghai, China). To understand the number of strains and genera in the sequence results per sample, the sequences were clustered into operational taxonomic unit (OTU) groups based on their similarity at the 97% similarity level. Then the taxonomic information was annotated using the SILVA database after subsampling based on the lowest number of reads. These sequences were classified into 876 OTUs. The sequencing data was flattened before conducting species diversity analysis, to ensure that the analysis was carried out on the same data volume and avoid bias due to the difference in the number of sample sequences, increasing the statistical significance of data. The read number in each sample was 28, 843 after flattening. After high-throughput sequencing on the Illumina PE300, microbial community composition and difference analysis and subsequent bioinformatic analysis were performed on the Illumina MiSeq platform. Bioinformatic analysis was used to describe the diversity of microbial communities and to verify the microbial species present (Li et al., 2020b).
3.2. Bacterial communities in V. natans leaf-associated biofilms 3.2.1. SEM images of the leaf surface Most microorganisms exist in the form of biofilms in aquatic environments (Sutherland, 2001). To characterize the morphology of biofilms attached to the leaf surfaces of V. natans, SEM images of the leaf surface were assessed (Fig. 2). Many particles such as bacillus, coccus, other forms of bacteria and organic matter can be observed on the surface of V. natans leaves, which was consistent with previous reports (Li et al., 2020a). The main components of each biofilm were very similar. The biofilms of the CT group visually had more coccus than the groups containing snails, while the groups with snails contained more bacillus than the CT group. 3.2.2. Microbial diversity analysis There is a complex interrelationship between biofilms and the biofilm host. The microbes in biofilms can be affected by both environmental parameters and the distributions of biofilms on the leaves of submerged macrophytes (Zhang et al., 2016). To analyze the microbial diversity in biofilms, the Alpha diversity was employed, referring to the diversity within a particular region or ecosystem, including a series of statistical analysis indexes to estimate species richness and diversity of environmental communities to study microbial diversity in the environment. Several Alpha diversity measures were evaluated using the MiSeq platform including the abundance based coverage estimator (ACE), the Shannon index, Simpson index, the observed richness (sobs), terminal richness estimation (Chao 1) and the Good's coverage estimation (Table S1). The sobs, ACE and Chao 1 values showed that the community richness of microbes in the CT group was higher than in samples from the treatment groups (T1, T2 and T3) and that the community richness of T2 was slightly higher than in T1 or T3. High coverage index values mean a high probability of being measured generally. In this study, the coverage was greater than 0.99 after subsampling based on the lowest number of reads, indicating that these samples reflected the actual community. The Shannon and Simpson index reflect community diversity. The Simpson index value is negatively correlated with community diversity and the Shannon index value is positively correlated with community diversity. The results of this study indicated that the community diversities in CT and T1 groups were higher than that in T2 and T3 groups, with the T2 group being the lowest. So, the grazing of snails decreased the microbial community richness and diversity of biofilms on the surface of macrophytes. Previous experiments have demonstrated that the amount of biofilms on the surface of macrophytes in the presence of snails was lower than that of the absence of snails (Bai et al., 2007; Cao et al., 2014). The result of this study was consistent with the previous experiments.
2.5. Statistical analysis The T test uses the t-distribution theory to infer the probability of differences, to compare whether the difference between the two average values is significant. One-way analysis of variance (ANOVA) was used to compare differences between multiple groups (n ≥ 3) using SPSS 18.0 (IBM, USA). The difference was considered statistically significant at p < 0.05. 3. Results and discussion 3.1. Effect of snail presence and density on growth of V. natans During the experimental period, all of the V. natans specimens remained alive. The fresh weight of V. natans in CT, T2 and T3 groups significantly increased (p < 0.05, Fig. 1(a)) during the experimental period. The fresh weight of V. natans in T1 did not differ significantly. The root length of V. natans in the CT group exhibited a significant increase (p < 0.05, Fig. 1(b)), while the root length in treatment groups (T1, T2 and T3) exhibited a different degree of reduction. The shoot height of V. natans decreased to different degrees (Fig. 1(c)) with shoot height of V. natans in the T1 group significantly decreasing, while shoot height of V. natans in T2 exhibited the least decrease. This study showed that the presence of snails can promote the
3.2.3. Phylum-level and genus-level taxonomic distribution The V3–V4 hypervariable region was assessed to establish the diversity and structure of microbial communities in biofilms on the leaves of submerged macrophytes. The Venn diagram analysis showed that the 3
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 1. Variations of fresh weight (a), root length (b), shoot height (c) of V. natans in four groups. * indicates significant differences at p < 0.05.
4
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 2. SEM images of biofilms attached to leaves of V. natans of CT, T1, T2 and T3groups. ①, cocci aggregates; ②, bacillus aggregates; ③, organic matter or extracellular polymers.
indicated that Proteobacteria was the most common phylum in all groups. But Proteobacteria in the CT group were less abundant than in treatment groups, with the T2 group containing the highest abundance among the four groups. However, Cyanobacteria abundance in T2 and T3 groups were much lower than in the CT group. Snails can reduce biofilms on the surface of the submerged macrophytes, especially Cyanobacteria, due to grazing. Snails have been reported to exhibit feeding preferences to different types of bacteria phyla (Guariento et al., 2009) and snails may have a preference for feeding on cyanobacteria, although this requires further investigation. The decline in Cyanobacteria led to a relative increase in the proportion of Proteobacteria and overall, the grazing of snails changed the composition
biofilm samples contained more than 82.2% of the same bacterial phyla (Fig. S2(a)). Obviously, there was a similar microbial composition in these samples. The community bar plot analysis diagram showed the composition distribution of the 7 most dominant phyla for all samples (Fig. 3(a)). The dominant bacterial phyla in the biofilm samples included Proteobacteria (52.34–84.17%), Cyanobacteria (7.26–31.76%), Bacteroidetes (4.09–5.20%) and Actinobacteria (0.92–5.68%). These bacterial phyla were consistent with the major phyla reported in leadassociated biofilms on submerged macrophytes (Han et al., 2018; Jiang et al., 2019; Li et al., 2020b). In addition, other phyla just occupied a minor percentage (< 5.00%). The stability of biofilms was determined by the main microorganisms on the biofilms (Lv et al., 2014). This study 5
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 3. Microbial community analysis: (a) Percent of community abundance on phylum level; (b) Heatmaps of the bacterial community in top 50 genera based on attached surface.
6
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 4. MDA contents of V. natans in different experiments. The horizontal line in the middle of each box indicates the median value, whiskers that protrude out of the box represent the minimum and maximum values.
distribution of biofilms. Microbial composition analysis was performed at the genus level. A heatmap of the 50 most abundant genera was established, with blue representing high abundance and red representing low abundance genera (Fig. 3(b)). Rhodobacter (11.15%–31.21%) was the most abundant genera in every sample. Norank_f_Leptolyngbyaceae (2.26%–10.47%), Pseudorhodobacter (4.07%–8.39%) and unclassified_f_Sphingomonadaceae (2.85%–4.57%) were also major genera. The proportion of Cyanobium in sample CT was relatively large (11.92%), while in treatment groups its abundance was close to zero. The existence of snails exerted a subtle effect on the microbial community composition. According to the clustering tree, the bacterial composition in samples CT and T1 was generally different from the samples T2 and T3, indicating that the density of snails can influence the microbial community composition. The results of hierarchical clustering analysis also supported the finding that the existence of snails altered the structure of the microbial community of biofilms on V. natans leaves. A distance heatmap showed that the higher densities of snail populations in the treatment group, resulted in a greater deviation from the control group (Fig. S2(b)). Moreover, the distance between T2 and CT was very close to the distance between T3 and CT, indicating that the influence of medium density and high density snail populations on the structure of the microbial community of biofilms was highly similar. Fig. 5. Antioxidant responses of V. natans in different experiment. (a) CAT activity, (b) POD activity, and (c) SOD activity. Columns denote by a different lowercase letter differ significantly by ANOVA at p < 0.05.
3.3. PCoA analysis based on OTUs Beta diversity represents a comparison of the composition of microbial communities and evaluates the difference between microbial communities. The basic output of the comparison is a distance matrix representing the differences between each two samples in the community. The Beta diversity was evaluated by PCA and the results are illustrated in Fig. S3. The principal components PC1 and PC2 explained 49.49% and 27% of variation in microbial community composition, respectively. The closer the two sample points are, the more similar the species composition is and the samples were divided into three distinct groups (group A: CT, group B: T1 and T2, group C: T3). The existence of snails (group A vs group B and group C) had a major influence on the microbial community structure. The separation of group B and C indicated that the density of the snail populations can also influence the microbial community.
3.4. Effect of snails on membrane lipid peroxidation and the antioxidant defense system of V. natans leaves Various stress factors can induce reactive oxygen species in plant leaves, while MDA can be produced from polyunsaturated fatty acid oxidation as a secondary end product, due to an excess of reactive oxygen species (Gunes et al., 2007; Janero, 1990). The MDA content in treatment groups was slightly lower than that in the control group, indicating that the existence of snails did not cause oxidative damage within the leaves of submerged macrophytes (Fig. 4). SOD dismutase superoxide generates H2O2, which can be decomposed to water and oxygen by the activities of CAT and POD (Wang et al., 2008). The CAT and POD content in the T2 group were slightly lower than in other groups, while there were no significant differences 7
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Fig. 6. Effects of snails of different densities on Fv/Fm and Chlorophyll of V. natans leaves. Different characters indicate significant difference (p < 0.01).
such as microcystin-LR to inhibit photosynthesis of V. natans leaves (Jiang et al., 2019; Pflugmacher, 2002; Yin et al., 2005). The total chlorophyll content (chlorophyll a + b) can represent the absorption of light energy by plants. The total chlorophyll content of the V.natans in T2 group was the highest, meaning they could absorb most light energy. It was consistent with the conclusion that the reduction of biofilm and cyanobacteria on the surface of V.natans promoted the absorption of light energy. There was no significant difference in chlorophyll a and Fv/Fm between the groups, indicating that there was no significant difference in light energy conversion efficiency. The grazing of snails could reduce the biofilm and decrease cyanobacteria proportion on leaf surface. The decrease in competitive pressure results in an increase in chlorophyll content in leaves and the enhancement of photosynthetic capacity.
in SOD, CAT and POD between groups (Fig. 5). Overall, these results indicate that the existence of snails did not induce more oxidative stress in submerged macrophytes, causing them to consume more energy for biosynthesis of these enzymes. 3.5. Effect of snails on photosynthesis of V. natans The Fv/Fm ratio of V. natans leaves was remained generally stable in the middle and late stage of the experimental period and different densities of snails did not affect the Fv/Fm ratio of V. natans (Fig. 6(a)). However, the chlorophyll content in leaves varied different under different treatment conditions. At the end of the experimental period, the chlorophyll contents of the leaves in the treatment groups (T1, T2, T3) were higher than the control group and the chlorophyll content was highest in the T2 group (Fig. 6(b)). The growth of biofilms can have negative impacts on plant cells (Gong et al., 2018). For example, the increase in biofilm area can directly lead to a decrease in the intensity of light available on the leaves (Phillips et al., 1978) and the cyanobacteria can release allelochemicals
3.6. Changes of water quality parameters PH, TOC, TN and TP concentrations under different treatment conditions were shown in Fig. S3. During the experimental period, the 8
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Acknowledgements
pH value in every treatment was increased slowly. The pH value in water varied with the density of snail populations, with higher the densities of the snail populations, resulting in the lower water pH values. However, the pH value in all treatment groups was greater than 7.0. The initial concentrations of TP and TN in all treatment groups were 0.213 ± 0.004 mg L−1 and 2.03 ± 0.07 mg L−1 respectively. At the end of experimental period, the concentrations of TP in CT, T1, T2, and T3 were 0.022, 0.031, 0.047 and 0.064 mg L−1, respectively, while the TP removal efficiencies were 89.7%, 85.4%, 77.9% and 70.0%, respectively. After the fourth day of the experimental period, the concentration of TN in different treatment groups decreased slowly. At the end of the experiment, the concentrations of TN in CT, T1, T2 and T3 were 0.39, 0.54, 1.05 and 2.57 mg L−1. After 24 days, the removal efficiencies of TN in CT, T1 and T2 were 80.8%, 73.4% and 48.3% respectively, while the concentration of TN in T3 was higher than the initial concentration. Snails can exchange nutrients with the water environment through metabolism and release nutrients into water, which is consistent with the findings of previous studies (Li et al., 2009a; Wang et al., 2017). This study showed that a higher density of snail population, resulted in a lower the pH value and higher TP and TN concentrations. V. natans could effectively absorb nitrogen, phosphorus and other nutrients from the water, reducing the content of nutrients in water, while the presence of snails will reduce the removal rate of nutrients in water by secreting and excreting substances. To further evaluate this point, the TOC concentration in water was measured, showing that the TOC concentration in the control group remained almost unchanged. In contrast, the TOC concentration in T1 increased slowly over time, while the TOC concentrations in T2 and T3 groups were significantly increased. This demonstrated that snails released material into water during the experimental period. In the treatment groups, the rate of TP decrease was lower than that of TP, because the content of phosphorus in the nutrients released by snails was very low, while the content of nitrogen was relatively high. These experimental results were consistent with the reported findings of two references (Li et al., 2009b; Zheng et al., 2008).
The study was supported by the Major Science and Technology Program for Water Pollution Control and Treatment (2012ZX07103004, 2017ZX07204005). Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.ecoenv.2020.110373. References Bai, X., Gu, X., Zhang, Y., 2007. The effects of Bellamya sp. on the growth of two submerged macrophytes in Lake Taihu. J. Lake Sci. 19 (1), 98–102. Cao, Y., Li, W., Jeppesen, E., 2014. The response of two submerged macrophytes and periphyton to elevated temperatures in the presence and absence of snails: a microcosm approach. Hydrobiologia 738 (1), 49–59. Chen, X., Chuai, X., Yang, L., 2014. Historical evolution and causes of eutrophication in lakes in typical lake regions of China. J. Ecol. Rural Environ. 30 (4), 438–443. Drake, L.A., Dobbs, F.C., 2003. Effects of epiphyte load on optical properties and photosynthetic potential of the seagrasses Thalassia testudinum Banks ex Konig and Zostera marina L. Limnol. Oceanogr. 48 (1), 456–463. Gao, Y., Dong, J., He, Y., Ge, F., Liu, B., Wu, Z., 2016. Research advances on the modes of action for allelopathic algal inhibition by submerged macrophytes based on the release characteristics of allelochemicals. Acta Hydrobiol. Sin. 40 (6), 1287–1294. Gong, L., Zhang, S., Chen, D., Liu, K., Lu, J., 2018. Response of biofilms-leaves of two submerged macrophytes to high ammonium. Chemosphere 192, 152–160. Gross, E.M., Hllt, S., Lombardo, P., Mulderij, G., 2007. Searching for allelopathic effects of submerged macrophytes on phytoplankton—state of the art and open questions. Hydrobiologia 584 (1), 77–88. Guariento, R.D., Caliman, A., Esteves, F.A., Bozelli, R.L., Enrich-Prast, A., Farjalla, V.F., 2009. Substrate influence and temporal changes on periphytic biomass accrual and metabolism in a tropical humic lagoon. Limnologica 39 (3), 209–218. Gunes, A., Guneri, E., Bagci, E.G., Coban, S., Sahin, O., 2007. Silicon increases boron tolerance and reduces oxidative damage of wheat grown in soil with excess boron. Biol. Plantarum 51 (3), 571–574. Han, B., Zhang, S.H., Wang, P.F., Wang, C., 2018. Effects of water flow on submerged macrophyte-biofilm systems in constructed wetlands. Sci. Rep. 8 (1). He, H., He, Y., Ji, Y., Guo, L., Liu, Z., Li, K., 2012. Effects of cyanobacterial accumulation and snail grazing on the growth of Vallisneria natans. Acta Hydrobiol. Sin. 32 (17), 5562–5567. Hilt, S., Gross, E.M., 2008. Can allelopathically active submerged macrophytes stabilise clear-water states in shallow lakes? Basic Appl. Ecol. 9 (4), 422–432. Hodges, D.M., Delong, J.M., Forney, C.F., Prange, R.K., 1999. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 207 (4), 604–611. Hough, R.A., Fornwall, M.D., Negele, B.J., Thompson, R.L., Putt, D.A., 1989. Plant community dynamics in a chain of lakes principal factors in the decline of rooted macrophytes with eutrophication. Hydrobiologia 173 (3), 199–217. Huang, Y., Fu, Y., Zhao, J., 2005. Research progress on mechanisms of phytoremediation for eutrophic water. Journal of Agro-Environment Science 24, 379–383. Janero, D.R., 1990. Malondialdehyde and thiobarbituric acid-reactivity as diagnostic indices of lipid peroxidation and peroxidative tissue injury. Free Radic. Biol. Med. 9 (6), 515–540. Jiang, M., Zhou, Y., Wang, N., Xu, L., Zheng, Z., Zhang, J., 2019. Allelopathic effects of harmful algal extracts and exudates on biofilms on leaves of Vallisneria natans. Sci. Total Environ. 655, 823–830. Jones, J.I., Young, J.O., Eaton, J.W., Moss, B., 2002. The influence of nutrient loading, dissolved inorganic carbon and higher trophic levels on the interaction between submerged plants and periphyton. J. Ecol. 90, 12–24. Li, F., Chu, S., Cui, L., Xiao, J., 2018. Research advances on the influence mechanisms of submerged plants growth and decomposition on nitrogen and phosphorus in eutrophic water. Ecological Science 37, 225–230. Li, H., Li, Q., Luo, X., Fu, J., Zhang, J., 2020a. Responses of the submerged macrophyte Vallisneria natans to a water depth gradient. Sci. Total Environ. 701, 134944. Li, K., Liu, Z., Gu, B., 2009a. Density-dependent effects of snail grazing on the growth of a submerged macrophyte, Vallisneria spiralis. Ecol. Complex. 6 (4), 438–442. Li, K., Liu, Z., Hu, Y., Yang, H., 2009b. Snail herbivory on submerged macrophytes and nutrient release: implications for macrophyte management. Ecol. Eng. 35 (11), 1664–1667. Li, Q., Gu, P., Zhang, H., Luo, X., Zhang, J., Zheng, Z., 2020b. Response of submerged macrophytes and leaf biofilms to the decline phase of microcystis aeruginosa: Antioxidant response, ultrastructure, microbial properties, and potential mechanism. Sci. Total Environ. 699, 134325. Lv, Y., Wan, C., Lee, D., Liu, X., Tay, J., 2014. Microbial communities of aerobic granules: granulation mechanisms. Bioresour. Technol. 169, 344–351. Michael, T.S., Shin, H.W., Hanna, R., Spafford, D.C., 2008. A review of epiphyte community development surface interactions and settlement on seagrass. J. Environ. Biol. 29, 629–638. Pan, G., Yang, B., Wang, D., Chen, H., Tian, B., Zhang, M., Yuan, X., Chen, J., 2011. Inlake algal bloom removal and submerged vegetation restoration using modified local
4. Conclusions The response of V. natans to snail populations of different densities was investigated in this study. The existence of snails could affect V. natans growth status including fresh weight, shoot height, root length and chlorophyll content. Snails effectively changed the microbial community structure in biofilms of leaves, and the influence of different density snail populations on the structure varied. The existence of snails was beneficial to the growth of submerged macrophytes. Under the medium density populations, the increase in snail density was beneficial to the growth of submerged macrophytes. The change in snail density from the medium density to high density populations had no significant effect on the growth of submerged plants. This study provides useful information for understanding how snails affect the growth of submerged macrophytes. CRediT authorship contribution statement Hao Zhang: Investigation, Data curation, Formal analysis, Writing original draft. Xin Luo: Investigation, Resources. Qi Li: Data curation, Writing - review & editing. Suzhen Huang: Formal analysis. Ning Wang: Writing - review & editing. Denghua Zhang: Resources. Jibiao Zhang: Conceptualization, Methodology. Zheng Zheng: Supervision. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. 9
Ecotoxicology and Environmental Safety 194 (2020) 110373
H. Zhang, et al.
Yin, L., Huang, J., Li, D., Liu, Y., 2005. Microcystin-RR uptake and its effects on the growth of submerged macrophyte Vallisneria natans (lour.) Hara. Environ. Toxicol. 20 (3), 308–313. Zhang, S., Pang, S., Wang, P., Wang, C., Guo, C., Addo, F.G., Li, Y., 2016. Responses of bacterial community structure and denitrifying bacteria in biofilm to submerged macrophytes and nitrate. Sci. Rep. 6. Zhao, J., Yang, Y., Zhong, S., Li, K., Chen, X., 2016. Simulation on rural water purification effect and mechanism with submerged macrophytes' sink. J. Lake Sci. 28, 1274–1282. Zhao, Y., Deng, X., Zhan, J., Xi, B., Lu, Q., 2010. Progress on preventing and controlling strategies of lake eutrophication in China. Environ. Sci. Technol. 33, 92–98. Zhao, Z., Qin, Z., Xia, L., Zhang, D., Hussain, J., 2018. Dissipation characteristics of pyrene and ecological contribution of submerged macrophytes and their biofilmsleaves in constructed wetland. Bioresour. Technol. 267, 158–166. Zheng, Y., Wen, M., Li, K., Wang, H., 2008. Effects of Bellamya sp. on the growth of Vallisneria natans in lake taihu. Res. Environ. Sci. 21 (4), 94–98. Zhu, J., Liu, B., Wang, J., Gao, Y., Wu, Z., 2010. Study on the mechanism of allelopathic influence on cyanobacteria and chlorophytes by submerged macrophyte (Myriophyllum spicatum) and its secretion. Aquat. Toxicol. 98 (2), 196–203. Zhu, J., Lu, K., Liu, X., 2013. Can the freshwater snail Bellamya aeruginosa (Mollusca) affect phytoplankton community and water quality? Hydrobiologia 707 (1), 147–157.
soils. Ecol. Eng. 37 (2), 302–308. Pflugmacher, S., 2002. Possible allelopathic effects of cyanotoxins, with reference to microcystin-LR, in aquatic ecosystems. Environ. Toxicol. 17 (4), 407–413. Phillips, G.L., Eminson, D., Moss, B., 1978. A mechanism to account for macrophyte decline in progressively eutrophicated freshwaters. Aquat. Bot. 4, 103–126. Seto, M., Takamura, N., Iwasa, Y., 2013. Individual and combined suppressive effects of submerged and floating-leaved macrophytes on algal blooms. J. Theor. Biol. 319, 122–133. Song, X., Wang, Z., Xiao, B., Li, E., Wang, X., 2017. Growth of Potamogeton crispus L. from turions in darkness: implications for restoring submerged plants in eutrophic lakes. Ecol. Eng. 101 255-230. Sutherland, I.W., 2001. The biofilm matrix – an immobilized but dynamic microbial environment. Trends Microbiol. 9 (5), 222–227. Wang, C., Zhang, S., Wang, P., Hou, J., Li, W., Zhang, W., 2008. Metabolic adaptations to ammonia-induced oxidative stress in leaves of the submerged macrophyte Vallisneria natans (Lour.) Hara. Aquat. Toxicol. 87 (2), 88–98. Wang, Q., Zhi, Y., Jiang, H., Cao, Y., Li, W., 2017. Effects of different initial snail densities on submerged macrophyte Vallisneria spinulosa Yan and its epiphyton. Plant Sci. J. 35 (5), 741–749. Xiao, X., Lou, L., Li, H., Chen, Y., 2009. Algal control ability of allelopathically active submerged macrophytes: a review. Chinese J. Appl. Eccol 20 (3), 705–712.
10