Rho kinase regulates fragmentation and phagocytosis of apoptotic cells

Experimental Cell Research 312 (2006) 5 – 15 www.elsevier.com/locate/yexcr

Research Article

Rho kinase regulates fragmentation and phagocytosis of apoptotic cells Kelly A. Orlando a, Nicole L. Stone b, Randall N. Pittman a,* a

Department of Pharmacology, University of Pennsylvania, 3620 Hamilton Walk, Philadelphia, PA 19104, USA b GlaxoSmithKline, 1250 S. Collegeville Rd., Collegeville, PA 19426, USA Received 29 August 2005, revised version received 19 September 2005, accepted 21 September 2005 Available online 2 November 2005

Abstract During the execution phase of apoptosis, a cell undergoes cytoplasmic and nuclear changes that prepare it for death and phagocytosis. The end-point of the execution phase is condensation into a single apoptotic body or fragmentation into multiple apoptotic bodies. Fragmentation is thought to facilitate phagocytosis; however, mechanisms regulating fragmentation are unknown. An isoform of Rho kinase, ROCK-I, drives membrane blebbing through its activation of actin – myosin contraction; this raises the possibility that ROCK-I may regulate other execution phase events, such as cellular fragmentation. Here, we show that COS-7 cells fragment into a number of small apoptotic bodies during apoptosis; treating with ROCK inhibitors (Y-27632 or H-1152) prevents fragmentation. Latrunculin B and blebbistatin, drugs that interfere with actin – myosin contraction, also inhibit fragmentation. During apoptosis, ROCK-I is cleaved and activated by caspases, while ROCK-II is not activated, but rather translocates to a cytoskeletal fraction. siRNA knock-down of ROCK-I but not ROCK-II inhibits fragmentation of dying cells, consistent with ROCK-I being required for apoptotic fragmentation. Finally, cells dying in the presence of the ROCK inhibitor Y-27632 are not efficiently phagocytized. These data show that ROCK plays an essential role in fragmentation and phagocytosis of apoptotic cells. D 2005 Elsevier Inc. All rights reserved. Keywords: Rho kinase; ROCK; Fragmentation; Apoptotic body; Execution phase; Apoptosis; Phagocytosis; Actin; Myosin; Cytoskeleton

Introduction Apoptosis is characterized by activation of pathways leading to systematic cell death through processes including cleavage of key cellular proteins, DNA fragmentation, surface expression of phagocytic markers, and formation of apoptotic bodies able to be phagocytized [1– 5]. Most of these changes occur during the execution phase of apoptosis. The execution phase consists of three morphological stages: the release stage, the blebbing stage, and the condensation stage [6]. During the release stage, cells detach from the extracellular matrix and become rounded.

Abbreviations: ROCK, Rho kinase; MLC, regulatory myosin light chain; PMA, phorbol 12-myrisate 13-acetate; BIM, bisindolylmaleimide; FITC, fluorescein isothiocyanate; PS, phosphatidylserine; GlcNAc, Nacetyl glucosamine. * Corresponding author. Fax: +215 573 2236. E-mail address: [email protected] (R.N. Pittman). 0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2005.09.012

During the blebbing stage, actin – myosin contraction coupled with focal loss of attachment of the cytoskeleton to the cell membrane appears to cause membrane blebbing [7 –9]. During the condensation stage, cells condense into a single apoptotic body or fragment into a number of small apoptotic bodies; little is known about the mechanism regulating fragmentation/apoptotic body formation although the actin cytoskeleton appears to be involved [10,11]. The overall function of the execution phase of apoptosis is to package apoptotic cells into corpses that can be recognized by phagocytes and properly cleared from the surrounding tissue [1,6]. Two isoforms of Rho kinase, ROCK-I and ROCK-II, have been identified as serine/threonine kinase effectors of Rho [12 – 14]. ROCK-I plays a role in the execution phase of apoptosis, through its control of membrane blebbing [15,16]. Membrane blebbing is regulated by the phosphorylation of the regulatory myosin light chain (MLC) of myosin II, which drives actin – myosin contraction [7,9].

6

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

ROCK-II also regulates MLC phosphorylation, either directly or by inhibiting myosin phosphatase [17,18]. There is over 90% homology between the two isoforms in the kinase domain, so it is thought that both isoforms of ROCK regulate MLC phosphorylation similarly [19]. ROCK-I and ROCK-II both consist of an N-terminal kinase domain and a C-terminal Rho binding domain; expression of the C-terminal domain alone negatively regulates ROCK activity [13,20]. Therefore, it is suggested that the C-terminal domain binds to and inhibits the kinase domain; when Rho binds, it causes the C-terminal domain to release the kinase domain, allowing ROCK to phosphorylate target proteins [21,22]. During apoptosis, ROCK-I is cleaved at a consensus caspase cleavage site, DETD1113^G [15,16]. This cleavage removes the Cterminal inhibitory domain, creating a constitutively active kinase. Inhibition of caspase activity blocks ROCK-I cleavage and membrane blebbing; expression of a truncated form of ROCK-I that lacks the C-terminal domain in cells drives membrane blebbing [15,16]. The ultimate goal of apoptosis is to package the dying cell so that it is rapidly cleared by phagocytosis. The constitutive activation of ROCK-I during execution and its regulation of the cytoskeleton make it a likely candidate to play a role in preparing apoptotic corpses for phagocytosis. An initial study by Shiratsuchi et al. [23] suggested that ROCK is required for membrane blebbing but not for phagocytosis of Jurkat cells. However, there are many factors that regulate the ability of dying cells to be phagocytized. For example, dying cells express a number of different surface markers for phagocytosis [24 –26]. In addition, many cells shrink during condensation, and some cells fragment into small apoptotic bodies [1,2,27]. It is hypothesized that the size of the apoptotic corpse should affect its ability to be phagocytized [6,26]. To determine if ROCK plays a role in preparing corpses for phagocytosis and its potential role in regulating cell fragmentation/apoptotic body formation, we used COS-7 cells, which fragment into a number of small apoptotic bodies during apoptosis. Inhibiting ROCK prevents fragmentation and decreases phagocytosis of apoptotic corpses. siRNA ‘‘knock-down’’ of ROCK-I but not ROCK-II inhibits fragmentation. These data indicate that endogenous ROCK plays a fundamental role in the execution phase of apoptosis and prepares apoptotic corpses for phagocytosis.

Materials and methods Materials and chemicals Camptothecin, tamoxifen, Hoechst 33342, FITC, and phorbol 12-myrisate 13-acetate (PMA) were obtained from Sigma (St. Louis, MO). ZVAD-fmk, Y-27632, latrunculin B, blebbistatin, bisindolylmaleimide (BIM), H-1152, and his-

tone H1 were obtained from Calbiochem (San Diego, CA). ROCK-I, ROCK-II, and myc antibodies were obtained from BD Biosciences (San Jose, CA); ROCK-II antibody used for translocation experiments was obtained from Santa Cruz Biotechnology (Santa Cruz, CA), and the antibody against caspase-cleaved ROCK was obtained from Imgenex (San Diego, CA). GAPDH antibody was obtained from Advanced Immunochemical (Long Beach, CA). pCAG-mycp160ROCK (ROCK-I) vector was provided by Shuh Narumiya and pEF-BOS-myc-Rho kinase (ROCK-II) by Kozo Kaibuchi. ROCK-I siRNA was obtained from Genscript Corp (Piscataway, NJ); ROCK-I (ATAGACAAGAGATTACAGA) or scrambled (ACATTGAAGCGAAGAATAA) sequences were inserted into the siRNA expression vector pRNATin-H1.2/Neo, which expresses the siRNA as well as GFP. The control siRNA used was a sequence designed by Genscript as a negative control and expressed in the pRNA-H1.1/Neo vector. A vector expressing ROCK-II siRNA (CGTCGACCTTAGATTGTTATC) was obtained from Upstate Cell Signaling Solutions (Lake Placid, NY) (pKD-ROKa/ROCK-II-v4). Blebbing, fragmentation, and cell death COS-7 and Rat-1 cells were grown in DMEM with 10% FBS containing penicillin/streptomycin. PC12 cells were grown in RPMI with 10% horse serum and 5% FBS containing penicillin/streptomycin. Cells were considered blebbing if dynamic blebs extended and retracted and were considered condensed if there was no motile activity (timelapse videomicroscopy verified this multiple times). For Fig. 1, COS-7 cells were treated with 60 uM tamoxifen, PC12 cells were serum deprived, and Rat-1 cells were treated with 18 uM camptothecin. For quantification of COS-7 cell fragmentation, control plates were treated with vehicle. Cells were pre-treated with inhibitors 30 min before induction of apoptosis with 60 uM tamoxifen. The percent of fragmenting cells was determined by counting total and fragmenting cells. For each experiment, at least 200 cells were counted per condition, under blinded conditions. ROCK-I/-II immunoblots and kinase assays Apoptotic cells were scraped, centrifuged at 15,000  g, and resuspended in lysis buffer (20 mM Tris – HCl, pH 8, 0.1% NP-40, 150 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, 1 mM PMSF, 5 ng/ml aprotinin, 5 ng/ml leupeptin, and 1 Ag/ml pepstatin). Samples were sonicated, centrifuged at 15,000  g, and equal protein concentrations of the supernatant were loaded onto a 7.5% SDS-PAGE gel. Protein was transferred to PVDF membrane (NEN Life Science Products) and blocked with 5% milk in PBS containing 0.1% Triton-X-100 (PBST) for 1 h. Membranes were incubated overnight with primary antibodies in milk at 4-C, washed with PBST, incubated for 40 min with HRP-

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

7

Fig. 1. Some apoptotic cells condense into a single apoptotic body, while others fragment into multiple apoptotic bodies. Blebbing is characterized by dynamic extension and retraction of blebs observed in real time or time-lapse videomicroscopy, while condensation is characterized by the absence of all motile activity. The insets contain magnified pictures of cells marked with white arrows.

conjugated secondary antibodies, and visualized by enhanced luminescence (Western Lightning). For ROCK kinase assays, cells were transfected with myc-ROCK-I or myc-ROCK-II in a 100-mm dish using Fugene 6 transfection reagent and split into 12 dishes (100 mm) after 4 h (4 dishes per condition). 24 h after transfection, cells were treated with 60 uM tamoxifen T 100 uM ZVADfmk; after 1 –2 h, cells were scraped, pelleted, and resuspended in lysis buffer. Samples were centrifuged at 15,000  g, 10% was removed from supernatants for inputs, and the rest was divided equally into two tubes. 1 Ag myc antibody was added to one tube, and an equal amount of control IgG was added to the other tube; samples were rotated overnight at 4-C, then magnetic Protein G Dynabeads (Dynal Biotech, Oslo, Norway) were added. The following day, the beads were washed three times in lysis buffer, two times in kinase buffer (50 mM Tris pH 7.5, 1 mM EDTA, 10 mM MgCl2, 50 mM NaCl, 1 mM DTT, and 0.03% Brij 35), and resuspended in 30 Al kinase buffer containing 10 uM ATP, 50 ng/Al histone H1 and 135 nCi/Al 32P-ATP. Samples were incubated for 30 min at 30-C, an equal volume of 4 Laemmli’s buffer was added to stop the reaction, and samples were run on a 15% gel. Kinase activity was quantified using a Phosphorimager; the density of each band was quantified using ImageQuant. Values from IgG-immunoprecipitated samples were subtracted from myc-immunoprecipitated values and expressed as arbitrary units.

mM NaF, 10 mM h-glycerophosphate, 5 mM Na pyrophosphate, 0.2 mM Na orthovanadate, 0.2 mM PMSF, 2 mM DTT, 0.1 uM calyculin A) for 30 min on ice, and centrifuged at 13,000  g for 10 min. The supernatant was removed (Triton-soluble fraction), and the pellet was resuspended in 2 Laemmli’s buffer (Triton-insoluble fraction). The Triton-insoluble fraction was sonicated briefly. Equal amounts of protein were electrophoresed on a 7.5% SDS gel and blotted for ROCK-II. Quantification of blots was performed using ImageQuant software.

ROCK-II translocation

Phagocytosis assay

Apoptotic COS-7 cells were lysed (25 mM HEPES, pH 7.6, 0.1% Triton-X-100, 300 mM NaCl, 1.5 mM MgCl2, 25

THP-1 cells were grown in RPMI with 10% FBS, 2 mM glutamine, and gentamicin, and differentiated for 24 – 48 h

SiRNA transfections COS-7 or HEK293T cells were transfected using Fugene 6; for ROCK-I, cells were transfected with a vector expressing both GFP and an siRNA specific for ROCK-I or a scrambled sequence; for ROCK-II, cells were cotransfected (1:3 ratio) with GFP and a vector containing siRNA specific for ROCK-II or siRNA containing a control siRNA sequence. 293T cells were collected after 72 h, run on 7.5% gels, and blotted for ROCK-I, ROCK-II, or GAPDH as a loading control. For COS-7 cells, 24 h after transfection, cells were split 1:2, 48 h after transfection, cells were treated with 60 uM tamoxifen for 1 to 2 h, and the number of green cells that were fragmented was counted versus total green cells. At least 200 cells were counted for each condition per experiment, under blinded conditions.

8

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

prior to phagocytosis assays by treating with 10 nM phorbol 12-myrisate 13-acetate (PMA). Apoptotic floating cells and cells detached by a gentle stream of medium were labeled with fluorescein isothiocyanate (FITC) according to the previously described procedure [28]. Following centrifugation, pelleted cells/fragments were rinsed one time in serumfree RPMI and incubated with 10 Ag/ml FITC in serum-free RPMI in the dark at 37-C for 30 min. Cells/fragments were pelleted and washed one time in serum-free RPMI. Cells/ fragments were resuspended in serum containing RPMI at a concentration of 107 cells/ml, and 50 Al was added to glass bottom wells (MatTek Corporation) containing differentiated THP-1 cells. In some experiments, FITC labeled apoptotic cells were triturated to fragment cells prior to adding to THP1 culture. Incubations were carried out for 1 h at 37-C in a 5% CO2 incubator followed by rinsing one time in serum-free RPMI and then incubating cells with 0.4% trypan blue in PBS for 15 min, rinsed in PBS, fixed with 2% paraformaldehyde, rinsed in water, and examined. Phagocytosis was quantified by determining the total number of THP-1 cells and the number of cells containing intracellular fluorescence in 4 fields per well and two wells for each condition in each experiment, under blinded conditions.

Results Actin –myosin contraction regulates fragmentation of dying cells into apoptotic bodies While most/all apoptotic cells undergo membrane blebbing during the execution phase of apoptosis, only a subset of cells fragment into multiple apoptotic bodies during condensation [6]. For example, although COS-7, Rat-1, and PC12 cells all bleb during apoptosis, PC12 and Rat-1 cells condense into one apoptotic body, while COS-7 cells fragment into a number of smaller apoptotic bodies (Fig. 1). Therefore, fragmentation into multiple apoptotic bodies is not simply the end product of membrane blebbing. In addition, apoptotic body formation appears to be dependent on the cell type rather than the agent used to initiate apoptosis (Table 1). Mechanisms regulating fragmentation have not been defined other than the potential role of actin in this process in HL-60 and 143B cells [10,11]. To determine if actin microfilaments are necessary for fragmentation of COS-7 cells, apoptotic cells were treated with latrunculin B, an inhibitor of actin polymerization. Inhibiting actin polymerization blocks fragmentation (Figs. 2A, B). To determine if actin –myosin contraction is necessary for fragmentation, apoptotic cells were treated with the myosin II inhibitor blebbistatin. Inhibiting actin –myosin contraction with blebbistatin also blocks fragmentation of dying COS-7 cells (Figs. 2A, C). Therefore, actin – myosin contraction is necessary for fragmentation of dying COS-7 cells into multiple apoptotic bodies.

Table 1 Condensation into a single apoptotic body or multiple apoptotic bodies is dependent on the cell type rather than the agent used to initiate apoptosisa Cell line

COS-7

PC12

Rat-1

Apoptotic induction

Serum withdrawal Camptothecin Tamoxifen UV Serum withdrawal Camptothecin Tamoxifen UV Serum withdrawal Camptothecin Tamoxifen UV

Condensation/Fragmentation Single apoptotic body

Multiple apoptotic bodies + + +

No cell death + + Necrosis + + + Necrosis +

a

Condensation into a single apoptotic body/multiple apoptotic bodies was observed following treatment of cells with indicated apoptotic inducers. Camptothecin was used at 18 uM, tamoxifen at 60 uM, and UV at 100 Joules/M2.

ROCK regulates fragmentation into apoptotic bodies ROCK appears to play a critical role in initiating and maintaining membrane blebbing, through its control of actin –myosin contraction [15,16]. A key issue is whether ROCK also functions in other execution events. Since actin – myosin contraction is necessary for apoptotic fragmentation, it is possible that ROCK also regulates fragmentation. In apoptotic COS-7 cells, as seen in other cell types, ROCK-I is cleaved to form a 130-kDa band, which corresponds to caspase-cleaved ROCK-I; this was further verified using an antibody against the neoepitope generated following cleavage at the DETD1113^G caspase-cleavage site (Fig. 3). ROCK-I cleavage is blocked by the pan-caspase inhibitor Z-VAD-fmk, but not by the ROCK inhibitors Y-27632 or H-1152 (Fig. 3). In contrast, ROCK-II is not cleaved during apoptosis (Fig. 3). To determine if ROCK has a role in fragmentation, the effect of the ROCK inhibitor, Y-27632, on apoptotic COS-7 cells was investigated. Y-27632 has a striking effect on the morphology of COS-7 corpses. Apoptotic COS-7 cells normally fragment into a number of small apoptotic bodies; however, they condense into a single large apoptotic body when treated with Y-27632 (Figs. 4A –C). In addition, another ROCK inhibitor, H-1152, also blocks fragmentation of COS-7 cells into apoptotic bodies (Figs. 4B, C), while the PKC inhibitor, BIM, does not affect fragmentation (Fig. 4B). Both Y-27632 and H-1152 show a dose-dependent decrease in fragmentation (Fig. 4C). As previously observed for NIH 3T3 and Jurkat cells [15,16], Y-27632 has no effect on the time course of apoptosis of COS-7 cells; therefore, decreased fragmentation is not due to a delay in cell death (Fig. 5).

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

9

Fig. 2. Drugs that block actin – myosin contraction inhibit fragmentation. Cells were treated with 60 uM tamoxifen to induce apoptosis in the presence or absence of 5 uM latrunculin B or 50 uM blebbistatin, and cells were stained with Hoechst 33342 to detect condensed chromatin. (A, B) Inhibiting actin polymerization with latrunculin B decreases fragmentation. Data represents mean T SEM of 4 experiments. (A, C) Inhibiting myosin II activity with blebbistatin decreases fragmentation. Data represent mean T SEM of 3 experiments; *P < 0.05.

ROCK-I, but not ROCK-II, is activated during apoptosis and is necessary for fragmentation into apoptotic bodies

Fig. 3. ROCK-I is cleaved in apoptotic COS-7 cells by caspases. Apoptosis was induced by treating with 60 uM tamoxifen in the presence or absence of Y-27632, H-1152, or the pan-caspase inhibitor ZVAD-fmk at the indicated concentrations. Lysates were blotted for ROCK-I, ROCK-II, or an antibody that recognizes the neoepitope formed when ROCK-I is cleaved by caspase at its DETD1113^G site (caspase-cleaved ROCK-I). Intact ROCK-I and ROCK-II migrate at approximately 160 kDa, cleaved ROCK-I migrates at 130 kDa, and the caspase-cleaved ROCK-I antibody recognizes a 30-kDa fragment.

ROCK-I is cleaved by caspases during apoptosis in several cell types including COS-7 cells (Fig. 3), and the constitutively active kinase is known to drive membrane blebbing; therefore, ROCK-I may control fragmentation as well. However, this does not preclude a possible role of ROCK-II in fragmentation. To determine if ROCK isoforms are activated during apoptosis, COS-7 cells were induced to undergo apoptosis, and the kinase activity of each of the isoforms was measured. ROCK-I kinase activity increases during apoptosis, and this increase is blocked by the pancaspase inhibitor Z-VAD-fmk (Fig. 6A). In contrast, ROCK-II kinase activity is not altered during apoptosis (Fig. 6B). The fact that ROCK-II activity did not increase in this assay does not rule out the possibility that it is involved in apoptotic fragmentation. Localization of ROCK-II could be altered by Rho; Rho binding to ROCK-II causes translocation toward the cell periphery, which could bring it closer to its cytoskeletal targets [12,13,29]. In addition, ROCK-II translocates to a Triton-insoluble cytoskeletal fraction in cells expressing active Rho [29] and in smooth

10

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

Fig. 4. ROCK regulates fragmentation of COS-7 cells and formation of apoptotic bodies. Apoptosis was induced by treating with 60 uM tamoxifen, and cells were stained with Hoechst 33342 to detect condensed chromatin. (A) Y-27632 inhibits fragmentation and formation of small apoptotic bodies. The insets contain magnified pictures of cells marked with white arrows. (B) Inhibiting ROCK with Y-27632 or H-1152 decreases fragmentation, while the PKC inhibitor, BIM, does not alter fragmentation. Data represents mean T SEM of 3 experiments. *P < 0.05. (C) Y-27632 and H-1152 inhibit fragmentation in a dosedependent manner. Data represent mean T SEM of 3 experiments.

muscle after muscarinic agonist stimulation [30]. Therefore, it is possible that ROCK-II may phosphorylate key substrates during apoptosis, which would not be detected in a traditional kinase assay. To determine if ROCK-II translocates to a cytoskeletal fraction during apoptosis, Triton-soluble and -insoluble fractions were examined from control and apoptotic cells. A significantly greater amount of ROCK-II is present in the Triton-insoluble cytoskeletal

fraction of apoptotic cells compared to control cells (Figs. 7A, B). Therefore, translocated ROCK-II may also play a role in apoptotic fragmentation. To determine which ROCK isoform is involved in apoptotic fragmentation, siRNA was used to decrease ROCK-I or ROCK-II. ROCK-I siRNA decreases ROCK-I protein (Fig. 8A) and inhibits fragmentation of dying COS-7 cells compared to control (scrambled) siRNA (Fig. 8B). In

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

11

Fig. 5. Inhibiting ROCK does not affect the time course of cell death. Cells were induced to undergo apoptosis by treatment with 60 uM tamoxifen in the presence or absence of 20 uM Y-27632. The percentage of dead cells was determined at indicated times after the apoptotic stimulation. Data represent mean T SEM of 3 experiments.

contrast, although ROCK-II siRNA decreases ROCK-II protein (Fig. 8A), it does not block fragmentation (Fig. 8C). Therefore, ROCK-I but not ROCK-II is necessary for fragmentation of dying cells into apoptotic bodies. Fig. 7. ROCK-II translocates to a Triton-insoluble fraction during apoptosis. (A) Triton-soluble and -insoluble lysates from control or apoptotic COS-7 cells were blotted for ROCK-II. (B) Quantification of ROCK-II translocation. Data represent mean T SEM for 4 experiments; *P < 0.05.

ROCK activity is necessary for phagocytosis of apoptotic bodies

Fig. 6. ROCK-I, but not ROCK-II, is activated during apoptosis. Cells were transfected with myc-ROCK-I (A) or myc-ROCK-II (B) for 24 h, then treated with 60 uM tamoxifen to induce apoptosis in the presence or absence of the pan-caspase inhibitor Z-VAD-fmk (100 uM); ROCK-I or ROCK-II was immunoprecipitated from lysates and kinase activity was measured using histone H1 as a substrate. Data represent mean T SEM of 3 experiments. *P < 0.05.

Fragmentation of a dying cell into small apoptotic bodies is hypothesized to facilitate phagocytosis [6,26]; we used COS-7 cells to test this hypothesis. COS-7 cells dying in the presence of Y-27632 do not form small apoptotic bodies (see Fig. 4A); therefore, the effect of Y-27632 on phagocytosis of apoptotic COS-7 cells was investigated. Inhibiting ROCK with Y-27632 decreases phagocytosis of COS-7 cells by THP-1 monocytes four-fold (Fig. 9A). This suggests that decreasing formation of apoptotic bodies affects the clearance/phagocytosis of apoptotic COS-7 cells. Although inhibiting formation of small apoptotic bodies may be the mechanism for decreased phagocytosis following inhibition of ROCK with Y-27632, an alternative possibility is that ROCK blocks one or more of the changes at the plasma membrane, such as externalization of phosphatidylserine (PS) or exposure of carbohydrates such as N-acetyl glucosamine (GlcNAc), that allow phagocytic cells to recognize apoptotic cells [24,31,32]. Examination of PS or GlcNAc on the surface of apoptotic COS-7 cells did not reveal consistent exposure of either during apoptosis; therefore, the potential role of ROCK on their expression could not be investigated (data not shown). Inhibition of ROCK with Y-27632, however, does not affect PS exposure in NIH3T3 cells [15]. To indirectly address whether the effect of inhibiting ROCK is due to decreased formation of small apoptotic bodies, cell fragments were generated

12

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

mechanically by triturating Y-27632-treated apoptotic cells. Cellular fragments from ROCK-inhibited cells are phagocytosed as well as fragments from untreated apoptotic cells (Fig. 9B), suggesting that decreased phagocytosis of corpses from Y-27632 treated cells is due to their inability to fragment into small apoptotic bodies. Taken together, the above data indicate that ROCK is important for proper phagocytosis of dying cells and suggest that it controls

Fig. 9. ROCK is important for phagocytosis of apoptotic corpses. Cells were treated with 60 uM tamoxifen to induce apoptosis in the presence or absence of 20 uM Y-27632. Dying cells were incubated with differentiated THP-1 monocytes, and the percent of THP-1 cells containing corpses/ apoptotic bodies was determined. (A) Data represent mean T SEM of 3 experiments; COS-7 cells treated with Y-27632 do not fragment into apoptotic bodies (see Fig. 4A) and are not efficiently phagocytized. (B) COS-7 cells were triturated to fragment them before incubation with THP-1 cells; large corpses formed in the presence of Y-27632 are effectively phagocytized following mechanical fragmentation of corpses. Data represent mean T SEM of 3 experiments. *P < 0.05.

phagocytosis through its regulation of cellular fragmentation into apoptotic bodies.

Discussion

Fig. 8. ROCK-I regulates fragmentation into apoptotic bodies. Cells were transfected with control siRNA or siRNA against ROCK-I (A, B) or ROCK-II (A, C). (A) Cells were collected 72 h after transfection and blotted for ROCK-I, ROCK-II, or GAPDH as a control for loading. (B, C) Cells were treated with 60 uM tamoxifen to induce apoptosis. siRNA for ROCK-I, but not siRNA for ROCK-II, decreased fragmentation compared to control siRNA. Data represent mean T SEM of 3 experiments. *P < 0.05.

Data in this study indicate that ROCK-I signaling during apoptosis regulates fragmentation of dying cells into apoptotic bodies. Our working model is that ROCK-I is cleaved and activated by caspases during apoptosis, and that active ROCK-I increases actin – myosin contraction. The increase in actin– myosin contraction drives fragmentation into apoptotic bodies. Finally, fragmentation is important for phagocytosis/clearance of apoptotic bodies. This study presents the first evidence that ROCKI activation plays an essential role in preparing apoptotic cells for clearance/phagocytosis, through its control of fragmentation.

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

A critical feature that distinguishes apoptosis from necrosis is that as an apoptotic cell dies, it prepares itself for rapid and efficient phagocytosis/clearance; this protects neighboring cells and the organism from release of intracellular contents and inflammatory responses [1]. During the condensation stage of apoptosis, dying cells condense into a single apoptotic body or fragment into a number of apoptotic bodies; fragmentation into a single or multiple apoptotic bodies appears to be dependent on the cell type rather than the initiator of apoptosis (Fig. 1, Table 1). Condensation/Fragmentation is hypothesized to increase the efficiency of phagocytosis [6,26]. Little is known about the mechanism of cellular fragmentation/apoptotic body formation during apoptosis; however, p21-activated protein kinase 2 (PAK2) is cleaved by caspases during apoptosis in Jurkat cells, and expression of a dominant-negative form of PAK2 inhibits formation of apoptotic bodies [33]. Kinases such as ROCK that regulate actin – myosin contraction are also prime candidates for regulating fragmentation/apoptotic body formation. Caspase cleavage of ROCK-I into a constitutively active kinase during apoptosis drives membrane blebbing [15,16]. However, a link has not been made between ROCK-I and the ultimate goal of apoptosis, preparing cells for phagocytosis. In part, this is due to the lack of information on mechanisms regulating other key events in the execution phase such as cell fragmentation. The present study shows that ROCK regulates cell fragmentation/apoptotic body formation resulting in more efficient phagocytosis of corpses. In addition to identifying an important function for ROCK-I in preparing apoptotic cells for phagocytosis, our study also defines initial components of a pathway regulating cell fragmentation/apoptotic body formation consisting of ROCK-I (but not ROCK-II), myosin II, and the actin cytoskeleton. The role of actin in this process is supported by previous data showing that disrupting actin filaments with cytochalasin B or latrunculin A or stabilizing actin with jasplakinolide, blocked apoptotic body formation [10,11]. During the execution phase of apoptosis, cells first round up, then undergo membrane blebbing, and finally condense into one or a number of apoptotic bodies. Our study shows that the ROCK-I-induced actin– myosin contractions that drive membrane blebbing are also responsible for fragmentation into apoptotic bodies. However, not every cell that blebs undergoes fragmentation; many cells simply condense into a single apoptotic body after membrane blebbing (see Fig. 1). If it was only the mechanical forces of blebbing that fragment the dying cell, then any blebbing cell should fragment into apoptotic bodies. The most likely reason for formation of small apoptotic bodies in some cells but not others is that there may be additional events that occur to allow blebs to pinch off, forming apoptotic bodies. These events are currently unknown, but one possibility is contractile forces similar to those occurring during phagocytosis, specifically during internalization and closure of

13

the phagosomes around a particle. A current model of phagocytosis suggests that pseudopods first extend around the particle to be engulfed, then as the particle is completely surrounded there is a ‘‘purse-string-like’’ contraction that encloses the particle and forms a vacuole [34]. The contraction that closes the phagosome is driven by myosin activity [34], possibly myosin-1C and/or myosin-X [34 – 36]. A similar contractile activity around the base of a bleb could cause it to pinch off and form an apoptotic body. Therefore, ROCK-I-driven myosin II mechanical forces may be necessary, but not sufficient, for corpse fragmentation; additional contractile forces, perhaps driven by other myosins, may be necessary for some cells to fragment into apoptotic bodies. Previous studies linking ROCK to membrane blebbing suggest that the ROCK-I isoform is the major effector [15,16]. This conclusion is based on studies showing that while Rho can activate both ROCK-I and ROCK-II, ROCKI is the only isoform cleaved by caspases during apoptosis, and that blocking caspase activity, but not Rho activity, blocks blebbing in Jurkat and NIH3T3 cells [15,16]. However, activation of ROCK-I or ROCK-II through Rho may also contribute to membrane blebbing; the Rho inhibitor C3-transferase decreases blebbing by approximately 50% in PC12 cells [9]. In addition, recently, it was determined that ROCK-II is cleaved by granzyme B during cytotoxic lymphocyte granule-induced cell death, forming a constitutively active kinase that drives membrane blebbing [37]. We find that in COS-7 cells, ROCK-I is the only isoform that is cleaved during apoptosis and that ROCK-I but not ROCK-II kinase activity increases during apoptosis (Figs. 3, 6). The fact that ROCK-II activity did not increase in our assay did not rule out the possibility that it was involved in apoptotic fragmentation. Binding to Rho can cause ROCK-II to translocate to the cell membrane; Rho binding does not seem to greatly increase ROCK-II activity but functions mainly to bring ROCK-II closer to cytoskeletal targets [13,29]. We find that ROCK-II translocates to a Triton-insoluble cytoskeletal fraction during apoptosis, suggesting that ROCK-II may phosphorylate cytoskeletal substrates during apoptosis and function in execution phase events other than fragmentation. Our siRNA studies however show that ROCK-I but not ROCK-II is the major effector of fragmentation during apoptosis in COS-7 cells. Our data also show that fragmentation requires myosin II and the actin cytoskeleton consistent with ROCK-I controlling fragmentation through its regulation of actin –myosin contraction. Interestingly, ROCK-mediated actin –myosin contraction was recently found to regulate disintegration of the nucleus during apoptosis [38]. Data in the present study show that ROCK-I regulates fragmentation of dying COS-7 cells into apoptotic bodies, a process that requires both myosin II and the actin cytoskeleton. Importantly, this study also shows that ROCK activity is essential for phagocytosis of dying cells. Therefore, ROCK appears to be a key regulator of multiple

14

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15

cytoplasmic execution events including membrane blebbing, cellular fragmentation/apoptotic body formation, and preparing corpses for phagocytosis. It will be important in future studies to identify additional components of the cell fragmentation pathway and additional functions of ROCK as a regulator of the execution phase of apoptosis.

[15]

Acknowledgments

[17]

We thank Shuh Narumiya for the myc-tagged ROCK-I vector and Kozo Kaibuchi for the myc-tagged ROCK-II vector. This work is supported by the National Institutes of Health Grant NS32465 (R.N.P.) and the Training Program in Age-Related Neurodegenerative Diseases T32AG00255 (K.A.O.).

References [1] J.F. Kerr, A.H. Wyllie, A.R. Currie, Apoptosis: a basic biological phenomenon with wide-ranging implications in tissue kinetics, Br. J. Cancer 26 (1972) 239 – 257. [2] A.H. Wyllie, J.F. Kerr, A.R. Currie, Cell death: the significance of apoptosis, Int. Rev. Cytol. 68 (1980) 251 – 306. [3] H. Steller, Mechanisms and genes of cellular suicide, Science 267 (1995) 1445 – 1449. [4] J. Savill, V. Fadok, Corpse clearance defines the meaning of cell death, Nature 407 (2000) 784 – 788. [5] K. Lauber, S.G. Blumenthal, M. Waibel, S. Wesselborg, Clearance of apoptotic cells: getting rid of the corpses, Mol. Cell 14 (2004) 277 – 287. [6] J.C. Mills, N.L. Stone, R.N. Pittman, Extranuclear apoptosis: the role of the cytoplasm in the execution phase, J. Cell Biol. 146 (1999) 703 – 707. [7] R.R. Torgerson, M.A. McNiven, The actin – myosin cytoskeleton mediates reversible agonist-induced membrane blebbing, J. Cell Sci. 111 (1998) 2911 – 2922. [8] J. Hagmann, M.M. Burger, D. Dagan, Regulation of plasma membrane blebbing by the cytoskeleton, J. Cell. Biochem. 73 (1999) 488 – 499. [9] J.C. Mills, N.L. Stone, J. Erhardt, R.N. Pittman, Apoptotic membrane blebbing is regulated by myosin light chain phosphorylation, J. Cell Biol. 140 (1998) 627 – 636. [10] T.G. Cotter, S.V. Lennon, J.M. Glynn, D.R. Green, Microfilamentdisrupting agents prevent the formation of apoptotic bodies in tumor cells undergoing apoptosis, Cancer Res. 52 (1992) 997 – 1005. [11] A. Majczak, M. Karbowski, M. Kaminski, M. Masaoka, C. Kurono, E. Niemczyk, J. Kedzior, T. Soji, D. Knap, A. Hallmann, T. Wakabayashi, Modification of physicochemical properties of actin filaments suppresses cell fragmentation in the execution phase of staurosporineinduced apoptotic processes, J. Electron. Microsc. (Tokyo) 53 (2004) 635 – 647. [12] T. Matsui, M. Amano, T. Yamamoto, K. Chihara, M. Nakafuku, M. Ito, T. Nakano, K. Okawa, A. Iwamatsu, K. Kaibuchi, Rho-associated kinase, a novel serine/threonine kinase, as a putative target for small GTP binding protein Rho, EMBO J. 15 (1996) 2208 – 2216. [13] T. Leung, X.Q. Chen, E. Manser, L. Lim, The p160 RhoA-binding kinase ROK alpha is a member of a kinase family and is involved in the reorganization of the cytoskeleton, Mol. Cell. Biol. 16 (1996) 5313 – 5327. [14] T. Ishizaki, M. Maekawa, K. Fujisawa, K. Okawa, A. Iwamatsu, A. Fujita, N. Watanabe, Y. Saito, A. Kakizuka, N. Morii, S. Narumiya,

[16]

[18]

[19]

[20]

[21]

[22] [23]

[24]

[25]

[26] [27] [28]

[29]

[30]

[31]

[32]

[33]

[34]

The small GTP-binding protein Rho binds to and activates a 160 kDa Ser/Thr protein kinase homologous to myotonic dystrophy kinase, EMBO J. 15 (1996) 1885 – 1893. M.L. Coleman, E.A. Sahai, M. Yeo, M. Bosch, A. Dewar, M.F. Olson, Membrane blebbing during apoptosis results from caspase-mediated activation of ROCK I, Nat. Cell. Biol. 3 (2001) 339 – 345. M. Sebbagh, C. Renvoize, J. Hamelin, N. Riche, J. Bertoglio, J. Breard, Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and apoptotic membrane blebbing, Nat. Cell. Biol. 3 (2001) 346 – 352. K. Kimura, M. Ito, M. Amano, K. Chihara, Y. Fukata, M. Nakafuku, B. Yamamori, J. Feng, T. Nakano, K. Okawa, A. Iwamatsu, K. Kaibuchi, Regulation of myosin phosphatase by Rho and Rhoassociated kinase (Rho-kinase), Science 273 (1996) 245 – 248. M. Amano, M. Ito, K. Kimura, Y. Fukata, K. Chihara, T. Nakano, Y. Matsuura, K. Kaibuchi, Phosphorylation and activation of myosin by Rho-associated kinase (Rho-kinase), J. Biol. Chem. 271 (1996) 20246 – 20249. O. Nakagawa, K. Fujisawa, T. Ishizaki, Y. Saito, K. Nakao, S. Narumiya, ROCK-I and ROCK-II, two isoforms of Rho-associated coiled-coil forming protein serine/threonine kinase in mice, FEBS Lett. 392 (1996) 189 – 193. T. Ishizaki, M. Naito, K. Fujisawa, M. Maekawa, N. Watanabe, Y. Saito, S. Narumiya, p160ROCK, a Rho-associated coiled-coil forming protein kinase, works downstream of Rho and induces focal adhesions, FEBS Lett. 404 (1997) 118 – 124. M. Amano, K. Chihara, N. Nakamura, T. Kaneko, Y. Matsuura, K. Kaibuchi, The COOH terminus of Rho-kinase negatively regulates rho-kinase activity, J. Biol. Chem. 274 (1999) 32418 – 32424. M. Amano, Y. Fukata, K. Kaibuchi, Regulation and functions of Rhoassociated kinase, Exp. Cell. Res. 261 (2000) 44 – 51. A. Shiratsuchi, T. Mori, Y. Nakanishi, Independence of plasma membrane blebbing from other biochemical and biological characteristics of apoptotic cells, J. Biochem. (Tokyo) 132 (2002) 381 – 386. E. Duvall, A.H. Wyllie, R.G. Morris, Macrophage recognition of cells undergoing programmed cell death (apoptosis), Immunology 56 (1985) 351 – 358. V.A. Fadok, D.R. Voelker, P.A. Campbell, J.J. Cohen, D.L. Bratton, P.M. Henson, Exposure of phosphatidylserine on the surface of apoptotic lymphocytes triggers specific recognition and removal by macrophages, J. Immunol. 148 (1992) 2207 – 2216. B. Fadeel, Plasma membrane alterations during apoptosis: role in corpse clearance, Antioxid Redox Signal 6 (2004) 269 – 275. M.J. Arends, A.H. Wyllie, Apoptosis: mechanisms and roles in pathology, Int. Rev. Exp. Pathol. 32 (1991) 223 – 254. M.J. McLaren, G. Inana, C.Y. Li, Double fluorescent vital assay of phagocytosis by cultured retinal pigment epithelial cells, Invest. Ophthalmol. Visual Sci. 34 (1993) 317 – 326. T. Leung, E. Manser, L. Tan, L. Lim, A novel serine/threonine kinase binding the Ras-related RhoA GTPase which translocates the kinase to peripheral membranes, J. Biol. Chem. 270 (1995) 29051 – 29054. M.J. Taggart, Y.H. Lee, K.G. Morgan, Cellular redistribution of PKCalpha, rhoA, and ROKalpha following smooth muscle agonist stimulation, Exp. Cell Res. 251 (1999) 92 – 101. D. Pradhan, S. Krahling, P. Williamson, R.A. Schlegel, Multiple systems for recognition of apoptotic lymphocytes by macrophages, Mol. Biol. Cell. 8 (1997) 767 – 778. A. Witting, P. Muller, A. Herrmann, H. Kettenmann, C. Nolte, Phagocytic clearance of apoptotic neurons by microglia/brain macrophages in vitro: involvement of lectin-, integrin-, and phosphatidylserine-mediated recognition, J. Neurochem. 75 (2000) 1060 – 1070. T. Rudel, G.M. Bokoch, Membrane and morphological changes in apoptotic cells regulated by caspase-mediated activation of PAK2, Science 276 (1997) 1571 – 1574. J.A. Swanson, M.T. Johnson, K. Beningo, P. Post, M. Mooseker, N.

K.A. Orlando et al. / Experimental Cell Research 312 (2006) 5 – 15 Araki, A contractile activity that closes phagosomes in macrophages, J. Cell Sci. 112 (1999) 307 – 316. [35] M. Diakonova, G. Bokoch, J.A. Swanson, Dynamics of cytoskeletal proteins during Fcgamma receptor-mediated phagocytosis in macrophages, Mol. Biol. Cell. 13 (2002) 402 – 411. [36] D. Cox, J.S. Berg, M. Cammer, J.O. Chinegwundoh, B.M. Dale, R.E. Cheney, S. Greenberg, Myosin X is a downstream effector of PI(3)K during phagocytosis, Nat. Cell. Biol. 4 (2002) 469 – 477.

15

[37] M. Sebbagh, J. Hamelin, J. Bertoglio, E. Solary, J. Breard, Direct cleavage of ROCK II by granzyme B induces target cell membrane blebbing in a caspase-independent manner, J. Exp. Med. 201 (2005) 465 – 471. [38] D.R. Croft, M.L. Coleman, S. Li, D. Robertson, T. Sullivan, C.L. Stewart, M.F. Olson, Actin – myosin-based contraction is responsible for apoptotic nuclear disintegration, J. Cell Biol. 168 (2005) 245 – 255.