Role of dopamine D1 receptor in 3-fluoromethamphetamine-induced neurotoxicity in mice

Neurochemistry International 113 (2018) 69e84

Contents lists available at ScienceDirect

Neurochemistry International journal homepage: www.elsevier.com/locate/nci

Role of dopamine D1 receptor in 3-fluoromethamphetamine-induced neurotoxicity in mice Phuong-Tram Nguyen a, 1, Eun-Joo Shin a, 1, Duy-Khanh Dang a, Hai-Quyen Tran a, Choon-Gon Jang b, Ji Hoon Jeong c, Yu Jeung Lee d, Hyo Jong Lee e, Yong Sup Lee e, Kiyofumi Yamada f, Toshitaka Nabeshima g, h, i, Hyoung-Chun Kim a, * a

Neuropsychopharmacology and Toxicology Program, College of Pharmacy, Kangwon National University, Chunchon 24341, Republic of Korea Department of Pharmacology, School of Pharmacy, Sungkyunkwan University, Suwon 16419, Republic of Korea Department of Pharmacology, College of Medicine, Chung-Ang University, Seoul 06974, Republic of Korea d Clinical Pharmacy, College of Pharmacy, Kangwon National University, Chunchon 24341, Republic of Korea e Department of Life and Nanopharmaceutical Sciences, College of Pharmacy, Kyung Hee University, Seoul, 02447, Republic of Korea f Department of Neuropsychopharmacology and Hospital Pharmacy, Nagoya University Graduate School of Medicine, Nagoya 466-8560, Japan g Advanced Diagnostic System Research Laboratory, Fujita Health University Graduate School of Health Science, Toyoake 470-1192, Japan h Aino University, Ibaraki, Osaka 567-0012, Japan i Japanese Drug Organization of Appropriate Use and Research, Nagoya 468-0069, Japan b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 September 2017 Received in revised form 14 November 2017 Accepted 28 November 2017

3-Fluoromethamphetamine (3-FMA) is an illegal designer drug of methamphetamine (MA) derivative. Up to date, little is known about the neurotoxic potential of 3-FMA. In the present study, we investigated the role of dopamine receptors in neurotoxicity induced by 3-FMA in comparison with MA (35 mg/kg, i.p.) as a control drug. Here we found that 3-FMA (40, 60 or 80 mg/kg, i.p.) produced mortality in a dosedependent manner in mice. Treatment with 3-FMA (40 mg/kg, i.p.) resulted in significant hyperthermia, oxidative stress and microgliosis (microglial differentiation into M1 phenotype) followed by proapoptotic changes and the induction of terminal deoxynucleotidyl transferase dUDP nick end labeling (TUNEL)-positive cells. Moreover, 3-FMA significantly produced dopaminergic impairments [i.e., increase in dopamine (DA) turnover rate and decreases in DA level, and in the expression of tyrosine hydroxylase (TH), dopamine transporter (DAT), and vesicular monoamine transporter 2 (VMAT-2)] with behavioral impairments. These dopaminergic neurotoxic effects of 3-FMA were comparable to those of MA. SCH23390, a dopamine D1 receptor antagonist, but not sulpiride, a dopamine D2 receptor antagonist significantly attenuated 3-FMA-induced neurotoxicity. Although both SCH23390 and sulpiride attenuated MA-induced dopaminergic neurotoxicity, sulpiride is more effective than SCH23390 on the dopaminergic neurotoxicity. Interestingly, SCH23390 treatment positively modulated 3-FMA-induced microglial activation (i.e., SCH23390 inhibited M1 phenotype from 3-FMA insult, but activated M2 phenotype). Therefore, our results suggest that the activation of dopamine D1 receptor is critical to 3FMA-induced neurotoxicity, while both dopamine D1 and D2 receptors (dopamine D2 receptor > dopamine D1 receptor) mediate MA-induced dopaminergic neurotoxicity. © 2017 Published by Elsevier Ltd.

Keywords: 3-Fluoromethamphetamine Dopaminergic deficits Striatum Dopamine receptors Oxidative stress Apoptosis

1. Introduction Amphetamines are psychoactive substances and members of the phenylethylamine family, which include a broad range of

* Corresponding author. E-mail address: [email protected] (H.-C. Kim). 1 PT Nguyen and EJ Shin are equally contributed to this work. https://doi.org/10.1016/j.neuint.2017.11.017 0197-0186/© 2017 Published by Elsevier Ltd.

substances that may be stimulant, euphoric, anorectic, or hallucinogenic agents (Carvalho et al., 2012). Amphetamine (AMPH), methamphetamine (MA), and 3,4methylenedioxymethamphetamine (MDMA) are widely abused amphetamine-like synthetic drugs, with the basic chemical structure of phenylethylamine (Teixeira-Gomes et al., 2015). It is well-known that MA-induced neurotoxicity associated with oxidative stress, apoptosis, and microglial activation might be, at least in part, due primarily to the excessive release of dopamine

70

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

neurotransmitter, accompanied by stimulation of dopamine receptors. The stimulation of dopamine receptors potentially leads to the activation of downstream pathways and ultimately results in damage of postsynaptic to the DA-terminal neurons (Xu et al., 2005). Therefore, investigators have demonstrated that blockade of dopamine receptors contributed to the protection of dopaminergic neurons against MA toxicity. Previous reports showed that not only pharmacological blockade (O'Dell et al., 1993; Metzger et al., 2000; Angulo et al., 2004; Ares-Santos et al., 2012, 2013; Dang et al., 2017a), but also genetic inactivation of dopamine D1 or D2 receptor (Granado et al., 2011a; Ares-Santos et al., 2012) prevented toxic effects on DA systems induced by MA, indicating that dopamine receptors are critical mediators to MA-induced neurotoxicity. Another amphetamine-type psychostimulant, 3fluoromethamphetamine (3-FMA) is structurally categorized as a synthetic drug of substituted AMPH and characterized by fluorine at the 3 position of the phenyl group of MA. 3-FMA has been officially notified as a newly emerging designer drug in Finland, U.S.A, China, and New Zealand (EMCDDA, 2009; Kelleher et al., 2011; C.F.a.D.A, 2015; Samantha J. Coward, 2016; Legislature U.S., 2017). However, there has been no scientific information on the prevalence of 3-FMA in these countries. 3-FMA has been associated with increased risk of death in Finland, England and Wales (Vili et al., 2012; Statistics, 2015; Shapiro, 2016) and listed as a restricted drug in West Virginia, U.S.A (Laws, 2015). An earlier study has shown that fluorinated derivatives of AMPH exhibited psychostimulant-like properties (Marona-Lewicka et al., 1995). In addition, the behavioral and neurotoxic effects induced by 3-FMA currently remain unknown. Impaired dopaminergic systems associated with MA have been well-documented (Walsh and Wagner, 1992; Kim et al., 1999; Nakajima et al., 2004; Shin et al., 2012, 2017b; Dang et al., 2016; Dang et al., 2017b). Previous reports have suggested that early MA use may be linked to higher risk for Parkinson's disease development (Callaghan et al., 2010, 2012; Curtin et al., 2015). Several studies have supported that exposure to MA causes persistent neurotoxicity in dopaminergic neurons, as evidenced by long-term reductions of dopamine transporter (DAT), decreases in the levels of DA and its metabolites, and tyrosine hydroxylase (TH) in the striatum (Yu et al., 2002; Xu et al., 2005; Zhu et al., 2005; Bowyer et al., 2008; Dang et al., 2016, 2017b; Shin et al., 2017a). Escalating evidence suggested that oxidative stress is a critical element in MA neurotoxicity (Jayanthi et al., 1998; Gluck et al., 2001; Iwashita et al., 2004; Shin et al., 2012, 2014; Dang et al., 2016). In addition, previous studies from our group (Shin et al., 2012, 2014; Dang et al., 2016) and others (Deng et al., 1999, 2001; Choi et al., 2002) demonstrated that MA treatment induces terminal deoxynucleotidyl transferase dUDP nick end labeling (TUNEL)-positive cells in the striatum. Further, numerous in vivo studies have demonstrated that neurotoxic dose of MA facilitates reactive microgliosis in the nigrostriatal area, possibly leading to neuronal injury (Thomas et al., 2004; Fantegrossi et al., 2008; Sekine et al., 2008; Dang et al., 2016). We investigated in the present study whether a single, high dose of 3-FMA (40 mg/kg, i.p.), exerts neurotoxicity, because a single, high dose (35 mg/kg, i.p.) of MA (control drug) is selective for inducing pro-apoptotic changes. In addition, we assessed whether 3-FMA activates dopamine receptors to induce neurotoxicity by assessing parameters of oxidative stress, pro-apoptosis, microgliosis and dopaminergic neuronal system. We observed that neurotoxicity induced by 3-FMA was almost comparable to that induced by MA, a control drug.

2. Materials and methods 2.1. Animals All animals were treated in accordance with the Guide for the Care and Use of Laboratory Animals (National Research Council of the National Academies. 2011; www.dels.nas.edu/ila). The present study was conducted in accordance with the Institute for Laboratory Research (ILAR) Guidelines for the Care and Use of Laboratory Animals. Institutional Animal Care and Use Committee (IACUC) approval (KW-160525-1) was obtained from the IACUC of Kangwon National University including the use of death as an end-point to estimate the mortality after 3-FMA treatment without the benefit of intervention or humane euthanasia. However, MA-treated mice were euthanized when a weight loss of >20% from the initial value occurred. Male 10-week-old ICR mice were purchased from Taconic Farms, Inc. Samtako Biokorea, O-san, South Korea). The mice were initially group housed (6e8 animals per cage) in laboratory polycarbonate mice cages (290
220
140 mm) covered with stainless steel wire-grid lids. Cages were bedded with irradiated heattreated aspen shavings (NEPCO, Warrensburg, NY, U.S.A.) and changed weekly. Mice were fed (Purinafeed, Korea) and provided with bottled tap water ad libitum. Mice were maintained with a controlled temperature (20e25  C) under a 12-h light:12-h dark cycle and were adapted to these conditions for 2 weeks prior to the experiment. All efforts were made to minimize suffering and distress. As we (Shin et al., 2012, 2014; Nguyen et al., 2015; Dang et al., 2016, 2017a) and others (Zhu et al., 2006a, 2006b) have reported that Taconic ICR mice are sensitive to MA-induced TUNEL-positive reaction, we employed 10-week-old male Taconic ICR mice (Taconic Farms, Inc. Samtako Bio Korea, O-San, South Korea) to evaluate the role of dopamine receptors in the pro-apoptotic effects induced by 3-FMA or MA. 2.2. Synthesis of 1-(3-fluorophenyl)-N-methylpropan-2-amine (3fluoromethamphetamine, 3-FMA) Synthesis and use of 3-FMA for the present study were approved by the Korea Food and Drug Administration (KFDA), and were performed in strict accordance with KFDA regulations. 3-FMA was synthesized as described previously (Nakazono et al., 2013) and its structure and purity were further confirmed by the following NMR spectroscopy and HPLC analyses. 1H-NMR (CD3OD, at R.T, d): 7.39e7.37 (1H, m), 7.10 (1H, d, J ¼ 7.6 Hz), 7.07e7.02 (1H þ 1H), 3.50e3.54 (1H, m), 3.15 (1H, dd, J ¼ 13.6, 5.2 Hz), 2.77 (1H, dd, J ¼ 13.6, 9.4 Hz), 2.73 (3H, s), 1.23 (3H, d, J ¼ 6.7 Hz); LC-MS (ESIþ, 15 and 20 V) calculated for [M þ H]þ C10H16FN at m/z 168; HPLC purity ¼ 98%, Hypersil Gold C18 3 mm (150
2.1 mm), mobile phase: acetonitrile: ammonium formate (10 mM, pH 3.5) (20: 80 v/v). 2.3. Drug treatment 3-FMA hydrochloride, MA hydrochloride and SCH23390 hydrochloride (D1 receptor antagonist; 0.1 mg/kg; Tocris Bioscience, Ellisville, MO, U.S.A) were dissolved in sterile 0.9% saline. (RS)(±)-sulpiride (D2 receptor antagonist; 20 mg/kg; Tocris Bioscience, Ellisville, MO, U.S.A) was dissolved in a small amount of 0.1 N HCl solution, and the pH was adjusted to 6e7 with 0.1 N NaOH. 10-week-old male Taconic ICR mice received 3-FMA (40 mg/kg, i.p.), MA (35 mg/kg, i.p.) or saline. They were sacrificed 4 h (n ¼ 6), 12 h (n ¼ 6), and 1 d (n ¼ 6) after 3-FMA or MA treatment to

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

examine changes in reactive oxygen species (ROS) formation, lipid peroxidation, protein oxidation, tyrosine hydroxylase (TH) and ionized calcium binding adaptor molecule 1 (Iba-1). We measured rectal temperature and behavioral activities (i.e., locomotor activity and rota-rod performance) 1 d and 3 d after the treatment of 3-FMA or MA. Mice were sacrificed 1 d after the treatment of 3-FMA or MA to examine changes in pro-apoptotic proteins (i.e., Bax, caspase-3), anti-apoptotic protein (i.e., Bcl-2, Bcl-xl), terminal deoxynucleotidyl transferase dUDP nick-end labeling (TUNEL)-positive cells, Iba-1-labeled microglia and M1/M2 phenotype of microglial mRNAs, dopamine (DA) level, DA metabolite levels, dopamine transporter (DAT), and vesicular monoamine transporter-2 (VMAT2) expression. Since we (Shin et al., 2012, 2014) and others (AresSantos et al., 2014; Mendieta et al., 2016) demonstrated that MA induces dopaminergic losses 1 d later, and contributes to motor impairments 1 d and 3 d later, we selected these time-points. To evaluate the role of the dopamine D1 or D2 receptor in hyperthermia, oxidative stress, pro-apoptosis changes, microgliosis, and dopaminergic impairments with behavioral impairments, SCH23390 (0.1 mg/kg, i.p.), a dopamine D1 receptor antagonist (n ¼ 6), or sulpiride (20 mg/kg, i.p.), a dopamine D2 receptor antagonist (n ¼ 6) was given 30 min before 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.) administration. The doses of SCH23390 and sulpiride were determined based on our previous studies (Shin et al., 2007; Dang et al., 2017a). All experiments were independently performed twice. The results from two independent experiments were combined for final analysis. 2.4. Rectal temperature Rectal temperature (under ambient temperature: 21 ± 1  C) was measured once before 3-FMA, MA or saline treatment and four times every hour after the treatment of 3-FMA, MA or saline by inserting a thermometer probe lubricated with oil at least 3 cm into the rectum of mice. To prevent sudden movements, animals were gently handled with a wool glove while their tail was moved to allow probe insertion. This was done to reduce any effect of restraint stress on rectal temperature. When the attempt to insert the probe was not successful (i.e., sudden movements of the animal or the need to restrain the mouse), the animal was excluded from the group (Shin et al., 2011; Dang et al., 2017a).

71

USA), or b-actin (1:50000; Sigma-Aldrich, St. Louis, MO, U.S.A.). Membranes were then incubated with HRP-conjugated secondary anti-rabbit IgG (1:1000, GE healthcare, Piscataway, NJ, U.S.A.), antimouse IgG (1:1000, Sigma-Aldrich) or anti-goat IgG (1:1000, Sigma-Aldrich) for 2 h. Subsequent visualization was performed using an enhanced chemiluminescence system (ECL plus®, GE Healthcare, Arlington Heights, IL, U.S.A.). The molecular weights of detected protein bands were estimated using Xpert Prestained Protein Marker (P8502, GenDEPOT, U.S.A.) ranging from 6 to 240 kDa. Relative intensities of the bands were quantified by PhotoCapt MW (version 10.01 for Windows; Vilber Lourmat, Marne la e, France), and then normalized to the intensity of b-actin Valle (Shin et al., 2014). 2.6. Quantification of 4-hydroxynonenal (HNE) The amount of lipid peroxidation was determined by measuring the level of 4-hydroxynonenal (HNE) using the OxiSelect™ HNE adduct ELISA kit (Cell Biolabs, Inc. San Diego, CA, U.S.A.) according to the manufacturer's instructions. 100 ml of striatal homogenate (n ¼ 6/group) at a protein concentration of 10 mg/ml was incubated in 96-well protein binding plates at 4  C overnight. After protein adsorption, HNE adducts in each well were labeled with HNE antibody, followed by HRP-conjugated secondary antibody. Colorimetric development was then performed with substrate solution. Absorbance was recorded at 450 nm using a microplate reader (Molecular Devices Inc. Sunnyvale, CA, U.S.A.), and an amount of HNE adduct in each sample was calculated from the standard curve for HNE-BSA. 2.7. Quantification of protein carbonyl groups The extent of protein oxidation was assessed by measuring the content of protein carbonyl group, which was determined spectrophotometrically with the 2,4-dinitrophenylhydrazine (DNPH)labeling procedure (Oliver et al., 1987; Shin et al., 2014). The results are expressed as nmol of DNPH incorporated/mg protein based on the extinction coefficient for aliphatic hydrazones of 21 mM1 cm1 (n ¼ 6/group). Protein was measured using the Pierce 660 nm Protein Assay™ reagent (Thermo Scientific, Rockford, IL, U.S.A). 2.8. Quantification of reactive oxygen species (ROS) formation

2.5. Western blot analysis Striatal tissues (n ¼ 6/group) were lysed in buffer containing a 200 mM TriseHCl (pH 6.8), 1% SDS, 5 mM EGTA, 5 mM EDTA, 10% glycerol, 1 x phosphatase inhibitor cocktail I (Sigma-Aldrich, St. Louis, MO, U.S.A.), and 1 x protease inhibitor cocktail (SigmaAldrich, St. Louis, MO, U.S.A.). Lysate was centrifuged at 12,000
g for 30 min and the supernatant fraction was used for Western blot analysis as described previously (Shin et al., 2012, 2014). Proteins were quantified with the Quant-iT™ protein assay kit (Q33211, Invitrogen, U.S.A), using the Qubit fluorometer according to the manufacturer's information. Proteins (20 mg/lane) were separated by 10% or 15% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (PAGE) and transferred onto PVDF membranes. Following transfer, the membranes were pre-incubated with 5% non-fat milk for 30 min and incubated overnight at 4  C with primary antibody against Bcl-2 (1:1 000; Santa Cruz Biotechnology), Bcl-xl (1:1 000; Cell Signaling, Danvers, MA, USA), Bax (1:1 000; Santa Cruz Biotechnology), cleaved caspase 3 (1:1 000; Cell Signaling Technology), caspase 3 (1:1 000; Cell Signaling Technology), Iba-1 (1:500, Wako Pure Chemical Industries, Chuo-ku, Osaka, Japan), TH [1:5000, Chemicon (EMD Millipore)], DAT (1:1000, Abcam, Cambridge, U.K.), VMAT-2 (1:500, Novus Biologicals, Littleton, CO,

The ROS formation in the striatum was assessed by measuring the conversion from 20 ,70 -dichlorofluorescin diacetate (DCFH-DA) to dichlorofluorescin (DCF) (Nguyen et al., 2015). Brain homogenates (n ¼ 6/group) were added to a tube containing 2 ml of PBS with 10 nmol of DCFH-DA, dissolved in methanol. The mixture was incubated at 37  C for 3 h, and then fluorescence was measured at 480 nm excitation and 525 nm emission. DCF was used as a standard. 2.9. Immunocytochemistry Immunocytochemistry was performed as described previously (Shin et al., 2014). Mice (n ¼ 6/group) were transcardially perfused with 50 ml of ice-cold PBS (10 ml/10 g body weight) followed by 4% paraformaldehyde (20 ml/10 g body weight). Brains were removed and stored in 4% paraformaldehyde overnight. Series of every sixth sections (35 mm thickness, 210 mm apart) from the striatum were selected and subjected to immunocytochemistry. Sections were blocked with PBS containing 0.3% hydrogen peroxide for 30 min and then incubated in PBS containing 0.4% Triton X-100% and 1% normal serum for 20 min. After a 48-h incubation with primary antibody against TH [1:500; Chemicon (EMD Millipore)], or Iba-1

72

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

(1:500, Wako Pure Chemical Industries, Chuo-ku, Osaka, Japan), sections were incubated with the biotinylated secondary antibody (1:1 000; Vector Laboratories, Burlingame, CA, U.S.A.) for 1 h. The sections were then immersed in a solution containing avidinebiotin peroxidase complex (Vector Laboratories) for 1 h, and 3,30 -diaminobenzidine was utilized as the chromogen. Digital images were acquired under an upright microscope (BX51; Olympus) using an attached digital microscope camera (DP72; Olympus) and an IBM PC. ImageJ version 1.47 software (National Institutes of Health, Bethesda, MD, U.S.A.) was employed to measure the immunoreactivities of TH and Iba-1 in the striatum as described previously (Wang et al., 2012; Dang et al., 2017a). Briefly, the entire striatal region from each section was selected as the region of interest (ROI). Threshold values for hue (0e100), saturation (0e255), and brightness (175e255) were set in the “Adjust Color Threshold” dialog box, and then the mean density was measured. 2.10. Reverse transcription and polymerase chain reaction (RT-PCR) Total RNA was isolated from the striatal tissues (n ¼ 6/group) using an RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer's instructions. Reverse transcription reactions were carried out using the RNA to cDNA Eco-Dry Premix (Clontech, Palo Alto, CA, USA) with a 1-h incubation at 42  C. Polymerase chain reaction (PCR) amplification was performed for 35 cycles of denaturation at 94  C for 1 min, annealing at 60  C for 2 min, and extension at 72  C for 1 min. Primer sequences (Wang et al., 2012) for PCR amplification are listed in Table 1. PCR products were separated on 2% agarose gels containing ethidium bromide and visualized under ultraviolet light. Quantitative analysis of RNA was performed using PhotoCapt MW (version 10.01 for Windows; Vilber Lourmat). 2.11. TUNEL staining For TUNEL staining, a series of every sixth section (35 mm thickness, 210 mm apart) from the striatum (n ¼ 6/group) was selected. TUNEL staining was performed using the FragEL DNA fragmentation detection kit (QIA33; Calbiochem, La Jolla, CA, USA) according to the manufacturer's protocol (Shin et al., 2012, 2014; Dang et al., 2016). Briefly, sections were permeabilized by incubation with 20 mg/ml proteinase K, and then incubated with 3% hydrogen peroxide to block endogenous peroxidase activity. After immersion in the terminal deoxynucleotidyl transferase (TdT) equilibration buffer, sections were incubated with biotinylated deoxynucleotides and TdT enzyme. Sections were then immersed in streptavidin-peroxidase complex with diaminobenzidine tetrahydrochloride as the chromogen. Counterstaining was performed using methyl green, which was provided in the kit. Digital images from each quadrant of the striatum (dorsal-medial, dorsal-lateral, ventral-media, ventral-lateral) were acquired (Zhu et al., 2006a,

Table 1 Gene primer sequences for RT-PCR analysis. Gene

Forward primer (5’ e 30 )

Reverse primer (5’ e 30 )

Arginase 1 CD206 CD16 CD32 CD86 GAPDH

GAACACGGCAGTGGCTTTAAC TCTTTGCCTTTCCCAGTCTCC TTTGGACACCCAGATGTTTCAG AATCCTGCCGTTCCTACTGATC TTGTGTGTGTTCTGGAAACGGAG ACCACAGTCCATGCCATCAC

TGCTTAGCTCTGTCTGCTTTGC TGACACCCAGCGGAATTTC GTCTTCCTTGAGCACCTGGATC GTGTCACCGTGTCTTCCTTGAG AACTTAGAGGCTGTGTTGCTGGG TCCACCACCCTGTTGCTGTA

2006b) at
40 objective magnification using an Olympus microscope (B
51; Olympus) and a digital microscope camera (DP72; Olympus). Cell counting was performed blindly. Apoptotic cells were identified based on the rounded, shrunken nature of the cytoplasm and nucleus and on the intense staining of the nucleus. After counting, a mean value was obtained by averaging the counts of each quadrant from five sections for each animal (Shin et al., 2012). 2.12. Measurement of dopamine (DA), 3,4-dihydroxyphenylacetic acid (DOPAC), homovanillic acid (HVA) Mice (n ¼ 6/group) were sacrificed by cervical dislocation and the brains were removed. The striatum was dissected, immediately frozen on dry ice, and stored at 70  C until assays were performed. Tissues were weighed, ultrasonicated in 10% perchloric acid, and centrifuged at 20,000
g for 10 min. The levels of DA and its metabolites DOPAC and HVA were determined by HPLC coupled with an electrochemical detector, as described previously (Wang et al., 2012; Shin et al., 2014). Supernatant aliquots (20 ml) were injected into an HPLC equipped with a C18 column with 3 mm particle size (Waters). The mobile phase was comprised of 26 ml of acetonitrile, 21 ml of tetrahydrofuran, and 960 ml of 0.15 M monochloroacetic acid (pH 3.0) containing 50 mg/l of EDTA and 200 mg/ ml of sodium octyl sulfate. The amount of DA was determined by comparison of peak areas of tissue samples with the standard, and was expressed in ng/g of wet tissue. 2.13. Locomotor activity Locomotor activity was measured for 30 min using an automated video-tracking system (Noldus Information Technology, Wageningen, The Netherlands). Four test boxes (40 cm
40 cm
40 cm high) were operated simultaneously by an IBM computer. Mice (n ¼ 12/group) were studied individually during locomotion in each test box, where they had been adapted for 5 min prior to the beginning of the experiment. A printout for each session showed the pattern of the movements in the test box. The distance travelled in centimeters by the animals during horizontal locomotor activity was analyzed. Data were collected and analyzed between 09:00 and 17:00 h (Shin et al., 2014). 2.14. Rota-rod test The apparatus (Ugo Basile model 7650, Comerio, VA, Italy) consisted of a base platform and a rotating rod with a non-slip surface. The rod was placed at a height of 15 cm from the base. The rod, 30 cm in length, was divided into five equal sections by six opaque disks (so that the subjects could not be distracted by one another). To assess motor performance, the mice (n ¼ 12/group) were first trained on the apparatus for 2 min at a constant rate of 4 rpm. The test was performed 30 min after training and an accelerating paradigm was applied, starting from a rate of 4 rpm to the maximal speed of 40 rpm, then the rotation speed was kept constant at 40 rpm for a maximum of 300 s. The duration for which animal could maintain balance on the rotating drum was measured as the latency to fall, with a maximal cut-off time of 300 s (Shin et al., 2014). 2.15. Statistics Data were analyzed using IBM SPSS ver. 19.0 (IBM, Chicago, IL, USA). One-way analysis of variance (ANOVA) or two-way ANOVA

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

was employed for the statistical analyses. Post-hoc Fisher's least significant difference pairwise comparisons tests were then conducted. Results are expressed as mean ± S.E.M. The statistical significance of mortality was calculated using the Chi-square test. Differences were considered statistically significant at P-values < 0.05. 3. Results 3.1. Effects of dopamine receptor antagonists on 3-FMA-induced hyperthermia in mice MA-induced hyperthermia has been shown to contribute to MA-induced neurotoxic effects (Bowyer et al., 1994; Albers and Sonsalla, 1995). According to experimental design shown in Fig. 1A, we examined whether SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist affects hyperthermia induced by 3-FMA (40 mg/kg) or MA (35 mg/kg). As shown in Fig. 1BeC, 3-FMA or MA treatment significantly increased rectal temperature (3-FMA: P < 0.01. MA: P < 0.01). SCH23390, but not sulpiride, significantly attenuated 3-FMA-induced hyperthermia (P < 0.01). In contrast, either SCH23390 or sulpiride significantly attenuated MA-induced hyperthermia (SCH: P < 0.05. Sulpiride: P < 0.01); this attenuation was more pronounced in sulpiride (P < 0.05) than in SCH23390. 3.2. Effects of dopamine receptor antagonists on 3-FMA-induced oxidative burdens in the striatum of mice We (Shin et al., 2012; Dang et al., 2016) and others (Zhu et al., 2006a, 2006b) demonstrated that a single, high dose of MA consistently produces oxidative stress followed by pro-apoptotic changes in Taconic ICR mice. In this study, we investigated whether a single, high dose of 3-FMA (40 mg/kg) produces reactive oxygen species (ROS) formation, lipid peroxidation (4Hydroxynonenal; 4-HNE level) and protein oxidation (protein carbonyl) 4 h, 12 h and 1 d post-3-FMA, and whether SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist attenuates these oxidative damages. We compared effects of 3-FMA with those of MA (35 mg/kg). As shown in Fig. 2AeC, treatment with 3-FMA or MA resulted in a significant increase in ROS, 4-HNE or protein carbonyl (4 h: P < 0.01. 12 h: P < 0.01. 1 d: P < 0.05). As presented in Fig. 2DeF, SCH23390 significantly attenuated increases in ROS (P < 0.01), 4-HNE (P < 0.01) and protein carbonyl (P < 0.05) induced by 3-FMA. However, sulpiride did not significantly affect oxidative damage induced by 3-FMA. In contrast, increases in ROS, 4-HNE and protein carbonyl induced by MA were significantly attenuated by not only SCH23390, but also sulpiride (SCH23390: P < 0.05. Sulpiride: P < 0.01). Sulpiride was more effective (ROS: P < 0.01. 4-HNE: P < 0.05. Protein carbonyl: P < 0.05) than SCH23390 in attenuating MA-induced oxidative stress. 3.3. Effects of dopamine receptor antagonists on 3-FMA-induced microgliosis and microglial differentiation into M1 or M2 type in the striatum of mice Microglial response associated with MA neurotoxicity appears to be a critical step in the neurodegeneration (Shin et al., 2014; Dang et al., 2016, 2017a). We demonstrated a substantial number of activated microglia occurred 1 d post-MA administration (Dang et al., 2016). Here we examined the changes in microglial activation at 4 h, 12 h and 1 d post-3-FMA and the effects of SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist on microglial activation and microglial

73

differentiation induced by 3-FMA (40 mg/kg) or MA (35 mg/kg). As shown in Fig. 3A, 3-FMA or MA caused a significant increase in Iba1 expression (4 h: P < 0.05. 12 h: P < 0.01. 1 d: P < 0.01). As shown in Fig. 3BeH, 3-FMA or MA significantly increased Iba-1 expression (P < 0.01), Iba-1-immunoreactivity (P < 0.01), the M1 phenotype mRNAs (CD16: P < 0.01. CD32: P < 0.01. CD86, post-3-FMA: P < 0.05. CD86, post-MA: P < 0.01) and either compound did not significantly change M2 phenotype mRNAs (Arginase 1 and CD206). SCH23390, but not sulpiride, significantly inhibited 3-FMA-induced Iba-1 expression (P < 0.01), Iba-1-immunoreactivity (P < 0.01), M1 phenotype mRNA expressions (CD16: P < 0.01. CD32: P < 0.05) and activated M2 phenotype mRNA expressions (Arginase 1: P < 0.01. CD206: P < 0.05). In contrast, both SCH23390 and sulpiride attenuated MA-induced Iba-1 expression (SCH23390: P < 0.05. Supiride: P < 0.01), Iba-1-immunoreactivity (SCH23390: P < 0.05. Supiride: P < 0.01), CD16 mRNA expression (SCH23390: P < 0.05. Supiride: P < 0.01), CD32 mRNA expression (SCH23390: P < 0.05. Supiride: P < 0.01), CD86 mRNA expression (SCH23390: P < 0.05. Supiride: P < 0.01). This attenuation was more pronounced in sulpiride treatment (Iba-1 expression: P < 0.05. Iba-1-immunoreactivity: P < 0.05. CD16: P < 0.05. CD32: P < 0.05) than in SCH23390 treatment. However, both dopamine receptor antagonists failed to activate M2 phenotype mRNA. 3.4. Effects of dopamine receptor antagonists on 3-FMA-induced increases in TUNEL-positive cells in the striatum of mice As we (Shin et al., 2012, 2014; Dang et al., 2016) and others (Deng and Cadet, 2000; Zhu et al., 2006a, 2006b) observed that the number of TUNEL-positive cells reached a maximal level 1 d postMA in Taconic ICR mice, we focused on this time-point. As shown in the experimental design in Fig. 4A, we examined whether SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist affects TUNEL-positive populations induced by 3-FMA (40 mg/kg) or MA (35 mg/kg) in Taconic ICR mice. As shown in Fig. 4B, a very little induction of TUNELpositive cells was observed in the absence of 3-FMA or MA. Treatment with 3-FMA resulted in a significant increase in TUNELpositive cells (P < 0.01). TUNEL-positive cells induced by 3-FMA was comparable to that induced by MA (P < 0.01). SCH23390, but not sulpiride, significantly attenuated an increase in TUNELpositive cells induced by 3-FMA (P < 0.01). In contrast, sulpiride was more efficacious (P < 0.05) than SCH23390 in attenuating MAinduced TUNEL-positive cells, although either compound significantly attenuated TUNEL-positive cells induced by MA (SCH23390: P < 0.05. Sulpiride: P < 0.01). 3.5. Effects of dopamine receptor antagonists on 3-FMA-induced change in pro-apoptotic and anti-apoptotic proteins in the striatum of mice We demonstrated that significant changes of pro-apoptotic and anti-apoptotic proteins were observed at 1 d post-MA (Dang et al., 2016). We tested whether SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist affects change in pro-apoptotic (i.e., Bax, cleaved caspase-3) and antiapoptotic (i.e., Bcl-2, Bcl-xl) proteins induced by 3-FMA (40 mg/ kg) or MA (35 mg/kg). As shown in Fig. 5AeD, treatment with 3FMA resulted in a significant increase in Bax expression (P < 0.01), and cleaved caspase-3 expression (P < 0.01), and in a significant decrease in Bcl-2 expression (P < 0.01), and Bcl-xl expression (P < 0.01). These changes by 3-FMA was comparable to those by MA (P < 0.01). SCH23390, but not sulpiride, significantly attenuated 3-FMA-induced changes in Bax- (P < 0.01), cleaved caspase-3- (P < 0.01), Bcl-2- (P < 0.01), and Bcl-xl-expressions

74

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

Fig. 1. Experimental design for understanding the effects of dopamine receptor antagonists on 3-FMA-induced hyperthermia in mice (A). Basal rectal temperature was measured 1 h before 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.) administration. SCH23390 (0.1 mg/kg, i.p.), a dopamine D1 receptor antagonist, or sulpiride (20 mg/kg, i.p.), a dopamine D2 receptor antagonist was given 30 min before 3-FMA or MA administration. Rectal temperature was measured four times at a 1 h time-interval after 3-FMA or MA administration. Effects of SCH or Sul on hyperthermia induced by 3-FMA or MA in mice (BeC). Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 6 animals. *P < 0.01 vs. Sal þ Sal. #P < 0.05, ##P < 0.01 vs. Sal þ 3-FMA or Sal þ MA. yP < 0.05, yy P < 0.01 vs. SCH þ MA (two-way ANOVA followed by Fisher's LSD pairwise comparisons).

(P < 0.01). In contrast, SCH23390 (Bax: P < 0.05. Cleaved caspase-3: P < 0.05. Bcl-2: P < 0.05. Bcl-xl: P < 0.01) and sulpiride (Bax: P < 0.01. Cleaved caspase-3: P < 0.01. Bcl-2: P < 0.01. Bcl-xl: P < 0.01) significantly attenuated MA-induced increase in pro-apoptotic proteins and decrease in anti-apoptotic proteins. On the other hand, the attenuation by sulpiride appeared to be more pronounced (Cleaved caspase-3: P < 0.05. Bcl-xl: P < 0.05) than that by

SCH23390 in response to MA insult. 3.6. Effects of dopamine receptor antagonists on 3-FMA-induced impairments of dopaminergic neurons in the striatum of mice We (Dang et al., 2016, 2017b) and others (Ares-Santos et al., 2014) demonstrated that a single, toxic MA dose (30e35 mg/kg,

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

75

Fig. 2. Effects of dopamine receptor antagonists on 3-FMA-induced oxidative stress in the striatum of mice. Changes in reactive oxygen species (ROS) (A), lipid peroxidation (4Hydroxynonenal; 4-HNE) (B) and protein oxidation (protein carbonyl) (C) 4 h, 12 h, and 1 d and effects of SCH or Sul on ROS (D), 4-HNE (E) and protein carbonyl (F) 4 h after treatment of 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.). Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 6 animals. *P < 0.05, **P < 0.01 vs. Sal or Sal þ Sal. #P < 0.05, ##P < 0.01 vs. Sal þ 3-FMA or Sal þ MA. yP < 0.05, yy P < 0.01 vs. SCH þ MA (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

76

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

Fig. 3. Effects of dopamine receptor antagonists on 3-FMA-induced microgliosis and microglial differentiation into M1 or M2 type in the striatum of mice. Changes in Iba-1 expression (A), and effects of SCH or Sul on the response to Iba-1-expression (B), Iba-1-immunoreactivity (C), microglial differentiation into M1 phenotype (DeF) and M2 phenotype (GeH) 1 d after the treatment of 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.). The information of gene primer sequences for RT-PCR analysis was shown in Table 1. Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 6 animals. *P < 0.05, **P < 0.01 vs. Sal or Sal þ Sal. #P < 0.05, ##P < 0.01 vs. Sal þ 3-FMA or Sal þ MA. yP < 0.05 vs. SCH þ MA (one-way ANOVA followed by Fisher's LSD pairwise comparisons). Scale bar ¼ 100 mm.

i.p.) significantly produces dopaminergic neuronal deficits in Taconic ICR mice. Here we investigated the changes in TH expression at 4 h, 12 h, and 1 d after 3-FMA treatment and the effects of SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist on changes in TH levels and dopaminergic parameters 1 d after 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.). As shown in Fig. 6A, a significant decrease of TH expression was observed after the treatment of 3-FMA (4 h: P < 0.05. 12 h: P < 0.05. 1 d: P < 0.01). As shown in Fig. 6BeG, significant decreases in TH expression (P < 0.01), THimmunoreactivity (P < 0.01), DA level (P < 0.01), DAT expression (P < 0.01), or VMAT-2 expression (P < 0.01) but a significant increase in DA turnover rate (P < 0.05) was observed 1 d after the treatment of 3-FMA. These changes were attenuated (TH expression: P < 0.01. TH-immunoreactivity: P < 0.01. DA level: P < 0.01. DAT expression: P < 0.01. VMAT-2 expression: P < 0.01. DA turnover rate: P < 0.05) by SCH23390, but not by sulpiride. In contrast, both SCH23390 and sulpiride significantly attenuated MA-induced decreases in TH expression, TH-immunoreactivity, DA level, DAT expression, VMAT-2 expression (SCH23390: P < 0.05. Sulpiride: P < 0.01), and an increase in DA turnover rate (Sulpiride: P < 0.05). The attenuation by sulpiride was more evident (TH expression: P < 0.05. TH-immunoreactivity: P < 0.05. DA level: P < 0.05) than that by SCH23390. Consistently, SCH23390 and/or sulpiride significantly altered the changes in TH expression and TH-

immunoreactivity 3 d (Supplementary Fig. S2).

after

3-FMA

or

MA

treatment

3.7. Effects of dopamine receptor antagonists on 3-FMA-induced behavioral impairments in mice We (Shin et al., 2012, 2014; Dang et al., 2017a) and others (Itoh et al., 1987; Walsh and Wagner, 1992; Chen et al., 2012) demonstrated that neurotoxic dose of MA leads to motor impairments. We investigated whether 3-FMA (40 mg/kg) produces behavioral impairments such as locomotor activity and rota-rod performance 1 d and 3 d post-3-FMA, and whether SCH23390, a dopamine D1 receptor antagonist, or sulpiride, a dopamine D2 receptor antagonist attenuates behavioral changes induced by 3-FMA in comparison with those of MA. As shown in Fig. 7AeB, treatment with 3-FMA or MA resulted in significant decreases in locomotor activity (1 d post3-FMA: P < 0.01. 3 d post-3-FMA: P < 0.01. 1 d post-MA: P < 0.01, 3 d post-MA: P < 0.01) and rota-rod performance (1 d post-3-FMA: P < 0.01. 3 d post-3-FMA: P < 0.01. 1 d post-MA: P < 0.01. 3 d postMA: P < 0.01). SCH23390, but not sulpiride, significantly ameliorated against 3-FMA-induced decreases in the locomotor activity (1 d: P < 0.01. 3 d: P < 0.01) and rota-rod performance (1 d: P < 0.05. 3 d: P < 0.01). Although both SCH23390 and sulpiride significantly attenuated MA-induced decreases in locomotor activity (SCH23390: 1 d: P < 0.05, 3 d: P < 0.01. Sulpiride: 1 d: P < 0.01, 3 d:

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

77

Fig. 4. Experimental design for understanding the effects of dopamine receptor antagonists on 3-FMA-induced increases in TUNEL-positive cells in the striatum of mice (A). Effects of SCH or Sul on the TUNEL-positive populations 1 d after the treatment of 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p) (B). Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 6 animals. *P < 0.01 vs. Sal þ Sal. #P < 0.05, ## P < 0.01 vs. Sal þ 3-FMA or Sal þ MA. yP < 0.05 vs. SCH þ MA (one-way ANOVA followed by Fisher's LSD pairwise comparisons). Scale bar ¼ 200 mm.

P < 0.01) and rota-rod performance (SCH23390: 3 d: P < 0.05. Sulpiride: 1 d: P < 0.05, 3 d: P < 0.01), sulpiride is more effective (Locomotor activity: 1 d: P < 0.01, 3 d: P < 0.05. Rota-rod: 3 d: P < 0.05) than SCH23390 in attenuating the behavioral loss.

4. Discussion In the present study, we demonstrated that treatment with 3FMA or MA resulted in hyperthermia, oxidative stress, microglial

78

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

Fig. 5. Effects of dopamine receptor antagonists on 3-FMA-induced change in pro-apoptotic and anti-apoptotic proteins in the striatum of mice. Effects of SCH or Sul on changes in Bax expression (A), cleaved caspase-3 expression (B), Bcl-2 expression (C) and Bcl-xl expression (D) 1 d after the treatment of 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.). Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 6 animals. *P < 0.01 vs. Sal þ Sal. #P < 0.05, ##P < 0.01 vs. Sal þ 3-FMA or Sal þ MA. yP < 0.05 vs. SCH þ MA (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

activation (microglial differentiation into M1 phenotype), and proapoptotic changes, followed by dopaminergic impairments (i.e., increase in DA turnover rate, and decreases in TH level, DAT-, and VMAT-2-expression) with behavioral impairments. We observed that dopamine D1 receptor mediates 3-FMA-induced neurotoxicities as well as mortality. In contrast, both dopamine D1 and D2 receptors mediate MA-induced hyperthermia, neurotoxicity and behavioral impairments; however, dopamine D2 receptor activation is more pronounced than dopamine D1 receptor activation in MA-induced neurotoxic consequences. Our finding reflects on the specific role for the dopamine receptors in the neurotoxic effects induced by amphetamine derivatives (Fig. 8). The hyperthermic response appears to be an important factor in the neurotoxicity induced by MA (Bowyer et al., 1994; Albers and Sonsalla, 1995; Farfel and Seiden, 1995). Hyperthermia, at least in part, has been shown to alter DAT function, and thereby increase intracellular accumulation of MA (Xie et al., 2000), promoting production of free radicals in the brain (Kil et al., 1996). The oxidation of DA induced by free radicals might potentiate dopaminergic damage (LaVoie and Hastings, 1999; Spencer et al., 2002). Here we propose that hyperthermia facilitates oxidative stress

induced by 3-FMA or MA, which is associated with neurotoxic consequences. Nevertheless, regulation of causes to produce hypothermia or prevent increases in core body temperature are, at least, protective against MA toxicity (Bowyer et al., 1994; Albers and Sonsalla, 1995). Accumulating evidence indicated that genetic or pharmacological inhibition of dopamine D1 or D2 receptor protected against hyperthermia induced by MA (Ito et al., 2008; Granado et al., 2011a; Ares-Santos et al., 2012; Dang et al., 2017a). Consistently, our results showed that dopamine D1 and D2 receptor antagonists protected MA-induced hyperthermia. In particular, the protective effect by dopamine D1 receptor antagonism against hyperthermia induced by 3-FMA was more evident than D2 receptor antagonism. Therefore, it is possible that hyperthermia induced by 3-FMA or MA requires activations of dopamine D1 and/ or D2 receptor. A previous report demonstrated that DA-dependent oxidative stress may be the initial event in MA neurotoxicity (Cubells et al., 1994). Oxidative burdens at early stage might be a prerequisite for neurotoxic scenarios induced by 3-FMA, and they are in line with MA case (Shin et al., 2012, 2014, 2017a). DA rapidly autooxidizes to form reactive quinone derivatives, hydrogen peroxide

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

79

Fig. 6. Effects of dopamine receptor antagonists on 3-FMA-induced dopaminergic impairments in the striatum of mice. The change in tyrosine hydroxylase (TH) expression (A) and effects of SCH or Sul on changes in TH-expression (B), TH-immunoreactivity (C), dopamine (DA) level (D), DA turnover rate (E), DA transporter (DAT)- (F), and vesicular monoamine transporter-2 (VMAT-2)-expressions (G) 1 d after the treatment of 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.). Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 6 animals. *P < 0.05, **P < 0.01 vs. Sal or Sal þ Sal. # P < 0.05, ##P < 0.01 vs. Sal þ 3-FMA or Sal þ MA. yP < 0.05 vs. SCH þ MA (one-way ANOVA followed by Fisher's LSD pairwise comparisons). Scale bar ¼ 1 mm.

and free radicals when MA redistributes DA from synaptic vesicles to cytoplasm (Graham et al., 1978; Slivka and Cohen, 1985; Cubells et al., 1994; Acikgoz et al., 1998). Thus, it is plausible that DAdependent oxidative stress may contribute to the specific neurotoxicity induced by 3-FMA or MA. Importantly, Granado et al. (2011b) demonstrated that nuclear factor-erythroid 2-related factor 2 (Nrf2) knockout mice exacerbated MA-induced oxidative stress, and damage to dopamine neurons in the striatum, suggesting that the protective role of Nrf2 in MA-induced neurotoxicity. A possible role of Nrf2 in 3-FMA-induced neurotoxicity remains to be determined. Neither 3-FMA nor MA produced nigral loss (Supplementary Fig. S3) or GFAP-labeled astrogliosis in the striatum (Supplementary Fig. S4). Current result is in line with our previous report that a single, high dose of MA does not significantly alter THimmunoreactivity in the substantia nigra as well as GFAP-

immunoreactivity in the striatum (Dang et al., 2017b). However, Iba-1-labeled microgliosis in the striatum is specific for the neurotoxicity induced by 3-FMA or MA, although precise mechanism remains elusive. A strong support for a dual role of microglia may be due to distinct microglial phenotypes, which have been broadly categorized into M1 (classically activated, pro-inflammatory) and M2 (alternatively activated, anti-inflammatory) (Martinez and Gordon, 2014; Franco and Fernandez-Suarez, 2015; Kawabori and Yenari, 2015; Thompson and Tsirka, 2017). We observed that 3-FMA or MA administration significantly increased mRNA expression of M1 phenotypic markers (CD16, CD32, and CD86) and did not significantly change mRNA expression of M2 phenotypic markers (Arginase 1 and CD206), suggesting that microgliosis induced by 3-FMA and MA treatment leads to neuroinflammation. In this study, dopamine D1 receptor antagonism to 3-FMA insult by SCH23390

80

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

Fig. 7. Effects of dopamine receptor antagonists on 3-FMA-induced behavioral impairments in mice. Effects of SCH or Sul on changes in locomotor activity (A) and rota-rod performance (B) 1 d and 3 d after the treatment of 3-FMA (40 mg/kg, i.p.) or MA (35 mg/kg, i.p.). Sal ¼ Saline. SCH ¼ SCH23390 (0.1 mg/kg, i.p), a dopamine D1 receptor antagonist. Sul ¼ sulpiride (20 mg/kg, i.p), a dopamine D2 receptor antagonist. Each value is the mean ± S.E.M of 12 animals. *P < 0.01 vs. Sal þ Sal. #P < 0.05, ##P < 0.01 vs. Sal þ 3FMA or Sal þ MA. yP < 0.05, yyP < 0.01 vs. SCH þ MA (one-way ANOVA followed by Fisher's LSD pairwise comparisons).

up-regulated M2 phenotype (i.e., Arginase 1 and CD206 mRNA expressions). However, both SCH23390 and sulpiride did not affect M2 phenotype mRNA levels in MA insult. Although this discrepancy remains to be fully elucidated, we cannot rule out the possibility that a fluorine atom at the 3 position of phenyl group in the chemical structure of 3-FMA may produce this different profile of toxicity as compared to MA. MA treatment up-regulates pro-apoptotic protein (i.e., Bax) and down-regulates anti-apoptotic proteins (i.e., Bcl-2, Bcl-xl) in the brain, which consequently induce caspase activation (Jayanthi et al., 2001; Nguyen et al., 2015; Dang et al., 2017a; Timucin and Basaga, 2017). It has been reported that caspase activation is involved in the induction of TUNEL-positive cells via apoptotic processes after a single, high dose of MA in the striatum of mice (Dang et al., 2016, 2017a; Shin et al., 2017a). Importantly, compelling evidence indicated that caspase activation regulates microglial activation via a PKCd-dependent pathway (Burguillos et al., 2011). Indeed, our previous reports demonstrated that PKCd mediates dopaminergic degeneration in neuroinflammation induced by MA

(Shin et al., 2011, 2012, 2014; Dang et al., 2015) or para-methoxymethamphetamine (PMMA) (Shin et al., 2016). The combination of oxidative stress and microglial activation generates a vicious cycle, that appears to lead to a progressive neuronal apoptosis (Hald and Lotharius, 2005; Shin et al., 2012, 2014; Dang et al., 2016). We propose that oxidative stress, microglial activation and proapoptotic signaling might be overlapping neurotoxic outcomes in 3-FMA and MA, although underlying mechanism of 3-FMA on dopaminergic receptor modulation is different from that of MA. Neurons in the striatum, unlike those in the cerebral cortex and cerebellum, do not form a layered or columnar structure. Although they appear to be randomly distributed, they are actually scattered in two embryologically different compartments called striosomes (often referred to as “patches” in rodents) and the matrix. The striosome compartment is embryologically older and the “dopamine island,” observed only during development, corresponds to patch/striosome. The matrix develops later and eventually accounts for approximately 85% of the entire striatum (Johnston et al., 1990; Nakamura et al., 2009; Fujiyama et al., 2015). The matrix

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

81

Fig. 8. A schematic depiction on the role of dopamine receptors in neurotoxicity induced by 3-FMA or MA. Treatment with 3-FMA or MA resulted in a significant hyperthermia and early oxidative stress followed by microglial activation, pro-apoptotic process, dopaminergic impairments with behavioral loss. SCH23390, a dopamine D1 receptor antagonist attenuated 3-FMA-induced neurotoxicity, while SCH23390, a dopamine D1 receptor antagonist or sulpiride, a dopamine D2 receptor antagonist protected against MA-induced neurotoxicity. As indicated previous report (Dang et al., 2017a), we confirmed that dopamine D2 antagonism by sulpiride were more pronounced than dopamine D1 antagonism by SCH23390 in attenuating MA-induced neurotoxicity. Interestingly, SCH23390 treatment positively modulated 3-FMA-induced microglial activation (i.e., SCH23390 inhibited M1 phenotype in response to 3-FMA, but activated M2 phenotype), while this phenomenon remains to be eluciated.

compartment is densely stained with acetylcholinesterase, and calbindin and somatostatin are expressed at relatively high levels (Graybiel and Ragsdale, 1978; Gerfen, 1992; Fujiyama et al., 2015). The striosome compartment is rich in m-opioid receptors (Delfs et al., 1994; Mansour et al., 1994; Nakamura et al., 2009; Fujiyama et al., 2015). Granado et al. (2010) provide the first evidence that MA produces a greater loss of TH/DAT-positive terminals in the striosomes than in the matrix, suggesting that the striosomes are differentially affected by MA. They also propose that the increased susceptibility of the striosomal compartment to the damaging effects of MA may be related to a lower antioxidant capacity in

striosomes than in matrix (Granado et al., 2010). A similar pattern of greater striosomal damage in the striatum has been observed following administration of MDMA (Granado et al., 2008a, 2008b). Therefore, we raise the possibility that 3-FMA also could induce similar striosomal damage in the striatum. Dopaminergic signaling involves a delicate balance between DA release and re-uptake by the pre-synaptic nerve terminal. Normally, neuronal activation promotes vesicular release of DA into the synapse. DAT removes DA from the synapse and VMAT-2 transports cytoplasmic DA into vesicles for storage, and protection from oxidation and reactive consequences (Riddle et al., 2006; Volz et al.,

82

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

2009). Accordingly, dysfunction of DAT and/or VMAT-2 leads to dopaminergic damage (Riddle et al., 2005). The rapid decrease in DAT activity may be the result of MA-induced ROS, because DAT is especially susceptible to oxidative damage formed after MA administration (Fleckenstein et al., 1997). Our results suggest that the significant depletion of DA terminal markers (TH, DAT and VMAT-2) induced by 3-FMA or MA may reflect oxidative stress and neuroinflammation as cascade of events leading to DA terminal damage. We (Shin et al., 2012, 2014; Dang et al., 2017a) and others (Itoh et al., 1987; Chen et al., 2012; Ares-Santos et al., 2014) demonstrated that treatment with MA resulted in motor impairments in mice. Clinical evidences also indicated that the relationship between motor performance and MA-induced psychiatric effects in adolescent abusers (King et al., 2010; Moratalla et al., 2017). This behavioral losses may result from impaired dopaminergic system (Grace et al., 2010). Previous reports demonstrated that a possible correlation between a reduction in behavioral activity and the degree of striatal DA loss (Lenard and Beer, 1975; Jung et al., 2010). These reports indicated that behavioral impairments occur after a significant reduction in the striatal dopamine level. Although it remains to be futher eluciated, we raise the possibility that initial oxidative stress, neuroinflammation and the condition of impaired phosphorylation of TH (Dang et al., 2015) are prerequisite for dopaminergic neuronal dysfunction and behavioral deficits. Henley et al. (1989) investigated the anatomical localization of glutamate receptor subtype-selective ligand binding sites in chick brain using quantitative autoradiography. It has been demonstrated that [3H]L-glutamate binding is densely localized in the telencephalon, particularly in the neostriatum (Henley et al., 1989). A recent study demonstrated that MA induced decreases in transcript and protein expression of glutamate receptors, which are associated with decreased glutamatergic responses in striatal neurons (Jayanthi et al., 2014). Therefore, the precise role of glutamate receptors in the neurotoxic effects of 3-FMA remains to be determined. 5. Conclusion Our results suggested that activation of dopamine D1 receptor mediates 3-FMA-mediated oxidative stress, microgliosis, proinflammatory changes (i.e., exacerbated activation of M1-type microglia), apoptotic cell death, dopaminergic impairments, behavioral loss, and mortality. In contrast, MA-induced dopaminergic neurotoxicity requires activation of both dopamine D1 and D2 receptors, although D2R is more pronounced than D1R in mediating neurotoxicity induced by MA. This difference in activation of dopamine D1 and D2 receptors between 3-FMA and MA remains to be elucidated. Conflicts of interest The authors indicate no potential conflicts of interest. Acknowledgements This study was supported by a grant (14182MFDS979) from the Korea Food and Drug Administration, by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Science and ICT (#NRF2017R1A2B1003346), Republic of Korea, and by a grant (17H04252) from the Japan Society for the Promotion of Science (JSPS). PhuongTram Nguyen, Duy-Khanh Dang and Hai-Quyen Tran were supported by the BK21 PLUS program, National Research Foundation of Korea, Republic of Korea. Equipment at the Institute of New Drug

Development Research (Kangwon National University) was used for this study. The English in this document has been checked by at least two professional editors, both native speakers of English. Appendix A. Supplementary data Supplementary data related to this article can be found at https://doi.org/10.1016/j.neuint.2017.11.017. References Acikgoz, O., Gonenc, S., Kayatekin, B.M., Uysal, N., Pekcetin, C., Semin, I., Gure, A., 1998. Methamphetamine causes lipid peroxidation and an increase in superoxide dismutase activity in the rat striatum. Brain Res. 813, 200e202. Albers, D.S., Sonsalla, P.K., 1995. Methamphetamine-induced hyperthermia and dopaminergic neurotoxicity in mice: pharmacological profile of protective and nonprotective agents. J. Pharmacol. Exp. Ther. 275, 1104e1114. Angulo, J.A., Angulo, N., Yu, J., 2004. Antagonists of the neurokinin-1 or dopamine D1 receptors confer protection from methamphetamine on dopamine terminals of the mouse striatum. Ann. N. Y. Acad. Sci. 1025, 171e180. https://doi.org/ 10.1196/annals.1316.022. Ares-Santos, S., Granado, N., Oliva, I., O'Shea, E., Martin, E.D., Colado, M.I., Moratalla, R., 2012. Dopamine D(1) receptor deletion strongly reduces neurotoxic effects of methamphetamine. Neurobiol. Dis. 45, 810e820. https://doi.org/ 10.1016/j.nbd.2011.11.005. Ares-Santos, S., Granado, N., Moratalla, R., 2013. The role of dopamine receptors in the neurotoxicity of methamphetamine. J. Intern Med. 273, 437e453. https:// doi.org/10.1111/joim.12049. Ares-Santos, S., Granado, N., Espadas, I., Martinez-Murillo, R., Moratalla, R., 2014. Methamphetamine causes degeneration of dopamine cell bodies and terminals of the nigrostriatal pathway evidenced by silver staining. Neuropsychopharmacology 39, 1066e1080. https://doi.org/10.1038/npp.2013.307. Bowyer, J.F., Davies, D.L., Schmued, L., Broening, H.W., Newport, G.D., Slikker Jr., W., Holson, R.R., 1994. Further studies of the role of hyperthermia in methamphetamine neurotoxicity. J. Pharmacol. Exp. Ther. 268, 1571e1580. Bowyer, J.F., Robinson, B., Ali, S., Schmued, L.C., 2008. Neurotoxic-related changes in tyrosine hydroxylase, microglia, myelin, and the blood-brain barrier in the caudate-putamen from acute methamphetamine exposure. Synapse 62, 193e204. https://doi.org/10.1002/syn.20478. Burguillos, M.A., Deierborg, T., Kavanagh, E., Persson, A., Hajji, N., GarciaQuintanilla, A., Cano, J., Brundin, P., Englund, E., Venero, J.L., Joseph, B., 2011. Caspase signalling controls microglia activation and neurotoxicity. Nature 472, 319e324. https://doi.org/10.1038/nature09788. C.F.a.D.A, 2015. China Food and Drug Administration. Callaghan, R.C., Cunningham, J.K., Sajeev, G., Kish, S.J., 2010. Incidence of Parkinson's disease among hospital patients with methamphetamine-use disorders. Mov. Disord. 25, 2333e2339. https://doi.org/10.1002/mds.23263. Callaghan, R.C., Cunningham, J.K., Sykes, J., Kish, S.J., 2012. Increased risk of Parkinson's disease in individuals hospitalized with conditions related to the use of methamphetamine or other amphetamine-type drugs. Drug Alcohol Depend. 120, 35e40. https://doi.org/10.1016/j.drugalcdep.2011.06.013. Carvalho, M., Carmo, H., Costa, V.M., Capela, J.P., Pontes, H., Remiao, F., Carvalho, F., Bastos Mde, L., 2012. Toxicity of amphetamines: an update. Arch. Toxicol. 86, 1167e1231. https://doi.org/10.1007/s00204-012-0815-5. Chen, H., Wu, J., Zhang, J., Fujita, Y., Ishima, T., Iyo, M., Hashimoto, K., 2012. Protective effects of the antioxidant sulforaphane on behavioral changes and neurotoxicity in mice after the administration of methamphetamine. Psychopharmacol. Berl. 222, 37e45. https://doi.org/10.1007/s00213-011-2619-3. Choi, H.J., Yoo, T.M., Chung, S.Y., Yang, J.S., Kim, J.I., Ha, E.S., Hwang, O., 2002. Methamphetamine-induced apoptosis in a CNS-derived catecholaminergic cell line. Mol. Cells 13, 221e227. Cubells, J.F., Rayport, S., Rajendran, G., Sulzer, D., 1994. Methamphetamine neurotoxicity involves vacuolation of endocytic organelles and dopamine-dependent intracellular oxidative stress. J. Neurosci. 14, 2260e2271. Curtin, K., Fleckenstein, A.E., Robison, R.J., Crookston, M.J., Smith, K.R., Hanson, G.R., 2015. Methamphetamine/amphetamine abuse and risk of Parkinson's disease in Utah: a population-based assessment. Drug Alcohol Depend. 146, 30e38. https://doi.org/10.1016/j.drugalcdep.2014.10.027. Dang, D.K., Duong, C.X., Nam, Y., Shin, E.J., Lim, Y.K., Jeong, J.H., Jang, C.G., Nah, S.Y., Nabeshima, T., Kim, H.C., 2015. Inhibition of protein kinase (PK) Cd attenuates methamphetamine-induced dopaminergic toxicity via upregulation of phosphorylation of tyrosine hydroxylase at Ser40 by modulation of protein phosphatase 2A and PKA. Clin. Exp. Pharmacol. Physiol. 42, 192e201. https://doi.org/ 10.1111/1440-1681.12341. Dang, D.K., Shin, E.J., Nam, Y., Ryoo, S., Jeong, J.H., Jang, C.G., Nabeshima, T., Hong, J.S., Kim, H.C., 2016. Apocynin prevents mitochondrial burdens, microglial activation, and pro-apoptosis induced by a toxic dose of methamphetamine in the striatum of mice via inhibition of p47phox activation by ERK. J. Neuroinflammation 13, 12. https://doi.org/10.1186/s12974-016-0478-x. Dang, D.K., Shin, E.J., Mai, A.T., Jang, C.G., Nah, S.Y., Jeong, J.H., Ledent, C., Yamamoto, T., Nabeshima, T., Onaivi, E.S., Kim, H.C., 2017a. Genetic or

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84 pharmacological depletion of cannabinoid CB1 receptor protects against dopaminergic neurotoxicity induced by methamphetamine in mice. Free Radic. Biol. Med. 108, 204e224. https://doi.org/10.1016/j.freeradbiomed.2017.03.033. Dang, D.K., Shin, E.J., Tran, H.Q., Kim, D.J., Jeong, J.H., Jang, C.G., Nah, S.Y., Sato, H., Nabeshima, T., Yoneda, Y., Kim, H.C., 2017b. The role of system Xc- in methamphetamine-induced dopaminergic neurotoxicity in mice. Neurochem. Int. https://doi.org/10.1016/j.neuint.2017.04.013. Delfs, J.M., Kong, H., Mestek, A., Chen, Y., Yu, L., Reisine, T., Chesselet, M.F., 1994. Expression of mu opioid receptor mRNA in rat brain: an in situ hybridization study at the single cell level. J. Comp. Neurol. 345, 46e68. https://doi.org/ 10.1002/cne.903450104. Deng, X., Ladenheim, B., Tsao, L.I., Cadet, J.L., 1999. Null mutation of c-fos causes exacerbation of methamphetamine-induced neurotoxicity. J. Neurosci. 19, 10107e10115. Deng, X., Cadet, J.L., 2000. Methamphetamine-induced apoptosis is attenuated in the striata of copper-zinc superoxide dismutase transgenic mice. Brain Res. Mol. Brain Res. 83, 121e124. Deng, X., Wang, Y., Chou, J., Cadet, J.L., 2001. Methamphetamine causes widespread apoptosis in the mouse brain: evidence from using an improved TUNEL histochemical method. Brain Res. Mol. Brain Res. 93, 64e69. EMCDDA, 2009. EMCDDA-europol 2009 Annual Report on the Implementation of Council Decision 2005/387/JHA. Fantegrossi, W.E., Ciullo, J.R., Wakabayashi, K.T., De La Garza 2nd, R., Traynor, J.R., Woods, J.H., 2008. A comparison of the physiological, behavioral, neurochemical and microglial effects of methamphetamine and 3,4methylenedioxymethamphetamine in the mouse. Neuroscience 151, 533e543. https://doi.org/10.1016/j.neuroscience.2007.11.007. Farfel, G.M., Seiden, L.S., 1995. Role of hypothermia in the mechanism of protection against serotonergic toxicity. II. Experiments with methamphetamine, pchloroamphetamine, fenfluramine, dizocilpine and dextromethorphan. J. Pharmacol. Exp. Ther. 272, 868e875. Fleckenstein, A.E., Metzger, R.R., Wilkins, D.G., Gibb, J.W., Hanson, G.R., 1997. Rapid and reversible effects of methamphetamine on dopamine transporters. J. Pharmacol. Exp. Ther. 282, 834e838. Franco, R., Fernandez-Suarez, D., 2015. Alternatively activated microglia and macrophages in the central nervous system. Prog. Neurobiol. 131, 65e86. https:// doi.org/10.1016/j.pneurobio.2015.05.003. Fujiyama, F., Takahashi, S., Karube, F., 2015. Morphological elucidation of basal ganglia circuits contributing reward prediction. Front. Neurosci. 9, 6. https:// doi.org/10.3389/fnins.2015.00006. Gerfen, C.R., 1992. The neostriatal mosaic: multiple levels of compartmental organization. Trends Neurosci. 15, 133e139. Gluck, M.R., Moy, L.Y., Jayatilleke, E., Hogan, K.A., Manzino, L., Sonsalla, P.K., 2001. Parallel increases in lipid and protein oxidative markers in several mouse brain regions after methamphetamine treatment. J. Neurochem. 79, 152e160. Grace, C.E., Schaefer, T.L., Herring, N.R., Graham, D.L., Skelton, M.R., Gudelsky, G.A., Williams, M.T., Vorhees, C.V., 2010. Effect of a neurotoxic dose regimen of (þ)-methamphetamine on behavior, plasma corticosterone, and brain monoamines in adult C57BL/6 mice. Neurotoxicol Teratol. 32, 346e355. https:// doi.org/10.1016/j.ntt.2010.01.006. Graham, D.G., Tiffany, S.M., Bell Jr., W.R., Gutknecht, W.F., 1978. Autoxidation versus covalent binding of quinones as the mechanism of toxicity of dopamine, 6hydroxydopamine, and related compounds toward C1300 neuroblastoma cells in vitro. Mol. Pharmacol. 14, 644e653. Granado, N., Escobedo, I., O'Shea, E., Colado, I., Moratalla, R., 2008a. Early loss of dopaminergic terminals in striosomes after MDMA administration to mice. Synapse 62, 80e84. https://doi.org/10.1002/syn.20466. Granado, N., O'Shea, E., Bove, J., Vila, M., Colado, M.I., Moratalla, R., 2008b. Persistent MDMA-induced dopaminergic neurotoxicity in the striatum and substantia nigra of mice. J. Neurochem. 107, 1102e1112. https://doi.org/10.1111/j.14714159.2008.05705.x. Granado, N., Ares-Santos, S., O'Shea, E., Vicario-Abejon, C., Colado, M.I., Moratalla, R., 2010. Selective vulnerability in striosomes and in the nigrostriatal dopaminergic pathway after methamphetamine administration : early loss of TH in striosomes after methamphetamine. Neurotox. Res. 18, 48e58. https://doi.org/ 10.1007/s12640-009-9106-1. Granado, N., Ares-Santos, S., Oliva, I., O'Shea, E., Martin, E.D., Colado, M.I., Moratalla, R., 2011a. Dopamine D2-receptor knockout mice are protected against dopaminergic neurotoxicity induced by methamphetamine or MDMA. Neurobiol. Dis. 42, 391e403. https://doi.org/10.1016/j.nbd.2011.01.033. Granado, N., Lastres-Becker, I., Ares-Santos, S., Oliva, I., Martin, E., Cuadrado, A., Moratalla, R., 2011b. Nrf2 deficiency potentiates methamphetamine-induced dopaminergic axonal damage and gliosis in the striatum. Glia 59, 1850e1863. https://doi.org/10.1002/glia.21229. Graybiel, A.M., Ragsdale Jr., C.W., 1978. Histochemically distinct compartments in the striatum of human, monkeys, and cat demonstrated by acetylthiocholinesterase staining. Proc. Natl. Acad. Sci. U. S. A. 75, 5723e5726. Hald, A., Lotharius, J., 2005. Oxidative stress and inflammation in Parkinson's disease: is there a causal link? Exp. Neurol. 193, 279e290. https://doi.org/10.1016/ j.expneurol.2005.01.013. Henley, J.M., Moratallo, R., Hunt, S.P., Barnard, E.A., 1989. Localization and quantitative autoradiography of glutamatergic ligand binding sites in chick brain. Eur. J. Neurosci. 1, 516e523. Ito, M., Numachi, Y., Ohara, A., Sora, I., 2008. Hyperthermic and lethal effects of methamphetamine: roles of dopamine D1 and D2 receptors. Neurosci. Lett. 438,

83

327e329. https://doi.org/10.1016/j.neulet.2008.04.034. Itoh, T., Murai, S., Yoshida, H., Masuda, Y., Saito, H., Chen, C.H., 1987. Effects of methamphetamine and morphine on the vertical and horizontal motor activities in mice. Pharmacol. Biochem. Behav. 27, 193e197. Iwashita, A., Mihara, K., Yamazaki, S., Matsuura, S., Ishida, J., Yamamoto, H., Hattori, K., Matsuoka, N., Mutoh, S., 2004. A new poly(ADP-ribose) polymerase inhibitor, FR261529 [2-(4-chlorophenyl)-5-quinoxalinecarboxamide], ameliorates methamphetamine-induced dopaminergic neurotoxicity in mice. J. Pharmacol. Exp. Ther. 310, 1114e1124. https://doi.org/10.1124/ jpet.104.068932. Jayanthi, S., Ladenheim, B., Cadet, J.L., 1998. Methamphetamine-induced changes in antioxidant enzymes and lipid peroxidation in copper/zinc-superoxide dismutase transgenic mice. Ann. N. Y. Acad. Sci. 844, 92e102. Jayanthi, S., Deng, X., Bordelon, M., McCoy, M.T., Cadet, J.L., 2001. Methamphetamine causes differential regulation of pro-death and anti-death Bcl-2 genes in the mouse neocortex. Faseb J. 15, 1745e1752. Jayanthi, S., McCoy, M.T., Chen, B., Britt, J.P., Kourrich, S., Yau, H.J., Ladenheim, B., Krasnova, I.N., Bonci, A., Cadet, J.L., 2014. Methamphetamine downregulates striatal glutamate receptors via diverse epigenetic mechanisms. Biol. Psychiatry 76, 47e56. https://doi.org/10.1016/j.biopsych.2013.09.034. Johnston, J.G., Gerfen, C.R., Haber, S.N., van der Kooy, D., 1990. Mechanisms of striatal pattern formation: conservation of mammalian compartmentalization. Brain Res. Dev. Brain Res. 57, 93e102. Jung, B.D., Shin, E.J., Nguyen, X.K., Jin, C.H., Bach, J.H., Park, S.J., Nah, S.Y., Wie, M.B., Bing, G., Kim, H.C., 2010. Potentiation of methamphetamine neurotoxicity by intrastriatal lipopolysaccharide administration. Neurochem. Int. 56, 229e244. https://doi.org/10.1016/j.neuint.2009.10.005. Kawabori, M., Yenari, M.A., 2015. The role of the microglia in acute CNS injury. Metab. Brain Dis. 30, 381e392. https://doi.org/10.1007/s11011-014-9531-6. Kelleher, C., Christie, R., Lalor, K., Fox, J., Bowden, M., O'Donnell, C., 2011. An Overview of New Psychoactive Substances and the Outlets Supplying Them. National Advisory Committee on Drugs. Kil, H.Y., Zhang, J., Piantadosi, C.A., 1996. Brain temperature alters hydroxyl radical production during cerebral ischemia/reperfusion in rats. J. Cereb. Blood Flow. Metab. 16, 100e106. https://doi.org/10.1097/00004647-199601000-00012. Kim, H.C., Jhoo, W.K., Choi, D.Y., Im, D.H., Shin, E.J., Suh, J.H., Floyd, R.A., Bing, G., 1999. Protection of methamphetamine nigrostriatal toxicity by dietary selenium. Brain Res. 851, 76e86. King, G., Alicata, D., Cloak, C., Chang, L., 2010. Psychiatric symptoms and HPA Axis function in adolescent methamphetamine users. J. Neuroimmune Pharmacol. 5, 582e591. https://doi.org/10.1007/s11481-010-9206-y. LaVoie, M.J., Hastings, T.G., 1999. Dopamine quinone formation and protein modification associated with the striatal neurotoxicity of methamphetamine: evidence against a role for extracellular dopamine. J. Neurosci. 19, 1484e1491. Laws, T.N.A.f.M.S.D., 2015. Changes to State Controlled Substance Schedules: Bill Status Update. Legislature, U.S., 2017. Utah Controlled Substances Act. Lenard, L.G., Beer, B., 1975. Relationship of brain levels of norepinephrine and dopamine to avoidance behavior in rats after intraventricular administration of 6-hydoxydopamine. Pharmacol. Biochem. Behav. 3, 895e899. Mansour, A., Fox, C.A., Burke, S., Meng, F., Thompson, R.C., Akil, H., Watson, S.J., 1994. Mu, delta, and kappa opioid receptor mRNA expression in the rat CNS: an in situ hybridization study. J. Comp. Neurol. 350, 412e438. https://doi.org/10.1002/ cne.903500307. Marona-Lewicka, D., Rhee, G.S., Sprague, J.E., Nichols, D.E., 1995. Psychostimulantlike effects of p-fluoroamphetamine in the rat. Eur. J. Pharmacol. 287, 105e113. Martinez, F.O., Gordon, S., 2014. The M1 and M2 paradigm of macrophage activation: time for reassessment. F1000Prime Rep. 6 https://doi.org/10.12703/p6-13. Mendieta, L., Granado, N., Aguilera, J., Tizabi, Y., Moratalla, R., 2016. Fragment C domain of tetanus toxin mitigates methamphetamine neurotoxicity and its motor consequences in mice. Int. J. Neuropsychopharmacol. 19 https://doi.org/ 10.1093/ijnp/pyw021. Metzger, R.R., Haughey, H.M., Wilkins, D.G., Gibb, J.W., Hanson, G.R., Fleckenstein, A.E., 2000. Methamphetamine-induced rapid decrease in dopamine transporter function: role of dopamine and hyperthermia. J. Pharmacol. Exp. Ther. 295, 1077e1085. Moratalla, R., Khairnar, A., Simola, N., Granado, N., Garcia-Montes, J.R., Porceddu, P.F., Tizabi, Y., Costa, G., Morelli, M., 2017. Amphetamine-related drugs neurotoxicity in humans and in experimental animals: main mechanisms. Prog. Neurobiol. 155, 149e170. https://doi.org/10.1016/ j.pneurobio.2015.09.011. Nakajima, A., Yamada, K., Nagai, T., Uchiyama, T., Miyamoto, Y., Mamiya, T., He, J., Nitta, A., Mizuno, M., Tran, M.H., Seto, A., Yoshimura, M., Kitaichi, K., Hasegawa, T., Saito, K., Yamada, Y., Seishima, M., Sekikawa, K., Kim, H.C., Nabeshima, T., 2004. Role of tumor necrosis factor-alpha in methamphetamineinduced drug dependence and neurotoxicity. J. Neurosci. 24, 2212e2225. https://doi.org/10.1523/jneurosci.4847-03.2004. Nakamura, K.C., Fujiyama, F., Furuta, T., Hioki, H., Kaneko, T., 2009. Afferent islands are larger than mu-opioid receptor patch in striatum of rat pups. Neuroreport 20, 584e588. https://doi.org/10.1097/WNR.0b013e328329cbf9. Nakazono, Y., Tsujikawa, K., Kuwayama, K., Kanamori, T., Iwata, Y.T., Miyamoto, K., Kasuya, F., Inoue, H., 2013. Differentiation of regioisomeric fluoroamphetamine analogs by gas chromatographyemass spectrometry and liquid chromatographyetandem mass spectrometry. Forensic Toxicol. 31, 241e250. https://doi.org/ 10.1007/s11419-013-0184-7.

84

P.-T. Nguyen et al. / Neurochemistry International 113 (2018) 69e84

Nguyen, X.K., Lee, J., Shin, E.J., Dang, D.K., Jeong, J.H., Nguyen, T.T., Nam, Y., Cho, H.J., Lee, J.C., Park, D.H., Jang, C.G., Hong, J.S., Nabeshima, T., Kim, H.C., 2015. Liposomal melatonin rescues methamphetamine-elicited mitochondrial burdens, pro-apoptosis, and dopaminergic degeneration through the inhibition PKCdelta gene. J. Pineal Res. 58, 86e106. https://doi.org/10.1111/jpi.12195. O'Dell, S.J., Weihmuller, F.B., Marshall, J.F., 1993. Methamphetamine-induced dopamine overflow and injury to striatal dopamine terminals: attenuation by dopamine D1 or D2 antagonists. J. Neurochem. 60, 1792e1799. Oliver, C.N., Ahn, B.W., Moerman, E.J., Goldstein, S., Stadtman, E.R., 1987. Age-related changes in oxidized proteins. J. Biol. Chem. 262, 5488e5491. Riddle, E.L., Fleckenstein, A.E., Hanson, G.R., 2005. Role of monoamine transporters in mediating psychostimulant effects. Aaps J. 7, E847eE851. https://doi.org/ 10.1208/aapsj070481. Riddle, E.L., Fleckenstein, A.E., Hanson, G.R., 2006. Mechanisms of methamphetamine-induced dopaminergic neurotoxicity. Aaps J. 8, E413eE418. Samantha, J., Coward, H.J.H., 2016. Novel Psychoactives in New Zealand. The Royal Society of Chemistry. Sekine, Y., Ouchi, Y., Sugihara, G., Takei, N., Yoshikawa, E., Nakamura, K., Iwata, Y., Tsuchiya, K.J., Suda, S., Suzuki, K., Kawai, M., Takebayashi, K., Yamamoto, S., Matsuzaki, H., Ueki, T., Mori, N., Gold, M.S., Cadet, J.L., 2008. Methamphetamine causes microglial activation in the brains of human abusers. J. Neurosci. 28, 5756e5761. https://doi.org/10.1523/jneurosci.1179-08.2008. Shapiro, H., 2016. NPS Come of Age: a UK Overview. Shin, E.J., Jeong, J.H., Kim, H.J., Jang, C.G., Yamada, K., Nabeshima, T., Kim, H.C., 2007. Exposure to extremely low frequency magnetic fields enhances locomotor activity via activation of dopamine D1-like receptors in mice. J. Pharmacol. Sci. 105, 367e371. Shin, E.J., Duong, C.X., Nguyen, T.X., Bing, G., Bach, J.H., Park, D.H., Nakayama, K., Ali, S.F., Kanthasamy, A.G., Cadet, J.L., Nabeshima, T., Kim, H.C., 2011. PKCd inhibition enhances tyrosine hydroxylase phosphorylation in mice after methamphetamine treatment. Neurochem. Int. 59, 39e50. https://doi.org/10.1016/ j.neuint.2011.03.022. Shin, E.J., Duong, C.X., Nguyen, X.K., Li, Z., Bing, G., Bach, J.H., Park, D.H., Nakayama, K., Ali, S.F., Kanthasamy, A.G., Cadet, J.L., Nabeshima, T., Kim, H.C., 2012. Role of oxidative stress in methamphetamine-induced dopaminergic toxicity mediated by protein kinase Cd. Behav. Brain Res. 232, 98e113. https:// doi.org/10.1016/j.bbr.2012.04.001. Shin, E.J., Shin, S.W., Nguyen, T.T., Park, D.H., Wie, M.B., Jang, C.G., Nah, S.Y., Yang, B.W., Ko, S.K., Nabeshima, T., Kim, H.C., 2014. Ginsenoside Re rescues methamphetamine-induced oxidative damage, mitochondrial dysfunction, microglial activation, and dopaminergic degeneration by inhibiting the protein kinase Cd gene. Mol. Neurobiol. 49, 1400e1421. https://doi.org/10.1007/s12035013-8617-1. Shin, E.J., Dang, D.K., Tran, H.Q., Nam, Y., Jeong, J.H., Lee, Y.H., Park, K.T., Lee, Y.S., Jang, C.G., Hong, J.S., Nabeshima, T., Kim, H.C., 2016. PKCd knockout mice are protected from para-methoxymethamphetamine-induced mitochondrial stress and associated neurotoxicity in the striatum of mice. Neurochem. Int. 100, 146e158. https://doi.org/10.1016/j.neuint.2016.09.008. Shin, E.J., Dang, D.K., Tran, T.V., Tran, H.Q., Jeong, J.H., Nah, S.Y., Jang, C.G., Yamada, K., Nabeshima, T., Kim, H.C., 2017a. Current understanding of methamphetamineassociated dopaminergic neurodegeneration and psychotoxic behaviors. Arch. Pharm. Res. 40, 403e428. https://doi.org/10.1007/s12272-017-0897-y. Shin, E.J., Tran, H.Q., Nguyen, P.T., Jeong, J.H., Nah, S.Y., Jang, C.G., Nabeshima, T., Kim, H.C., 2017b. Role of mitochondria in methamphetamine-induced dopaminergic neurotoxicity: involvement in oxidative stress, neuroinflammation, and pro-apoptosis-A Review. Neurochem. Res. https://doi.org/10.1007/s11064017-2318-5.

Slivka, A., Cohen, G., 1985. Hydroxyl radical attack on dopamine. J. Biol. Chem. 260, 15466e15472. Spencer, J.P., Whiteman, M., Jenner, P., Halliwell, B., 2002. 5-s-Cysteinyl-conjugates of catecholamines induce cell damage, extensive DNA base modification and increases in caspase-3 activity in neurons. J. Neurochem. 81, 122e129. Statistics, O.f.N., 2015. Deaths Related to Drug Poisoning in England and Wales: 2014 Registrations. Teixeira-Gomes, A., Costa, V.M., Feio-Azevedo, R., Bastos Mde, L., Carvalho, F., Capela, J.P., 2015. The neurotoxicity of amphetamines during the adolescent period. Int. J. Dev. Neurosci. 41, 44e62. https://doi.org/10.1016/ j.ijdevneu.2014.12.001. Thomas, D.M., Walker, P.D., Benjamins, J.A., Geddes, T.J., Kuhn, D.M., 2004. Methamphetamine neurotoxicity in dopamine nerve endings of the striatum is associated with microglial activation. J. Pharmacol. Exp. Ther. 311, 1e7. https:// doi.org/10.1124/jpet.104.070961. Thompson, K.K., Tsirka, S.E., 2017. The diverse roles of microglia in the neurodegenerative aspects of central nervous system (CNS) autoimmunity. Int. J. Mol. Sci. 18 https://doi.org/10.3390/ijms18030504. Timucin, A.C., Basaga, H., 2017. Pro-apoptotic effects of lipid oxidation products: HNE at the crossroads of NF-kappaB pathway and anti-apoptotic Bcl-2. Free Radic. Biol. Med. 111, 209e218. https://doi.org/10.1016/ j.freeradbiomed.2016.11.010. Vili, V., Hannele, T., Martta, F., Perala, K., 2012. Finland e Drug Situation 2012. National Institute for Health and Welfare. Volz, T.J., Farnsworth, S.J., Rowley, S.D., Hanson, G.R., Fleckenstein, A.E., 2009. Agedependent differences in dopamine transporter and vesicular monoamine transporter-2 function and their implications for methamphetamine neurotoxicity. Synapse 63, 147e151. https://doi.org/10.1002/syn.20580. Walsh, S.L., Wagner, G.C., 1992. Motor impairments after methamphetamineinduced neurotoxicity in the rat. J. Pharmacol. Exp. Ther. 263, 617e626. Wang, Q., Shin, E.J., Nguyen, X.K., Li, Q., Bach, J.H., Bing, G., Kim, W.K., Kim, H.C., Hong, J.S., 2012. Endogenous dynorphin protects against neurotoxin-elicited nigrostriatal dopaminergic neuron damage and motor deficits in mice. J. Neuroinflammation 9, 124. https://doi.org/10.1186/1742-2094-9-124. Xie, T., McCann, U.D., Kim, S., Yuan, J., Ricaurte, G.A., 2000. Effect of temperature on dopamine transporter function and intracellular accumulation of methamphetamine: implications for methamphetamine-induced dopaminergic neurotoxicity. J. Neurosci. 20, 7838e7845. Xu, W., Zhu, J.P., Angulo, J.A., 2005. Induction of striatal pre- and postsynaptic damage by methamphetamine requires the dopamine receptors. Synapse 58, 110e121. https://doi.org/10.1002/syn.20185. Yu, J., Cadet, J.L., Angulo, J.A., 2002. Neurokinin-1 (NK-1) receptor antagonists abrogate methamphetamine-induced striatal dopaminergic neurotoxicity in the murine brain. J. Neurochem. 83, 613e622. Zhu, J.P., Xu, W., Angulo, J.A., 2005. Disparity in the temporal appearance of methamphetamine-induced apoptosis and depletion of dopamine terminal markers in the striatum of mice. Brain Res. 1049, 171e181. https://doi.org/ 10.1016/j.brainres.2005.04.089. Zhu, J.P., Xu, W., Angulo, J.A., 2006a. Methamphetamine-induced cell death: selective vulnerability in neuronal subpopulations of the striatum in mice. Neuroscience 140, 607e622. https://doi.org/10.1016/ j.neuroscience.2006.02.055. Zhu, J.P., Xu, W., Angulo, N., Angulo, J.A., 2006b. Methamphetamine-induced striatal apoptosis in the mouse brain: comparison of a binge to an acute bolus drug administration. Neurotoxicology 27, 131e136. https://doi.org/10.1016/ j.neuro.2005.05.014.