Role of endogenous retroviruses as mutagens: The hairless mutation of mice

Cell, Vol. 54, 383-391,

July 29, 1988, Copyright

0 1988 by Cell Press

Role of Endogenous Retmviruses The Hairless Mutation of Mice Jonathan P. Stoye: Sabine Fenner: Gavin E. Greenoak,t Chris Moran,t and John M. Coffin” *Tufts University School of Medicine Department of Molecular Biology and Microbiology Boston, Massachusetts 02111 TDepartment of Veterinary Pathology *and Department of Animal Husbandry University of Sydney 2006 New South Wales, Australia

Summary We have developed an experimental approach to distinguish the 40-60 endogenous C-type proviruses of mice and to determine their association with well characterized developmental and physiological mutations. The hairless (hr) mutation causes a variety of pleiotropic effects. Using oligonucleotide probes specific for different classes of murine leukemia virus, we have identified and cloned a provirus present in HRSN hrlhr animals but absent in HRS/J +I+. Genetic analyses showed perfect concordance between the hr phenotype and the presence of the provirus in a number of inbred and congenic strains of mice. Molecular analysis of a haired revertant established the causal relationship since it revealed the excision of most of the proviral genome leaving behind one long terminal repeat. These findings show that virus integration caused the hairless mutation and point to the utility of naturally occurring retroviral integrations for accessing the genome of the mouse. Introduction Numerous mutations influencing the development and physiology of the mouse have been described (Green, 1981), but few of the genes affected have been identified. As has been the case with simpler organisms, elucidation of the molecular basis of such mutations and isolation of the affected genes should prove highly rewarding, but there is a paucity of tools available for obtaining such genes from the mouse in pure form. A potentially fruitful approach to this problem is analogous to “transposon tagging;’ in which the insertion of foreign DNA both causes a mutation and provides a marker for its subsequent molecular cloning. Indeed, some interesting mutations have been observed and analyzed following insertion of DNA introduced into mouse early embryos either by microinjection (Woychik et al., 1985) or retroviral infection (Jaenisch et al., 1983; Soriano et al., 1987). This approach is useful, but rather haphazard, in that there is no good way to screen for any desired mutation and it requires a complex genetic and phenotypic analysis of any mutant strain so derived. An alternative strategy is to determine whether already known and well characterized spontaneous mutations

as Mutagens:

were caused by insertion of specific transposable elements that might serve as tags for their isolation. At present, the only group of mobile elements amenable to such analysis in mammals is endogenous retroviruses, of which the average mouse is estimated to contain 500-1000 copies in its genome (Stoye and Coffin, 1985). Indeed, at least one genetically well characterized mutation in mice (d for dilute-referring to the distinctive coat color) has been shown to be caused by insertion of an endogenous ecotropic provirus (Jenkins et al., 1981; Copeland et al., 1983). However, this approach has been limited to the ecotropic proviruses that comprise a relatively small fraction (
Cell 384

-PT

mPT hr hr

hr +

+ +

hr hr

hr +

-X + +

hr hr

hr +

+ +

B II

MX40A

;

pj

- probe JS5

“9’1;

7

MX40B

-

probe BgE

-

probe BgX

Figure 2. Restriction Enzyme Maps of the Partial Proviral Clones MX4OA and MX40B Two clones corresponding to the hr associated provirus were initially cloned in Charon 27, then transferred to Bluescribe plus for detailed mapping. MX40A is a 5.4 kb BamHI-Hindlll fragment containing some of PO/, env, the 3’ LTR and 0.5 kb of 3’ flanking DNA. MX40B is a 3.1 kb EcoRl fragment containing some of env, the 3’ LTR, and 1 kb of flanking cell DNA. Restriction sites shown are: B, BamHI; H, Hindlll; E, EcoRI; Bg, Bglll; K, Kpnl; and X, Xbal. Thin lines and thick lines correspond to viral and cell sequences, respectively. The open box shows the position of the LTR. Also shown are two flanking sequence probes, BgE and BgX, used to probe genomic DNA and the location of the JS5 reactive sequences.

1

2

3

Figure 1. Non-Ecotropic MLV Content of HRS/J Mice EcoRI-digested DNA (10 ug) of HRS/J hr/hr(lane l), hr/+ (lane 2) +/+ (lane 3) DNA was electrophoresed and transferred to nitrocellulose filters. The filter shown in the left panel was probed with JS4 for modified polytropic proviruses, that in the center panel was probed with JS5 for polytropic proviruses, and that in the right panel was probed with a mixture of JS6 and JSlO for xenotropic proviruses. Size markers were from Hindlll digested lambda DNA. The arrows indicate the proviral fragment associated with hr.

hr. All inbred strains of mice contain four classes of endogenous MLV-related sequences, namely, ecotropic, xenotropit, polytropic, and modified polytropic (Stoye and Coffin, 1987). No two strains contain an identical set of endogenous proviruses. Each endogenous provirus is located at a unique site within the genome. Thus, if mouse DNA is digested with a restriction enzyme that cuts at a converved site within endogenous proviruses, individual proviruses will yield differently sized virus-cell junction fragments depending on the position of the nearest restriction site in the flanking cellular DNA sequence. In principle, therefore, it is easy to determine by Southern hybridization analysis whether two DNA samples differ in their proviral content provided that the probes utilized do not recognize too many cross-reacting viruses. We initially compared the proviral content of mutant and wild-type HRS/J mice. DNA samples made from HRSIJ hrlhr, hrl+, and +I+ animals were digested with EcoRI, electrophoresed, transferred to nitrocellulose, and probed with the three specific probes (Figure 1). Of the 42 total proviruses detected with these probes, no difference between the mice was seen with the modified polytropic (JS4) or xenotropic (JS6+10)

specific probes, However, a difference between the three samples was observed with the polytropic provirus probe (JS5): the hrlhrsample contains a 3.1 kb reactive band that is not present in the +I+ sample and appears to be present at half copy level in the heterozygous sample. Similar results were obtained with other digestions; HRS hrlhr contained an extra 5.4 kb band in Hindlll plus BamHl digested DNA and a 6.0 kb band in BamHl digested DNA (data not shown), ruling out the possibility that the difference between hrlhr and +I+ was due to a simple restriction site polymorphism. Comparison of four additional HRS hrlhrand hrl+ animals gave results similar to those shown in Figure 1; in the four hrlhr samples, a band of 3.1 kb with comparable intensity to the other bands in the autoradiogram was seen, and the corresponding band in the hrl+ samples was reduced in intensity (data not shown). These results were consistent with the idea that this provirus might have caused the hr mutation, but alternatively, might reflect the presence of a provirus closely linked to but not causally associated with the mutant allele. Cloning of the hr-Associated Provirus Before embarking on a more detailed genetic analysis of the relationship between the extra provirus and the hr mutation, we decided to obtain a probe specific for the sequence flanking the provirus to allow us to detect the nonviral allele and to obviate thenecessity of relying on the intensity of the 3.1 kb virus-containing fragment for distinguishing between homozygous and heterozygous animals. HRS hrlhr DNA was digested with EcoRl or with BamHl and Hindlll, and appropriately sized DNA fragments were purified by electrophoresis and cloned into the lambda vector, Charon 27. Libraries were screened with JS5 and two clones, MX40A and MX40B (with the

MLV Insertion 305

the hr Mutation

HRS/J

C57BU6

hr hr

size 23

Causes

hr +

+ +

hr hr

hr +

C3H

DBA/2J + +

hr hr

hr + + +

hr hr

hr + + +

WLHR hr hr

HR/DeH

hr hr hr + hr +

-

6.6

-

between MX40 and hr in Strains (5 ug) were probed with sequence probe BgE. 2, HRS hr/+; 3, HRSlJ

+/+; 4, C57BLWhr/hr; C57Bl.M; 7, DSARJ.

5, C57&/6J.hr/+, 6, hr/hr; 0, DSA12J. hr/+; 9, DSAI2J; 10, C3HIHeJ. hrlhr; 11, CSH/HeJ.hr/+; 12, C3HIHeJ; 13, WLHR hr/hr; 14, WLHR hr/+; 15, HRlDeH hrhr; and 16, HRlDeH hr/+,

-

9.4

Figure 3. Association Six Inbred or Congenic EcoRt digested DNAs the MX40 flanking Lanes: 1, HRSIJ hvhr;

‘: 4.4

-

2.3

_

2.0

-

123456

7

8

9 IO

11 12 13

shown in Figure 2), were isolated. A 700 bp Bglll-EcoRI fragment of mouse DNA was subcloned for synthesis of a flanking sequence probe (probe BgE; Figure 2). This probe reacted with a single copy band of the appropriate size in HRS hr/hr DNA as well as with a 5.5 kb EcoRl fragment in HRS +/+ (Figure 3). Since this probe also detected a significant background due to hybridization with repetitive DNA (as judged by the background smears visible in Figure 3) we subsequently subcloned a 350 bp Bglll-Xbal fragment (probe BgX; Figure 2) for use in later cloning studies. In addition, we sequenced the 1 kb of mouse flanking sequence in MX40B (some of which is shown in Figure 5; the remainder of the sequence is available upon request). This sequence revealed the presence of mouse 82 repeats (Krayev et al., 1982) and yielded no evidence for the presence of coding sequences, such as long open reading frames or obvious potential splice donor or acceptor sites. structures

Genetic Analysis of the Relationship between MX40 and the hr Mutation The hr mutation of HRSlJ mice is usually maintained by crossing hr/+ females with hr/hr males (HRSIJ hr/hr females are fertile, but do not nurse their young well). To directly test the linkage of the MX40 provirus and hr, we examined 30 hairless and 30 haired progeny of such a cross. Hybridization analysis of DNAs from these animals with the flanking sequence probe BgE showed that the 30 hairless animals were homozygous for the provirus since all contained a reactive 3.1 kb EcoRl fragment (data not shown). By contrast, all 30 hr/+ animals were heterozygous, showing two reactive EcoRl fragments of 3.1 kb and 5.5 kb in size. The absence of recombinants between MX40 and hr indicates the close genetic linkage between the two markers. Since many proviruses are shared among apparently unrelated strains of mice (Stoye and Coffin, 1988; J. Stoye,

14 15 16

W. Frankel, and J. Coffin, unpublished data), we next tested DNAs of a panel of 48 strains and substrains of mice (listed under Experimental Procedures) obtained from the Jackson Laboratory. All of these strains contained a 5.5 kb EcoRl fragment that reacted with probe BgE (data not shown), implying that no normal haired animals contained the provirus associated with hr in HRS/J mice. We next tested a variety of strains known, or believed, to carry the same mutant hairless allele. The hairless mutation apparently occurred in London in the 1920s (Crew and Mirskaia, 1931); pedigree records indicate that this mutation has been propagated in two independently derived segregating inbred strains, HRS/J and HR/De/H/lcr (Forbes, 1981). Three congenic lines have been derived by transferring the hr mutation from HRSlJ to C3H, C57BU8, and DBA/2 backgrounds. In addition, hairless mutations phenotypically indistinguishable from the original mutation are carried by the strains WLHR and HRAISkh. DNA samples from all these strains were tested for the presence of MX40 using the BgE flanking sequence probe. In all cases, hr/hr animals contained only the 3.1 kb EcoRl fragment, and hr/+ animals contained 3.1 kb and 5.5 kb fragments, whereas +I+ animals had only the 5.5 kb band (Figure 3 and data not shown). By contrast, an independent mutation at the hr locus, hP, gave only the 5.5 kb band (data not shown). Taken together, the HRS/J, HRIDeIHllcR, and WLHR strains have been inbred for nearly 300 generations with no segregation between the hr mutation and MX40. Analysis of a Haired Revertant Although consistent with a causal role of MX40 in the hr mutation, the genetic data presented in the preceding sections do not allow us to distinguish this possibility from extremely tight, but coincidental, linkage. The discovery of a revertant at the hr locus allowed us to address this issue. The HRA/Skh strain, in which the hr mutation is prop-

A

Eco RI

genotype

III H

H H HR HR

hr

hr +

hr +

+

Figure 4. Characterization of the Restriction Enzyme Sites around the hr Associated Viral Integration in Mutant and Revertant Mice (A) EcoRI- (lanes 1-5) and BamHI- (lanes 6-10) digested DNAs (5 pg each) of HFWJ h&r, HRS/J hr/+, HRSIJ +I+, HRAlSkh hr+lhr+, HRA/Skh hdhr mice were electrophoresed, transferred to nitrocellulose, and probed with the MX40 flanking sequence probe BgX. (B) The predicted structures of the wild-type, mutant, and revertant alleles of the hairless locus. Restriction sites shown are: B, BamHI; E, EcoRI; K, Kpnl. Lower case letters indicate sites that are presumed to be present by analogy with other endogenous polytropic viruses (Stoys and Coffin, 1997) but that were not demonstrated directly. Thin lines and thick lines correspond to viral and cell sequences, respectively. The open box shows the position of the LTR. The bracketed region shows the location of sequences presented in Figure 5.

Barn HI H

H

H HR HR

hr’ hr

hr hr

+

h;

hr

hr* hr

hr

+

h;

hr

+

kb 23 9.6 6.6

4.4

2.3

1234

B

567

8910

m-5.5-5.7EKBK

o-3.1

-D

t---6.2EKBK WI

k ?I

kbB II

K

E I

I

fl

-6.3~ -6.5EKBK WI

K

II

K PI

EB

EB II

agated in the homozygous form (Forbes, 1981) has been maintained at the University of Sydney since 1981. In 1984, one hairy offspring was found in a litter of hairless animals. Mice homozygous for the putative revertant allele were bred, and DNA was prepared from fifth generation homozygous hr+ animals. Details of the derivation and properties of the hr+/hr+ strain will be reported elsewhere. A possible mechanism for reversion of certain retroviral insertion mutations is homologous recombination between the two LTRs, leaving behind a solo LTR (Copeland et al., 1983; Varmus et al., 1981). To examine whether this had also occurred in the hr revertant, DNAs from HFWJ h&r, hr/+, and +/+ and HRAlSkh ht?hr+ and hrlhr were digested with EcoRl or BamHl and probed with flanking sequence BgX (Figure 4A). Revertant DNA contained EcoRl and BamHl fragments approximately 800 bp longer than the corresponding wild-type allele fragments. This is the size of the MX40 LTR and is consistent with the presence of a solo LTR in the revertant. A Kpnl digestion of these samples yielded the same size reactive fragment in

hr -

K $

the revertant and the mutant alleles, implying the presence of the LTR-associated Kpnl site (data not shown). A proposed scheme for the structure of the different alleles in shown in Figure 48. These data are consistent with an excision event involving homologous recombination between the two LTRs of MX40. However, they might also be explained by an illegitimate recombination between 5’flanking and internal viral sequences or recombination with another endogenous provirus. To distinguish these possibilities, we cloned the 8.3 kb EcoRl fragment from the revertant DNA and compared the nucleotide sequence of the virus-related region with that of the LTR of MX40B. The data in Figure 5 show that HRA/Skh hr+/hr+ DNA contains an LTR with identical sequence to that of MX40B. Three lines of evidence show that the solo LTR found in hr+ DNA arose by recombination between the 5’ and 3’ LTRs of MX40. First, the sequences are identical to one another but differ by a few nucleotides ((1%) from the LTRs of other endogenous polytropic viruses that have been determined (Khan and Martin, 1983; Ou et al., 1983; Stoye and Coffin, 1987).

MLV Insertion 307

Causes

the hr Mutation

10 hr

20

30

40

50

60

70

80

120 cenv 100 110 14Q TCMTAGATCCA AAGCGGAATCACGTGA&AMGATTTT

90 1

c l *

l

*

l

l

l *

l

.

l **

l *

l

l *

l

*

l .*

t

l

.

*

l

t

t

l

l

*tt

*

f

.

f

hr+

PP

150 hr

u,+

160 190 200 210 220 230 240 250 260 270 28!l GAMGACCCCACCATMGGCTTAGCAAGCTAGCTGCAGTAACGCCATTTT~M~CATG~GTACCAMGCT6AGTTCTCAAMGTTAC~MAGTTCAATT~GAT t**t***tt***.*r*ttt**..*******.*****.**.*****.*****~.******..*******...**************.********.*****************

hr+

c Cell U. + 290 300 310 320 330 340 350 360 370 WO 390 400 410 42cL. TAACAGTTMAGATTMGGCTGAATAATACTGG~CAGGGGCC~TATCGGTGGTCAAGCACCTGGGCCCCG6CTCA6~CM~CAGATG6CTCTCAGACGTCAGTGATA~AGMCTAGCTTCACTGATCTAGAA ****tt***.t****.*..*,****.***.*********.*.*.****.**..*******.****.***..****.*****.*.****.***.*****...*.*.************.****************,*****

hr hr+

430 440 450 460 470 480 490 500 510 520 530 540 550 560 AAATAGAGGTGCACAGTGCTCTGGCCACTCCTTGMCCTGTGTGTCTGCCAATGTTCTGACCAGGTTTGTGCCCATTGTTGMCC~CA~AGACCCTTTCCTCGTACCCCTCCCATACCCATTTCTTGAAMTAGACAT ***.t**ttt*tt*t*t*t***********.**..,******.*.********.*****.***.*****~**..****.**.**********.*****.**********.*************.*..**.******.** AAATAGA6GTWACAGTGCTCTGGCCwATGTTCTGACCAGGTTTGT-

hr hr+

570 580 590 600 610 620 630 640 650 660 670 680 690 700 TGTTTAGATCTAMMGTCCCACCTCAG~CCCCAAATGACCGGGAMTACCCCAAGCCTTATTCGAACTMCCMCCAWTCGC~CTCGCTTCTGTMCCGCGCTTTTTGCTCCCCA~CCCAGCCCTATMAMGG tt***tt*t***t**t**t*.******.********...*.********..***.*********************.*******~****************************************************** TGTTTAGATCTAAAMGTCCCACCTCA6T~CCCCAMTGACCGGGAMTACCCCMGCCTTATTCGAACTAACCAACCAGCTCGCTTCTCGCTTCTGTAACCGCGCTTTAAAAAGG

hr hr+

710 780 + R lb+ c- U,R + 730 740 750 760 770 a00 al0 a20 a30 a40 GTAAMACTCCACACTCG CGCCAGTCCTCCGATAWCTGTGTCGCCCGGGTACCCGTTCCTAAT~GCCTCTTGCTG~TGC CCGAATCGTGGTCTCGCTGGTCCTTGAGAGGGTCTCCTCACTGACT t**.*.************* ***************************************************************. ***.t*********************************************** GTAAAAACTCCACACTCGG CtECAGTCCTCCGATAGACTGTGTCGCCC6GGTACCGTT CCGMTCGTGGTCTCGCTGGTCCTTGAGAGGGTCTCCTCAGATTGATTGACT

hr hr+

,,,,,,, yr:,,,a,I,i+ a80 a90 900 910 920 'T,. 940 950 960 970 9ao ACCCACGTCGGGGGTCTTTC CA T6TATGCTAGGMCTMACCTGGACCCTCMCAGCAAGTGCTCTTMCCACTGAGCCMCTCTTCAmCCCTTCGTACCTTtTTTCACCTGGGAACTGGGGAT *************t******************.********************************.~******.******************************************* ACCCACGTCGGGGGTCTTTC CA TGTATGCTAGGAACTAMCCTGGACCCTCAACAGCAAGTGCTCTTAACCACTGAGCCMCTCTTCATTTtttTTCGTACCCATTCT~AAAGMGTCACCTGGGMCTGGGGAT

hr hr+

990 1000 1060 1070 1080 1090 1100 1010 1020 1030 1040 1050 1110 1120 ATGAATTTGGTTAGTAAAGTGATGACCAAGCAMCAGGAG~CCTACG~CCGGTCCCTA6CACCTGTGTTAMTCT66CCATGGTGCECCAC~G~GATCAGAGACCTGCAGGTTCCT~AACTCAATGATCAGCCAG *****************************************.*********.********.*.************.*****..*******~.**~**************~******************“******** ATGMTTTGGTTAGTAAAGTGATGACCMGCAMtAGGAGGACCTACGTTCCGGTCCCTAGCACCTGTGTTAMTCTGGCCATGGTGGCCCACTTGGGGATCAGAGACCTGCAGGTTCCTGGAACTCAATGATCAGCCAG

hr hr +

Figure

5. Sequences

of the Revertant

and Proviral

LTRs

The sequences of the region including the 3’ LTR in the mutant (hr) and revertant (hP) clones was determined by dideoxy sequencing. in sequences are closely related to the 3’ region of the other polytropic proviruses (Stoye and Coffin, 1967). Note the 4 bp duplication either end of the solo LTR in hr+ DNA.

Second, provirus integration is accompanied by a 4 bp duplication of host cell DNA (Varmus, 1983) and the 4 bp flanking the LTR from the hr+ sample (CCAT) are identical to one another and to the 4 bp to the 3’ side of the MX40B LTR. Third, probes prepared from the 5’side of the hr+ clone react with an EcoRl fragment of identical mobility from wild-type DNA as does the BgX probe (data not shown). Taken together, the results of these genetic and molecular analyses indicate that the hr mutation was caused by a retroviral insertion, and the reversion of the mutation has occurred by excision of the provirus. Discussion The rationale for this study was that the endogenous nonecotropic proviruses in inbred strains of mice might play a causal role in some fraction of the mutations that distin-

Provirus

Class

Modified polytropic polytropic xenotropic xenotropic

guish one strain from another. Even if the fraction of endogenous retroviral-induced mutations is small, the potential value of this approach to genetic analysis is large, since it provides a direct strategy for cloning of genes that are already well studied genetically and phenotypically. We are in the process of analyzing a variety of well characterized mutation6 in laboratory mice for association with endogenous proviruses. Table 1 lists the present status of this search (J. Stoye, W. Frankel, and J. Coffin, unpublished data). We are currently investigating these linkage6 in more detail; if they are all found to reflect causality, then we would estimate that some 5% of recessive mutation6 in inbred mice are due to insertion of C-type proviruses. At this level, it would be worth screening all spontaneous mutations for extra proviruses. The feasibility of cloning affected genes via the inserted provirus might be an important feature in deciding which mutations

Oligonucleotide 554 555 JS6 JSlO

The boxed (CCAT) at

GCAGCCTCTATACAACCTGGGACGGGAG GCAGCCTCTATAGTCCCTGAGACTGCCC ACGGTCTCTATGGTACCTGGGGCTCCCt ACGGTCTCTATGGTGCCTGGGGCTtCCC

Figure 6. Sequences Probes

of the Oligonucleotide

The sequences (6-3’) of JS4 (modified polytropic virus), JS5 (polytropic virus), and JS6 and 10 (xenotropic virus) are shown.

Cell 366

Table 1. Linkage

between

Proviruses

and Mouse

hairless ichthyosis retinal degeneration

causal

non-agouti Fv-1 t’* pvlfl 100 mouse

Miceb

provirus O-6.0 CM from ic provirus O-2.0 CM from rd provirus O-l .O CM from c provirus O-3.1 cM from a 4 proviruses O-2.9 CM from Fv-lb presence of extra provirus presence of 3 extra proviruses

albino

Over

Mutation

Linkagea

Locus

mutations

have been examined.

a Presented

as lower and upper

b Data from

CG = congenic

95% confidence

mice,

A complete

intervals

RI = recombinant

list of mutations

calculated

inbred

betweeen

LTRs.

Proviral

loss

by this

mechanism

CG, RI RI RI RI CG CG

showing

no evidence

from the method

for extra proviruses

is available

upon request.

of Silver (1965).

mice.

to propagate further. Even if some of the linkages presented in Table 1 are merely coincidental, the proviruses might map close enough to the affected loci to provide starting points for chromosome walking experiments, as appears to be the case with an ecotropic provirus linked to lethal yellow (Siracusa et al., 1987). Inbred strains of mice show a high degree of genetic polymorphism (Green, 1981), and it seems possible that proviral insertion might be at least partially responsible for this phenomenon. Since insertional mutagenesis is dependent on provirus mobility, an estimate of the rates of endogenous provirus amplification would be very helpful in assessing the mutagenic potential of C-type retroviruses. Different inbred stains of mice are polymorphic in endogenous provirus content (Jenkins et al., 1982; Wejman et al., 1984; Stoye and Coffin, 1988), suggesting that proviruses were acquired relatively recently. Is virus endogenization an ongoing process, or do these differences reflect integration that occurred prior to inbreeding? Ecotropic provirus amplification in inbred strains has been well documented (Rowe and Kozak, 1980; Steffen et al., 1982; Herr and Gilbert, 1982). Amplification is usually associated with viremic mothers and most probably occurs by infection of germ cells (Jenkins and Copeland, 1985), though there has been one report of virus amplification in a strain that does not usually produce large amounts of ecotropic virus (Mowat and Bernstein, 1983). The situation with the non-ecotropic proviruses is less well defined. To approach this question, we have used our oligonucleotide probes to investigate the proviral content of seven different substrains of AKR mice in which previous studies had documented the acquisition of 14 new ecotropic proviruses over a period of 80 years (Steffen et al., 1982). By contrast, only three new non-ecotropic proviruses were observed (J. Stoye and J. Coffin, unpublished data). This observation suggests that the current rate of non-ecotropic provirus acquisition, though low, is still perceptible, and that mutagenesis caused by insertion of these retroviruses is likely to be a continuing process. In the present example, we were able first to establish a genetic linkage and then to make the causal connection between hr and insertion of an endogenous provirus by analysis of an hr+ revertant in which the bulk of the provirus had been lost, apparently by homologous recombination

CG

ap-

pears to be a general and ongoing phenomenon as evidenced by the cloning of several solo LTR-containing clones corresponding to unselected deletions of nonecotropic proviruses from mouse DNA (Kuemmerle et al., 1987; J. Stoye and J. Coffin, unpublished data); thus, it remains formally possible that the excision event occurred independently of the reversion. However, estimates for proviral excision rates range from lO+ to 1O-7 per generation (Seperack et al., 1988; Varmus et al., 1981), so the probability of losing this particular provirus, which is genetically closely linked to hr, in the five generations if inbreeding that separate the mutant and revertant HRAlSkh samples can be considered vanishingly small. Furthermore, this mechanism of reversion is exactly analogous to five revertants of dilute, each one of which contained a solo LTR (Copeland et al., 1983). Thus, it seems appropriate to conclude that the proviral excision did, in fact, cause the reversion, and therefore, that the original insertion of this provirus caused the hr mutation. hr is an interesting mutation with multiple effects on skin and thymus function, including increased susceptibility to spontaneous and ultraviolet light-induced carcinogenesis (Gallagher et al., 1984). It is noteworthy that the susceptibility of shaved outbred hr+/hr+ animals to skin carcinogenesis is almost entirely abrogated after regimes known to induce 100% tumor incidence in hrlhr mice (G. Greenoak, C. H. Gallagher, V. Reeve, and P. Canfield, unpublished data), indicating the pleiotropic nature of the effects on hair coat and carcinogen susceptibility. A variety of independent mutations at the hairless locus have been described (Garber, 1952; Howard, 1940; Stelzner, 1983), and these mutations are phenotypically distinguishable. However, despite a number of detailed histological and ultrastructural studies, nothing is known about the product(s) of the hairless locus. The observation that the hr mutation is caused by a retroviral insertion should permit the characterization of the product of the wild-type allele and the molecular analysis of the different hr mutations. Using the flanking sequence probes prepared from the partial provirus clone, it will be possible to clone the chromosomal gion surrounding this locus and then, using these

re-

clones, to isolate the mRNA encoding the product of the wild-type gene. It should be noted, however, that it may not prove trivial sertion

to identify coding does not appear

sequences, to lie within

since the an exon.

proviral inSequence

MLV Insertion 389

Table

Causes

2. Description

the hr Mutation

of Mouse

Strains

Studied Generations of Inbreedinga

Strain

Genotype

This panel consisted of A/Hal, A/J, AIWySnJ, AKWJ, AU/!&J, BALB/cByJ, BALBIcJ, BUB/BnJ, CBA/Cal, CBA/NJ, CBA/CaH-TGJ, CBAIJ, C57BU6ByJ. C57BL/6J, C57BUlOJ, C57BUlOSnJ, C57BUKsJ, C57BR/cdJ, C57UJ, C58/J, CE/J, C3HeB/FeJ, C3HIHeJ, CBH/OuJ, C3HIHeSnJ. DBAIlJ, DBA12J, IILnJ. LPN, MAIMyJ, NZB/BlNJ, NZWlLacJ, P/J, PUJ, RBF/DnJ, RF/J, RIIISIJ, SJUJ, SM/J, STlbJ, SWRIJ, 129/J, 129/ReJ, 129/SvJ, WBIReJ, WCIReJ.

+/+

HRSIJ

hr/hr hr/+ +/+

>F80 >F80

1 1 2

WLHR

hr/hr hr/+

>FlO8 >Fl 08

1 1

HRlDelHllcr

hr/hr hr/+

>F97 >F97

3 3

C57BUGJ.HRS

hr/hr hr/+

NzhNzoFm WIB.N~F~

3 3

DBAl2J.HRS

hr/hr hr/+

bFz3 N&a

3 3

C3H/HeJ.C3HIHeN,HRS

hr/hr hr/+

NI& Nd12

3 3

HRA/Skh

hrlhr hr+lhr+

>N30 N5

4.5 5

p Number of generations of b (l)The Jackson Laboratory Poland (McArdle Laboratory and Cancer Hospital (Temple ty of Sydney (Sydney, New

Sourceb 1

inbreeding for the strains carrying hr (when known), given as the number of backcross (N) or intercross (F) matings. (Bar Harbor, ME); (2) N. Jenkins and N. Copeland (NCI-Frederick Cancer Research Facility, Frederick, MD); (3) A. for Cancer Research, Madison, WI). More details about these strains can be found in Poland et al. (1984); (4) Skin University, Philadelphia, PA); (5) The hr+ revertant was isolated in a colony of HRAlSkh maintained at the UniversiSouth Wales, Australia) since 1981, and then crossed to an outbred hairless stock.

analysis of the flanking DNAs we have cloned does not immediately suggest possible coding sequences. Indeed, the sequence just adjacent to the provirus on the 3’side is related to the 62 family of mouse interspersed repeat DNA (Krayev et al., 1982). Furthermore, the observation that reversion occurs by excision of the body of the provirus by homologous recombination between the two LTRs implies that the presence of a solo LTR does not interfere with the functioning of this gene. Presumably, the provirus is located either within an intron or in noncoding 5’ or 3’ sequences. Whether it exerts its effect at the transcriptional level, as seems to be the case with MO-MLV in the a-collagen gene (Breindl et al., 1984), or at a posttranscriptional processing stage obviously remains to be determined. Whether analysis of additional murine retrovirus-induced mutations will reveal the wide variety of mechanisms of insertional inactivation seen with Drosophila mobile elements (Levis et al., 1984; Zachar et al., 1985) remains to be determined. It seems likely that the MLVs we have studied here represent only the tip of the retroviral iceberg. These viruses are relatively recent inhabitants of the mouse germ line, but it seems very likely that remnants of earlier forms are also present, as has been shown with avian endogenous viruses (Dunwiddie et al., 1987). Furthermore, the C-type proviruses are greatly outnumbered by members of the intracisternal A-type and VL30 families (Stoye and Coffin, 1995), and it seems likely that several tenths of one percent of the mouse genome is made of retrovirus-like elements. It remains a formidable, but potentially rewarding,

task to assess the role of these elements in generating genetic diversity among members of the mus species and to utilize these elements in the study of the organization of the mouse genome. Experimental Sources

Procedures

and Preparation

of DNA Samples

The sources of the mice examined weight spleen DNA was prepared al., 1982).

DNA Digestion,

Transfer,

are given in Table 2. High molecular as previously described (Jenkins et

and Hybridization

High molecular weight DNA (5 or 10 ng) was digested with 50 U of restriction enzyme overnight at 37oC. Restriction enzymes were from Boehringer Mannheim Biochemicals (Indianapolis, IN) or from New England Biolabs (Beverly, MA). Samples were electrophoresed and transferred to nitrocellulose filters as previously described (Stoye and Coffin, 1988). Hybridizations with szP-labeled oligonucleotides specific for endogenous modified polytropic sequences (JS4), polytropic (JS5) and xenotropic (JS6 + JSlO) sequences (Figures 6) and subsequent washes were previously described, except that the hybridization solution contained 1% rather than 0.2% SDS (Stoye and Coffin, 1988). Hybridizations with probes labeled by nick-translation were carried out in 6x SSC, 10x Denhardt, 1% SDS with 50 c(g/ul of denatured salmon sperm DNA and yeast RNA. In these cases, the stringent 6rYC washes were in 0.1 x SSC 0.1% SDS. Filters were exposed for 2-3 weeks (oligonucleotide probes) or 3-5 days (nick-translated probes) at -70°C with an intensifying screen.

Cloning

of Proviral

and Cellular

DNAs

All DNA manipulations were carried out essentially Maniatis et al. (1982). In brief, EcoRl or BamHl plus high molecular weight DNAs from HRS/J hr/hr and were fractionated on low melting point agarose gels,

as described by Hindlll-digested HRA/Skh hr+/hr+ and DNAs of the

appropriate size classes were isolated by phenol extraction and to Charon 27 (Rimm et al., 1980) DNAs digested with the priate restriction enzymes, packaged in vitro and plated on E. coli. Plaque lifts were screened either with 3zP-labeled flanking sequences probe BgX under the conditions described Plate lysate DNAs were prepared from pure plaques, and the were subcloned into Bluescribe plus (Stratagene, San Diego, further restriction enzyme analysis.

ligated approLE392 JS5 or above. inserts CA) for

DNA Sequencing DNA sequences were determined by the dideoxy method (Sanger et al., 1977; Biggin et al., 1983) on restriction fragments subcloned into the Ml3 vectors mp18 and mp19 (New England Biolabs, Beverly, MA).

Acknowledgments We thank A. Poland, N. Jenkins, and N. Copeland for supplying tissue and DNA samples, M. Bostic-Fitzgerald for manuscript preparation, S. Morrison for photography, and N. Rosenberg, W. Frankel, N. Jenkins, N. Copeland, D. Forbes, J. Silver, C. Gallagher, V. Reeve, and P Canfield for helpful discussions. This work was supported by grants from the National Cancer Institute and the Australian National Health and Medical Research Council. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked ‘advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received

Howard, A. (1940). “Rhino” 37, 467-470.

MuLV integrations

an allele of hairless

in the mouse.

in AKRlJ J. Hered.

Jaenisch, R., Harbers, K., Schnieke, A., Liihler, J., Chumakov, I., Jahner, D., Grotkopp, D., and Hoffman, E. (1983). Germline integration of Moloney murine leukemia virus at the Movld locus leads to recessive lethal mutation and early embryonic death. Cell 32, 209-216. Jenkins, N. A., and Copeland, N. G. (1985). High frequency germ-line acquisition of ecotropic MuLV proviruses in SWR/J-RF/J hybrid mice. Cell 43, 811-819. Jenkins, N. A., Copeland, N. G., Taylor, B.A., and Lee, B. K. (1981). Dt lute (d) coat colour mutation of DBA/2J mice is associated with the site of integration of an ecotropic MuLV genome. Nature 293, 370-374. Jenkins, N. A., Copeland, N. G., Taylor, B. A., and Lee, 8. K. (1982). Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA in chromosomes of Mus musculus. J. Virol. 43, 26-36. Khan, A. S.. and Martin, M. A. (1983). Endogenous murine leukemia proviral long terminal repeats contain a unique 190 base-pair insert. Proc. Natl. Acad. Sci. USA 80, 2699-2703. Krayev, A. S., Markusheva, T. V, Kramerov, D. A., Ryskov, A. l?, Skryabin, K. G., Bayev, A. A., and Georgiev, G. P (1982). Ubiquitous transposon-like repeats Bl and 82 of the mouse genome: 82 sequencing. Nucl. Acids Res. 70, 7481-7475. Kuemmerle, N. B., Chang, L.-Y., Koh, C. K., Boone, L. R., and Yang, W. K. (1987). Characterization of two solitary long terminal repeats of murine leukemia virus that are conserved in the chromosome of laboratory inbred mouse strains. Virology 706, 379-388.

April 27, 1988.

Biggin, M. D., Gibson, T. J., and Hong, G. F. (1983). Buffer gradient gels and % label as an aid to rapid DNA sequence determination. Proc. Natl. Acad. Sci. USA 80, 3983-3985. Breindl, M., Habers, K., and Jaenisch, R. (1984). Retrovirus-induced lethal mutation in collagen I gene of mice is associated with an altered chromatin structure. Cell 38, 9-18. Co% J. M. (1982). Endogenous retroviruses. In Molecular Biology of Tumor Viruses, Part Ill. RNA Tumor Viruses, Vol. I, 2nd Edition, R. Weiss, N. Teich, H. E. Varmus, and J. M. Coffin, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 1109-1203. Copeland, N. G., Hutchinson, K. W., and Jenkins, N. A. (1983). Excision of the DBA ecotropic provirus in dilute coat-color revertants of mice occurs by homologous recombination involving the viral LTRs. Cell 33, 379-387. Crew, F. A. E., and Mirskaia, mouse. J. Genet. 25, 17-24.

Herr, W., and Gilbert, W. (1982). Germ-line mice. Nature 296, 885-868.

L. (1931). The character

“hairless”

in the

Dunwiddie, C. T., Resnick, R., Boyce-Jacino, M., Alegre, J. N., and Faras, A. J. (1986). Molecular cloning and characterization of gag-, poland env-related gene sequences in the ev-chicken. J. Virol. 59, 669-675. Forbes, P D. (1981). Hairless mice for carcinogenesis studies. In Proceedings of the 2nd NCIIEPAINIOSH Collaborative Workshop: Progress on Joint Environmental and Occupational Cancer Studies, H. F. Kraybill, I. C. Blackwood, and N. B. Freas, eds. 1982-3810132:561, US Government Printing Office, pp. 671-684. Gallagher, C. H., Canfield, P J., Greenoak, (1984). Characterization and histogenesis mouse produced by low-dosage incremental vest. Dermatol. 83, 169-174.

G. E., and Reeve, V. E. of tumors in the hairless ultraviolet radiation. J. In-

Garber, mouse.

E. D. (1952). Bald, a second J. Hered. 43, 45-46.

allele of hairless

in the house

Green, Mouse.

M. C. (1981). Genetic Variants and Strains of the Laboratory (Stuttgart and New York: Gustav Fischer Verlag), pp. l-476.

Green, N., Hiai, f-t., Elder, J. H., Schwartz, R. S., Khiroya, R. H.. Thomas, C. Y., Tsichlis, P N., and Coffin, J. M. (1980). Expression of leukemogenic recombinant viruses associated with a recessive gene in HRS/J mice. J. Exp. Med. 152. 249-264.

Levis, R., O’Hare, element insertions Cell 38, 471-481.

K., and Rubin, G. M. (1984). Effects of transposable on RNA encoded by the white gene of Drosophila.

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Meier, H., Myers, D. D., and Huebner, R. J. (1969). Genetic control by the hr-locus of susceptibility and resistance of leukemia. Proc. Natl. Acad. Sci. USA 63, 759-786. Morrissey, P J., Parkinson, D. R., Schwartz, R. S., and Waksal, S. D. (1980). Immunologic abnormalities in HRS/J mice. I. Specific defecit in T lymphocyte helper function in a mutant mouse. J. Immunol. 725, 1558-1562. Mowat. M., and Bernstein, A. (1983). Linkage of the Fv-2 gene to a newly inserted ecotropic retrovirus in Fv-2 congenic mice. J. Viral. 47, 471-477. C’Neill, R. R., Khan, A. S., Hoggan, M. D., Hartley, J. W., Martin, MA. and Repaske, R. (1986). Specific hybridization probes demonstrate fewer xenotropic than mink cell focus-forming murine leukemia virus env-related sequence in DNAs from inbred laboratory mice. J. Virol. 58, 359-368. Ou, C-Y., Boone, L. R., and Yang, W. K. (1983). A novel sequence element and the nucleotide structural features in the long terminal repeat of a BALB/c mouse genomic leukemia virus-related DNA clone. Nucl. Acids Res. 77, 5603-5620. Poland, A., Knutson, J. C., and Glover, E. (1984). Histologic changes produced by 2, 3, 7, 8-tetrachlorodibenzo-p-dioxin in the skin of mice carrying mutations that affect the integument. J. Invest. Dermatol. 83, 454-459. Rimm, D. L., Horness, D., Kucera, J., and Blattner, F. R. (1980). Construction of coliphage lambda Charon vectors with BamHl cloning sites. Gene 72, 301-309. Rowe, W. P, and Kozak, C. A. (1980). Germ-line reinsertions of AKR murine leukemia virus genomes in Akv-I congenic mice. Proc. Natl. Acad. Sci. USA 77, 487t-4874. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74. 5463-5467. Seperack,

P K., Strobel.

M. C., Corrow,

D. J., Jenkins,

N. A., and

MLV Insertion 391

Causes

the hr Mutation

Copeland, N. G. (1986). Somatic and germ-line reverse mutation rates of the retrovirus-induced dilute coat-color mutation of DBA mice. Proc. Natl. Acad. Sci. USA 85, 189-192. Silver, J. (1965). Confidence on analysis of recombinant

limits for estimates of gene linkage based inbred strains. J. Hered. 76, 436-440.

Siracusa, L. D., Russel, L. B., Jenkins, N. A., and Copeland, N. G. (1967). Allelic variation within the Em-15 locus defines cellular sequences closely linked to the agouti locus on mouse chromosome 2. Genetics 117, 85-92. Snell, G. D. (1931). Inheritance in the house mouse, the heritage tions of short-ear, hairless, and babed. Genetics 78, 42-74. Soriano, P., Gridley, T., and Jaenisch, Ft. (1987). Retrovirusesand tional mutagenesis; proviral integration at the Mov 34 locus early embryonic death. Genes Dev. 1, 366-375.

rela-

inserleads to

Steffen, D. L., Taylor, B. A., and Weinberg, R. A. (1982). Continuing germ line integration of AKV proviruses during the breeding of AKR mice and derivative recombinant inbred stains. J. Virol. 42, 165-175. Stelzner, K. F. (1983). Four dominant autosomal mutation affecting and hair development in the mouse. J. Hered. 74, 193-196.

skin

Stoye, J. P., and Coffin, J. M. (1985). Endogenous retroviruses. In Molecular Biology of Tumor Viruses, Part Ill. RNA Tumor Viruses, Vol. 2, 2nd Edition, R. Weiss, N. Teich, H. E. Varmus, and J. hf. Coffin, eds. (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory), pp. 357-404. Stoye, J. f?, and Coffin, J. M. (1967). The four classes of endogenous murine leukemia virus: structural relationships and potential for recombination. J. Virol. 61, 2659-2669. Stoye, J. P, and Coffin, J. M. (1988). Polymorphism of murine endogenous proviruses revealed by using virus class-specific oligonucleotide probes. J. Virol. 62, 168-175. Varmus, Shapiro,

H. E. (1963). Retroviruses. ed. (New York: Academic

In Mobile Genetic Elevnts, Press), pp. 411-503,

J. A.

Varmus. H. W., Quintrell, N., and Ortiz, S. (1961). Retroviruses as mutagens: insertion and excision of a nontransforming provirus alter expression of a resident transforming provirus. Cell 25, 23-36. Wejman, J. C., Taylor, B. A., Jenkins, N. A., and Copeland, N. G. (1964). Endogenous xenotropic murine leukemia-related sequences map to chromosomal locationsencoding mouse lymphocyte antigens. J. Virol. 50, 237-247. Woychik, R. P., Stewart, T. A., Davis, L. G., D’Eustachio, P, and Leder, f? (1985). An inherited limb deformity created by insertional mutagenesis in a transgenic mouse. Nature 318, 36-40. Zachar, detailed fects of sophila

i!., Davidson, D., Garza, D., and Bingham, P M. (1985). A developmental and structural study of the transcriptional efinsertion of the copia transposon into the white locus of Dromelanogaster: Genetics 717, 495-515.