- Email: [email protected]
Role of membrane-associated serine protease in Trichophyton rubrum pathogenesis
P1406
P1410
Role of membrane-associated serine protease in Trichophyton rubrum pathogenesis Jagpal Singh, PhD, Mediprobe Research Inc., London, ON, Canada; Muhammad Zaman, PhD, Mediprobe Research Inc., London, ON, Canada; Aditya Gupta, MD, PhD, MBA, Mediprobe Research Inc., London, ON, Canada
Safety, tolerance, and pharmacokinetics of topical nanoemulsion (NB-002) for the treatment of onychomycosis Terry Jones, MD, J&S Studies Inc., Bryan, TX, United States; Mary Flack, MD, NanoBio Corp, Ann Arbor, MI, United States; Marian Ijzerman, PhD, NanoBio Corp, Ann Arbor, MI, United States; James Baker Jr., MD, University of Michigan, Ann Arbor, MI, United States
Trichophyton rubrum grows exclusively on the stratum corneum, nails, or hair and it is evident that secreted proteinases digest keratin and other proteins in the stratum corneum, facilitating the establishment of T rubrum infection. Several serine proteases of the subtilisin family have been characterized in T rubrum with some exhibiting high keratin degradation activities. Serine proteases have been proposed to facilitate keratin penetration, degradation of host defense-related proteins, and to allow the fungus to utilize host cell proteins as a nutrient source during colonization. A serine protease encoded by T rubrum SUB4 gene has been reported to play the role for keratin degradation, which may have an important role in T rubrum infections, suggesting studies of this protein at the molecular level are essential for the understanding of T rubrum pathogenesis. T rubrum SUB4 cDNA was amplified from using ATGGTCTGCCTTAAGACTCTG and CTGGCCACTTCCGTTGTAGAG primers and cloned into PCR 2.1-Topo vector (Invitrogen, Burlington, Canada) which contains BamHI and NotI restriction sites. A transformation construct was prepared using pMT-sGFP vector carrying arginine B marker and green fluorescent protein under the control of Aspergillus nidulans alcA promoter. Briefly, SUB4 was digested from PCR 2.1-Topo BamHI and NotI restriction enzymes and cloned into the pENTRTM2B (Invitrogen) gateway entry vector containing BamHI and NotI restricton sites for recombination reaction. The SUB4 was transformed from pENTRTM2B vector to the pMT-sGFP vector using the GATEWAY LR recombination reaction (Invitrogen). SUB4 was confirmed for its orientation and open reading frame by sequencing analysis and digested with restriction enzymes. The flourescent construct containing SUB4, eGFP under the control of A. nidulans alcA promoter was transformed through nonhomologous recombination into the T rubrum protoplasts by polyethylene glycol (PEG) method. This transformation technique will be used to elucidate the detailed molecular analysis of establishment of T rubrum infection. The virulence will be assessed by the ability of the genetically transformed fluorescent T rubrum strain to infect and expand into skin explants during the development of elongated hyphae and to degrade keratin and elastin. Commercial support: None identified.
Background: NB-002 is a topical oil-in-water emulsion containing high-energy nanometer-sized particles with cetylpyridinium chloride (CPC) at the oil-water interface. These nanoparticles have potent activity against the dermatophytes that cause onychomycosis, including activity against fungal spores. We examined the safety, tolerability (dermal irritation) and pharmacokinetics of NB-002 in subjects with distal subungual onychomycosis (DSO). Methods: Twenty subjects with advanced distal subungual onychomycosis (DSO) of the toenails were randomized to 0.25% NB-002 or 0.5% NB-002 BID. The levels of NB002 applied to the skin (0.25% and 0.5%) were 1250 to 2500-fold higher than the minimum fungicidal concentrations determined against dermatophytes (0.0002%). Treatments were applied twice daily to 10 toenails and to 5 mm of adjacent skin for 28 days. Adverse event query, dermal irritation scoring and pharmacokinetic sampling were performed on days 1, 3, 7, 14, 21, and 28 as well as a follow-up safety evaluation on day 56. Systemic drug absorption of CPC was determined by HPLC in plasma samples collected at 14 time points during the 28-day treatment period. Sixty additional subjects with mild to moderate DSA were randomized to receive either vehicle or NB-002 (0.25% BID, 0.5% qD, or 0.5% BID). Adverse event query and dermal irritation scoring were performed at baseline and weeks 1, 3, 6, and 12. Results: NB-002 was well tolerated with no safety or skin irritation concerns. There were no serious adverse events, no drop-outs because of adverse events, and no drug-related adverse events. All of the subjects had dermal irritation scores of 0 or 1 indicating nil or minimal skin irritation. There were no detectable levels of CPC in any of the pharmacokinetic samples (limit of detection ¼ 1 ng/ml). Conclusion: NB-002 is a novel antifungal agent for topical application with activity against the dermatophytes that cause onychomycosis, including spores. These data indicate that NB-002 is well tolerated in humans at doses that are more than 1000fold higher than the minimum fungicidal concentration. The drug appears to work by local mechanisms that do not require systemic levels of active drug. This could provide a significant advance for onychomycosis therapy in terms of safety and drug resistance. Based on these data, a phase II study is currently underway, recruiting more than 400 subjects at 22 centers in the United States and Canada. Funded by NanoBio Corporation.
P1412 P1408 The prevalence of thyroid function test abnormalities in patients with alopecia areata Samantha Hill, MD, Saint Louis University, St. Louis, MO, United States; Nicole Burkemper, MD, Saint Louis University, St. Louis, MO, United States Background: The purpose of this retrospective chart review study is to determine the prevalence of thyroid function test abnormalities in patients diagnosed with alopecia areata at Saint Louis University Department of Dermatology. Previous studies have suggested that 8% to 24% of patients may have abnormal thyroid function studies, most of them subclinical. While many dermatologists order baseline thyroid function studies in patients with alopecia areata, there is not definitive evidence to support this practice.
Sensitive scalp: An epidemiologic approach Laurent Misery, MD, Hopital Morvan, Brest, France; Marco Ambonati, MD, Laboratoires Dermatologiques Ducray, Lavaur, France; Sami Boussetta, PhD, Pierre Fabre, Boulogne, France; Charles Taieb, MD, PhD, Pierre Fabre, Boulogne, France Context: The concept of sensitive scalp (SS) is poorly understood. There are no epidemiologic studies that describe or measure the condition, calling into question its very existence.
Results: The charts of 92 adult patients with alopecia areata who were evaluated between December 1995 and February 2007 (55 females, 37 males) were examined. The mean age at diagnosis was 34.6 years with a standard deviation of 11.5 years. Eighty-four patients had patch type alopecia (91.3%), 4 had alopecia universalis (4.3%), 3 had ophiasis pattern (3.3%), and 1 patient had alopecia totalis (1.1%). Twenty-seven patients had documented TSH values (29.3%) and 12 patients had documented free T4 values (13%). Three patients had abnormal serum TSH levels (11.1%) and no patient had abnormal serum free T4 levels. Of those patients with abnormal TSH levels, two patients had elevated TSH and one had a low level. All 3 patients with abnormal values had patch type alopecia areata. Conclusions: Previously reported prevalence of thyroid function abnormalities in patients with alopecia areata has ranged from 8% to 24%, and our prevalence of 11.1% falls within that range. The overall prevalence of subclinical hypothyroidism in the general population ranges from 7.5% to 8.5% in women to 2.8% to 4.4% in men. Given our finding that only 11.1% of patients with alopecia areata in whom thyroid function tests were checked had abnormal results, we propose that it may not be necessary to order these studies in patients with alopecia areata who are asymptomatic.
Objective: Using an epidemiologic approach, evaluate and analyze subjects who consider their scalp to be sensitive. Method: A representative sample of the population 15 years of age and older was taken by CSA Sante´. One thousand and eleven individuals were questioned by telephone and selected as per the quotas method. Results: Statistically more women than men considered themselves to be ‘‘someone who has a very or rather SS’’ (47.4% vs. 40.8%; P ¼ .036). While 5.7% of the total population (6.1% and 5.2% of men and women, respectively) declared that they suffered from a scalp disorder, 11.5% of these were in the sensitive population (13.6% and 9.8% of men and women, respectively) versus 1.1% in the nonsensitive population (P \.001). Twenty-four percent of responders complained of dry scalp, 58% had a normal scalp, 16% an oily scalp, and 1% a mixed scalp. More than 60% (60.3%) of responders with a dry scalp also considered that they had a very or rather SS, while this percentage dropped to 58.4% in responders with oily scalps and finally to 32.9% in those with a normal scalp (P \.001). Of the subjects questioned, 13% experienced stinging, 25% itching, and 2% burning or pain. Subjects with SS experienced statistically more frequent stinging, itching, and burning than those with nonsensitive scalps, with 18.9% versus 8.4% (P \ .001) for stinging, 37.6% versus 15.6% (P \.001) for itching, and 4.5% versus 0.7% for burning. No significant difference was detected as regards pain depending on scalp sensitivity. This percentage rose to 16.7% in the responders with SS. 56.6% of subjects reported SS (answered yes to at least one area). 65.8% of this population also declared they had a SS versus 49.5% in the other responders (P \.001). Discussion: SS exists and is a common occurrence. Numerous factors can trigger SS, but not in a systematic fashion. This study also made it possible to establish a link between the concepts of sensitive skin and SS. Sensitive skin appears to be more frequently observed in patients with a SS. Finally, the symptoms that characterize sensitive skin are not systematically the same as those that define SS. It would therefore be interesting to study this aspect in order to establish a more precise definition of scalp sensitivity (presence of dandruff, dry scalp, excessive sweating, etc.).
Commercial support: None identified.
50% supported by Ducray and 50% by Pierre Fabre´.
Objective: The purpose of this study is to determine if all patients diagnosed with alopecia areata should have a laboratory assessment of their thyroid function as standard of care. Methods: A retrospective chart review was performed of adults patients treated for alopecia areata in the Saint Louis University Department of Dermatology. Subjects greater than 19 years of age who had documented thyroid function test results were included in the study.
FEBRUARY 2008
J AM ACAD DERMATOL
AB83
P1410
Role of membrane-associated serine protease in Trichophyton rubrum pathogenesis Jagpal Singh, PhD, Mediprobe Research Inc., London, ON, Canada; Muhammad Zaman, PhD, Mediprobe Research Inc., London, ON, Canada; Aditya Gupta, MD, PhD, MBA, Mediprobe Research Inc., London, ON, Canada
Safety, tolerance, and pharmacokinetics of topical nanoemulsion (NB-002) for the treatment of onychomycosis Terry Jones, MD, J&S Studies Inc., Bryan, TX, United States; Mary Flack, MD, NanoBio Corp, Ann Arbor, MI, United States; Marian Ijzerman, PhD, NanoBio Corp, Ann Arbor, MI, United States; James Baker Jr., MD, University of Michigan, Ann Arbor, MI, United States
Trichophyton rubrum grows exclusively on the stratum corneum, nails, or hair and it is evident that secreted proteinases digest keratin and other proteins in the stratum corneum, facilitating the establishment of T rubrum infection. Several serine proteases of the subtilisin family have been characterized in T rubrum with some exhibiting high keratin degradation activities. Serine proteases have been proposed to facilitate keratin penetration, degradation of host defense-related proteins, and to allow the fungus to utilize host cell proteins as a nutrient source during colonization. A serine protease encoded by T rubrum SUB4 gene has been reported to play the role for keratin degradation, which may have an important role in T rubrum infections, suggesting studies of this protein at the molecular level are essential for the understanding of T rubrum pathogenesis. T rubrum SUB4 cDNA was amplified from using ATGGTCTGCCTTAAGACTCTG and CTGGCCACTTCCGTTGTAGAG primers and cloned into PCR 2.1-Topo vector (Invitrogen, Burlington, Canada) which contains BamHI and NotI restriction sites. A transformation construct was prepared using pMT-sGFP vector carrying arginine B marker and green fluorescent protein under the control of Aspergillus nidulans alcA promoter. Briefly, SUB4 was digested from PCR 2.1-Topo BamHI and NotI restriction enzymes and cloned into the pENTRTM2B (Invitrogen) gateway entry vector containing BamHI and NotI restricton sites for recombination reaction. The SUB4 was transformed from pENTRTM2B vector to the pMT-sGFP vector using the GATEWAY LR recombination reaction (Invitrogen). SUB4 was confirmed for its orientation and open reading frame by sequencing analysis and digested with restriction enzymes. The flourescent construct containing SUB4, eGFP under the control of A. nidulans alcA promoter was transformed through nonhomologous recombination into the T rubrum protoplasts by polyethylene glycol (PEG) method. This transformation technique will be used to elucidate the detailed molecular analysis of establishment of T rubrum infection. The virulence will be assessed by the ability of the genetically transformed fluorescent T rubrum strain to infect and expand into skin explants during the development of elongated hyphae and to degrade keratin and elastin. Commercial support: None identified.
Background: NB-002 is a topical oil-in-water emulsion containing high-energy nanometer-sized particles with cetylpyridinium chloride (CPC) at the oil-water interface. These nanoparticles have potent activity against the dermatophytes that cause onychomycosis, including activity against fungal spores. We examined the safety, tolerability (dermal irritation) and pharmacokinetics of NB-002 in subjects with distal subungual onychomycosis (DSO). Methods: Twenty subjects with advanced distal subungual onychomycosis (DSO) of the toenails were randomized to 0.25% NB-002 or 0.5% NB-002 BID. The levels of NB002 applied to the skin (0.25% and 0.5%) were 1250 to 2500-fold higher than the minimum fungicidal concentrations determined against dermatophytes (0.0002%). Treatments were applied twice daily to 10 toenails and to 5 mm of adjacent skin for 28 days. Adverse event query, dermal irritation scoring and pharmacokinetic sampling were performed on days 1, 3, 7, 14, 21, and 28 as well as a follow-up safety evaluation on day 56. Systemic drug absorption of CPC was determined by HPLC in plasma samples collected at 14 time points during the 28-day treatment period. Sixty additional subjects with mild to moderate DSA were randomized to receive either vehicle or NB-002 (0.25% BID, 0.5% qD, or 0.5% BID). Adverse event query and dermal irritation scoring were performed at baseline and weeks 1, 3, 6, and 12. Results: NB-002 was well tolerated with no safety or skin irritation concerns. There were no serious adverse events, no drop-outs because of adverse events, and no drug-related adverse events. All of the subjects had dermal irritation scores of 0 or 1 indicating nil or minimal skin irritation. There were no detectable levels of CPC in any of the pharmacokinetic samples (limit of detection ¼ 1 ng/ml). Conclusion: NB-002 is a novel antifungal agent for topical application with activity against the dermatophytes that cause onychomycosis, including spores. These data indicate that NB-002 is well tolerated in humans at doses that are more than 1000fold higher than the minimum fungicidal concentration. The drug appears to work by local mechanisms that do not require systemic levels of active drug. This could provide a significant advance for onychomycosis therapy in terms of safety and drug resistance. Based on these data, a phase II study is currently underway, recruiting more than 400 subjects at 22 centers in the United States and Canada. Funded by NanoBio Corporation.
P1412 P1408 The prevalence of thyroid function test abnormalities in patients with alopecia areata Samantha Hill, MD, Saint Louis University, St. Louis, MO, United States; Nicole Burkemper, MD, Saint Louis University, St. Louis, MO, United States Background: The purpose of this retrospective chart review study is to determine the prevalence of thyroid function test abnormalities in patients diagnosed with alopecia areata at Saint Louis University Department of Dermatology. Previous studies have suggested that 8% to 24% of patients may have abnormal thyroid function studies, most of them subclinical. While many dermatologists order baseline thyroid function studies in patients with alopecia areata, there is not definitive evidence to support this practice.
Sensitive scalp: An epidemiologic approach Laurent Misery, MD, Hopital Morvan, Brest, France; Marco Ambonati, MD, Laboratoires Dermatologiques Ducray, Lavaur, France; Sami Boussetta, PhD, Pierre Fabre, Boulogne, France; Charles Taieb, MD, PhD, Pierre Fabre, Boulogne, France Context: The concept of sensitive scalp (SS) is poorly understood. There are no epidemiologic studies that describe or measure the condition, calling into question its very existence.
Results: The charts of 92 adult patients with alopecia areata who were evaluated between December 1995 and February 2007 (55 females, 37 males) were examined. The mean age at diagnosis was 34.6 years with a standard deviation of 11.5 years. Eighty-four patients had patch type alopecia (91.3%), 4 had alopecia universalis (4.3%), 3 had ophiasis pattern (3.3%), and 1 patient had alopecia totalis (1.1%). Twenty-seven patients had documented TSH values (29.3%) and 12 patients had documented free T4 values (13%). Three patients had abnormal serum TSH levels (11.1%) and no patient had abnormal serum free T4 levels. Of those patients with abnormal TSH levels, two patients had elevated TSH and one had a low level. All 3 patients with abnormal values had patch type alopecia areata. Conclusions: Previously reported prevalence of thyroid function abnormalities in patients with alopecia areata has ranged from 8% to 24%, and our prevalence of 11.1% falls within that range. The overall prevalence of subclinical hypothyroidism in the general population ranges from 7.5% to 8.5% in women to 2.8% to 4.4% in men. Given our finding that only 11.1% of patients with alopecia areata in whom thyroid function tests were checked had abnormal results, we propose that it may not be necessary to order these studies in patients with alopecia areata who are asymptomatic.
Objective: Using an epidemiologic approach, evaluate and analyze subjects who consider their scalp to be sensitive. Method: A representative sample of the population 15 years of age and older was taken by CSA Sante´. One thousand and eleven individuals were questioned by telephone and selected as per the quotas method. Results: Statistically more women than men considered themselves to be ‘‘someone who has a very or rather SS’’ (47.4% vs. 40.8%; P ¼ .036). While 5.7% of the total population (6.1% and 5.2% of men and women, respectively) declared that they suffered from a scalp disorder, 11.5% of these were in the sensitive population (13.6% and 9.8% of men and women, respectively) versus 1.1% in the nonsensitive population (P \.001). Twenty-four percent of responders complained of dry scalp, 58% had a normal scalp, 16% an oily scalp, and 1% a mixed scalp. More than 60% (60.3%) of responders with a dry scalp also considered that they had a very or rather SS, while this percentage dropped to 58.4% in responders with oily scalps and finally to 32.9% in those with a normal scalp (P \.001). Of the subjects questioned, 13% experienced stinging, 25% itching, and 2% burning or pain. Subjects with SS experienced statistically more frequent stinging, itching, and burning than those with nonsensitive scalps, with 18.9% versus 8.4% (P \ .001) for stinging, 37.6% versus 15.6% (P \.001) for itching, and 4.5% versus 0.7% for burning. No significant difference was detected as regards pain depending on scalp sensitivity. This percentage rose to 16.7% in the responders with SS. 56.6% of subjects reported SS (answered yes to at least one area). 65.8% of this population also declared they had a SS versus 49.5% in the other responders (P \.001). Discussion: SS exists and is a common occurrence. Numerous factors can trigger SS, but not in a systematic fashion. This study also made it possible to establish a link between the concepts of sensitive skin and SS. Sensitive skin appears to be more frequently observed in patients with a SS. Finally, the symptoms that characterize sensitive skin are not systematically the same as those that define SS. It would therefore be interesting to study this aspect in order to establish a more precise definition of scalp sensitivity (presence of dandruff, dry scalp, excessive sweating, etc.).
Commercial support: None identified.
50% supported by Ducray and 50% by Pierre Fabre´.
Objective: The purpose of this study is to determine if all patients diagnosed with alopecia areata should have a laboratory assessment of their thyroid function as standard of care. Methods: A retrospective chart review was performed of adults patients treated for alopecia areata in the Saint Louis University Department of Dermatology. Subjects greater than 19 years of age who had documented thyroid function test results were included in the study.
FEBRUARY 2008
J AM ACAD DERMATOL
AB83