- Email: [email protected]
Salubrinal Protects Against Cigarette Smoke Extract-induced HBEpC Apoptosis Likely Via Regulating the Activity of PERK-eIF2α Signaling Pathway
Archives of Medical Research 43 (2012) 522e529
ORIGINAL ARTICLE
Salubrinal Protects Against Cigarette Smoke Extract-induced HBEpC Apoptosis Likely Via Regulating the Activity of PERK-eIF2a Signaling Pathway Ting Yuan, Bai-ling Luo, Tian-hong Wei, Li Zhang, Bai-mei He, and Rui-chao Niu Department of Respiratory Medicine, Xiangya Hospital, Central South University, Changsha, China Received for publication May 15, 2012; accepted September 13, 2012 (ARCMED-D-12-00253).
Background and Aims. Endoplasmic reticulum (ER) stress plays an important role in cigarette smoke extract (CSE)-induced apoptotic cell death, which is an important pathogenic factor of chronic obstructive pulmonary disease (COPD). The aim of this study was to explore the role of the PERK-eIF2 pathway in CSE-induced human bronchial epithelial (HBE) cell apoptosis and to evaluate the protective effects and possible mechanism of salubrinal (Sal) on CSE-induced HBE cell apoptosis. Methods. Normal human bronchial epithelial cells (HBEpC) were cultured and then treated with CSE alone or together with Sal or preincubated with or without PERK siRNA. Expressions of p-PERK/PERK, p-eIF2a/eIF2a, and caspase 3 and 4 were detected with PCR, Western blot, and immunofluorescence. Apoptosis was detected using AnnexinV-PI flow cytometry. Results. CSE induced apoptotic cell death and caused a dynamic change in PERK-eIF2a pathway activity following the course of CSE exposure. The knockdown of PERK suppressed the expression of both PERK and p-eIF2a and caused a great increase in cell apoptosis. Sal could eliminate the effects of PERK knockdown, protecting the cells against the CSE insult, and this protection was accomplished through maintaining the homeostasis of PERK- eIF2a pathway. Conclusions. PERK-eIF2a pathway mediates the CSE-induced HBE cell apoptosis. The intactness of PERK-eIF2a pathway is crucial for HBE cell survival under CSE insult. Sal can protect against CSE-induced HBE cell apoptosis, and this effect is likely achieved through maintaining the homeostasis of PERK- eIF2a pathway. Ó 2012 IMSS. Published by Elsevier Inc. Key Words: COPD, PERK, eIF2a, Apoptosis, Salubrinal, Human bronchial epithelial cells.
Introduction Chronic obstructive pulmonary disease (COPD), with an increasing mortality, is one of the most common causes of death worldwide (1), and cigarette smoking plays a crucial role in its pathogenesis (2). Cigarette smoke extract (CSE) can induce endoplasmic reticulum (ER) stress and trigger a cellular stress response called the unfolded protein response (UPR) that intends to protect the cell against the aggregated toxics (3), but eventually leads to the apoptosis of pulmonary cells under certain circumstances (4). Address reprint requests to: Bai-ling Luo, MD, Department of Respiratory Medicine, Xiangya Hospital, No. 87, XiangYa Road, Changsha, Hunan, China; Phone: 86-13974941969; FAX: 86-73184327202; E-mail: [email protected]
Increased numbers of apoptotic alveolar, bronchiolar, and endothelia cells in lung tissues from patients with COPD have been observed in several reports (5). Activation of the UPR in mammalians is mediated by three distinct ER stress sensors, namely, ER kinase (PERK), transcription factor ATF6, and endoribonuclease IRE-1 (6,7). The most immediate response to ER stress, however, is provoked by the PERK (8). Oligomerization of PERK in ER membranes induces its autophosphorylation and kinase domain activation. PERK phosphorylates and inactivates eIF2a, shutting off mRNA translation and reducing the protein load on the ER. eIF2a phosphorylation is an important determinant between cell survival and death in response to various forms of stress. The ability of phosphorylated eIF2a to control cell survival or death depends on the
0188-4409/$ - see front matter. Copyright Ó 2012 IMSS. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.arcmed.2012.10.002
Salubrinal Protect Cells from Apoptosis
type of stimuli and the specificity of the kinase that mediates the phosphorylation of eIF2a (9). Caspases are cysteine proteases that exist within the cell as inactive pro-forms or zymogens and are cleaved to form active enzymes following the induction of apoptosis. Caspase-12 directly triggers apoptosis, but the role of caspase-12 in human cells is not clear; other caspases such as caspase-4 may be involved in ER stress-induced apoptosis in human cells (10,11). As the epithelial cells are highly susceptible to the toxic effects of aggregated redox (reduction-oxidation), ER stress-mediated cell apoptosis may have an important role in the pathogenesis of COPD. Salubrinal (Sal) is a selective activator of eIF2a and can enhance cell survival against apoptosis induced by the ER stressors through increasing the phosphorylation level of eIF2a (12,13). Drugs that reprogram stress pathways, balance ER-protein load with cellular folding capacity, and reduce HBE cell apoptosis may provide a new approach for the treatment of COPD (12,14). Because the role of UPR remains uncertain, especially in PERK/eIF2a pathways in CSE-induced HBE cell apoptosis, we hypothesized that the PERK/eIF2a pathway may be essential in CSE-induced HBE cell apoptosis, and Sal may protect HBE cells from CSE-induced apoptosis through regulating the PERK pathway. In the present study, set as an in vitro COPD model, HBE cells were used and treated with CSE. Activity of PERK/eIF2a pathway was observed. The effects of Sal and specific PERK-interfering RNA (PERK-siRNA) on the activity of PERK/eIF 2a pathway and on CSE-induced HBE cell apoptosis were investigated. Materials and Methods Cigarette Smoke Extract (CSE) Preparation CSE was prepared using a smoking machine as previously described (15). Direct and side stream smoke from one cigarette (Fu-rong) was directed via a tube throng 3-mL PBS using a peristaltic pump. Subsequently, the optical density (OD) of this extract was determined using a spectrometer measured at a wavelength of 450 nm. Freshly prepared CSE was used in all experiments. The 3 mL solution was recognized as 100% CSE. Cell Culture Human bronchial epithelial (HBE) cells were obtained from Xiangya Central Laboratory and cultured at 37 C in 1640 RPMI medium (Gibco, Grand Island, NY) supplemented with 10% heat-inactivated FBS in a humidified 95% air, 5% CO2 incubator. Sal was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, catalog #sc-202332). For subculture, cells were detached with 1% trypsin. After reaching 80% confluence, cells were seeded into six-well plates at a density of 1 105 cells per well to grow again to 80% confluence.
523
PERK siRNA PERK siRNA and all transfected reagents were purchased from Santa Cruz Biotechnology. For the transfection, HBE cells were seeded onto six-well plates and allowed to reach 60% confluence on the day of transfection. The transfection was performed according to the manufacturer’s protocols. The cells were divided into six groups: 1) control group, 2) CSE group, 3) CSE þ control siRNA group, 4) CSE þ control siRNA þ Sal group, 5) CSE þ PERK siRNA group, and 6) CSE þ PERK siRNA þ Sal group. Cell Counting Kit-8 (CCK-8) Assay HBE cells were seeded in a 96-well plate at a density of 1 x 104 cells/well. Cells were then treated with 5% CSE and Sal at various concentrations for 24 h in 37 C in 95% air, 5% CO2 incubator. Afterwards, the CCK-8 assay reagent (Dojindo Laboratories, Kumamoto, Japan) was added to culture media and incubated for 3 h. Absorbance was read at 450 nm on a microplate reader. Each assay was performed in triplicate. Hoechst 33258 Staining Cellular shrinkages or apoptosis assessment was examined with the Hoechst 33258 (Beyotime, Jiangsu, China) staining and then observed using a fluorescence microscope (16). Briefly, cells were treated with 5% CSE for different periods according to the experimental design and were then stained with Hoechst 33258 (1 mg/mL) for 15 min. Stained cells were observed under an IX71 inverted fluorescence microscope. Quantification of the images were processed and analyzed as described previously; positive staining was presented as percentage of positive cells among the total cells (% cell stained) (17). Each experiment was repeated a minimum of three times. RT-PCR Total RNA was isolated from the cells using Trizol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. cDNA was synthesized using Superscript II Reverse Transcription system (Invitrogen). The primers were mixed with AccuPower PCR premix (Bioneer, Daejeon, Korea) and the sequences were PERK forward 50 -ATCCCCCATGGAACGACCTG-30 and reverse 50 -ACCCGCCAGGGACAAA AATG-30 , eIF2a forward 50 -GGTTCAATAACA CGGATCCATTATG TCATCTCAG-30 and reverse 50 -GTAT GGATCCTGCAGTTTCTTCTAGTTTAT TC-30 . GAPDH forward 50 -GGAAGGTGAAGGTCGGAGT-30 and reverse 50 -GCT CCTGGAAGATGGTGATGG-30 . Amplification conditions were as follows: single cycle at 94 C for 5 min followed by 30 cycles at 94 C for 30 sec, 58 C for 30 sec and 72 C for 30 sec, and the final extension cycle at 72 C for 7 min.
524
Yuan et al./ Archives of Medical Research 43 (2012) 522e529
Figure 1. Effects of CSE on cell viability and apoptosis in HBE cells. (A) HBE cells were treated with CSE (1, 2, 5, 10%) for 1e48 h, and then the cell viability was tested with CCK-8 assay. Assays were performed in quadruplicate. Asterisks indicate statistically significant differences, with 8 samples for each mean value. (B) Apoptotic cells were detected using Hoechst staining and expressed as the percentage of positive staining cells among the total cells. (C) Representative image of Hoechst staining; the arrows showing the positive apoptotic cells characterized with condensed chromatin having strong Hoechst staining (fluorescence microscope 100). Data were presented as mean SD. Results are representative of three separate experiments with six samples for each mean value.
Western Blot Total proteins from HBE cells were isolated using the protein buffer (Beyotime). Lysates were cleared by centrifugation at 12,000 g for 10 min at 4 C. Proteins were then separated by 8e12% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Blots were blocked for 2 h at room temperature with Tris-buffered saline (TBS) (10 mM Tris, pH 7.5, 100 mM NaCl) containing 5% nonfat dry milk. After washing three times with TBS, the membranes were incubated at 4 C overnight with primary antibodies against PERK (1:100, Santa Cruz Biotechnology), phosphor-PERK (1:100, Santa Cruz Biotechnology), eIF2a (1:1000, Cell Signaling, Beverly, MA), phosphor-eIF2a (1:1000, Cell Signaling), caspase 4 (1:1000, Protein Technology, Chicago, IL), caspase 3(1:1000, Epitomics, Burlingame, CA) and rabbit antiGAPDH as control (1:1000, Hangzhou Xianzhi Biology, Zhejiang, China). The next day, after washing three times with TBST, membranes were incubated for 2 h at room temperature with horseradish peroxidase (HRP)-secondary antibodies (1:1000, Protein Technology) in TBST and then visualized using the ECL detection system (Beyotime). Immunofluorescence Staining Cells grown on glass cover slides were washed with PBS and fixed in 10% formalin solution containing 4%
formaldehyde for 20 min, incubated with p-eIF2a (1:100 Cell Signaling) primary antibody, and then revealed with anti-rabbit IgG secondary Cy3 antibody (1:100 Protein Technology). After the reaction with secondary antibodies, the cells were stained with 100 nM 40 -6-diamidino-2-phenylindole (DAPI) for 5 min and observed under fluorescence microcopy. Annexin V-PI Flow Cytometry After the cells were subjected to the designated treatments, 1 106 cells were collected and resuspended in 500 ml binding buffer. Fluorescein isothiocyanate-conjugated annexin V (5 ml) and PI (10 ml) were added to each sample, and the mixture was incubated for 5 min at room temperature in the dark. Cells were then immediately subjected to FACS analysis (BD FACSCalibur, Becton Dickinson Co., Franklin Lakes, NJ). Each assay was performed in triplicate. Statistical Analysis Data were expressed as mean SD. SPSS v.16.0 (SPSS, Inc., Chicago, IL) was used for statistical analysis. Statistical significance among mean values was evaluated with one-way ANOVA tests for measurement data, with LSD-t test for comparisons between each other; p !0.05 was considered statistically significant.
Salubrinal Protect Cells from Apoptosis
525
Figure 2. CSE induces a dynamic change in PERK-eIF2a pathway activity. (A) Western blot with anti-p-PERK in HBE cells treated with 5% CSE shows the activation of p-PERK from 6 h, but the suppression decreased when CSE persisted. *p !0.05 compared with the control groups. (B) Western blot with anti-peIF2a also shows the activation of p-eIF2a. *p !0.05 compared with the control groups. Lower panel: Representative images of p-PERK and p-eIF2a immunofluorescence staining after 6 h CSE treatment show increased staining in cytoplasm (fluorescence microscope 400). Results are representative of three separate experiments with six samples for each mean value.
Results CSE-induced Apoptosis in HBE Cells CCK-8 assay showed that cell viability was markedly reduced in CSE-treated HBE cells in a dose- and timedependent manner (Figure 1A). Hoechst staining showed that treating the HBE cells with 5% CSE for 24 h greatly induced cell apoptosis (Figures 1B and 1C), and the apoptosis increased in a time-dependent manner. CSE Induced a Dynamic Change in PERK-eIF2a Pathway Activity In order to mimic the aging microenvironment in vitro, we treated HBE cells with CSE (5%) for 6, 12, and 24 h. Activity of the PERK pathway in the cells was then observed using Western blot analysis. An increase in the phosphorylated PERK (p-PERK) and phosphorylated eIF2a (p-eIF2a) in
the cells indicated an upregulated PERK pathway activity. As shown in Figure 2, both p-PERK and p-eIF2a had a dynamic change following the time course in CSE-treated HBE cells (Figures 2A and 2B), peaking at 6 h ( p !0.05) and then gradually downregulated following CSE treatment. Transient upregulation of p-PERK and p-eIF2a was also detected by immunofluorescence staining. At the time point of 6 h CSE treatment, cytoplasm p-PERK and p-eIF2a levels were significantly increased (Figures 2C and 2D). All these showed that the activity of the PERK pathway in HBE cells was significantly affected by CSE. Salubrinal Protects HBE Cells against CSE-induced Apoptosis To standardize the therapeutic strategy of Sal for controlling ER stress-induced apoptosis, we first treated HBE cells with Sal in different concentrations (0e100 mM); 2 h later, cells
526
Yuan et al./ Archives of Medical Research 43 (2012) 522e529
Figure 3. Salubrinal protects the HBE cells against CSE-induced apoptosis. (A) Dose-dependent protection of Sal on HBE cells treated with 5% CSE and cell viability was assessed by CCK-8. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. Assays were performed in quadruplicate, and eight samples were used for each meanvalue. (B) Western blot of caspase 4 and caspase 3. Cells were divided into six groups: control, 5% CSE, Sal (100 mM), 5% CSE þ Sal (1 mM), 5% CSE þ Sal (10 mM), 5% CSE þ Sal (100 mM). *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. (C) AnnexinV-PI flow cytometry showed that Sal attenuated CSE-induced apoptosis. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. Results are representative of three separate experiments; six samples for each mean value. (A color figure can be found in the online version of this article.)
were treated with CSE (5%) for 24 h. We then detected the cell survival rate using CCK-8, finding that cell survival rates were increased following the increase in Sal concentrations,
and that the optimal protective concentration was 100 mM (Figure 3A). On the other hand, Western blot analysis was performed on HBE cells pretreated with different
Salubrinal Protect Cells from Apoptosis
527
CSE-induced apoptosis possibly through regulating the PERK-eIF2a pathway activity. Hence, we tested the protein level of p-PERK and p-eIF2a using Western blot analysis after pretreating HBE cells with Sal at different concentrations (1 mM, 10 mM, 100 mM). Western blot analysis revealed that Sal selectively enhanced eIF2a phosphorylation without affecting the expression of p-PERK (Figures 4A and 4B). The induction of eIF2a phosphorylation by Sal was dose-dependent. These results suggest that Sal reverses the subsequent suppression of eIF2a phosphorylation, and an intact PERK-eIF2a pathway is necessary for cell survival under CSE insult. Effects of PERK Knockdown on CSE-induced Apoptosis
Figure 4. Sal attenuated CSE-induced apoptosis through increasing p-eIF2a. Cells were divided into six groups: control, 5% CSE, Sal (100 mM), 5% CSE þ Sal (1 mM), 5% CSE þ Sal (10 mM), 5% CSE þ Sal (100 mM). Western blot analysis using anti-p-PERK and anti-p-eIF2a antibodies showed the expression of p-eIF2a was dose-dependent, but the expression of p-PERK was not statistically significant among all groups. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. Results are representative of three separate experiments with six samples for each mean value.
concentrations (1 mM, 10 mM, and 100 mM) for 2 h and then treated with CSE (5%) for 24 h. Western blot analysis showed that expressions of caspase 3 and caspase 4 were decreased following the increase in Sal concentration (Figure 3B). Furthermore, flow cytometry analysis of AnnexinV-PI double staining also revealed that the apoptotic rate of CSE-treated cells was reduced by Sal in a dosedependent manner (Figure 3C). These data suggested a therapeutic potential of Sal against CSE-induced lung injury (or even emphysema), which warrants further evaluation.
To further explore the role of PERK-eIF2a pathway in ER stress-induced HBE cell apoptosis following CSE treatment, transfection of HBE cells with specific siRNA against PERK gene was performed. After preincubation with PERK siRNA and then stimulation with 5% CSE for 24 h, the expression of PERK at both the mRNA and protein levels was downregulated significantly (Figures 5A and 5B). Phosphorylation of eIF2a, but not the total eIF2a, was also inhibited. Furthermore, in this experiment, effect of Sal on CSE-induced HBE cell apoptosis was investigated again in comparison with PERK-siRNA. Whereas the knockdown of PERK gene suppressed the expression of p-eIF2a causing a great increase in cell apoptosis (Figure 5C), Sal alone effectively enhanced the phosphorylation of eIF2a. The decrease of p-eIF2a caused by PERK-siRNA was also eliminated by Sal after combining Sal with PERK-siRNA transfected cells. It is worth noting that the apoptotic rate of HBE cells varied closely with the changes in p-eIF2a levels as detected in this experiment. A decrease in p-eIF2a was highly relevant with an increase in the apoptotic rate (Figure 5C), confirming that the intactness of PERK/eIF2a pathway, especially the level of p-eIF2a, is crucial for cell survival under CSE insult, and PERK may participate in the activation of p-eIF2a.
Discussion Sal Attenuated CSE-induced Apoptosis Possibly through Regulation of p-eIF2a Level As observed in this study, there was a dynamic change in PERK-eIF2a pathway activity of the HBE cells following CSE treatment. Whereas the p-PERK and p-eIF2a levels were dynamically changing from peaking at 6 h to returning to (or even lower than) normal level at 24 h following the time course of CSE treatment, cell viability declined steadily. The 24 h treatment with CSE markedly induced HBE cell apoptosis and caused a consequent decrease in p-eIF2a level. We hypothesize that this decrease in p-eIF2a following 24 h CSE treatment may contribute to HBE cell apoptosis. Sal exerts its protective effect against
It is well known that CSE induces HBE cell apoptosis; thus, CSE has been successfully used to establish an experimental model for COPD-related studies (18). CSE exposure induces ER stress and eventually causes apoptosis (19). Research also shows that ER stress, to which the PERK provokes the very immediate response, contributes to the pathophysiology of COPD (3,20). However, detailed information on how PERK and the PERK/eIF2a pathway changes during the process of CSE insult and how the changes in the activity of PERK/eIF2 pathway affect the degree of HBE cell damages caused by CSE is still needed. In the present study we found that 5% CSE caused a dynamic change in the PERK/eIF2a pathway activity
528
Yuan et al./ Archives of Medical Research 43 (2012) 522e529
Figure 5. Effects of PERK knockdown on CSE-induced apoptosis. (A) PERK siRNA was confirmed by the PERK RT-PCR analysis. (B) Expression of PERK and p-eIF2a/eIF2a was detected by Western blot in six groups. (C) Apoptosis of the cells in six groups. Data were presented as mean SD. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups, **p !0.05 compared with the CSE þ PERK siRNA groups. Results are representative of three separate experiments with six samples for each mean value. (A color figure can be found in the online version of this article.)
following CSE exposure. PERK/eIF2a activities peaked at 6 h and then gradually downregulated during CSE treatment. This exposure of CSE for 24 h greatly induced HBE cell apoptosis. These results clearly demonstrate the involvement
of PERK/eIF2a pathway in the development of HBE cell apoptosis following CSE exposure. Research has shown that when cells are challenged with ER stress, phosphorylated eIF2a is increased, mediating a transient decrease in global
Salubrinal Protect Cells from Apoptosis
translation and a translational upregulation of selective stress-induced mRNAs. When ER stress is not mitigated and homeostasis is not restored, the UPR triggers apoptosis (20,21). Our results are consistent with this finding. To further explore the role of the PERK/eIF2a pathway in the development of CSE-induced HBE cell apoptosis and the treatment potential of Sal, we treated the cells at various concentration of Sal for 2 h before CSE (5%) treatment for 24 h. Our experiments revealed that Sal selectively enhanced eIF2a phosphorylation without affecting the expression of p-PERK (Figures 4A and 4B). Induction of eIF2a phosphorylation by Sal was dose-dependent. The results from CCK-8, Western blot analysis, and flow cytometry analysis of AnnexinV-PI double staining also showed that the cell survival rates were increased following the increase in Sal concentrations, and the apoptotic rate of CSE-treated cells was reduced by Sal in a dose-dependent manner accompanied with the decrease in the apoptotic markers of caspase 3 and caspase 4 expression. The importance of an intact PERK-eIF2a pathway for cell survival under CSE insult is clearly confirmed here, and Sal’s protective effect against CSE-induced HBE cell damage is likely via maintaining the homeostasis of PERK-eIF2a pathway. The knockdown of PERK gene by specific interfering RNA (siRNA) in this study further confirmed the importance of the intactness of the PERK-eIF2a pathway for cell survival under CSE insult. The knockdown of PERK suppressed the expression of PERK and it is noteworthy that p-eIF2a caused a great increase in cell apoptosis (Figure 5C). In contrast, Sal showed an opposite effect. It eliminated the decrease in p-eIF2a caused by the PERK knockdown, enhanced eIF2a phosphorylation, and significantly attenuated CSE-induced HBC cell apoptosis. Furthermore, our results also revealed that it was the p-eIF2a level, rather than the total eIF2a level, that was highly relevant with the occurrence of HBE cell apoptosis. A decrease in p-eIF2a pointed to an increase in the apoptotic rate. The intactness of PERK/eIF2a pathway, especially the level of p-eIF2a, is crucial for cell survival under CSE insult because this pathway is necessary for cell survival mechanisms rather than cell apoptosis, which is in accordance with other reports (22,23). In summary, our results demonstrate that CSE induces HBE cell apoptosis likely via PERK-eIF2a dependent induction of caspases. PERK-eIF2a pathway plays an important role in CSE-induced HBE cell injury. The intactness of PERK-eIF2a pathway is a key to cell survival under CSE insult. Sal can protect against CSE-induced HBE cell apoptosis through regulating the PERK pathway, demonstrating a potential new approach for the effective treatment of COPD. Acknowledgments This study was supported by the National Natural Science Fund (project number: 30971324).
529
References 1. Pauwels RA, Rabe KF. Burden and clinical features of chronic obstructive pulmonary disease (COPD). Lancet 2004;364:613e620. 2. Pauwels RA, Buist AS, Calverley PM, et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 2001;163:1256e1276. 3. Kelsen SG, Duan X, Ji R, et al. Cigarette smoke induces an unfolded protein response in the human lung: a proteomic approach. Am J Respir Cell Mol Biol 2008;38:541e550. 4. Demedts IK, Demoor T, Bracke KR, et al. Role of apoptosis in the pathogenesis of COPD and pulmonary emphysema. Respir Res 2006;7:53. 5. Kuwano K. Epithelial cell apoptosis and lung remodeling. Cell Mol Immunol 2007;4:419e429. 6. Lindholm D, Wootz H, Korhonen L. ER stress and neurodegenerative diseases. Cell Death Differ 2006;13:385e392. 7. Zhou J, Liu CY, Back SH, et al. The crystal structure of human IRE1 luminal domain reveals a conserved dimerization interface required for activation of the unfolded protein response. Proc Natl Acad Sci USA 2006;103:14343e14348. 8. Harding HP, Zhang Y, Bertolotti A, et al. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell 2000;5:897e904. 9. Muaddi H, Majumder M, Peidis P, et al. Phosphorylation of eIF2alpha at serine 51 is an important determinant of cell survival and adaptation to glucose deficiency. Mol Biol Cell 2010;21:3220e3231. 10. Fischer H, Koenig U, Eckhart L, et al. Human caspase 12 has acquired deleterious mutations. Biochem Biophys Res Commun 2002;293:722e726. 11. Hitomi J, Katayama T, Eguchi Y, et al. Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Abeta-induced cell death. J Cell Biol 2004;165:347e356. 12. Boyce M, Bryant KF, Jousse C, et al. A selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress. Science 2005; 307:935e939. 13. Kim I, Xu W, Reed JC. Cell death and endoplasmic reticulum stress: disease relevance and therapeutic opportunities. Nat Rev Drug Discov 2008;7:1013e1030. 14. Bodas M, Min T, Vij N. Early-age-related changes in proteostasis augment immunopathogenesis of sepsis and acute lung injury. PLoS One 2010;5:e15480. 15. Braber S, Koelink PJ, Henricks PA, et al. Cigarette smoke-induced lung emphysema in mice is associated with prolyl endopeptidase, an enzyme involved in collagen breakdown. Am J Physiol Lung Cell Mol Physiol 2011;300:L255eL265. 16. Xiong XL, Jia RH, Yang DP, et al. Irbesartan attenuates contrast mediainduced NRK-52E cells apoptosis. Pharmacol Res 2006;54:253e260. 17. Xu FF, Liu XH, Cai LR. [Role of hypoxia-inducible factor-1alpha in the prevention of cardiomyocyte injury induced by hypoxic preconditioning]. Sheng Li Xue Bao 2004;56:609e614. 18. Hansel NN, Sidhaye V, Rafaels NM, et al. Aquaporin 5 polymorphisms and rate of lung function decline in chronic obstructive pulmonary disease. PLoS One 2010;5:e14226. 19. Min T, Bodas M, Mazur S, et al. Critical role of proteostasisimbalance in pathogenesis of COPD and severe emphysema. J Mol Med (Berl) 2011;89:577e593. 20. Barnes PJ. The cytokine network in chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 2009;41:631e638. 21. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007;8:519e529. 22. Lee do Y, Lee KS, Lee HJ, et al. Activation of PERK signaling attenuates Abeta-mediated ER stress. PLoS One 2010;5:e10489. 23. Sokka AL, Putkonen N, Mudo G, et al. Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain. J Neurosci 2007;27:901e908.
ORIGINAL ARTICLE
Salubrinal Protects Against Cigarette Smoke Extract-induced HBEpC Apoptosis Likely Via Regulating the Activity of PERK-eIF2a Signaling Pathway Ting Yuan, Bai-ling Luo, Tian-hong Wei, Li Zhang, Bai-mei He, and Rui-chao Niu Department of Respiratory Medicine, Xiangya Hospital, Central South University, Changsha, China Received for publication May 15, 2012; accepted September 13, 2012 (ARCMED-D-12-00253).
Background and Aims. Endoplasmic reticulum (ER) stress plays an important role in cigarette smoke extract (CSE)-induced apoptotic cell death, which is an important pathogenic factor of chronic obstructive pulmonary disease (COPD). The aim of this study was to explore the role of the PERK-eIF2 pathway in CSE-induced human bronchial epithelial (HBE) cell apoptosis and to evaluate the protective effects and possible mechanism of salubrinal (Sal) on CSE-induced HBE cell apoptosis. Methods. Normal human bronchial epithelial cells (HBEpC) were cultured and then treated with CSE alone or together with Sal or preincubated with or without PERK siRNA. Expressions of p-PERK/PERK, p-eIF2a/eIF2a, and caspase 3 and 4 were detected with PCR, Western blot, and immunofluorescence. Apoptosis was detected using AnnexinV-PI flow cytometry. Results. CSE induced apoptotic cell death and caused a dynamic change in PERK-eIF2a pathway activity following the course of CSE exposure. The knockdown of PERK suppressed the expression of both PERK and p-eIF2a and caused a great increase in cell apoptosis. Sal could eliminate the effects of PERK knockdown, protecting the cells against the CSE insult, and this protection was accomplished through maintaining the homeostasis of PERK- eIF2a pathway. Conclusions. PERK-eIF2a pathway mediates the CSE-induced HBE cell apoptosis. The intactness of PERK-eIF2a pathway is crucial for HBE cell survival under CSE insult. Sal can protect against CSE-induced HBE cell apoptosis, and this effect is likely achieved through maintaining the homeostasis of PERK- eIF2a pathway. Ó 2012 IMSS. Published by Elsevier Inc. Key Words: COPD, PERK, eIF2a, Apoptosis, Salubrinal, Human bronchial epithelial cells.
Introduction Chronic obstructive pulmonary disease (COPD), with an increasing mortality, is one of the most common causes of death worldwide (1), and cigarette smoking plays a crucial role in its pathogenesis (2). Cigarette smoke extract (CSE) can induce endoplasmic reticulum (ER) stress and trigger a cellular stress response called the unfolded protein response (UPR) that intends to protect the cell against the aggregated toxics (3), but eventually leads to the apoptosis of pulmonary cells under certain circumstances (4). Address reprint requests to: Bai-ling Luo, MD, Department of Respiratory Medicine, Xiangya Hospital, No. 87, XiangYa Road, Changsha, Hunan, China; Phone: 86-13974941969; FAX: 86-73184327202; E-mail: [email protected]
Increased numbers of apoptotic alveolar, bronchiolar, and endothelia cells in lung tissues from patients with COPD have been observed in several reports (5). Activation of the UPR in mammalians is mediated by three distinct ER stress sensors, namely, ER kinase (PERK), transcription factor ATF6, and endoribonuclease IRE-1 (6,7). The most immediate response to ER stress, however, is provoked by the PERK (8). Oligomerization of PERK in ER membranes induces its autophosphorylation and kinase domain activation. PERK phosphorylates and inactivates eIF2a, shutting off mRNA translation and reducing the protein load on the ER. eIF2a phosphorylation is an important determinant between cell survival and death in response to various forms of stress. The ability of phosphorylated eIF2a to control cell survival or death depends on the
0188-4409/$ - see front matter. Copyright Ó 2012 IMSS. Published by Elsevier Inc. http://dx.doi.org/10.1016/j.arcmed.2012.10.002
Salubrinal Protect Cells from Apoptosis
type of stimuli and the specificity of the kinase that mediates the phosphorylation of eIF2a (9). Caspases are cysteine proteases that exist within the cell as inactive pro-forms or zymogens and are cleaved to form active enzymes following the induction of apoptosis. Caspase-12 directly triggers apoptosis, but the role of caspase-12 in human cells is not clear; other caspases such as caspase-4 may be involved in ER stress-induced apoptosis in human cells (10,11). As the epithelial cells are highly susceptible to the toxic effects of aggregated redox (reduction-oxidation), ER stress-mediated cell apoptosis may have an important role in the pathogenesis of COPD. Salubrinal (Sal) is a selective activator of eIF2a and can enhance cell survival against apoptosis induced by the ER stressors through increasing the phosphorylation level of eIF2a (12,13). Drugs that reprogram stress pathways, balance ER-protein load with cellular folding capacity, and reduce HBE cell apoptosis may provide a new approach for the treatment of COPD (12,14). Because the role of UPR remains uncertain, especially in PERK/eIF2a pathways in CSE-induced HBE cell apoptosis, we hypothesized that the PERK/eIF2a pathway may be essential in CSE-induced HBE cell apoptosis, and Sal may protect HBE cells from CSE-induced apoptosis through regulating the PERK pathway. In the present study, set as an in vitro COPD model, HBE cells were used and treated with CSE. Activity of PERK/eIF2a pathway was observed. The effects of Sal and specific PERK-interfering RNA (PERK-siRNA) on the activity of PERK/eIF 2a pathway and on CSE-induced HBE cell apoptosis were investigated. Materials and Methods Cigarette Smoke Extract (CSE) Preparation CSE was prepared using a smoking machine as previously described (15). Direct and side stream smoke from one cigarette (Fu-rong) was directed via a tube throng 3-mL PBS using a peristaltic pump. Subsequently, the optical density (OD) of this extract was determined using a spectrometer measured at a wavelength of 450 nm. Freshly prepared CSE was used in all experiments. The 3 mL solution was recognized as 100% CSE. Cell Culture Human bronchial epithelial (HBE) cells were obtained from Xiangya Central Laboratory and cultured at 37 C in 1640 RPMI medium (Gibco, Grand Island, NY) supplemented with 10% heat-inactivated FBS in a humidified 95% air, 5% CO2 incubator. Sal was purchased from Santa Cruz Biotechnology (Santa Cruz, CA, catalog #sc-202332). For subculture, cells were detached with 1% trypsin. After reaching 80% confluence, cells were seeded into six-well plates at a density of 1 105 cells per well to grow again to 80% confluence.
523
PERK siRNA PERK siRNA and all transfected reagents were purchased from Santa Cruz Biotechnology. For the transfection, HBE cells were seeded onto six-well plates and allowed to reach 60% confluence on the day of transfection. The transfection was performed according to the manufacturer’s protocols. The cells were divided into six groups: 1) control group, 2) CSE group, 3) CSE þ control siRNA group, 4) CSE þ control siRNA þ Sal group, 5) CSE þ PERK siRNA group, and 6) CSE þ PERK siRNA þ Sal group. Cell Counting Kit-8 (CCK-8) Assay HBE cells were seeded in a 96-well plate at a density of 1 x 104 cells/well. Cells were then treated with 5% CSE and Sal at various concentrations for 24 h in 37 C in 95% air, 5% CO2 incubator. Afterwards, the CCK-8 assay reagent (Dojindo Laboratories, Kumamoto, Japan) was added to culture media and incubated for 3 h. Absorbance was read at 450 nm on a microplate reader. Each assay was performed in triplicate. Hoechst 33258 Staining Cellular shrinkages or apoptosis assessment was examined with the Hoechst 33258 (Beyotime, Jiangsu, China) staining and then observed using a fluorescence microscope (16). Briefly, cells were treated with 5% CSE for different periods according to the experimental design and were then stained with Hoechst 33258 (1 mg/mL) for 15 min. Stained cells were observed under an IX71 inverted fluorescence microscope. Quantification of the images were processed and analyzed as described previously; positive staining was presented as percentage of positive cells among the total cells (% cell stained) (17). Each experiment was repeated a minimum of three times. RT-PCR Total RNA was isolated from the cells using Trizol Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. cDNA was synthesized using Superscript II Reverse Transcription system (Invitrogen). The primers were mixed with AccuPower PCR premix (Bioneer, Daejeon, Korea) and the sequences were PERK forward 50 -ATCCCCCATGGAACGACCTG-30 and reverse 50 -ACCCGCCAGGGACAAA AATG-30 , eIF2a forward 50 -GGTTCAATAACA CGGATCCATTATG TCATCTCAG-30 and reverse 50 -GTAT GGATCCTGCAGTTTCTTCTAGTTTAT TC-30 . GAPDH forward 50 -GGAAGGTGAAGGTCGGAGT-30 and reverse 50 -GCT CCTGGAAGATGGTGATGG-30 . Amplification conditions were as follows: single cycle at 94 C for 5 min followed by 30 cycles at 94 C for 30 sec, 58 C for 30 sec and 72 C for 30 sec, and the final extension cycle at 72 C for 7 min.
524
Yuan et al./ Archives of Medical Research 43 (2012) 522e529
Figure 1. Effects of CSE on cell viability and apoptosis in HBE cells. (A) HBE cells were treated with CSE (1, 2, 5, 10%) for 1e48 h, and then the cell viability was tested with CCK-8 assay. Assays were performed in quadruplicate. Asterisks indicate statistically significant differences, with 8 samples for each mean value. (B) Apoptotic cells were detected using Hoechst staining and expressed as the percentage of positive staining cells among the total cells. (C) Representative image of Hoechst staining; the arrows showing the positive apoptotic cells characterized with condensed chromatin having strong Hoechst staining (fluorescence microscope 100). Data were presented as mean SD. Results are representative of three separate experiments with six samples for each mean value.
Western Blot Total proteins from HBE cells were isolated using the protein buffer (Beyotime). Lysates were cleared by centrifugation at 12,000 g for 10 min at 4 C. Proteins were then separated by 8e12% SDS-PAGE and transferred to polyvinylidene difluoride membranes. Blots were blocked for 2 h at room temperature with Tris-buffered saline (TBS) (10 mM Tris, pH 7.5, 100 mM NaCl) containing 5% nonfat dry milk. After washing three times with TBS, the membranes were incubated at 4 C overnight with primary antibodies against PERK (1:100, Santa Cruz Biotechnology), phosphor-PERK (1:100, Santa Cruz Biotechnology), eIF2a (1:1000, Cell Signaling, Beverly, MA), phosphor-eIF2a (1:1000, Cell Signaling), caspase 4 (1:1000, Protein Technology, Chicago, IL), caspase 3(1:1000, Epitomics, Burlingame, CA) and rabbit antiGAPDH as control (1:1000, Hangzhou Xianzhi Biology, Zhejiang, China). The next day, after washing three times with TBST, membranes were incubated for 2 h at room temperature with horseradish peroxidase (HRP)-secondary antibodies (1:1000, Protein Technology) in TBST and then visualized using the ECL detection system (Beyotime). Immunofluorescence Staining Cells grown on glass cover slides were washed with PBS and fixed in 10% formalin solution containing 4%
formaldehyde for 20 min, incubated with p-eIF2a (1:100 Cell Signaling) primary antibody, and then revealed with anti-rabbit IgG secondary Cy3 antibody (1:100 Protein Technology). After the reaction with secondary antibodies, the cells were stained with 100 nM 40 -6-diamidino-2-phenylindole (DAPI) for 5 min and observed under fluorescence microcopy. Annexin V-PI Flow Cytometry After the cells were subjected to the designated treatments, 1 106 cells were collected and resuspended in 500 ml binding buffer. Fluorescein isothiocyanate-conjugated annexin V (5 ml) and PI (10 ml) were added to each sample, and the mixture was incubated for 5 min at room temperature in the dark. Cells were then immediately subjected to FACS analysis (BD FACSCalibur, Becton Dickinson Co., Franklin Lakes, NJ). Each assay was performed in triplicate. Statistical Analysis Data were expressed as mean SD. SPSS v.16.0 (SPSS, Inc., Chicago, IL) was used for statistical analysis. Statistical significance among mean values was evaluated with one-way ANOVA tests for measurement data, with LSD-t test for comparisons between each other; p !0.05 was considered statistically significant.
Salubrinal Protect Cells from Apoptosis
525
Figure 2. CSE induces a dynamic change in PERK-eIF2a pathway activity. (A) Western blot with anti-p-PERK in HBE cells treated with 5% CSE shows the activation of p-PERK from 6 h, but the suppression decreased when CSE persisted. *p !0.05 compared with the control groups. (B) Western blot with anti-peIF2a also shows the activation of p-eIF2a. *p !0.05 compared with the control groups. Lower panel: Representative images of p-PERK and p-eIF2a immunofluorescence staining after 6 h CSE treatment show increased staining in cytoplasm (fluorescence microscope 400). Results are representative of three separate experiments with six samples for each mean value.
Results CSE-induced Apoptosis in HBE Cells CCK-8 assay showed that cell viability was markedly reduced in CSE-treated HBE cells in a dose- and timedependent manner (Figure 1A). Hoechst staining showed that treating the HBE cells with 5% CSE for 24 h greatly induced cell apoptosis (Figures 1B and 1C), and the apoptosis increased in a time-dependent manner. CSE Induced a Dynamic Change in PERK-eIF2a Pathway Activity In order to mimic the aging microenvironment in vitro, we treated HBE cells with CSE (5%) for 6, 12, and 24 h. Activity of the PERK pathway in the cells was then observed using Western blot analysis. An increase in the phosphorylated PERK (p-PERK) and phosphorylated eIF2a (p-eIF2a) in
the cells indicated an upregulated PERK pathway activity. As shown in Figure 2, both p-PERK and p-eIF2a had a dynamic change following the time course in CSE-treated HBE cells (Figures 2A and 2B), peaking at 6 h ( p !0.05) and then gradually downregulated following CSE treatment. Transient upregulation of p-PERK and p-eIF2a was also detected by immunofluorescence staining. At the time point of 6 h CSE treatment, cytoplasm p-PERK and p-eIF2a levels were significantly increased (Figures 2C and 2D). All these showed that the activity of the PERK pathway in HBE cells was significantly affected by CSE. Salubrinal Protects HBE Cells against CSE-induced Apoptosis To standardize the therapeutic strategy of Sal for controlling ER stress-induced apoptosis, we first treated HBE cells with Sal in different concentrations (0e100 mM); 2 h later, cells
526
Yuan et al./ Archives of Medical Research 43 (2012) 522e529
Figure 3. Salubrinal protects the HBE cells against CSE-induced apoptosis. (A) Dose-dependent protection of Sal on HBE cells treated with 5% CSE and cell viability was assessed by CCK-8. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. Assays were performed in quadruplicate, and eight samples were used for each meanvalue. (B) Western blot of caspase 4 and caspase 3. Cells were divided into six groups: control, 5% CSE, Sal (100 mM), 5% CSE þ Sal (1 mM), 5% CSE þ Sal (10 mM), 5% CSE þ Sal (100 mM). *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. (C) AnnexinV-PI flow cytometry showed that Sal attenuated CSE-induced apoptosis. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. Results are representative of three separate experiments; six samples for each mean value. (A color figure can be found in the online version of this article.)
were treated with CSE (5%) for 24 h. We then detected the cell survival rate using CCK-8, finding that cell survival rates were increased following the increase in Sal concentrations,
and that the optimal protective concentration was 100 mM (Figure 3A). On the other hand, Western blot analysis was performed on HBE cells pretreated with different
Salubrinal Protect Cells from Apoptosis
527
CSE-induced apoptosis possibly through regulating the PERK-eIF2a pathway activity. Hence, we tested the protein level of p-PERK and p-eIF2a using Western blot analysis after pretreating HBE cells with Sal at different concentrations (1 mM, 10 mM, 100 mM). Western blot analysis revealed that Sal selectively enhanced eIF2a phosphorylation without affecting the expression of p-PERK (Figures 4A and 4B). The induction of eIF2a phosphorylation by Sal was dose-dependent. These results suggest that Sal reverses the subsequent suppression of eIF2a phosphorylation, and an intact PERK-eIF2a pathway is necessary for cell survival under CSE insult. Effects of PERK Knockdown on CSE-induced Apoptosis
Figure 4. Sal attenuated CSE-induced apoptosis through increasing p-eIF2a. Cells were divided into six groups: control, 5% CSE, Sal (100 mM), 5% CSE þ Sal (1 mM), 5% CSE þ Sal (10 mM), 5% CSE þ Sal (100 mM). Western blot analysis using anti-p-PERK and anti-p-eIF2a antibodies showed the expression of p-eIF2a was dose-dependent, but the expression of p-PERK was not statistically significant among all groups. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups. Results are representative of three separate experiments with six samples for each mean value.
concentrations (1 mM, 10 mM, and 100 mM) for 2 h and then treated with CSE (5%) for 24 h. Western blot analysis showed that expressions of caspase 3 and caspase 4 were decreased following the increase in Sal concentration (Figure 3B). Furthermore, flow cytometry analysis of AnnexinV-PI double staining also revealed that the apoptotic rate of CSE-treated cells was reduced by Sal in a dosedependent manner (Figure 3C). These data suggested a therapeutic potential of Sal against CSE-induced lung injury (or even emphysema), which warrants further evaluation.
To further explore the role of PERK-eIF2a pathway in ER stress-induced HBE cell apoptosis following CSE treatment, transfection of HBE cells with specific siRNA against PERK gene was performed. After preincubation with PERK siRNA and then stimulation with 5% CSE for 24 h, the expression of PERK at both the mRNA and protein levels was downregulated significantly (Figures 5A and 5B). Phosphorylation of eIF2a, but not the total eIF2a, was also inhibited. Furthermore, in this experiment, effect of Sal on CSE-induced HBE cell apoptosis was investigated again in comparison with PERK-siRNA. Whereas the knockdown of PERK gene suppressed the expression of p-eIF2a causing a great increase in cell apoptosis (Figure 5C), Sal alone effectively enhanced the phosphorylation of eIF2a. The decrease of p-eIF2a caused by PERK-siRNA was also eliminated by Sal after combining Sal with PERK-siRNA transfected cells. It is worth noting that the apoptotic rate of HBE cells varied closely with the changes in p-eIF2a levels as detected in this experiment. A decrease in p-eIF2a was highly relevant with an increase in the apoptotic rate (Figure 5C), confirming that the intactness of PERK/eIF2a pathway, especially the level of p-eIF2a, is crucial for cell survival under CSE insult, and PERK may participate in the activation of p-eIF2a.
Discussion Sal Attenuated CSE-induced Apoptosis Possibly through Regulation of p-eIF2a Level As observed in this study, there was a dynamic change in PERK-eIF2a pathway activity of the HBE cells following CSE treatment. Whereas the p-PERK and p-eIF2a levels were dynamically changing from peaking at 6 h to returning to (or even lower than) normal level at 24 h following the time course of CSE treatment, cell viability declined steadily. The 24 h treatment with CSE markedly induced HBE cell apoptosis and caused a consequent decrease in p-eIF2a level. We hypothesize that this decrease in p-eIF2a following 24 h CSE treatment may contribute to HBE cell apoptosis. Sal exerts its protective effect against
It is well known that CSE induces HBE cell apoptosis; thus, CSE has been successfully used to establish an experimental model for COPD-related studies (18). CSE exposure induces ER stress and eventually causes apoptosis (19). Research also shows that ER stress, to which the PERK provokes the very immediate response, contributes to the pathophysiology of COPD (3,20). However, detailed information on how PERK and the PERK/eIF2a pathway changes during the process of CSE insult and how the changes in the activity of PERK/eIF2 pathway affect the degree of HBE cell damages caused by CSE is still needed. In the present study we found that 5% CSE caused a dynamic change in the PERK/eIF2a pathway activity
528
Yuan et al./ Archives of Medical Research 43 (2012) 522e529
Figure 5. Effects of PERK knockdown on CSE-induced apoptosis. (A) PERK siRNA was confirmed by the PERK RT-PCR analysis. (B) Expression of PERK and p-eIF2a/eIF2a was detected by Western blot in six groups. (C) Apoptosis of the cells in six groups. Data were presented as mean SD. *p !0.05 compared with the control groups. #p !0.05 compared with the CSE groups, **p !0.05 compared with the CSE þ PERK siRNA groups. Results are representative of three separate experiments with six samples for each mean value. (A color figure can be found in the online version of this article.)
following CSE exposure. PERK/eIF2a activities peaked at 6 h and then gradually downregulated during CSE treatment. This exposure of CSE for 24 h greatly induced HBE cell apoptosis. These results clearly demonstrate the involvement
of PERK/eIF2a pathway in the development of HBE cell apoptosis following CSE exposure. Research has shown that when cells are challenged with ER stress, phosphorylated eIF2a is increased, mediating a transient decrease in global
Salubrinal Protect Cells from Apoptosis
translation and a translational upregulation of selective stress-induced mRNAs. When ER stress is not mitigated and homeostasis is not restored, the UPR triggers apoptosis (20,21). Our results are consistent with this finding. To further explore the role of the PERK/eIF2a pathway in the development of CSE-induced HBE cell apoptosis and the treatment potential of Sal, we treated the cells at various concentration of Sal for 2 h before CSE (5%) treatment for 24 h. Our experiments revealed that Sal selectively enhanced eIF2a phosphorylation without affecting the expression of p-PERK (Figures 4A and 4B). Induction of eIF2a phosphorylation by Sal was dose-dependent. The results from CCK-8, Western blot analysis, and flow cytometry analysis of AnnexinV-PI double staining also showed that the cell survival rates were increased following the increase in Sal concentrations, and the apoptotic rate of CSE-treated cells was reduced by Sal in a dose-dependent manner accompanied with the decrease in the apoptotic markers of caspase 3 and caspase 4 expression. The importance of an intact PERK-eIF2a pathway for cell survival under CSE insult is clearly confirmed here, and Sal’s protective effect against CSE-induced HBE cell damage is likely via maintaining the homeostasis of PERK-eIF2a pathway. The knockdown of PERK gene by specific interfering RNA (siRNA) in this study further confirmed the importance of the intactness of the PERK-eIF2a pathway for cell survival under CSE insult. The knockdown of PERK suppressed the expression of PERK and it is noteworthy that p-eIF2a caused a great increase in cell apoptosis (Figure 5C). In contrast, Sal showed an opposite effect. It eliminated the decrease in p-eIF2a caused by the PERK knockdown, enhanced eIF2a phosphorylation, and significantly attenuated CSE-induced HBC cell apoptosis. Furthermore, our results also revealed that it was the p-eIF2a level, rather than the total eIF2a level, that was highly relevant with the occurrence of HBE cell apoptosis. A decrease in p-eIF2a pointed to an increase in the apoptotic rate. The intactness of PERK/eIF2a pathway, especially the level of p-eIF2a, is crucial for cell survival under CSE insult because this pathway is necessary for cell survival mechanisms rather than cell apoptosis, which is in accordance with other reports (22,23). In summary, our results demonstrate that CSE induces HBE cell apoptosis likely via PERK-eIF2a dependent induction of caspases. PERK-eIF2a pathway plays an important role in CSE-induced HBE cell injury. The intactness of PERK-eIF2a pathway is a key to cell survival under CSE insult. Sal can protect against CSE-induced HBE cell apoptosis through regulating the PERK pathway, demonstrating a potential new approach for the effective treatment of COPD. Acknowledgments This study was supported by the National Natural Science Fund (project number: 30971324).
529
References 1. Pauwels RA, Rabe KF. Burden and clinical features of chronic obstructive pulmonary disease (COPD). Lancet 2004;364:613e620. 2. Pauwels RA, Buist AS, Calverley PM, et al. Global strategy for the diagnosis, management, and prevention of chronic obstructive pulmonary disease. NHLBI/WHO Global Initiative for Chronic Obstructive Lung Disease (GOLD) Workshop summary. Am J Respir Crit Care Med 2001;163:1256e1276. 3. Kelsen SG, Duan X, Ji R, et al. Cigarette smoke induces an unfolded protein response in the human lung: a proteomic approach. Am J Respir Cell Mol Biol 2008;38:541e550. 4. Demedts IK, Demoor T, Bracke KR, et al. Role of apoptosis in the pathogenesis of COPD and pulmonary emphysema. Respir Res 2006;7:53. 5. Kuwano K. Epithelial cell apoptosis and lung remodeling. Cell Mol Immunol 2007;4:419e429. 6. Lindholm D, Wootz H, Korhonen L. ER stress and neurodegenerative diseases. Cell Death Differ 2006;13:385e392. 7. Zhou J, Liu CY, Back SH, et al. The crystal structure of human IRE1 luminal domain reveals a conserved dimerization interface required for activation of the unfolded protein response. Proc Natl Acad Sci USA 2006;103:14343e14348. 8. Harding HP, Zhang Y, Bertolotti A, et al. Perk is essential for translational regulation and cell survival during the unfolded protein response. Mol Cell 2000;5:897e904. 9. Muaddi H, Majumder M, Peidis P, et al. Phosphorylation of eIF2alpha at serine 51 is an important determinant of cell survival and adaptation to glucose deficiency. Mol Biol Cell 2010;21:3220e3231. 10. Fischer H, Koenig U, Eckhart L, et al. Human caspase 12 has acquired deleterious mutations. Biochem Biophys Res Commun 2002;293:722e726. 11. Hitomi J, Katayama T, Eguchi Y, et al. Involvement of caspase-4 in endoplasmic reticulum stress-induced apoptosis and Abeta-induced cell death. J Cell Biol 2004;165:347e356. 12. Boyce M, Bryant KF, Jousse C, et al. A selective inhibitor of eIF2alpha dephosphorylation protects cells from ER stress. Science 2005; 307:935e939. 13. Kim I, Xu W, Reed JC. Cell death and endoplasmic reticulum stress: disease relevance and therapeutic opportunities. Nat Rev Drug Discov 2008;7:1013e1030. 14. Bodas M, Min T, Vij N. Early-age-related changes in proteostasis augment immunopathogenesis of sepsis and acute lung injury. PLoS One 2010;5:e15480. 15. Braber S, Koelink PJ, Henricks PA, et al. Cigarette smoke-induced lung emphysema in mice is associated with prolyl endopeptidase, an enzyme involved in collagen breakdown. Am J Physiol Lung Cell Mol Physiol 2011;300:L255eL265. 16. Xiong XL, Jia RH, Yang DP, et al. Irbesartan attenuates contrast mediainduced NRK-52E cells apoptosis. Pharmacol Res 2006;54:253e260. 17. Xu FF, Liu XH, Cai LR. [Role of hypoxia-inducible factor-1alpha in the prevention of cardiomyocyte injury induced by hypoxic preconditioning]. Sheng Li Xue Bao 2004;56:609e614. 18. Hansel NN, Sidhaye V, Rafaels NM, et al. Aquaporin 5 polymorphisms and rate of lung function decline in chronic obstructive pulmonary disease. PLoS One 2010;5:e14226. 19. Min T, Bodas M, Mazur S, et al. Critical role of proteostasisimbalance in pathogenesis of COPD and severe emphysema. J Mol Med (Berl) 2011;89:577e593. 20. Barnes PJ. The cytokine network in chronic obstructive pulmonary disease. Am J Respir Cell Mol Biol 2009;41:631e638. 21. Ron D, Walter P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 2007;8:519e529. 22. Lee do Y, Lee KS, Lee HJ, et al. Activation of PERK signaling attenuates Abeta-mediated ER stress. PLoS One 2010;5:e10489. 23. Sokka AL, Putkonen N, Mudo G, et al. Endoplasmic reticulum stress inhibition protects against excitotoxic neuronal injury in the rat brain. J Neurosci 2007;27:901e908.