- Email: [email protected]
SCN1AIVS5-91G>A polymorphism is associated with susceptibility to epilepsy but not with drug responsiveness
Biochimie 95 (2013) 1350e1353
Contents lists available at SciVerse ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Short communication
SCN1AIVS5-91G>A polymorphism is associated with susceptibility to epilepsy but not with drug responsiveness Ritu Kumari a, Ram Lakhan a, Surendra Kumar a, R.K. Garg c, U.K. Misra b, J. Kalita b, Balraj Mittal a, * a b c
Department of Genetics, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Raebareli Road, Lucknow 226014, India Department of Neurology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India Department of Neurology, King George’s Medical University, Lucknow 226003, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 June 2012 Accepted 4 February 2013 Available online 1 March 2013
Sodium channel alpha subunit type 1 (SCN1A) is voltage gated ion channel which plays critical role in membrane excitability. A common SCN1A IVS5-91G>A (rs3812718) allele has been attributed to be a possible modifying factor for epilepsy susceptibility and therapeutic response. In the present study, we enrolled 485 epilepsy patients and 298 age-sex matched controls free of neurological deficits. Therapeutic response of carbamazepine/oxcarbamazepine (CBZ/OXC) and other antiepileptic drugs were observed in terms of drug responsiveness and drug resistance. Genotyping of SCN1A IVS5-91G>A is done by Taqman custom designed assay; in a real time7500HT System. We observe highly significant association [(P-values for GA (P ¼ 6.58 105, OR ¼ 2.13, 95% CI ¼ 1.47e3.09) and AA (P ¼ 4.11 109, OR ¼ 3.59, 95% CI ¼ 2.35e5.50)] at variant genotypes as well as A allele (P ¼ 6.92 1011), OR ¼ 1.99, 95%, CI ¼ 1.62e2.45) in epilepsy patients versus control subjects. The relative risk for epilepsy susceptibility due to variant containing genotypes (GA þ AA) was also significant (P ¼ 1.64 105; OR ¼ 2.56; 95% CI ¼ 1.80e3.65) when compared with homozygous wild-type GG. The risk in recessive model (P ¼ 1.34 105; OR ¼ 2.12; 95% CI ¼ 1.51e2.97) was also apparent when compared with GA þ GG. In case-only analysis, we evaluated the effect of SCN1A IVS5-91G>A polymorphism with drug resistance of anti-epileptic drug therapies. However, we did not observe significant associations either with patients showing drug resistance to CBZ/OXC monotherapy or polytherapy. In conclusion, we report that SCN1AIVS5-91G>A polymorphism is associated with epilepsy susceptibility but not with drug responsiveness in epilepsy patients from North India. Ó 2013 Elsevier Masson SAS. All rights reserved.
Keywords: Antiepileptic drug Drug resistance Pharmacotherapy Voltage gated sodium channel
1. Introduction Epilepsy is clinically and genetically heterogeneous group of disorders characterized by an episode of excessive synchronized neuronal activity [1]. According to World Health Organization (WHO); worldwide eight per 1000 persons have epilepsy [2]. Earlier reports suggested that almost half of all epilepsies have some genetic predisposition which could directly or indirectly modulate seizure phenotype [3]. Studies indicate that different types of epilepsies can aggregate in families [4e6], suggesting the existence of shared genetic factors that increase susceptibility to different epilepsies [7]. The advances in pharmacogenetics have further revealed that genetic variations also determine clinical response of epilepsy patients to different drugs [8]. Therefore, * Corresponding author. Tel.: þ91 522 2668700x2322; fax: þ91 522 2668017. E-mail addresses: [email protected], [email protected] (B. Mittal). 0300-9084/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.biochi.2013.02.006
genetic factors could be major determinants of individual susceptibility to epilepsy, and response to therapeutic compounds. Voltage-gated sodium channels (VGSCs) are responsible for neuronal depolarization as well as initiation and propagation of action potentials in neurons [9]. These are heterologous multisubunit complexes that contain a large ‘a’ subunit and smaller ‘b’ subunits [10]. In fact, altered sodium channel transcript levels in human epilepsy have been found in brain tissues, suggesting a potential role for sodium channels in the pathophysiology of epilepsy. Along with other genetic variants of sodium channels, SCN1A IVS5-91G>A (rs3812718) allele has been attributed to be a possible modifying factor for epilepsy susceptibility and therapeutic response [11]. It has been suggested that the polymorphism influences treatment response of carbamazepine in epilepsy patients [12e14], but results from replication studies have not been consistent. Therefore, we aimed to re-evaluate the role of SCN1AIVS5-91G>A gene polymorphism in epilepsy susceptibility as
R. Kumari et al. / Biochimie 95 (2013) 1350e1353
well as pharmacotherapy in North Indian epilepsy patients visiting tertiary care hospital in North India. 2. Methods 2.1. Recruitment of epilepsy patients and healthy controls The epilepsy patients were recruited from the Neurology OutPatient Department (OPD) of Sanjay Gandhi Postgraduate Institute of Medical Sciences (SGPGIMS), and King George’s Medical University (KGMU), Lucknow, India. The patients were diagnosed and classified by experienced neurologists following criteria of the International League against Epilepsy (ILAE, 1989). The recruitment of the subjects was done according to the inclusion and exclusion criteria as described earlier [15]. A total of 485 eligible epilepsy patients undergoing pharmacotherapy were selected for the present study from June 2006 to June 2011. During same period, 298 healthy controls (HC) subjects were enrolled from volunteers like healthy staff members and general population. All healthy controls were age, sex, and ethnicity matched and free from any neurological disorders and belonged to same geographical region. The study protocol was approved by the Ethics Committees of SGPGIMS and KGMU Lucknow, India. After informed consent, 5 ml of blood was collected in EDTA vial from each patient or control and stored at 70 C.
1351
3.1.2. Genotyping Genomic DNA was isolated from peripheral blood leukocytes by the salting-out protocol [18]. Samples were genotyped for the SCN1A IVS5-91G>A (rs3812718) polymorphism (Gene Bank: NM_001165963) by a custom designed Taqman based allelic discrimination assay (Applied Biosystems, Foster City, CA, U.S.A.). Assay primer and fluorescently labeled probe sequences were as follows (all are 50 / 30 ): forward primer, TTCAGAGTCTTGAGCTT TGAAAA; reverse primer, TGTGACGTAGTACCTGTAATAGGGAGTTC; G probe, FAM-AATTCCAGGTAAGAAGTGA-MGB; and A Probe, VIC-AATT CCAGGTAAAAAGTGA-MGB. Assay conditions were in accordance with manufacturer’s protocols. Fluorescence outputs were quantified in real time by using a 7500HT Fast Real Time PCR System (Applied Biosystems, Carlsbad, California). 3.1.3. Statistical analysis Genotype frequencies for each SCN1A IVS5-91G>A marker in controls were examined for deviation from HardyeWeinberg equilibrium (HWE) using the X2 test. The relationship between various genotypes and responsiveness was examined using binary logistic regression. Association was expressed as odds ratios (OR) or risk estimates with 95% confidence intervals (CI). The significant association was considered when P-value was <0.05. All analyses were conducted using the SPSS statistical analysis software, version 16.0 (SPSS Inc., Chicago, IL, USA). 4. Results
3. Treatment protocol 3.1. CBZ/OXZ monotherapy Because OXC is a CBZ derivative which also acts by blocking sodium channels [16], data on these two drugs were analyzed together. Among epilepsy patients, 213 cases were administered CBZ/OXZ monotherapy for 6 month as first line of therapy. Initially, the patients received CBZ or oxcarbazepine (OXC) dose of 2, 00 mg/day, and 3.00 mg/day respectively. At each follow-up visit, patient compliance was recorded. The dose of CBZ/OXZ was increased when participants suffered a recurrence of epilepsy. In the case of resistance to CBZ/OXZ or a serious adverse reaction, CBZ/OXZ was replaced with another AED. Adverse drug reactions associated with the use of CBZ/OXZ, such as disorders of liver function or serum lipid levels and changes in blood cells, were also recorded. In addition, we recorded the reason for any discontinuation of the medication. Finally, 124 out of 213 patients responded to CBZ/OXZ monotherapy and remaining 89 patients were subjected to other AED mono or polytherapy. 3.1.1. Multi-drug resistance The remaining two hundred seventy two epilepsy patient initially received monotherapy of drugs other than CBZ/OXZ, If the drug under maximum tolerated doses did not work, then other AEDs were prescribed either single (monotherapy) or in combination (Polytherapy). Multi-drug resistance was defined as the occurrence of at least four seizures over a period of one year with three or more appropriate antiepileptic drugs (AEDs) either alone or in combination, at maximum tolerated doses [15,17]. The epilepsy patients who had complete freedom from seizures for at least one year from last follow up visit were considered drug responsive. A total of 251 epilepsy patients received polytherapy, 170 patients responded to the anti-epileptic treatment while remaining 81 patients were non-responsive and termed drug resistant.
In controls, genotype and allelic frequencies of SCN1A IVS5e 91G>A polymorphism were consistent with HardyeWeinberg equilibrium (P ¼ 0.86) and the genotypic frequencies were similar to those reported by Grover et al. [19], for North Indian population. Frequencies of GA and AA genotypes of SCN1A IVS5-91G>A were found to be significantly higher in epilepsy patients versus control subjects for GA (P ¼ 6.58 105, OR ¼ 2.13, 95% CI ¼ 1.47e3.09) and AA (P ¼ 4.11 109, OR ¼ 3.59, 95% CI ¼ 2.35e5.50) genotypes as well as for variant A allele (P ¼ 6.92 1011), OR ¼ 1.99, 95%, CI ¼ 1.62e2.45 (Table 1). The relative risk for epilepsy susceptibility due to variant (GA þ AA) was significant (P ¼ 1.64 105; OR ¼ 2.56; 95% CI ¼ 1.80e 3.65) when compared with homozygous wild-type GG. The risk in recessive model (P ¼ 1.34 105; OR ¼ 2.12; 95% CI ¼ 1.51e2.97) was also apparent when compared with GA þ GG. The trend test was also significant (P ¼ 3.13 109) (Table 1). In case only analysis of epilepsy patients regarding effect of SCN1AIVS5-91G>A genotype on drug response, we did not observe significant associations either with patients showing drug resistance to CBZ/OXC monotherapy or multidrug polytherapy (Table 2).
Table 1 Distribution of SCN1A IVS5-91G>A (rs3812718) gene polymorphism in epilepsy patients versus healthy controls. Genotypes /alleles
Epilepsy patients (N ¼ 485)
P-Value
Odds ratio (95% CI)
(30.5%) (48.9%) (20.5%) (56.7%) (43.3%)
71 243 171 385 585
(14.6%) (50.1%) (35.3%) (39.7%) (60.3%)
Ref. 6.58 4.11 Ref. 6.92 3.13
Ref. 2.13 (1.47e3.09) 3.59 (2.35e5.50) Ref. 1.99 (1.62e2.45)
(30.5%) (69.5%) (79.5%) (20.5%)
71 414 314 171
(14.6%) (85.6%) (64.7%) (35.3%)
Ref. 1.64 3 10L5 Ref. 1.34 3 10L5
Control subjects (N ¼ 298)
GG 91 GA 146 AA 61 G* 338 A* 258 P trend Carrier analysis GG 91 GA þ AA 207 GA þ GG 237 AA 61
Significant values are shown in bold.
3 10L5 3 10L9 3 10L11 3 10L9
Ref. 2.56 (1.80e3.65) Ref. 2.12 (1.51e2.97)
1352
R. Kumari et al. / Biochimie 95 (2013) 1350e1353
Table 2 Distribution of SCN1A IVS5-91G>A (rs3812718) gene polymorphism in drug responsive versus drug resistant epilepsy patients on CBZ/OXZ treated and on multidrug treated epilepsy patients. Genotypes/alleles
GG GA AA G* A* P trend
Drug responsive and drug resistant epilepsy patients on monotherapy (N ¼ 213)
Drug responsive and drug resistant epilepsy patients on multidrug therapy (N ¼ 251)
CBZ/OXZ treated drug responsive patients (N ¼ 124)
CBZ/OXZ treated drug resistant patients (N ¼ 89)
P-Value
Odds ratio (95% CI)
Drug responsive (N ¼ 170)
Drug resistant (N ¼ 81)
P-Value
Odds ratio (95% CI)
19 66 39 104 144
9 49 31 67 111
Ref. 0.314 0.272 Ref. 0.373 0.34
Ref. 1.567 (0.653e3.760) 1.678 (0.667e4.222) Ref. 1.197 (0.807e1.775)
28 82 60 138 202
16 40 25 72 90
Ref. 0.667 0.422 Ref. 0.413 0.41
Ref. 0.854 (0.415e1.756) 0.729 (0.337e1.577) Ref. 0.854 (0.585e1.246)
(15.3%) (53.2%) (31.4%) (41.9%) (58.1%)
(10.1%) (55.1%) (34.8%) (37.6%) (62.3%)
Because maximum tolerated doses were different for different individuals in our epilepsy patients, it did not allow any meaningful evaluation for influence of genotypes on drug dosage in our study.
(16.5%) (48.2%) (35.3%) (40.6%) (59.4%)
(19.6%) (49.4%) (30.9%) (44.4%) (55.5%)
Acknowledgments The study was supported by a grant received from the Department of Biotechnology, Government of India, and fellowships provided by ICMR New Delhi, India.
5. Discussion References In the present study, we observed an association of potentially functional genetic variant SCN1A IVS5-91G>A gene polymorphism with epilepsy susceptibility but not with drug responsiveness either in CBZ/OXZ treated monotherapy or multi-drug polytherapy in epilepsy patients in a North Indian population. There are substantial evidences to suggest that most of genes not only predispose to epilepsy but are also believed to determine responsiveness to antiepileptic drugs. It is becoming increasingly clear that genetic polymorphisms play an integral role in variability of both AED pharmacokinetics and pharmacodynamics. The SCN1A gene coding for voltage-gated sodium channels has been an attractive candidate for investigating the link between genetic polymorphisms in drug targets and clinical response. AEDs like carbamazepine, phenytoin and oxcarbazepine interact with voltage-gated sodium, calcium and potassium channels [20]. Animal and human studies also provide evidence for a possible link between loss of sodium channel drug sensitivity to carbamazepine (CBZ) and drug-resistant epilepsy [21]. Based on pioneering studies by Tate et al., SCN1A IVS5-91G>A polymorphism has been specially linked to CBZ treatment in epilepsy patients [13]. However, we failed to reproduce previously reported associations between the SCN1A IVS5-91G>A polymorphism and response to AED treatment [12,22]. Our results are consistent with several studies [13,23] which also failed to confirm an association of this polymorphism with drug resistance. Many investigators have also looked into association of the gene polymorphism with requirement of carbamazepine and phenytoin serum concentration at maintenance dose [13] or retention rate of the drug [24] but we did not study the pharmacokinenetics aspects of AEDs. The discrepancies in different studies may be explained by many factors, including sample size, sample heterogeneity, selection bias, and other confounders. Several other factors may explain failure to replicate the initial results, including differences in ethnic background among populations, differences in underlying etiologies of epilepsy, and differences in treatment regimens analyzed (type of AED and proportions of patients receiving monotherapy and Polytherapy). In conclusion, we report that SCN1AIVS5-91G>A polymorphism is associated with epilepsy susceptibility but not with CBZ or multidrug responsiveness therapy in epilepsy patients. These results suggest that a subunit of SCN1A gene may play an important role in pathophysiology rather than pharmacotherapy response in epilepsy.
[1] M. Mantegazza, G. Curia, G. Biagini, D.S. Ragsdale, M. Avoli, Voltage-gated sodium channels as therapeutic targets in epilepsy and other neurological disorders, Lancet Neurol. 9 (2010) 413e424. [2] R. Lakhan, R. Kumari, K. Singh, J. Kalita, U.K. Misra, B. Mittal, Possible role of CYP2C9 & CYP2C19 single nucleotide polymorphisms in drug refractory epilepsy, Indian J. Med. Res. 134 (2011) 295e301. [3] J.F. Annegers, W.A. Rocca, W.A. Hauser, Causes of epilepsy: contributions of the Rochester epidemiology project, Mayo Clin. Proc. 71 (1996) 570e575. [4] O.G. Ottmann, D. Hoelzer, Growth factors in the treatment of acute lymphoblastic leukemia, Leuk. Res. 22 (1998) 1171e1178. [5] C. Bianchi, R. Fato, M.L. Genova, G. Parenti Castelli, G. Lenaz, Structural and functional organization of complex I in the mitochondrial respiratory chain, Biofactors 18 (2003) 3e9. [6] S.F. Berkovic, J.M. Serratosa, H.A. Phillips, L. Xiong, E. Andermann, F. DiazOtero, P. Gomez-Garre, M. Martin, Y. Fernandez-Bullido, F. Andermann, I. Lopes-Cendes, F. Dubeau, R. Desbiens, I.E. Scheffer, R.H. Wallace, J.C. Mulley, M. Pandolfo, Familial partial epilepsy with variable foci: clinical features and linkage to chromosome 22q12, Epilepsia 45 (2004) 1054e1060. [7] D. Kasperaviciute, C.B. Catarino, E.L. Heinzen, C. Depondt, G.L. Cavalleri, L.O. Caboclo, S.K. Tate, J. Jamnadas-Khoda, K. Chinthapalli, L.M. Clayton, K.V. Shianna, R.A. Radtke, M.A. Mikati, W.B. Gallentine, A.M. Husain, S. Alhusaini, D. Leppert, L.T. Middleton, R.A. Gibson, M.R. Johnson, P.M. Matthews, D. Hosford, K. Heuser, L. Amos, M. Ortega, D. Zumsteg, H.G. Wieser, B.J. Steinhoff, G. Kramer, J. Hansen, T. Dorn, A.M. Kantanen, L. Gjerstad, T. Peuralinna, D.G. Hernandez, K.J. Eriksson, R.K. Kalviainen, C.P. Doherty, N.W. Wood, M. Pandolfo, J.S. Duncan, J.W. Sander, N. Delanty, D.B. Goldstein, S.M. Sisodiya, Common genetic variation and susceptibility to partial epilepsies: a genome-wide association study, Brain 133 (2010) 2136e 2147. [8] S.M. Sisodiya, C. Marini, Genetics of antiepileptic drug resistance, Curr. Opin. Neurol. 22 (2009) 150e156. [9] J.P. Magby, A.P. Neal, W.D. Atchison, I.P. Pessah, T.J. Shafer, Channelopathies: summary of the hot topic keynotes session, Neurotoxicology 32 (2011) 661e 665. [10] Y.Y. Vilin, P.C. Ruben, Slow inactivation in voltage-gated sodium channels: molecular substrates and contributions to channelopathies, Cell. Biochem. Biophys. 35 (2001) 171e190. [11] A.J. Lombardo, R. Kuzniecky, R.E. Powers, G.B. Brown, Altered brain sodium channel transcript levels in human epilepsy, Brain Res. Mol. Brain Res. 35 (1996) 84e90. [12] S.K. Tate, C. Depondt, S.M. Sisodiya, G.L. Cavalleri, S. Schorge, N. Soranzo, M. Thom, A. Sen, S.D. Shorvon, J.W. Sander, N.W. Wood, D.B. Goldstein, Genetic predictors of the maximum doses patients receive during clinical use of the anti-epileptic drugs carbamazepine and phenytoin, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 5507e5512. [13] S.K. Tate, R. Singh, C.C. Hung, J.J. Tai, C. Depondt, G.L. Cavalleri, S.M. Sisodiya, D.B. Goldstein, H.H. Liou, A common polymorphism in the SCN1A gene associates with phenytoin serum levels at maintenance dose, Pharmacogenet. Genomics 16 (2006) 721e726. [14] C.C. Kuo, R.S. Chen, L. Lu, R.C. Chen, Carbamazepine inhibition of neuronal Naþ currents: quantitative distinction from phenytoin and possible therapeutic implications, Mol. Pharmacol. 51 (1997) 1077e1083. [15] R. Lakhan, U.K. Misra, J. Kalita, S. Pradhan, N.J. Gogtay, M.K. Singh, B. Mittal, No association of ABCB1 polymorphisms with drug-refractory epilepsy in a North Indian population, Epilepsy Behav. 14 (2009) 78e82.
R. Kumari et al. / Biochimie 95 (2013) 1350e1353 [16] R.H. Levy, Antiepileptic Drugs, Lippincott Williams & Wilkins, Philadelphia, 2002. [17] A. Siddiqui, R. Kerb, M.E. Weale, U. Brinkmann, A. Smith, D.B. Goldstein, N.W. Wood, S.M. Sisodiya, Association of multidrug resistance in epilepsy with a polymorphism in the drug-transporter gene ABCB1, N. Engl. J. Med. 348 (2003) 1442e1448. [18] S.A. Miller, D.D. Dykes, H.F. Polesky, A simple salting out procedure for extracting DNA from human nucleated cells, Nucleic Acids Res. 16 (1988) 1215. [19] S. Grover, M. Gourie-Devi, R. Baghel, S. Sharma, K. Bala, M. Gupta, K. Narayanasamy, B. Varma, K. Kaur, P. Talwar, H. Kaur, S. Giddaluru, A. Sharma, S.K. Brahmachari, C. Indian Genome Variation, R. Kukreti, Genetic profile of patients with epilepsy on first-line antiepileptic drugs and potential directions for personalized treatment, Pharmacogenomics 11 (2010) 927e941. [20] B. Dworakowska, K. Dolowy, Ion channels-related diseases, Acta Biochim. Pol. 47 (2000) 685e703.
1353
[21] R.K. Ellerkmann, S. Remy, J. Chen, D. Sochivko, C.E. Elger, B.W. Urban, A. Becker, H. Beck, Molecular and functional changes in voltage-dependent Na(þ) channels following pilocarpine-induced status epilepticus in rat dentate granule cells, Neuroscience 119 (2003) 323e333. [22] T. Abe, T. Seo, T. Ishitsu, T. Nakagawa, M. Hori, K. Nakagawa, Association between SCN1A polymorphism and carbamazepine-resistant epilepsy, Br. J. Clin. Pharmacol. 66 (2008) 304e307. [23] F. Zimprich, E. Stogmann, S. Bonelli, C. Baumgartner, J.C. Mueller, T. Meitinger, A. Zimprich, T.M. Strom, A functional polymorphism in the SCN1A gene is not associated with carbamazepine dosages in Austrian patients with epilepsy, Epilepsia 49 (2008) 1108e1109. [24] B.T. Zhou, Q.H. Zhou, J.Y. Yin, G.L. Li, X.J. Xu, J. Qu, D. Liu, H.H. Zhou, Z.Q. Liu, Comprehensive analysis of the association of SCN1A gene polymorphisms with the retention rate of carbamazepine following monotherapy for newonset focal seizures in the Chinese Han population, Clin. Exp. Pharmacol. Physiol. 39 (2012) 379e384.
Contents lists available at SciVerse ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Short communication
SCN1AIVS5-91G>A polymorphism is associated with susceptibility to epilepsy but not with drug responsiveness Ritu Kumari a, Ram Lakhan a, Surendra Kumar a, R.K. Garg c, U.K. Misra b, J. Kalita b, Balraj Mittal a, * a b c
Department of Genetics, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Raebareli Road, Lucknow 226014, India Department of Neurology, Sanjay Gandhi Postgraduate Institute of Medical Sciences, Lucknow 226014, India Department of Neurology, King George’s Medical University, Lucknow 226003, India
a r t i c l e i n f o
a b s t r a c t
Article history: Received 4 June 2012 Accepted 4 February 2013 Available online 1 March 2013
Sodium channel alpha subunit type 1 (SCN1A) is voltage gated ion channel which plays critical role in membrane excitability. A common SCN1A IVS5-91G>A (rs3812718) allele has been attributed to be a possible modifying factor for epilepsy susceptibility and therapeutic response. In the present study, we enrolled 485 epilepsy patients and 298 age-sex matched controls free of neurological deficits. Therapeutic response of carbamazepine/oxcarbamazepine (CBZ/OXC) and other antiepileptic drugs were observed in terms of drug responsiveness and drug resistance. Genotyping of SCN1A IVS5-91G>A is done by Taqman custom designed assay; in a real time7500HT System. We observe highly significant association [(P-values for GA (P ¼ 6.58 105, OR ¼ 2.13, 95% CI ¼ 1.47e3.09) and AA (P ¼ 4.11 109, OR ¼ 3.59, 95% CI ¼ 2.35e5.50)] at variant genotypes as well as A allele (P ¼ 6.92 1011), OR ¼ 1.99, 95%, CI ¼ 1.62e2.45) in epilepsy patients versus control subjects. The relative risk for epilepsy susceptibility due to variant containing genotypes (GA þ AA) was also significant (P ¼ 1.64 105; OR ¼ 2.56; 95% CI ¼ 1.80e3.65) when compared with homozygous wild-type GG. The risk in recessive model (P ¼ 1.34 105; OR ¼ 2.12; 95% CI ¼ 1.51e2.97) was also apparent when compared with GA þ GG. In case-only analysis, we evaluated the effect of SCN1A IVS5-91G>A polymorphism with drug resistance of anti-epileptic drug therapies. However, we did not observe significant associations either with patients showing drug resistance to CBZ/OXC monotherapy or polytherapy. In conclusion, we report that SCN1AIVS5-91G>A polymorphism is associated with epilepsy susceptibility but not with drug responsiveness in epilepsy patients from North India. Ó 2013 Elsevier Masson SAS. All rights reserved.
Keywords: Antiepileptic drug Drug resistance Pharmacotherapy Voltage gated sodium channel
1. Introduction Epilepsy is clinically and genetically heterogeneous group of disorders characterized by an episode of excessive synchronized neuronal activity [1]. According to World Health Organization (WHO); worldwide eight per 1000 persons have epilepsy [2]. Earlier reports suggested that almost half of all epilepsies have some genetic predisposition which could directly or indirectly modulate seizure phenotype [3]. Studies indicate that different types of epilepsies can aggregate in families [4e6], suggesting the existence of shared genetic factors that increase susceptibility to different epilepsies [7]. The advances in pharmacogenetics have further revealed that genetic variations also determine clinical response of epilepsy patients to different drugs [8]. Therefore, * Corresponding author. Tel.: þ91 522 2668700x2322; fax: þ91 522 2668017. E-mail addresses: [email protected], [email protected] (B. Mittal). 0300-9084/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.biochi.2013.02.006
genetic factors could be major determinants of individual susceptibility to epilepsy, and response to therapeutic compounds. Voltage-gated sodium channels (VGSCs) are responsible for neuronal depolarization as well as initiation and propagation of action potentials in neurons [9]. These are heterologous multisubunit complexes that contain a large ‘a’ subunit and smaller ‘b’ subunits [10]. In fact, altered sodium channel transcript levels in human epilepsy have been found in brain tissues, suggesting a potential role for sodium channels in the pathophysiology of epilepsy. Along with other genetic variants of sodium channels, SCN1A IVS5-91G>A (rs3812718) allele has been attributed to be a possible modifying factor for epilepsy susceptibility and therapeutic response [11]. It has been suggested that the polymorphism influences treatment response of carbamazepine in epilepsy patients [12e14], but results from replication studies have not been consistent. Therefore, we aimed to re-evaluate the role of SCN1AIVS5-91G>A gene polymorphism in epilepsy susceptibility as
R. Kumari et al. / Biochimie 95 (2013) 1350e1353
well as pharmacotherapy in North Indian epilepsy patients visiting tertiary care hospital in North India. 2. Methods 2.1. Recruitment of epilepsy patients and healthy controls The epilepsy patients were recruited from the Neurology OutPatient Department (OPD) of Sanjay Gandhi Postgraduate Institute of Medical Sciences (SGPGIMS), and King George’s Medical University (KGMU), Lucknow, India. The patients were diagnosed and classified by experienced neurologists following criteria of the International League against Epilepsy (ILAE, 1989). The recruitment of the subjects was done according to the inclusion and exclusion criteria as described earlier [15]. A total of 485 eligible epilepsy patients undergoing pharmacotherapy were selected for the present study from June 2006 to June 2011. During same period, 298 healthy controls (HC) subjects were enrolled from volunteers like healthy staff members and general population. All healthy controls were age, sex, and ethnicity matched and free from any neurological disorders and belonged to same geographical region. The study protocol was approved by the Ethics Committees of SGPGIMS and KGMU Lucknow, India. After informed consent, 5 ml of blood was collected in EDTA vial from each patient or control and stored at 70 C.
1351
3.1.2. Genotyping Genomic DNA was isolated from peripheral blood leukocytes by the salting-out protocol [18]. Samples were genotyped for the SCN1A IVS5-91G>A (rs3812718) polymorphism (Gene Bank: NM_001165963) by a custom designed Taqman based allelic discrimination assay (Applied Biosystems, Foster City, CA, U.S.A.). Assay primer and fluorescently labeled probe sequences were as follows (all are 50 / 30 ): forward primer, TTCAGAGTCTTGAGCTT TGAAAA; reverse primer, TGTGACGTAGTACCTGTAATAGGGAGTTC; G probe, FAM-AATTCCAGGTAAGAAGTGA-MGB; and A Probe, VIC-AATT CCAGGTAAAAAGTGA-MGB. Assay conditions were in accordance with manufacturer’s protocols. Fluorescence outputs were quantified in real time by using a 7500HT Fast Real Time PCR System (Applied Biosystems, Carlsbad, California). 3.1.3. Statistical analysis Genotype frequencies for each SCN1A IVS5-91G>A marker in controls were examined for deviation from HardyeWeinberg equilibrium (HWE) using the X2 test. The relationship between various genotypes and responsiveness was examined using binary logistic regression. Association was expressed as odds ratios (OR) or risk estimates with 95% confidence intervals (CI). The significant association was considered when P-value was <0.05. All analyses were conducted using the SPSS statistical analysis software, version 16.0 (SPSS Inc., Chicago, IL, USA). 4. Results
3. Treatment protocol 3.1. CBZ/OXZ monotherapy Because OXC is a CBZ derivative which also acts by blocking sodium channels [16], data on these two drugs were analyzed together. Among epilepsy patients, 213 cases were administered CBZ/OXZ monotherapy for 6 month as first line of therapy. Initially, the patients received CBZ or oxcarbazepine (OXC) dose of 2, 00 mg/day, and 3.00 mg/day respectively. At each follow-up visit, patient compliance was recorded. The dose of CBZ/OXZ was increased when participants suffered a recurrence of epilepsy. In the case of resistance to CBZ/OXZ or a serious adverse reaction, CBZ/OXZ was replaced with another AED. Adverse drug reactions associated with the use of CBZ/OXZ, such as disorders of liver function or serum lipid levels and changes in blood cells, were also recorded. In addition, we recorded the reason for any discontinuation of the medication. Finally, 124 out of 213 patients responded to CBZ/OXZ monotherapy and remaining 89 patients were subjected to other AED mono or polytherapy. 3.1.1. Multi-drug resistance The remaining two hundred seventy two epilepsy patient initially received monotherapy of drugs other than CBZ/OXZ, If the drug under maximum tolerated doses did not work, then other AEDs were prescribed either single (monotherapy) or in combination (Polytherapy). Multi-drug resistance was defined as the occurrence of at least four seizures over a period of one year with three or more appropriate antiepileptic drugs (AEDs) either alone or in combination, at maximum tolerated doses [15,17]. The epilepsy patients who had complete freedom from seizures for at least one year from last follow up visit were considered drug responsive. A total of 251 epilepsy patients received polytherapy, 170 patients responded to the anti-epileptic treatment while remaining 81 patients were non-responsive and termed drug resistant.
In controls, genotype and allelic frequencies of SCN1A IVS5e 91G>A polymorphism were consistent with HardyeWeinberg equilibrium (P ¼ 0.86) and the genotypic frequencies were similar to those reported by Grover et al. [19], for North Indian population. Frequencies of GA and AA genotypes of SCN1A IVS5-91G>A were found to be significantly higher in epilepsy patients versus control subjects for GA (P ¼ 6.58 105, OR ¼ 2.13, 95% CI ¼ 1.47e3.09) and AA (P ¼ 4.11 109, OR ¼ 3.59, 95% CI ¼ 2.35e5.50) genotypes as well as for variant A allele (P ¼ 6.92 1011), OR ¼ 1.99, 95%, CI ¼ 1.62e2.45 (Table 1). The relative risk for epilepsy susceptibility due to variant (GA þ AA) was significant (P ¼ 1.64 105; OR ¼ 2.56; 95% CI ¼ 1.80e 3.65) when compared with homozygous wild-type GG. The risk in recessive model (P ¼ 1.34 105; OR ¼ 2.12; 95% CI ¼ 1.51e2.97) was also apparent when compared with GA þ GG. The trend test was also significant (P ¼ 3.13 109) (Table 1). In case only analysis of epilepsy patients regarding effect of SCN1AIVS5-91G>A genotype on drug response, we did not observe significant associations either with patients showing drug resistance to CBZ/OXC monotherapy or multidrug polytherapy (Table 2).
Table 1 Distribution of SCN1A IVS5-91G>A (rs3812718) gene polymorphism in epilepsy patients versus healthy controls. Genotypes /alleles
Epilepsy patients (N ¼ 485)
P-Value
Odds ratio (95% CI)
(30.5%) (48.9%) (20.5%) (56.7%) (43.3%)
71 243 171 385 585
(14.6%) (50.1%) (35.3%) (39.7%) (60.3%)
Ref. 6.58 4.11 Ref. 6.92 3.13
Ref. 2.13 (1.47e3.09) 3.59 (2.35e5.50) Ref. 1.99 (1.62e2.45)
(30.5%) (69.5%) (79.5%) (20.5%)
71 414 314 171
(14.6%) (85.6%) (64.7%) (35.3%)
Ref. 1.64 3 10L5 Ref. 1.34 3 10L5
Control subjects (N ¼ 298)
GG 91 GA 146 AA 61 G* 338 A* 258 P trend Carrier analysis GG 91 GA þ AA 207 GA þ GG 237 AA 61
Significant values are shown in bold.
3 10L5 3 10L9 3 10L11 3 10L9
Ref. 2.56 (1.80e3.65) Ref. 2.12 (1.51e2.97)
1352
R. Kumari et al. / Biochimie 95 (2013) 1350e1353
Table 2 Distribution of SCN1A IVS5-91G>A (rs3812718) gene polymorphism in drug responsive versus drug resistant epilepsy patients on CBZ/OXZ treated and on multidrug treated epilepsy patients. Genotypes/alleles
GG GA AA G* A* P trend
Drug responsive and drug resistant epilepsy patients on monotherapy (N ¼ 213)
Drug responsive and drug resistant epilepsy patients on multidrug therapy (N ¼ 251)
CBZ/OXZ treated drug responsive patients (N ¼ 124)
CBZ/OXZ treated drug resistant patients (N ¼ 89)
P-Value
Odds ratio (95% CI)
Drug responsive (N ¼ 170)
Drug resistant (N ¼ 81)
P-Value
Odds ratio (95% CI)
19 66 39 104 144
9 49 31 67 111
Ref. 0.314 0.272 Ref. 0.373 0.34
Ref. 1.567 (0.653e3.760) 1.678 (0.667e4.222) Ref. 1.197 (0.807e1.775)
28 82 60 138 202
16 40 25 72 90
Ref. 0.667 0.422 Ref. 0.413 0.41
Ref. 0.854 (0.415e1.756) 0.729 (0.337e1.577) Ref. 0.854 (0.585e1.246)
(15.3%) (53.2%) (31.4%) (41.9%) (58.1%)
(10.1%) (55.1%) (34.8%) (37.6%) (62.3%)
Because maximum tolerated doses were different for different individuals in our epilepsy patients, it did not allow any meaningful evaluation for influence of genotypes on drug dosage in our study.
(16.5%) (48.2%) (35.3%) (40.6%) (59.4%)
(19.6%) (49.4%) (30.9%) (44.4%) (55.5%)
Acknowledgments The study was supported by a grant received from the Department of Biotechnology, Government of India, and fellowships provided by ICMR New Delhi, India.
5. Discussion References In the present study, we observed an association of potentially functional genetic variant SCN1A IVS5-91G>A gene polymorphism with epilepsy susceptibility but not with drug responsiveness either in CBZ/OXZ treated monotherapy or multi-drug polytherapy in epilepsy patients in a North Indian population. There are substantial evidences to suggest that most of genes not only predispose to epilepsy but are also believed to determine responsiveness to antiepileptic drugs. It is becoming increasingly clear that genetic polymorphisms play an integral role in variability of both AED pharmacokinetics and pharmacodynamics. The SCN1A gene coding for voltage-gated sodium channels has been an attractive candidate for investigating the link between genetic polymorphisms in drug targets and clinical response. AEDs like carbamazepine, phenytoin and oxcarbazepine interact with voltage-gated sodium, calcium and potassium channels [20]. Animal and human studies also provide evidence for a possible link between loss of sodium channel drug sensitivity to carbamazepine (CBZ) and drug-resistant epilepsy [21]. Based on pioneering studies by Tate et al., SCN1A IVS5-91G>A polymorphism has been specially linked to CBZ treatment in epilepsy patients [13]. However, we failed to reproduce previously reported associations between the SCN1A IVS5-91G>A polymorphism and response to AED treatment [12,22]. Our results are consistent with several studies [13,23] which also failed to confirm an association of this polymorphism with drug resistance. Many investigators have also looked into association of the gene polymorphism with requirement of carbamazepine and phenytoin serum concentration at maintenance dose [13] or retention rate of the drug [24] but we did not study the pharmacokinenetics aspects of AEDs. The discrepancies in different studies may be explained by many factors, including sample size, sample heterogeneity, selection bias, and other confounders. Several other factors may explain failure to replicate the initial results, including differences in ethnic background among populations, differences in underlying etiologies of epilepsy, and differences in treatment regimens analyzed (type of AED and proportions of patients receiving monotherapy and Polytherapy). In conclusion, we report that SCN1AIVS5-91G>A polymorphism is associated with epilepsy susceptibility but not with CBZ or multidrug responsiveness therapy in epilepsy patients. These results suggest that a subunit of SCN1A gene may play an important role in pathophysiology rather than pharmacotherapy response in epilepsy.
[1] M. Mantegazza, G. Curia, G. Biagini, D.S. Ragsdale, M. Avoli, Voltage-gated sodium channels as therapeutic targets in epilepsy and other neurological disorders, Lancet Neurol. 9 (2010) 413e424. [2] R. Lakhan, R. Kumari, K. Singh, J. Kalita, U.K. Misra, B. Mittal, Possible role of CYP2C9 & CYP2C19 single nucleotide polymorphisms in drug refractory epilepsy, Indian J. Med. Res. 134 (2011) 295e301. [3] J.F. Annegers, W.A. Rocca, W.A. Hauser, Causes of epilepsy: contributions of the Rochester epidemiology project, Mayo Clin. Proc. 71 (1996) 570e575. [4] O.G. Ottmann, D. Hoelzer, Growth factors in the treatment of acute lymphoblastic leukemia, Leuk. Res. 22 (1998) 1171e1178. [5] C. Bianchi, R. Fato, M.L. Genova, G. Parenti Castelli, G. Lenaz, Structural and functional organization of complex I in the mitochondrial respiratory chain, Biofactors 18 (2003) 3e9. [6] S.F. Berkovic, J.M. Serratosa, H.A. Phillips, L. Xiong, E. Andermann, F. DiazOtero, P. Gomez-Garre, M. Martin, Y. Fernandez-Bullido, F. Andermann, I. Lopes-Cendes, F. Dubeau, R. Desbiens, I.E. Scheffer, R.H. Wallace, J.C. Mulley, M. Pandolfo, Familial partial epilepsy with variable foci: clinical features and linkage to chromosome 22q12, Epilepsia 45 (2004) 1054e1060. [7] D. Kasperaviciute, C.B. Catarino, E.L. Heinzen, C. Depondt, G.L. Cavalleri, L.O. Caboclo, S.K. Tate, J. Jamnadas-Khoda, K. Chinthapalli, L.M. Clayton, K.V. Shianna, R.A. Radtke, M.A. Mikati, W.B. Gallentine, A.M. Husain, S. Alhusaini, D. Leppert, L.T. Middleton, R.A. Gibson, M.R. Johnson, P.M. Matthews, D. Hosford, K. Heuser, L. Amos, M. Ortega, D. Zumsteg, H.G. Wieser, B.J. Steinhoff, G. Kramer, J. Hansen, T. Dorn, A.M. Kantanen, L. Gjerstad, T. Peuralinna, D.G. Hernandez, K.J. Eriksson, R.K. Kalviainen, C.P. Doherty, N.W. Wood, M. Pandolfo, J.S. Duncan, J.W. Sander, N. Delanty, D.B. Goldstein, S.M. Sisodiya, Common genetic variation and susceptibility to partial epilepsies: a genome-wide association study, Brain 133 (2010) 2136e 2147. [8] S.M. Sisodiya, C. Marini, Genetics of antiepileptic drug resistance, Curr. Opin. Neurol. 22 (2009) 150e156. [9] J.P. Magby, A.P. Neal, W.D. Atchison, I.P. Pessah, T.J. Shafer, Channelopathies: summary of the hot topic keynotes session, Neurotoxicology 32 (2011) 661e 665. [10] Y.Y. Vilin, P.C. Ruben, Slow inactivation in voltage-gated sodium channels: molecular substrates and contributions to channelopathies, Cell. Biochem. Biophys. 35 (2001) 171e190. [11] A.J. Lombardo, R. Kuzniecky, R.E. Powers, G.B. Brown, Altered brain sodium channel transcript levels in human epilepsy, Brain Res. Mol. Brain Res. 35 (1996) 84e90. [12] S.K. Tate, C. Depondt, S.M. Sisodiya, G.L. Cavalleri, S. Schorge, N. Soranzo, M. Thom, A. Sen, S.D. Shorvon, J.W. Sander, N.W. Wood, D.B. Goldstein, Genetic predictors of the maximum doses patients receive during clinical use of the anti-epileptic drugs carbamazepine and phenytoin, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 5507e5512. [13] S.K. Tate, R. Singh, C.C. Hung, J.J. Tai, C. Depondt, G.L. Cavalleri, S.M. Sisodiya, D.B. Goldstein, H.H. Liou, A common polymorphism in the SCN1A gene associates with phenytoin serum levels at maintenance dose, Pharmacogenet. Genomics 16 (2006) 721e726. [14] C.C. Kuo, R.S. Chen, L. Lu, R.C. Chen, Carbamazepine inhibition of neuronal Naþ currents: quantitative distinction from phenytoin and possible therapeutic implications, Mol. Pharmacol. 51 (1997) 1077e1083. [15] R. Lakhan, U.K. Misra, J. Kalita, S. Pradhan, N.J. Gogtay, M.K. Singh, B. Mittal, No association of ABCB1 polymorphisms with drug-refractory epilepsy in a North Indian population, Epilepsy Behav. 14 (2009) 78e82.
R. Kumari et al. / Biochimie 95 (2013) 1350e1353 [16] R.H. Levy, Antiepileptic Drugs, Lippincott Williams & Wilkins, Philadelphia, 2002. [17] A. Siddiqui, R. Kerb, M.E. Weale, U. Brinkmann, A. Smith, D.B. Goldstein, N.W. Wood, S.M. Sisodiya, Association of multidrug resistance in epilepsy with a polymorphism in the drug-transporter gene ABCB1, N. Engl. J. Med. 348 (2003) 1442e1448. [18] S.A. Miller, D.D. Dykes, H.F. Polesky, A simple salting out procedure for extracting DNA from human nucleated cells, Nucleic Acids Res. 16 (1988) 1215. [19] S. Grover, M. Gourie-Devi, R. Baghel, S. Sharma, K. Bala, M. Gupta, K. Narayanasamy, B. Varma, K. Kaur, P. Talwar, H. Kaur, S. Giddaluru, A. Sharma, S.K. Brahmachari, C. Indian Genome Variation, R. Kukreti, Genetic profile of patients with epilepsy on first-line antiepileptic drugs and potential directions for personalized treatment, Pharmacogenomics 11 (2010) 927e941. [20] B. Dworakowska, K. Dolowy, Ion channels-related diseases, Acta Biochim. Pol. 47 (2000) 685e703.
1353
[21] R.K. Ellerkmann, S. Remy, J. Chen, D. Sochivko, C.E. Elger, B.W. Urban, A. Becker, H. Beck, Molecular and functional changes in voltage-dependent Na(þ) channels following pilocarpine-induced status epilepticus in rat dentate granule cells, Neuroscience 119 (2003) 323e333. [22] T. Abe, T. Seo, T. Ishitsu, T. Nakagawa, M. Hori, K. Nakagawa, Association between SCN1A polymorphism and carbamazepine-resistant epilepsy, Br. J. Clin. Pharmacol. 66 (2008) 304e307. [23] F. Zimprich, E. Stogmann, S. Bonelli, C. Baumgartner, J.C. Mueller, T. Meitinger, A. Zimprich, T.M. Strom, A functional polymorphism in the SCN1A gene is not associated with carbamazepine dosages in Austrian patients with epilepsy, Epilepsia 49 (2008) 1108e1109. [24] B.T. Zhou, Q.H. Zhou, J.Y. Yin, G.L. Li, X.J. Xu, J. Qu, D. Liu, H.H. Zhou, Z.Q. Liu, Comprehensive analysis of the association of SCN1A gene polymorphisms with the retention rate of carbamazepine following monotherapy for newonset focal seizures in the Chinese Han population, Clin. Exp. Pharmacol. Physiol. 39 (2012) 379e384.