- Email: [email protected]
Screening of Pyrus pyrifolia genotypes for resistance to Alternaria alternata
Scientia Horticulturae 259 (2020) 108838
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Screening of Pyrus pyrifolia genotypes for resistance to Alternaria alternata Xiaoping Yang a b c
a,b
a
a
a
a
c,⁎
a,⁎
T
, Xiujuan He , Qiliang Chen , Jingguo Zhang , Jing Fan , Pu Liu , Hongju Hu
Research Institute of Fruit and Tea, Hubei Academy of Agricultural Science, Wuhan, Hubei, 430064, PR China Hubei Laboratory of Crop Diseases, Insect Pests and Weeds Control, Wuhan, Hubei, 430064, PR China Anhui Engineering Laboratory for Horticultural Crop Breeding, College of Horticulture, Anhui Agricultural University, Hefei, 230036, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Pyrus pyrifolia Alternaria alternata Pear black spot Resistance Simple sequence repeat (SSR)
Black spot disease (BSD) caused by the fungus Alternaria alternata is one of the most devastating diseases in pear. Most cultivated sand pear (Pyrus pyrifolia Nakai) and its hybrids are susceptible to this disease, and the main measures for the disease control are bagging and spraying of fungicides. Here, we evaluated the resistance of various P. pyrifolia genotypes to the disease by both natural infection and artificial inoculation during the years of 2013–2015. Among the 331 genotypes, 9 were highly resistant (HR) to A. alternata. Multiple linear stepwise (MLS) regression analysis indicated that the susceptibility of P. pyrifolia to A. alternata was correlated with stalk length, branching ability, duration of fruit development, fruit weight and soluble solid content. Totally 11 simple sequence repeat (SSR) markers, which selected from previous RNA-Seq data, were used to check their contributions to the disease resistance and for analysis of genetic diversity. The mean polymorphism information content was 0.66, indicating a high level of SSR polymorphism. The proportions of SSR loci 6167B and 15091C were higher in disease-resistant varieties, while those of SSR loci 6484A, 6643A and 12717A were higher in disease-susceptible varieties. This study provides the genetic variations of pear genotypes resistant to A. alternata, which could contribute to future breeding of BSD resistant varieties.
1. Introduction Pear, one of the most important fruit crops worldwide, belongs to the genus Pyrus in the family Rosaceae, with thousands of cultivars belonging to five domesticated species and dozens of wild species (Liu et al., 2015, 2018; Wu et al., 2018). Currently, pear is commercially grown in over 50 countries in Asia, Australasia, Europe, America and North Africa (Kumar et al., 2017). China has a history as long as about 3300 years of growing pear according to “The Book of Odes”. Sand pear (Pyrus pyrifolia Nakai), which is characterized by its sweet, juicy and dainty fruit flesh, is extensively cultivated in southern and central China. A large number of landraces (local cultivars) and wild species of P. pyrifolia have been found in China due to the complex climatic and geographical conditions. At present, the planting of sand pear is increasing in China, and has become the dominant industry in some part of southern provinces in China (Yang et al., 2015). Black spot disease (BSD) caused by the fungus Alternaria alternata is one of the most harmful diseases for sand pear (Kohmoto et al., 1992; Kan et al., 2017). The main symptom is the appearance of black necrotic spots on the leaves, fruits and twigs, which cause early leaf defoliation and thus decrease the yield and quality of fruit. The disease
was first reported on sand pear in Japan in 1933, then in China in 1935, and in France in 1993 (Baudry et al., 1993; Zhang et al., 2011). As a plant pathogen, A. alternata is a ubiquitous and saprophytic fungus in various dead plant materials and is also known for its pathogenicity to cause indefinite or opportunistic diseases on a number of crops (Tsuge et al., 2013). All isolates belonging to A. alternata possess the potential to penetrate membranes through appressoria of germinated conidia. As a known producer of toxic secondary metabolites, A. alternata attacks pear plants via producing host-specific toxin (AK-toxin), which causes necrosis and early leaf fall in sensitive cultivars (Nakashima et al., 1985; Sanchez-Vallet et al., 2018; Tsuge et al., 2013). Most commercial cultivars of sand pear are susceptible to A. alternata, such as ‘Nijjiseiki’. Bagging and fungicide spraying to control A. alternata are costly, laborintensive and environment-unfriendly, and may also pose threats to human health (Terakami et al., 2016). Exploiting or breeding new varieties resistant to BSD has been considered as the most effective way to control A. alternata infection on sand pear. However, little is known about the resistance of different pear genotypes to BSD. Therefore, it is of great significance to screen the genotypes of P. pyrifolia that are resistant to A. alternata, and to elucidate the molecular mechanism underlying their fungal disease resistance.
⁎
Corresponding authors. E-mail addresses: [email protected] (X. Yang), [email protected] (X. He), [email protected] (Q. Chen), [email protected] (J. Zhang), [email protected] (J. Fan), [email protected] (P. Liu), [email protected] (H. Hu). https://doi.org/10.1016/j.scienta.2019.108838 Received 15 April 2019; Received in revised form 3 September 2019; Accepted 5 September 2019 0304-4238/ © 2019 Elsevier B.V. All rights reserved.
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Since phenotypic evaluations are time-consuming, subjective and complex, molecular markers have been taken as a powerful tool for detecting the resistance genes in fruit and vegetable crops. Several genes have been reported for their roles in response to A. alternata. For example, the expression levels of some ABA-stress response (ASR) and calcium-dependent protein kinase (CPK) genes were reported to be associated with A. alternata resistance in apple (Huang et al., 2016; Wei et al., 2016). In A. alternata susceptible apple cultivars, the expression of transcription factor genes MdWRKYN1 and MdWRKY26 was inhibited via microRNAs Md-miR156ab and Md-miR395 (Zhang et al., 2017). Recently, a single nucleotide polymorphism in the promoter of a hairpin RNA MdhpRNA277 was found to contribute to the resistance against Alternaria leaf spot in apple (Zhang et al., 2018a, 2018b). In our previous study, 28 genes were identified as promising candidates for A. alternata resistance in sand pear, especially Pbr039001, Pbr001627, Pbr025080 and Pbr023112 (Yang et al., 2015). However, few DNA markers directly associated with BSD resistance have been mapped in pear (Yamamoto et al., 2016). To further explore the BSD resistant germplasm resources of sand pear, 331 sand pear genotypes, including 72 improved cultivars, 18 breeding lines and 241 landraces from the germplasm bank of Chinese National Pear Germplasm Repository (Wuhan) of the Ministry of Agriculture of the People's Republic of China, were evaluated for their resistance to A. alternata under both natural infection and artificial inoculation in three consecutive years (2013–2015). The 16 botanical and biological characteristics of sand pear germplasm traits, including leaf length, leaf width, petiole length, stalk length, stalk thickness, branching ability, days of fruit development, days of vegetative growth, fruit weight, fruit diameter, fruit length, flesh firmness, soluble solids content, soluble sugar content, titratable acidity and vitamin C, were analyzed for their correlation to A. alternate resistance. Based on RNA-Seq data (Yang et al., 2015), 11 simple sequence repeat (SSR) markers were selected from 864 microsatellites for genetic diversity analysis and to check their relationship with the disease resistance. Results of this study present important information about the resistant pear accessions which can contribute to future breeding programmes.
Table 1 Resistance levels of different sand pear genotypes to A. alternata from different regions. Number
Origin
Number of genotypes
Average disease index
1 2 3 4 5 6 7 8 9 10 11
Fujian Guangdong Guangxi Guizhou Hubei Hunan Jiangsu Sichuan Yunnan Zhejiang Japan
18 14 46 24 40 14 22 21 40 36 37
29.90 25.05 34.66 32.66 33.39 33.05 34.49 34.65 39.03 31.80 38.80
± ± ± ± ± ± ± ± ± ± ±
1.12 e 0.75 f 0.88 b 0.18 cd 0.58 b 0.18 b 0.49 b 0.39 b 0.58 a 0.46 cd 0.49 a
Numbers followed by the same letter are not significantly different from each other according to Duncan's multiple range test at 0.05 level.
molecular biology (Yang et al., 2015). Stock cultures of the strain were stored at 4 °C and subcultured on PSA medium at 28 °C. After three weeks, 5 mL of sterilized distilled water was added to the surface of the plates, from which colonies were scraped off using a small brush to remove the mycelia. Conidial suspensions were filtered through four layers of cheesecloth, and centrifuged for 20 min at 6000×g to remove mycelial fragments. 2.2. Sand pear genotypes 331 sand pear genotypes used in this study, including cultivars, breeding lines and landraces (Table S1), were divided into 11 groups according to their origins (Table 1). For each genotype, 50 individual plants were grafted on P. calleryana Decne rootstock in a greenhouse. 2.3. Evaluation of resistance to A. alternata The experiments were performed from May to June in 2013, 2014 and 2015, respectively at a greenhouse 2 km from the germplasm bank of Chinese National Pear Germplasm Repository in Research Institute of Fruit and Tea, Hubei Academy of Agricultural Science. Two hundred leaves (50 leaves were randomly investigated in 4 directions, east, west, north and south of the tree) were sampled from each genotype to investigate the effect of natural infection of A. alternaria in July. Meanwhile, 50 individual plants of each genotype were grafted on P. calleryana Decne stock in a greenhouse for artificial inoculation (temperature, 25 °C; air humidity, above 95%). The plant spacing of the grafted plants was 20 cm and the row spacing was 25 cm, and artificial inoculation was performed when the seedlings grow to 1 m high. The conidial solution was adjusted to 1.0 × 105 conidia/mL in concentration and then sprayed on leaves of grafted plants using a portable hand spray. The inoculated grafted plants were covered with a transparent polyethylene bag to serve as a humid chamber for 16–18 h. Inoculations was always conducted in the afternoon. Symptom observations were performed two weeks post inoculation. The leaves of the whole plant were investigated to access the resistance of sand pear germplasm to the BSD. The evaluation criteria of disease severity levels were based on the diseased area on the leaf as follows: 0, no symptoms; 1, < 10% of the leaf; 3, 10–25% of the leaf; 5, 26–40% of the leaf; 7, 41–65% of the leaf; 9, > 65% of the leaf. Disease indexes were calculated with the formula of BI = ∑ (xini)/9 N × 100, in which BI stands for disease index of black spot, xi for the disease severity level of each leaf, ni for the number of leaves for each level, and N for total leaf number. The resistance level of each sand pear genotype to A. alternata was evaluated according to disease indexes as follows: high resistance (HR), BI < 10.0; resistance (R), 25.0 > BI ≥ 10.0; moderate resistance (MR), 40.0 > BI ≥ 25.0; susceptibility (S), 65.0 > BI ≥ 40.0; high susceptibility (HS),
2. Materials and methods 2.1. Maintenance and inoculation of A. alternata strains For the artificial inoculation, inoculum was prepared with the black spot strains obtained from the leaves of ‘Xiangnan’ (P. pyrifolia Nakai) pear in the germplasm bank of Chinese National Pear Germplasm Repository (N: 30°29′31′′, E: 114°14′86′′; Area, 7.7 ha) in Research Institute of Fruit and Tea, Hubei Academy of Agricultural Science, and the pathogen strain was isolated by single spore at Hubei Laboratory of Crop Diseases, Insect Pests and Weeds Control. The strain H was identified by Koch's rule. First single spore isolates were re-inoculated into leaves of ‘Xiangnan’ pear, single spore was isolated again after pear black spot symptom was appeared in leaves. The spore morphology of the strain was observed under a microscope. Conidia shape was long ovate, inverted pear-shaped with mediastinum 1–3, transverse 2–4, transverse constriction phenomenon, and the color of conidia was brown/dark brown. Conidial terrier was solitary or fascicled, and the color was brown or dark brown. Colony characteristics: the colony diameter was 6–9 cm after 7 days of cultivation at 25℃ on Potato Sucrose Agar (PSA). Colonies was spreading, dense or loosely villous, colony color was gray at earlier stage, later into a dark gray or bluebrown, and the back of the colony is often brown to black. DNA of pathogen strains was extracted by CTAB method (Wang and Zhuang, 2007), and internal transcribed spacer sequence of rDNA of strains was amplified by primer ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 ( TCCTCCGCTTATTGATATGC). The ITS gene sequence were compared with those of standard pear black spot in GenBank database. H strain was identified as A. alternaria combined with morphology and 2
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
BI ≥ 65.0.
3. Results 3.1. Resistance of various sand pear genotypes to A. alternata
2.4. Morphological evaluation of sand pear genotypes to A. alternata Generally, different genotypes of sand pear (P. pyrifolia Nakai) presented different levels of resistance to A. alternata under artificial inoculation. Small brown necrosis spots were observed on diseased leaves at first, and the size increased with time gradually, finally resulting in large necrotic lesions on the leaves. Under natural infection, a majority of genotypes showed low susceptibility to A. alternata, with disease index values lower than 10 except for eight genotypes including ‘Hongfen’ pear, ‘Shilixiang’, ‘Baiyu’, ‘Hakataao’, Cangxiliuyuexue’, ‘Zhaotongxiaohuang’, ‘Jinshuishu’ and ‘Shinsui’ (Fig. 1). Under artificial inoculation in the field, nine genotypes were highly resistant, 71 genotypes were resistant, 165 genotypes were moderately resistant, 68 genotypes were susceptible and 18 genotypes were highly susceptible to BSD (Fig. 2).
Botanical and biological characteristics of sand pear genotypes, including leaf length, leaf width, petiole length, stalk length, stalk thickness, branching ability, duration of fruit development, duration of vegetative growth, fruit weight, fruit diameter, fruit length, flesh firmness, soluble solid content, soluble sugar content, titratable acidity and vitamin C, were retrieved from the Chinese National Pear Germplasm Repository to determine their correlations with the resistance of various sand pear genotypes to A. alternata (Table S2). The length, width and petiole length of 4–6 leaves from the base of 5 fully developed spring branches were measured by Vernier Caliper (Shanghai Jiuliang Hardware Tools Co., LTD) before the growth of new twigs stops to deciduous leaves. The stalk length, stalk thickness, fruit diameter and fruit length of 10 representative ripe fruits were measured by Vernier Caliper. Fruit weight of 10 representative ripe fruits was measured by Electronic Scales (Shanghai Jinping Scientific Instrument Co., LTD). 30 long-growing branches in the outer canopy with light cutting were selected. The number of long-growing branches with more than 15 cm on each branch was recorded after the growth of new branches stopped in the second year and before the winter cutting, and the branching ability was the number of long branches grown on each branch. The duration of fruit development was calculated the number of days from flowering to fruit ripening and the evaluation was based on the average of 3 years' data. The duration of vegetative growth was calculated the number of days from bud germination to leaf fall and the evaluation was based on the average of 3 years' data. The flesh firmness of 10 representative ripe fruits was measured by fruit hardness tester GY-1. The soluble solid content of 10 representative ripe fruits was measured by digital display sugar meter PAL-1. The soluble sugar content was measured using Fehling's titration method. The titratable acidity was measured by acid - base titration. The vitamin C was measured by 2,6-dichloroindophenol titrimetric method. The above measurement and sampling methods was refered to ‘Description and Data Standard for Pear (Pyrus spp.)’ (Cao et al., 2006).
3.2. Resistance of various sand pear genotypes to A. alternata from different regions The average disease indexes of genotypes from eleven regions were compared with the data from artificial inoculation in the field. The average disease indexes of each sand pear germplasm origin from Fujian, Guangdong, Guizhou and Zhejiang provinces ranged from 25.05 to 32.66, which were significantly lower than those from other seven regions (Table 1). In these four regions, a lot of genotypes were resistant to BSD. The average disease index of each genotypes origin from Yunnan and Japan were 39.03 and 38.80, respectively, which were significantly higher than those from other nine regions. In these two regions, 32 genotypes were susceptible to BSD. The average disease index of each genotypes from Guangxi, Hubei, Hunan, Jiangsu and Sichuan were from 33.05 to 34.66. 3.3. Comparison of disease indexes of sand pear genotypes with different genetic backgrounds The values of disease indexes of the genotypes with various genetic backgrounds, including breeding lines, improved cultivars and landraces, were significantly different under artificial inoculation in the field (Fig. 3). The average value of disease indexes followed the order of breeding lines (24.82) < landraces (34.09) < improved cultivars (37.97), indicating that the improved cultivars and breeding lines are the most and least susceptible to BSD, respectively.
2.5. Evaluation of the relationship between SSR markers and disease resistance of different sand pear genotypes In this study, 100 pear genotypes (50 resistant and 50 susceptible) were analyzed by SSR markers (Table 2). Genomic DNA was extracted from fresh leaves following a CTAB protocol (Fu et al., 2017). DNA quality was tested using 1% agarose gel, and DNA concentration was determined by NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) and diluted to 30 ng/μL. Eleven SSR markers (Yang et al., 2015) were used for PCR amplification. PCR reactions were carried out in a 25 μL volume containing 2 μL of 30 ng/μL genomic DNA template, 2.5 μL of 10 × PCR buffer, 0.5 μL of 2.5 mM dNTP mixture, 0.5 μL each of forward and reverse primer (10 pmol/μL), 0.5 μL of 2 U/μL Taq polymerase (Beijing Dingguo Changsheng Biotechnology Co. LTD), and 18.5 μL ddH2O. PCR amplification was carried out according to the following temperature profile: an initial step of 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 55 °C and 30 s at 72 °C, and a final extension of 10 min at 72 °C. The PCR products were analyzed by an ABI 3730 sequencer system (Applied Biosystems, Inc., USA). The amplified fragment size was calculated based on an internal standard DNA with GeneMapper 3.0 software (Applied Biosystems, Inc., USA). The putative allele number (No.), expected heterozygosity (He), observed heterozygosity (Ho), and polymorphism information content (PIC) were calculated for the 11 SSR loci by Popgene version 1.31 software (Yang and Yeh, 1993).
3.4. Correlation between A. alternata resistance and botanical/biological characteristics Among the 16 evaluated botanical and biological characteristics of sand pear genotypes, five were highly correlated with A. alternata resistance as calculated by multiple linear stepwise (MLS) regression (Martina et al., 2010). The disease indexes of improved cultivars, breeding lines and landraces were positively correlated with the stalk length (X4; r = 0.08916) and branching ability (X6; r = 0.11982), while negatively correlated with the duration of fruit development (X7;–0.11814), fruit weight (X9;–0.10996), and soluble solid content (X13; –0.08111) (Table 3). Therefore, the A. alternata resistance of the genotypes was negatively correlated with stalk length and branching ability while positively correlated with duration of fruit development, fruit weight and soluble solid content. 3.5. Relationship between SSR markers and disease resistance of different sand pear genotypes Based on our previous RNA-Seq data, 11 SSR markers were selected for further analysis. 129 alleles were obtained with the 11 SSR loci in 3
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Table 2 Disease index of 50 resistant germplasm and 50 susceptible germplasm on the condition of natural incidence and artificial inoculation. Number
Genotype
Origin
Disease index/natural infection
Disease index/artificial inoculation
Resistance
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
Jinjing Mali Miduhuangpili Yiwulizi Xipili Hululi 29-6-19 Lijiangmazhanli(3) Hengxianjinpaoli Wangshuibai Gaoyaodanshuili Yunlv Weiningzaoli Sianqingpili 29-6-29 Nanningdashali Jingqiu Lijiangbaipaoli Yousu Matsushima Beiliuqingli Gengtouqing Zhe12-4 Hengxianlingshanli Wuyuansuli Napiqingpili Badongpingtouli Xinghuadayinli Duanbazao Gaoyaohuangli Annong No.1 Huangpisuanli Jianyeli Wuyubaili Dalidongli Guanyangtangli 43-4-11 Hehuali Meitanmugua Weininghuangshuili Lichuanyuchuan 26-1-31 Eli No.2 Choujuurou Huangguan Jinshui No.1 Miduxiaohongli Huafeng Shounan Cuiguan Changshuibali Shinchuu Huilizaobai Huilihengshanluli Shangengzi Shinseiki Enoshima Kousui Housui Lipuhuangpili Jinshuisu Meigetsu Shinsui Huobali Dalishatangli Komazawa Midushenwali Sanmenjiangshali Qingpi Shounan Weiningdahuangli Lijiangxiaohuangli pulixiao Hanghong Huahong
Hubei Fujiang Yunnan Zhejiang Anhui Fujiang Hubei Yunnan Guangxi Hubei Guangdong Zhejiang Guizhou Guangxi Hubei Guangxi Hubei Yunnan Jiangxi Japan Yunnan Hunan Zhejiang Guangxi Jiangxi Guangxi Hubei Guangdong Hunan Guangdong Hunan Guangxi Guangdong Jiangxi Yunnan Guangxi Hubei Guangdong Guizhou Guizhou Hubei Hubei Hubei Japan Hebei Hubei Yunnan Hubei Japan Zhejiang Yunnan Japan Sichuan Sichuan Sichuan Japan Japan Japan Japan Guangxi Hubei Japan Japan Yunnan Yunnan Japan Yunnan Guangxi Hubei Guizhou Yunnan Jiangxi Zhejiang Zhejiang
1.78 ± 0.35 1.51 ± 0.96 1.39 ± 0.36 0.87 ± 0.87 0.33 ± 0.46 0.12 ± 0.12 0.49 ± 0.09 0.4 ± 0.26 1.17 ± 0.31 0.13 ± 0.03 1.38 ± 0.19 2.19 ± 1.01 2.57 ± 0.84 0.44 ± 0.29 0.18 ± 0.02 0.95 ± 0.41 0.79 ± 0.44 1.34 ± 0.46 1.18 ± 0.12 1.31 ± 0.25 0.51 ± 0.2 0.37 ± 0.03 1.22 ± 0.3 0.33 ± 0.21 1.12 ± 0.25 0.79 ± 0.47 0.51 ± 0.25 0.12 ± 0.01 1.93 ± 0.71 0.61 ± 0.27 0.63 ± 0.12 0.17 ± 0.06 0.18 ± 0.06 0.73 ± 0.13 2.51 ± 0.6 1.57 ± 0.59 0.18 ± 0.02 1.68 ± 0.42 3.9 ± 1.13 0.89 ± 0.46 0.33 ± 0.21 1.34 ± 0.36 0.79 ± 0.63 0.73 ± 0.3 1.95 ± 0.9 0.56 ± 0.18 1.23 ± 0.35 0.73 ± 0.18 3.78 ± 2.8 1.40 ± 0.32 1.08 ± 0.32 0.84 ± 0.57 2.39 ± 1.1 1.50 ± 0.4 0.56 ± 0.35 2.86 ± 1.4 1.34 ± 0.31 0.37 ± 0.23 7.95 ± 1.25 2.22 ± 0.98 11.43 ± 1.31 7.41 ± 2.45 10.17 ± 0.04 1.11 ± 0.14 4.03 ± 0.6 0.94 ± 0.69 2.23 ± 1.18 0.39 ± 0.18 8.56 ± 1.21 3.17 ± 1.51 0.84 ± 0.57 9.67 ± 0.17 8.1 ± 2.1 2.88 ± 1.34
5.72 ± 1.23 5.08 ± 1.09 7.34 ± 1.43 8.89 ± 0.82 8.22 ± 1.44 8.67 ± 0.3 8.34 ± 0.97 9.46 ± 0.67 9.7 ± 0.18 11.08 ± 0.31 11.28 ± 0.79 12 ± 1.8 14.08 ± 3.04 15.38 ± 2.72 16.16 ± 2.39 16.39 ± 2.94 16.78 ± 3.07 16.83 ± 3.37 16.9 ± 1.03 16.94 ± 3.29 18.16 ± 4.95 18.28 ± 4.71 19.2 ± 3.97 19.21 ± 4.49 19.35 ± 4.11 19.47 ± 4.1 19.6 ± 4 19.69 ± 4.85 19.85 ± 2.88 21.21 ± 1.98 21.24 ± 2 21.42 ± 3.68 21.45 ± 3.21 21.76 ± 1.9 21.96 ± 2.1 22.09 ± 2.35 21.12 ± 2.65 22.27 ± 2.27 22.34 ± 1.98 22.41 ± 2.58 23.34 ± 1.68 23.44 ± 1.22 28.98 ± 1.11 29.59 ± 2.6 30.45 ± 3.25 32.73 ± 2.95 33.35 ± 4.49 32.82 ± 2.95 37.46 ± 5.83 39.86 ± 0.35 42.77 ± 1.51 42.54 ± 1.56 46.59 ± 4.6 41.44 ± 1.25 47 ± 4.85 43.4 ± 3.27 45.59 ± 4.22 47.45 ± 3.69 47.51 ± 5.31 47.65 ± 5.7 47.74 ± 4.39 48.04 ± 6.84 48.29 ± 6.42 49.39 ± 4.94 49.4 ± 4.81 50.69 ± 4.45 53.44 ± 6.33 53.47 ± 0.8 53.7 ± 4.94 54.35 ± 6.31 55.72 ± 3.26 56.14 ± 4.85 53.8 ± 5.82 58.22 ± 1.69
HR HR HR HR HR HR HR HR HR R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R MR MR MR MR MR MR MR MR S S S S S S S S S S S S S S S S S S S S S S S S
(continued on next page) 4
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Table 2 (continued) Number
Genotype
Origin
Disease index/natural infection
Disease index/artificial inoculation
Resistance
75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
Qing jade Xihuaxueli Midubaihe Jingxitangli Huali No.1 Jinshui No.2 Fuyuanhuangli Xibaqingshuili Doitsu liuyuehuangzongli Hongfeili Shilixiang Huangpieli Liuchenxueli Guihuali Huangqieli Baozhuli Cangxiliuyuexueli Houzuili Hakataao Baiyu Asahi Shaotongxiaohuangli Qingli Dalixiangsuli Qingpisuanli
Japan Zhejiang Yunnan Guangxi Hubei Hubei Yunnan Yunnan Japan Fujiang Guizhou Hubei Guangxi Guangxi Guangxi Zhejiang Yunnan Sichuan Hubei Japan Jiangxi Japan Yunnan Hunan Yunnan Guangxi
6.26 ± 2.51 1.26 ± 0.15 4.95 ± 2.31 1.79 ± 0.75 1.79 ± 0.72 2.84 ± 1.55 2.22 ± 1.06 2.21 ± 0.49 6.62 ± 2.08 1.09 ± 0.69 66.74 ± 0.84 46.45 ± 4.3 0.11 ± 0.02 1.12 ± 0.35 0.68 ± 0.38 6.23 ± 2.84 4.79 ± 2 23.75 ± 1.03 1.78 ± 0.73 27.94 ± 1.51 32.67 ± 2 2.39 ± 0.38 12.01 ± 0.83 1.57 ± 0.54 2.51 ± 0.18 0.33 ± 0.18
57.8 ± 2.22 57.79 ± 0.4 58.69 ± 3.76 59.92 ± 4.41 60.34 ± 2.85 55.44 ± 5.13 59.33 ± 4.79 61.94 ± 1.71 64.05 ± 0.83 64.14 ± 2.38 65.38 ± 0.12 65.79 ± 1.47 66.38 ± 1.24 66.81 ± 0.96 68.05 ± 2.69 68.54 ± 5.53 72.28 ± 4.62 77.24 ± 2.98 77.51 ± 1.64 79.64 ± 2.85 81.08 ± 5 81.29 ± 1.16 85.67 ± 3.7 88.05 ± 2.17 89.51 ± 1.7 91.34 ± 1.99
S S S S S S S S S S HS HS HS HS HS HS HS HS HS HS HS HS HS HS HS HS
Note: HR: High resistant; R: Resistant; MR: Moderately resistant; S: Susceptible; HS: High susceptible.
Fig. 1. Resistance of the 331 genotypes sand pear to A. alternata under natural and artificial inoculation. The Y axis represents the disease indexes, and the X axis represents 331 sand pear germplasm.
100 pear genotpypes. The numbers of alleles ranged from 5 (15305A) to 17 (3918 and 12717A), with an average value of 11.73. The expected heterozygosity (He) ranged from 0.272 (12717B) to 0.876 (12717A), with a mean value of 0.70. The observed heterozygosity (Ho) ranged from 0.041 (15305A) to 0.73 (6643A), with an average value of 0.42. The polymorphism information content (PIC) ranged from 0.261 (12717B) to 0.859 (12717A), with an average value of 0.66 (Table 4). We further analyzed the frequency distribution of specific alleles in 100 pear genotypes (50 resistant and 50 susceptible). As a result, the proportions of SSR loci 6167B and 15091C were higher in disease-resistant varieties, and those of SSR loci 6484A, 6643A and 12717A were higher in disease-susceptible varieties (Table 5). Fig. 2. The number of different resistant sand pear germplasm to A. alternata under artificial inoculation. The Y axis represents the number of sand pear germplasm, and the X axis represents classification criteria for different resistant genotypes.
4. Discussion Pear is one of the most important fruit crops for its high productivity 5
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Fig. 3. Resistance of breeding line, improved cultivar and landrace of sand pear germplasm. Disease index of different biological status to artificial inoculation in the field were significantly different. The same letter at the tops of column indicates that there is no significant difference from each other according to Duncan's multiple range test, p = 0.05.
Table 3 Correlation between resistance to A. alternata and 16 botanical/biological characteristics of sand pear genotypes. Variable
Parameter Estimate
Standard Error
t Value
Pr > |t|
Standard Estimate
Intercept Stalk length Branching ability Duration of fruit development Fruit weight Soluble solids content
0.03217 0.08916 0.11982 −0.11814
0.05598 0.05440 0.05691 0.05505
0.57 1.64 2.11 −2.15
0.5659 0.1022 0.0360 0.0326
0 0.08916 0.11498 −0.11809
−0.10996 −0.08111
0.05448 0.05490
−2.02 −1.48
0.0444 0.1406
−0.10992 −0.08005
Table 5 Frequency distribution of specific alleles in resistant and susceptible sand pear genotypes.
All variables significant at the 0.1500 level were retained in the model, while other variables were excluded. Among the 16 evaluated botanical and biological characteristics possibly related to A. alternata resistance, including leaf length, leaf width, petiole length, stalk length, stalk thickness, branching ability, duration of fruit development, duration of vegetative growth, fruit weight, fruit diameter, fruit length, flesh firmness, soluble solid content, soluble sugar content, titratable acidity and vitamin C, five characteristics including stalk length, branching ability, duration of fruit development, fruit weight and soluble solid content were highly correlated with the resistance as calculated using the method of multiple linear stepwise regressions.
SSR loci
Specific alleles
Frequency distribution in resistant varieties (%)
Frequency distribution in susceptible varieties (%)
Distribution ratio of resistant varieties to susceptible varieties
3436A 3918 6167B 6484A 6643A 6643D 12717A 12717B 15091B 15091C 15305A
387 327 301 400 245 401 296 356 276 327 335
55 39 37 17 7 43 8 67 45 32 56
44 28 16 39 23 29 18 81 42 14 48
1.25 1.39 2.31 0.44 0.30 1.48 0.44 0.83 1.07 2.29 1.17
Frequency distribution of specific alleles in 100 pear genotypes (50 resistant and 50 susceptible) was analyzed. The proportions of SSR loci 6167B and 15091C were higher in disease-resistant varieties, and those of SSR loci 6484A, 6643A and 12717A were higher in disease-susceptible varieties.
Table 4 Relationship between SSR markers and disease resistance of sand pear genotypes. SSR loci
No. of putative alleles
Expected heterozygosity
Observed heterozygosity
Polymorphism information content
3436A 3918 6167B 6484A 6643A 6643D 12717A 12717B 15091B 15091C 15305A Mean
7 17 13 13 16 11 17 9 9 12 5 11.73
0.583 0.767 0.698 0.768 0.87 0.781 0.876 0.272 0.733 0.824 0.561 0.70
0.327 0.663 0.352 0.552 0.73 0.619 0.5 0.092 0.28 0.5 0.041 0.42
0.499 0.734 0.654 0.729 0.851 0.752 0.859 0.261 0.701 0.795 0.468 0.66
A total of 100 pear genotypes (50 resistant and 50 susceptible) were analyzed by SSR markers in this study. Eleven SSR markers from pear transcriptome sequencing were used for PCR amplification. The PCR products were analyzed by an ABI 3730 sequencer system (Applied Biosystems, Inc., USA). The putative allele number (NO.), the expected heterozygosity (He), the observed heterozygosity (Ho), and the polymorphism information content (PIC) were calculated for the 11 SSR loci by Popgene version 1.31 software.
Fig. 4. Frequency distribution diagram of disease indexes of 331 sand pear germplasm under artificial inoculation. The X axis represents the disease indexes, and linear map represents the partial normal distribution curve. The value of Kolmogorov-Smirnov Z is 2.058.
6
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
solids content. That meant BSD-resistance of sand pear was correlation to these characters in natural evolution. Evaluation of the pathogen resistance of different plant genotypes was mainly based on natural pathogen inoculation in previous studies (Abe et al., 2010; Chandelier et al., 2016; Hajano et al., 2016). In this study, improved cultivars, landrace and breeding lines of sand pear showed different susceptibilities to BSD under both natural infection and artificial inoculation (Fig. 3). We identified four relatively more resistant lines from improved cultivars, including ‘Huangguan’, ‘Huali NO.2′, ‘JinshuiNo.1′ and ‘Erli No.2′, which could be further popularized in production area. Resistant breeding lines such as 29-6-19, 29-6-29 and 26-4-2 could be used as breeding materials. The cultivars such as ‘Cuiguan’, ‘Kousui’ and ‘Huali No.1′ are susceptible to BSD, and thus special attention should be paid to the prevention and control of BSD in the planting of these cultivars. Besides, we also identified some highly resistant genotypes such as ‘Weiningxiangmian’ and ‘Jinjing’, and some highly susceptible genotypes such as ‘Shaotongxiaohuangli’ and ‘Hongfen’, which could be used for studies of the resistance mechanism of sand pear in the future. A single-nucleotide polymorphism (SNP) was identified in the MdhpRNA277 promoter region between ‘Golden Delicious’ (pMdhpRNA277-GD) and ‘Hanfu’ (pMdhpRNA277-HF) to distinguish among apple varieties that are resistant or susceptible to A. alternata leaf spot (Zhang et al., 2018a, 2018b). 34 microsatellites were identified from resistance cultivar ‘Jinjing’ (J-CK/J-P) compared with the susceptible cultivar ‘Hongfen’ (H-CK/H–P) by RNA-Seq, and 11 primer pairs were able to distinguish ‘Jinjing’ from ‘Hongfen’ pear (Yang et al., 2015). In previous study, SSR marker have been taken as a powerful tool to evaluate the genetic diversity in plant genotypes for resistance against Alternaria disease, such as Indian mustard (Pratap et al., 2016), groundnut (Shoba et al., 2012; Zongo et al., 2017), To further verify the correlation of 11 SSR markers with BSD- resistance, 50 resistant and 50 susceptible germplasms were analyzed by these 11 SSR markers in this study. The results showed (Table 5) the proportion of SSR loci 6167B and 15091C were higher in disease-resistant varieties, and the proportion of SSR loci 6484A, 6643A and 12717A were higher in diseasesusceptible varieties. That means the SSR loci 6167B and 15091C are related to BSD resistance, while the SSR loci 6484A, 6643A and 12717A are associated with BSD susceptibility in pear. As a whole, this study provides some SSR markers for the molecular breeding of disease resistant pear varieties, as well as some germplasm resources for research on the molecular mechanism of BSD resistance of pear in the future.
and economic value. However, its production is often severely affected by many fungal diseases. BSD caused by the fungus A. alternata is one of the most serious diseases in pear (Terakami et al., 2007, 2016). Planting of resistant cultivars and application of fungicides are the major approaches to manage BSD in pear (Kan et al., 2017; Yang et al., 2015; Yamamoto et al., 2016). In this study, the resistance of 331 sand pear genotypes to A. alternata was evaluated under both natural infection and artificial inoculation. We found that no sand pear genotypes were immune to A. alternata, which could be due to the production of hostselective toxins by the fungus (Tsuge et al., 2013). All tissues of improved cultivars, breeding lines and landraces of sand pear are highly susceptible to BSD due to the production of AK-toxin by A. alternata (Tanaka and Tsuge, 2000). It has been proposed that the susceptibility is controlled by a single dominant gene designated as A, and a heterozygous genotype (A/a) was observed in susceptible cultivars (Terakami et al., 2007). The disease indexes of 331 sand pear genotypes followed an overall partial normal distribution (Fig. 4), further indicating that all the genotypes are susceptible to A. alternata, and the susceptibility is controlled by dominant genes. Conidia can infect crops during all seasons, and the conidial concentration in the air over the crop is closely related to the environmental conditions (Blanco et al., 2006). Because the conidial concentration of black spot fungus is very low in the air, it is difficult to distinguish different resistance levels of various sand pear genotypes to BSD under natural infection. Since the conidial concentration of pathogens is high under artificial inoculation and the leaves are more easily infected, different resistance levels of the genotypes to black spot fungus could be more accurately and efficiently determined. However, ‘Hongfenli’ and ‘Shilixiang’ were two exceptional genotypes for their high disease indexes under both natural infection and artificial inoculation, possibly because they could be infected at extremely low conidial concentrations. The disease indexes of sand pear genotypes varied significantly among the 11 regions under artificial inoculation in the field (Table 1). Plants defend against pathogens in complex ways, and resistance (R) genes perform a pivotal role in defense response initiation (Yang et al., 2015; Zhang et al., 2018a, 2018b). Among all known types of R genes, nucleotide-binding site leucine rich repeats (NBS-LRR) genes represent for about 80% of the characterized R genes, including TIR (Toll/interleukin-1 receptor) -NBS-LRR and the non-TIR-NBS-LRR (Cannon et al., 2002). Sand pear germplasms from different regions might have undergone different pressures from native A. alternata, and thus may have maintained different homologous R genes. Therefore, genotypes from different regions showed different disease incidence when inoculated by the same concentration of black spot spores. Plant surface is the first barrier for plant against microbial invasion. In a previous study, pear fruit cuticular wax, surface hydrophobicity and ethylene signaling were reported to be affected by A. alternata infection (Tang et al., 2017; Sun et al., 2017). MLS regression analysis showed that the BSD resistance of sand pear genotypes to A. alternata was correlated with five main botanical and biological characteristics (Table 3), including stalk length, branching ability, duration of fruit development, fruit weight, and soluble solid content. A. alternata resistance of the genotypes was negatively correlated with branching ability, the possible reason is that pear branching ability is the stronger, the pear tree will grow more branches, and canopy of the pear tree is airtight, therefore, pear leaves are seriously affected. A. alternata resistance of the genotypes was positively correlated with duration of fruit development, fruit weight and soluble solid content. As improved cultivar, fruit development, fruit weight and soluble solids content were positively correlating with BDS resistance merely because they were selected, during the breeding program from the original germplasm. However, besides 18 breeding line and 72 improved cultivars, 241 Landrace were also done correlation analysis with BDS resistance. The result showed that the BSD-resistance of the 241 landraces were positively related to days of fruit development, fruit weight, and soluble
5. Conclusion Black spot disease caused by the fungus Alternaria alternata is one of the most devastating diseases in pear. In this study, 331 sand pear germplasm were evaluated for their resistance to BSD under both natural infection and artificial inoculation conditions in three consecutive years. We screened nine highly resistant, 71 resistant, 165 moderately resistant, 68 susceptible and 18 highly susceptible sand pear germplasm to BSD. Multiple linear stepwise regression analysis indicated that susceptibility of sand pear to BSD was related to five main botanical and biological characteristics, stalk length, branching ability, days of fruit development, fruit weight, and soluble solids content. 11 simple sequence repeat (SSR) markers from pear RNA-Seq data were performed genetic diversity and resistance relationships analysis. SSR loci 6167B and 15091C were correlated with pear resistance, and SSR loci 6484A, 6643A and 12717A were correlated with pear susceptible. Results of this study present important information about the resistant pear accessions which can contribute to future breeding programs. Acknowledgments This research was financially supported by the National Natural Science Fund of China (no. 31601721), Hubei Agricultural Science and 7
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Technology Innovation Fund (no. 2016-620-000-001-029), Supported project of Hubei Academy of Agricultural Sciences (2019fcxjh05), Hubei Laboratory of Crop Diseases, Insect Pests and Weeds Control Open project (2017ZTSJJ1) and China Agriculture Research System (no.CARS-28-39). We thank Prof. Zuoxiong Liu from the Foreign Language School of HZAU for proof-reading and revising the English language of the manuscript.
807–815. Pratap, P., Thakur, A.K., Meena, P., Meena, H.S., Sharma, P., Singh, D., Majumdar, R., 2016. Genetic diversity assessment in Indian mustard (Brassica juncea L) for Alternaria blight tolerance using SSR markers. J. Oilseed Brassica. 6, 175–182. Sanchez-Vallet, A., Fouche, S., Fudal, I., Hartmann, F.E., Soyer, J.L., Tellier, A., Croll, D., 2018. The genome biology of effector gene evolution in filamentous plant pathogens. Annu. Rev. Phytopathol. 56, 21–40. Shoba, D., Manivannan, N., Nigam, S.N., 2012. SSR markers associated for late leaf spot disease resistance by bulked segregant analysis in groundnut (Arachis hypogaea L.). Euphytica 188, 265–272. Sun, H., Song, N., Ma, L., Li, J., Ma, L., Wu, J., Wu, J., 2017. Ethylene signalling is essential for the resistance of Nicotiana attenuata against Alternaria alternata and phytoalexin scopoletin biosynthesis. Plant Pathol. 66, 277–284. Tanaka, A., Tsuge, T., 2000. Structural and functional complexity of the genomic region controlling AK-toxin biosynthesis and pathogenicity in the Japanese pear pathotype of Alternaria alternata. Mol. Plant Microbe Interact. 13, 975–986. Tang, Y., Li, Y., Bi, Y., Wang, Y., 2017. Role of pear fruit cuticular wax and surface hydrophobicity in regulating the prepenetration phase of Alternaria alternata infection. J. Phytopathol. 165, 313–322. Terakami, S., Adachi, Y., Iketani, H., Sato, Y., Sawamura, Y., Takada, N., Yamamoto, T., 2007. Genetic mapping of genes for susceptibility to black spot disease in Japanese pears. Genome 50, 735–741. Terakami, S., Moriya, S., Adachi, Y., Kunihisa, M., Nishitani, C., Saito, T., Abe, K., Yamamoto, T., 2016. Fine mapping of the gene for susceptibility to black spot disease in Japanese pear (Pyrus pyrifolia Nakai). Breeding Sci. 66, 271–280. Tsuge, T., Harimoto, Y., Akimitsu, K., Ohtani, K., Kodama, M., Akagi, Y., Egusa, M., Yamamoto, M., Otani, H., 2013. Host-selective toxins produced by the plant pathogenic fungus Alternaria alternata. FEMS Microbiol. Rev. 37, 44–66. Wang, L., Zhuang, W., 2007. Phylogenetic analyses of Penicillia based on partial calmodulin gene sequences. BioSystems. 88, 113–126. Wei, M., Wang, S., Dong, H., Cai, B., Tao, J., 2016. Characterization and comparison of the CPK gene family in the apple (Malus × domestica) and other Rosaceae species and its response to Alternaria alternata infection. PLoS One 11, e0155590. Wu, J., Wang, Y., Xu, J., Korban, S.S., Fei, Z., Tao, S., et al., 2018. Diversification and independent domestication of Asian and European pears. Genome Biol. 19, 77. Yamamoto, M., Terakami, S., Takada, N., Yamamoto, T., 2016. Physical mapping of black spot disease resistance/susceptibility-related genome regions in Japanese pear (Pyrus pyrifolia) by BAC-FISH. Breeding Sci. 66, 444–449. Yang, R.C., Yeh, F.C., 1993. Multilocus structure in Pinus contorta Dougl. Theor. Appl. Genet. 87, 568–576. Yang, X., Hu, H., Yu, D., Sun, Z., He, X., Zhang, J., Chen, Q., Tian, R., Fan, J., 2015. Candidate resistant genes of sand pear (Pyrus pyrifolia Nakai) to Alternaria alternata revealed by transcriptome sequencing. PLoS One 10, e0135046. Zhang, L., Jia, C., Liu, L., Zhang, Z., Li, C., Wang, Q., 2011. The involvement of jasmonates and ethylene in Alternaria alternata f. Sp. Lycopersici toxin-induced tomato cell death. J. Exp. Bot. 62, 5405–5418. Zhang, Q., Li, Y., Zhang, Y., Wu, C., Wang, S., Hao, L., Wang, S., Li, T., 2017. MdEmiR156ab and MdEmiR395 target WRKY transcription factors to influence apple resistance to leaf spot disease. Front. Plant Sci. 8, 526. Zhang, Q., Ma, C., Zhang, Y., Gu, Z., Li, W., Duan, X., Wang, S., Hao, L., Wang, Y., Wang, S., Li, T., 2018a. A single nucleotide polymorphism in the promoter of a hairpin RNA contributes to Alternaria leaf spot resistance in apple (Malus × domestica Borkh.). Plant Cell 30, 1924–1942. Zhang, Q., Ma, C., Zhang, Y., Gu, Z., Li, W., Duan, X., Wang, S., Hao, L., Wang, Y., Wang, S., Li, T., 2018b. A single-nucleotide polymorphism in the promoter of a hairpin RNA contributes to Alternaria alternata leaf spot resistance in apple (Malus × domestica). Plant Cell 30, 1924–1942. Zongo, A., Khera, P., Sawadogo, M., Shasidhar, Y., Sriswathi, M., Vishwakarma, M.K., Sankara, P., Ntare, B.R., Varshney, R.K., Pandey, M.K., Desmae, H., 2017. SSR markers associated to early leaf spot disease resistance through selective genotyping and single marker analysis in groundnut (Arachis hypogaea L.). Biotechnol. Rep. Amst. 15, 132–137.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2019.108838. References Abe, K., Iwanami, H., Kotoda, N., Moriya, S., Takahashi, S., 2010. Evaluation of apple genotypes and Malus species for resistance to Alternaria blotch caused by Alternaria alternata apple pathotype using detached-leaf method. Plant Breed. 129, 208–218. Baudry, A., Morzières, J.P., Larue, P., 1993. First report of Japanese pear black spot caused by Alternaria kikuchiana in France. Plant Dis. 77, 19–22. Blanco, C., los de Santos, B., Romero, 2006. Relationship between concentrations of Botrytis cinerea conidia in air, environmental conditions, and the incidence of grey mould in strawberry flowers and fruits. Eur. J. Plant Pathol. 114, 415–425. Cannon, S.B., Zhu, H., Baumgarten, A.M., Spangler, R., May, G., Cook, D.R., Young, N.D., 2002. Diversity, distribution, and ancient taxonomic relationships within the TIR and non-TIR NBS-LRR resistance gene subfamilies. J. Mol. Evol. 54, 548–562. Cao, Y., Liu, F., Hu, H., Zhang, B., 2006. Description and Data Standard for Pear (Pyrus spp.). China Agricultural Press, Beijing (in Chinese). Chandelier, A., Husson, C., Druart, P., Marçais, B., 2016. Assessment of inoculation methods for screening black alder resistance to Phytophthora × alni. Plant Pathol. 65, 441–450. Fu, Z., Song, J., Paula, J., 2017. A rapid and cost effective protocol for plant genomic DNA isolation using regenerated silica columns in combination with CTAB extraction. J. Integr. Agric. 16 (8), 1682–1688. Hajano, J.U.D., Zhang, H.B., Ren, Y.D., Lu, C.T., Wang, X.F., 2016. Screening of rice (Oryza sativa) cultivars for resistance to rice black streaked dwarf virus using quantitative PCR and visual disease assessment. Plant Pathol. 65, 1509–1517. Huang, K., Zhong, Y., Li, Y., Zheng, D., Cheng, Z.-M., 2016. Genome-wide identification and expression analysis of the apple ASR gene family in response to Alternaria alternataf. sp. mali. Genome 59, 866–878. Kan, J., Liu, T., Ma, N., Li, H., Li, X., Wang, J., Zhang, B., Chang, Y., Lin, J., 2017. Transcriptome analysis of Callery pear (Pyrus calleryana) reveals a comprehensive signalling network in response to Alternaria alternata. PLoS One 12, e0184988. Kohmoto, K., Otani, H., Cavanni, P., Bugiani, R., 1992. Occurrence of the japanese pear pathotype of Alternaria alternata in japanese pear orchards in Italy. Phytopathol. Mediterr. 31, 141–147. Kumar, S., Kirk, C., Deng, C., Wiedow, C., Knaebel, M., Brewer, L., 2017. Genotyping-bysequencing of pear (Pyrus spp.) accessions unravels novel patterns of genetic diversity and selection footprints. Hortic. Res. 4, 17015. Liu, Q., Song, Y., Liu, L., Zhang, M., Sun, J., Zhang, S., Wu, J., 2015. Genetic diversity and population structure of pear (Pyrus spp.) collections revealed by a set of core genomewide SSR markers. Tree Genet. Genomes 11, 1–22. Liu, P., Shi, Y., Zhu, L., 2018. Geneticvariation in resistance to valsa canker is related to arbutin and gallic acid content in Pyrus bretschneideri. Horticul. Plant J. 4, 233–238. Martina, I., Ghania, Md., Ahmadb, S., 2010. Stepwise multiple regression method to forecast fish landing. Procedia Soc. Behav. Sci. 8, 549–554. Nakashima, T., Ueno, T., Fukami, H., Taga, T., Masuda, H., Osaki, K., Nishimura, S., 1985. Isolation and structures of AK-toxin I and II, host-specific phytotoxic metabolites produced by Alternaria alternata Japanese pear pathotype. Agr. Biol. Chem. 49,
8
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Screening of Pyrus pyrifolia genotypes for resistance to Alternaria alternata Xiaoping Yang a b c
a,b
a
a
a
a
c,⁎
a,⁎
T
, Xiujuan He , Qiliang Chen , Jingguo Zhang , Jing Fan , Pu Liu , Hongju Hu
Research Institute of Fruit and Tea, Hubei Academy of Agricultural Science, Wuhan, Hubei, 430064, PR China Hubei Laboratory of Crop Diseases, Insect Pests and Weeds Control, Wuhan, Hubei, 430064, PR China Anhui Engineering Laboratory for Horticultural Crop Breeding, College of Horticulture, Anhui Agricultural University, Hefei, 230036, PR China
A R T I C LE I N FO
A B S T R A C T
Keywords: Pyrus pyrifolia Alternaria alternata Pear black spot Resistance Simple sequence repeat (SSR)
Black spot disease (BSD) caused by the fungus Alternaria alternata is one of the most devastating diseases in pear. Most cultivated sand pear (Pyrus pyrifolia Nakai) and its hybrids are susceptible to this disease, and the main measures for the disease control are bagging and spraying of fungicides. Here, we evaluated the resistance of various P. pyrifolia genotypes to the disease by both natural infection and artificial inoculation during the years of 2013–2015. Among the 331 genotypes, 9 were highly resistant (HR) to A. alternata. Multiple linear stepwise (MLS) regression analysis indicated that the susceptibility of P. pyrifolia to A. alternata was correlated with stalk length, branching ability, duration of fruit development, fruit weight and soluble solid content. Totally 11 simple sequence repeat (SSR) markers, which selected from previous RNA-Seq data, were used to check their contributions to the disease resistance and for analysis of genetic diversity. The mean polymorphism information content was 0.66, indicating a high level of SSR polymorphism. The proportions of SSR loci 6167B and 15091C were higher in disease-resistant varieties, while those of SSR loci 6484A, 6643A and 12717A were higher in disease-susceptible varieties. This study provides the genetic variations of pear genotypes resistant to A. alternata, which could contribute to future breeding of BSD resistant varieties.
1. Introduction Pear, one of the most important fruit crops worldwide, belongs to the genus Pyrus in the family Rosaceae, with thousands of cultivars belonging to five domesticated species and dozens of wild species (Liu et al., 2015, 2018; Wu et al., 2018). Currently, pear is commercially grown in over 50 countries in Asia, Australasia, Europe, America and North Africa (Kumar et al., 2017). China has a history as long as about 3300 years of growing pear according to “The Book of Odes”. Sand pear (Pyrus pyrifolia Nakai), which is characterized by its sweet, juicy and dainty fruit flesh, is extensively cultivated in southern and central China. A large number of landraces (local cultivars) and wild species of P. pyrifolia have been found in China due to the complex climatic and geographical conditions. At present, the planting of sand pear is increasing in China, and has become the dominant industry in some part of southern provinces in China (Yang et al., 2015). Black spot disease (BSD) caused by the fungus Alternaria alternata is one of the most harmful diseases for sand pear (Kohmoto et al., 1992; Kan et al., 2017). The main symptom is the appearance of black necrotic spots on the leaves, fruits and twigs, which cause early leaf defoliation and thus decrease the yield and quality of fruit. The disease
was first reported on sand pear in Japan in 1933, then in China in 1935, and in France in 1993 (Baudry et al., 1993; Zhang et al., 2011). As a plant pathogen, A. alternata is a ubiquitous and saprophytic fungus in various dead plant materials and is also known for its pathogenicity to cause indefinite or opportunistic diseases on a number of crops (Tsuge et al., 2013). All isolates belonging to A. alternata possess the potential to penetrate membranes through appressoria of germinated conidia. As a known producer of toxic secondary metabolites, A. alternata attacks pear plants via producing host-specific toxin (AK-toxin), which causes necrosis and early leaf fall in sensitive cultivars (Nakashima et al., 1985; Sanchez-Vallet et al., 2018; Tsuge et al., 2013). Most commercial cultivars of sand pear are susceptible to A. alternata, such as ‘Nijjiseiki’. Bagging and fungicide spraying to control A. alternata are costly, laborintensive and environment-unfriendly, and may also pose threats to human health (Terakami et al., 2016). Exploiting or breeding new varieties resistant to BSD has been considered as the most effective way to control A. alternata infection on sand pear. However, little is known about the resistance of different pear genotypes to BSD. Therefore, it is of great significance to screen the genotypes of P. pyrifolia that are resistant to A. alternata, and to elucidate the molecular mechanism underlying their fungal disease resistance.
⁎
Corresponding authors. E-mail addresses: [email protected] (X. Yang), [email protected] (X. He), [email protected] (Q. Chen), [email protected] (J. Zhang), [email protected] (J. Fan), [email protected] (P. Liu), [email protected] (H. Hu). https://doi.org/10.1016/j.scienta.2019.108838 Received 15 April 2019; Received in revised form 3 September 2019; Accepted 5 September 2019 0304-4238/ © 2019 Elsevier B.V. All rights reserved.
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Since phenotypic evaluations are time-consuming, subjective and complex, molecular markers have been taken as a powerful tool for detecting the resistance genes in fruit and vegetable crops. Several genes have been reported for their roles in response to A. alternata. For example, the expression levels of some ABA-stress response (ASR) and calcium-dependent protein kinase (CPK) genes were reported to be associated with A. alternata resistance in apple (Huang et al., 2016; Wei et al., 2016). In A. alternata susceptible apple cultivars, the expression of transcription factor genes MdWRKYN1 and MdWRKY26 was inhibited via microRNAs Md-miR156ab and Md-miR395 (Zhang et al., 2017). Recently, a single nucleotide polymorphism in the promoter of a hairpin RNA MdhpRNA277 was found to contribute to the resistance against Alternaria leaf spot in apple (Zhang et al., 2018a, 2018b). In our previous study, 28 genes were identified as promising candidates for A. alternata resistance in sand pear, especially Pbr039001, Pbr001627, Pbr025080 and Pbr023112 (Yang et al., 2015). However, few DNA markers directly associated with BSD resistance have been mapped in pear (Yamamoto et al., 2016). To further explore the BSD resistant germplasm resources of sand pear, 331 sand pear genotypes, including 72 improved cultivars, 18 breeding lines and 241 landraces from the germplasm bank of Chinese National Pear Germplasm Repository (Wuhan) of the Ministry of Agriculture of the People's Republic of China, were evaluated for their resistance to A. alternata under both natural infection and artificial inoculation in three consecutive years (2013–2015). The 16 botanical and biological characteristics of sand pear germplasm traits, including leaf length, leaf width, petiole length, stalk length, stalk thickness, branching ability, days of fruit development, days of vegetative growth, fruit weight, fruit diameter, fruit length, flesh firmness, soluble solids content, soluble sugar content, titratable acidity and vitamin C, were analyzed for their correlation to A. alternate resistance. Based on RNA-Seq data (Yang et al., 2015), 11 simple sequence repeat (SSR) markers were selected from 864 microsatellites for genetic diversity analysis and to check their relationship with the disease resistance. Results of this study present important information about the resistant pear accessions which can contribute to future breeding programmes.
Table 1 Resistance levels of different sand pear genotypes to A. alternata from different regions. Number
Origin
Number of genotypes
Average disease index
1 2 3 4 5 6 7 8 9 10 11
Fujian Guangdong Guangxi Guizhou Hubei Hunan Jiangsu Sichuan Yunnan Zhejiang Japan
18 14 46 24 40 14 22 21 40 36 37
29.90 25.05 34.66 32.66 33.39 33.05 34.49 34.65 39.03 31.80 38.80
± ± ± ± ± ± ± ± ± ± ±
1.12 e 0.75 f 0.88 b 0.18 cd 0.58 b 0.18 b 0.49 b 0.39 b 0.58 a 0.46 cd 0.49 a
Numbers followed by the same letter are not significantly different from each other according to Duncan's multiple range test at 0.05 level.
molecular biology (Yang et al., 2015). Stock cultures of the strain were stored at 4 °C and subcultured on PSA medium at 28 °C. After three weeks, 5 mL of sterilized distilled water was added to the surface of the plates, from which colonies were scraped off using a small brush to remove the mycelia. Conidial suspensions were filtered through four layers of cheesecloth, and centrifuged for 20 min at 6000×g to remove mycelial fragments. 2.2. Sand pear genotypes 331 sand pear genotypes used in this study, including cultivars, breeding lines and landraces (Table S1), were divided into 11 groups according to their origins (Table 1). For each genotype, 50 individual plants were grafted on P. calleryana Decne rootstock in a greenhouse. 2.3. Evaluation of resistance to A. alternata The experiments were performed from May to June in 2013, 2014 and 2015, respectively at a greenhouse 2 km from the germplasm bank of Chinese National Pear Germplasm Repository in Research Institute of Fruit and Tea, Hubei Academy of Agricultural Science. Two hundred leaves (50 leaves were randomly investigated in 4 directions, east, west, north and south of the tree) were sampled from each genotype to investigate the effect of natural infection of A. alternaria in July. Meanwhile, 50 individual plants of each genotype were grafted on P. calleryana Decne stock in a greenhouse for artificial inoculation (temperature, 25 °C; air humidity, above 95%). The plant spacing of the grafted plants was 20 cm and the row spacing was 25 cm, and artificial inoculation was performed when the seedlings grow to 1 m high. The conidial solution was adjusted to 1.0 × 105 conidia/mL in concentration and then sprayed on leaves of grafted plants using a portable hand spray. The inoculated grafted plants were covered with a transparent polyethylene bag to serve as a humid chamber for 16–18 h. Inoculations was always conducted in the afternoon. Symptom observations were performed two weeks post inoculation. The leaves of the whole plant were investigated to access the resistance of sand pear germplasm to the BSD. The evaluation criteria of disease severity levels were based on the diseased area on the leaf as follows: 0, no symptoms; 1, < 10% of the leaf; 3, 10–25% of the leaf; 5, 26–40% of the leaf; 7, 41–65% of the leaf; 9, > 65% of the leaf. Disease indexes were calculated with the formula of BI = ∑ (xini)/9 N × 100, in which BI stands for disease index of black spot, xi for the disease severity level of each leaf, ni for the number of leaves for each level, and N for total leaf number. The resistance level of each sand pear genotype to A. alternata was evaluated according to disease indexes as follows: high resistance (HR), BI < 10.0; resistance (R), 25.0 > BI ≥ 10.0; moderate resistance (MR), 40.0 > BI ≥ 25.0; susceptibility (S), 65.0 > BI ≥ 40.0; high susceptibility (HS),
2. Materials and methods 2.1. Maintenance and inoculation of A. alternata strains For the artificial inoculation, inoculum was prepared with the black spot strains obtained from the leaves of ‘Xiangnan’ (P. pyrifolia Nakai) pear in the germplasm bank of Chinese National Pear Germplasm Repository (N: 30°29′31′′, E: 114°14′86′′; Area, 7.7 ha) in Research Institute of Fruit and Tea, Hubei Academy of Agricultural Science, and the pathogen strain was isolated by single spore at Hubei Laboratory of Crop Diseases, Insect Pests and Weeds Control. The strain H was identified by Koch's rule. First single spore isolates were re-inoculated into leaves of ‘Xiangnan’ pear, single spore was isolated again after pear black spot symptom was appeared in leaves. The spore morphology of the strain was observed under a microscope. Conidia shape was long ovate, inverted pear-shaped with mediastinum 1–3, transverse 2–4, transverse constriction phenomenon, and the color of conidia was brown/dark brown. Conidial terrier was solitary or fascicled, and the color was brown or dark brown. Colony characteristics: the colony diameter was 6–9 cm after 7 days of cultivation at 25℃ on Potato Sucrose Agar (PSA). Colonies was spreading, dense or loosely villous, colony color was gray at earlier stage, later into a dark gray or bluebrown, and the back of the colony is often brown to black. DNA of pathogen strains was extracted by CTAB method (Wang and Zhuang, 2007), and internal transcribed spacer sequence of rDNA of strains was amplified by primer ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 ( TCCTCCGCTTATTGATATGC). The ITS gene sequence were compared with those of standard pear black spot in GenBank database. H strain was identified as A. alternaria combined with morphology and 2
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
BI ≥ 65.0.
3. Results 3.1. Resistance of various sand pear genotypes to A. alternata
2.4. Morphological evaluation of sand pear genotypes to A. alternata Generally, different genotypes of sand pear (P. pyrifolia Nakai) presented different levels of resistance to A. alternata under artificial inoculation. Small brown necrosis spots were observed on diseased leaves at first, and the size increased with time gradually, finally resulting in large necrotic lesions on the leaves. Under natural infection, a majority of genotypes showed low susceptibility to A. alternata, with disease index values lower than 10 except for eight genotypes including ‘Hongfen’ pear, ‘Shilixiang’, ‘Baiyu’, ‘Hakataao’, Cangxiliuyuexue’, ‘Zhaotongxiaohuang’, ‘Jinshuishu’ and ‘Shinsui’ (Fig. 1). Under artificial inoculation in the field, nine genotypes were highly resistant, 71 genotypes were resistant, 165 genotypes were moderately resistant, 68 genotypes were susceptible and 18 genotypes were highly susceptible to BSD (Fig. 2).
Botanical and biological characteristics of sand pear genotypes, including leaf length, leaf width, petiole length, stalk length, stalk thickness, branching ability, duration of fruit development, duration of vegetative growth, fruit weight, fruit diameter, fruit length, flesh firmness, soluble solid content, soluble sugar content, titratable acidity and vitamin C, were retrieved from the Chinese National Pear Germplasm Repository to determine their correlations with the resistance of various sand pear genotypes to A. alternata (Table S2). The length, width and petiole length of 4–6 leaves from the base of 5 fully developed spring branches were measured by Vernier Caliper (Shanghai Jiuliang Hardware Tools Co., LTD) before the growth of new twigs stops to deciduous leaves. The stalk length, stalk thickness, fruit diameter and fruit length of 10 representative ripe fruits were measured by Vernier Caliper. Fruit weight of 10 representative ripe fruits was measured by Electronic Scales (Shanghai Jinping Scientific Instrument Co., LTD). 30 long-growing branches in the outer canopy with light cutting were selected. The number of long-growing branches with more than 15 cm on each branch was recorded after the growth of new branches stopped in the second year and before the winter cutting, and the branching ability was the number of long branches grown on each branch. The duration of fruit development was calculated the number of days from flowering to fruit ripening and the evaluation was based on the average of 3 years' data. The duration of vegetative growth was calculated the number of days from bud germination to leaf fall and the evaluation was based on the average of 3 years' data. The flesh firmness of 10 representative ripe fruits was measured by fruit hardness tester GY-1. The soluble solid content of 10 representative ripe fruits was measured by digital display sugar meter PAL-1. The soluble sugar content was measured using Fehling's titration method. The titratable acidity was measured by acid - base titration. The vitamin C was measured by 2,6-dichloroindophenol titrimetric method. The above measurement and sampling methods was refered to ‘Description and Data Standard for Pear (Pyrus spp.)’ (Cao et al., 2006).
3.2. Resistance of various sand pear genotypes to A. alternata from different regions The average disease indexes of genotypes from eleven regions were compared with the data from artificial inoculation in the field. The average disease indexes of each sand pear germplasm origin from Fujian, Guangdong, Guizhou and Zhejiang provinces ranged from 25.05 to 32.66, which were significantly lower than those from other seven regions (Table 1). In these four regions, a lot of genotypes were resistant to BSD. The average disease index of each genotypes origin from Yunnan and Japan were 39.03 and 38.80, respectively, which were significantly higher than those from other nine regions. In these two regions, 32 genotypes were susceptible to BSD. The average disease index of each genotypes from Guangxi, Hubei, Hunan, Jiangsu and Sichuan were from 33.05 to 34.66. 3.3. Comparison of disease indexes of sand pear genotypes with different genetic backgrounds The values of disease indexes of the genotypes with various genetic backgrounds, including breeding lines, improved cultivars and landraces, were significantly different under artificial inoculation in the field (Fig. 3). The average value of disease indexes followed the order of breeding lines (24.82) < landraces (34.09) < improved cultivars (37.97), indicating that the improved cultivars and breeding lines are the most and least susceptible to BSD, respectively.
2.5. Evaluation of the relationship between SSR markers and disease resistance of different sand pear genotypes In this study, 100 pear genotypes (50 resistant and 50 susceptible) were analyzed by SSR markers (Table 2). Genomic DNA was extracted from fresh leaves following a CTAB protocol (Fu et al., 2017). DNA quality was tested using 1% agarose gel, and DNA concentration was determined by NanoDrop 2000 spectrophotometer (Thermo Scientific, USA) and diluted to 30 ng/μL. Eleven SSR markers (Yang et al., 2015) were used for PCR amplification. PCR reactions were carried out in a 25 μL volume containing 2 μL of 30 ng/μL genomic DNA template, 2.5 μL of 10 × PCR buffer, 0.5 μL of 2.5 mM dNTP mixture, 0.5 μL each of forward and reverse primer (10 pmol/μL), 0.5 μL of 2 U/μL Taq polymerase (Beijing Dingguo Changsheng Biotechnology Co. LTD), and 18.5 μL ddH2O. PCR amplification was carried out according to the following temperature profile: an initial step of 5 min at 94 °C, followed by 35 cycles of 30 s at 94 °C, 30 s at 55 °C and 30 s at 72 °C, and a final extension of 10 min at 72 °C. The PCR products were analyzed by an ABI 3730 sequencer system (Applied Biosystems, Inc., USA). The amplified fragment size was calculated based on an internal standard DNA with GeneMapper 3.0 software (Applied Biosystems, Inc., USA). The putative allele number (No.), expected heterozygosity (He), observed heterozygosity (Ho), and polymorphism information content (PIC) were calculated for the 11 SSR loci by Popgene version 1.31 software (Yang and Yeh, 1993).
3.4. Correlation between A. alternata resistance and botanical/biological characteristics Among the 16 evaluated botanical and biological characteristics of sand pear genotypes, five were highly correlated with A. alternata resistance as calculated by multiple linear stepwise (MLS) regression (Martina et al., 2010). The disease indexes of improved cultivars, breeding lines and landraces were positively correlated with the stalk length (X4; r = 0.08916) and branching ability (X6; r = 0.11982), while negatively correlated with the duration of fruit development (X7;–0.11814), fruit weight (X9;–0.10996), and soluble solid content (X13; –0.08111) (Table 3). Therefore, the A. alternata resistance of the genotypes was negatively correlated with stalk length and branching ability while positively correlated with duration of fruit development, fruit weight and soluble solid content. 3.5. Relationship between SSR markers and disease resistance of different sand pear genotypes Based on our previous RNA-Seq data, 11 SSR markers were selected for further analysis. 129 alleles were obtained with the 11 SSR loci in 3
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Table 2 Disease index of 50 resistant germplasm and 50 susceptible germplasm on the condition of natural incidence and artificial inoculation. Number
Genotype
Origin
Disease index/natural infection
Disease index/artificial inoculation
Resistance
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74
Jinjing Mali Miduhuangpili Yiwulizi Xipili Hululi 29-6-19 Lijiangmazhanli(3) Hengxianjinpaoli Wangshuibai Gaoyaodanshuili Yunlv Weiningzaoli Sianqingpili 29-6-29 Nanningdashali Jingqiu Lijiangbaipaoli Yousu Matsushima Beiliuqingli Gengtouqing Zhe12-4 Hengxianlingshanli Wuyuansuli Napiqingpili Badongpingtouli Xinghuadayinli Duanbazao Gaoyaohuangli Annong No.1 Huangpisuanli Jianyeli Wuyubaili Dalidongli Guanyangtangli 43-4-11 Hehuali Meitanmugua Weininghuangshuili Lichuanyuchuan 26-1-31 Eli No.2 Choujuurou Huangguan Jinshui No.1 Miduxiaohongli Huafeng Shounan Cuiguan Changshuibali Shinchuu Huilizaobai Huilihengshanluli Shangengzi Shinseiki Enoshima Kousui Housui Lipuhuangpili Jinshuisu Meigetsu Shinsui Huobali Dalishatangli Komazawa Midushenwali Sanmenjiangshali Qingpi Shounan Weiningdahuangli Lijiangxiaohuangli pulixiao Hanghong Huahong
Hubei Fujiang Yunnan Zhejiang Anhui Fujiang Hubei Yunnan Guangxi Hubei Guangdong Zhejiang Guizhou Guangxi Hubei Guangxi Hubei Yunnan Jiangxi Japan Yunnan Hunan Zhejiang Guangxi Jiangxi Guangxi Hubei Guangdong Hunan Guangdong Hunan Guangxi Guangdong Jiangxi Yunnan Guangxi Hubei Guangdong Guizhou Guizhou Hubei Hubei Hubei Japan Hebei Hubei Yunnan Hubei Japan Zhejiang Yunnan Japan Sichuan Sichuan Sichuan Japan Japan Japan Japan Guangxi Hubei Japan Japan Yunnan Yunnan Japan Yunnan Guangxi Hubei Guizhou Yunnan Jiangxi Zhejiang Zhejiang
1.78 ± 0.35 1.51 ± 0.96 1.39 ± 0.36 0.87 ± 0.87 0.33 ± 0.46 0.12 ± 0.12 0.49 ± 0.09 0.4 ± 0.26 1.17 ± 0.31 0.13 ± 0.03 1.38 ± 0.19 2.19 ± 1.01 2.57 ± 0.84 0.44 ± 0.29 0.18 ± 0.02 0.95 ± 0.41 0.79 ± 0.44 1.34 ± 0.46 1.18 ± 0.12 1.31 ± 0.25 0.51 ± 0.2 0.37 ± 0.03 1.22 ± 0.3 0.33 ± 0.21 1.12 ± 0.25 0.79 ± 0.47 0.51 ± 0.25 0.12 ± 0.01 1.93 ± 0.71 0.61 ± 0.27 0.63 ± 0.12 0.17 ± 0.06 0.18 ± 0.06 0.73 ± 0.13 2.51 ± 0.6 1.57 ± 0.59 0.18 ± 0.02 1.68 ± 0.42 3.9 ± 1.13 0.89 ± 0.46 0.33 ± 0.21 1.34 ± 0.36 0.79 ± 0.63 0.73 ± 0.3 1.95 ± 0.9 0.56 ± 0.18 1.23 ± 0.35 0.73 ± 0.18 3.78 ± 2.8 1.40 ± 0.32 1.08 ± 0.32 0.84 ± 0.57 2.39 ± 1.1 1.50 ± 0.4 0.56 ± 0.35 2.86 ± 1.4 1.34 ± 0.31 0.37 ± 0.23 7.95 ± 1.25 2.22 ± 0.98 11.43 ± 1.31 7.41 ± 2.45 10.17 ± 0.04 1.11 ± 0.14 4.03 ± 0.6 0.94 ± 0.69 2.23 ± 1.18 0.39 ± 0.18 8.56 ± 1.21 3.17 ± 1.51 0.84 ± 0.57 9.67 ± 0.17 8.1 ± 2.1 2.88 ± 1.34
5.72 ± 1.23 5.08 ± 1.09 7.34 ± 1.43 8.89 ± 0.82 8.22 ± 1.44 8.67 ± 0.3 8.34 ± 0.97 9.46 ± 0.67 9.7 ± 0.18 11.08 ± 0.31 11.28 ± 0.79 12 ± 1.8 14.08 ± 3.04 15.38 ± 2.72 16.16 ± 2.39 16.39 ± 2.94 16.78 ± 3.07 16.83 ± 3.37 16.9 ± 1.03 16.94 ± 3.29 18.16 ± 4.95 18.28 ± 4.71 19.2 ± 3.97 19.21 ± 4.49 19.35 ± 4.11 19.47 ± 4.1 19.6 ± 4 19.69 ± 4.85 19.85 ± 2.88 21.21 ± 1.98 21.24 ± 2 21.42 ± 3.68 21.45 ± 3.21 21.76 ± 1.9 21.96 ± 2.1 22.09 ± 2.35 21.12 ± 2.65 22.27 ± 2.27 22.34 ± 1.98 22.41 ± 2.58 23.34 ± 1.68 23.44 ± 1.22 28.98 ± 1.11 29.59 ± 2.6 30.45 ± 3.25 32.73 ± 2.95 33.35 ± 4.49 32.82 ± 2.95 37.46 ± 5.83 39.86 ± 0.35 42.77 ± 1.51 42.54 ± 1.56 46.59 ± 4.6 41.44 ± 1.25 47 ± 4.85 43.4 ± 3.27 45.59 ± 4.22 47.45 ± 3.69 47.51 ± 5.31 47.65 ± 5.7 47.74 ± 4.39 48.04 ± 6.84 48.29 ± 6.42 49.39 ± 4.94 49.4 ± 4.81 50.69 ± 4.45 53.44 ± 6.33 53.47 ± 0.8 53.7 ± 4.94 54.35 ± 6.31 55.72 ± 3.26 56.14 ± 4.85 53.8 ± 5.82 58.22 ± 1.69
HR HR HR HR HR HR HR HR HR R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R R MR MR MR MR MR MR MR MR S S S S S S S S S S S S S S S S S S S S S S S S
(continued on next page) 4
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Table 2 (continued) Number
Genotype
Origin
Disease index/natural infection
Disease index/artificial inoculation
Resistance
75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100
Qing jade Xihuaxueli Midubaihe Jingxitangli Huali No.1 Jinshui No.2 Fuyuanhuangli Xibaqingshuili Doitsu liuyuehuangzongli Hongfeili Shilixiang Huangpieli Liuchenxueli Guihuali Huangqieli Baozhuli Cangxiliuyuexueli Houzuili Hakataao Baiyu Asahi Shaotongxiaohuangli Qingli Dalixiangsuli Qingpisuanli
Japan Zhejiang Yunnan Guangxi Hubei Hubei Yunnan Yunnan Japan Fujiang Guizhou Hubei Guangxi Guangxi Guangxi Zhejiang Yunnan Sichuan Hubei Japan Jiangxi Japan Yunnan Hunan Yunnan Guangxi
6.26 ± 2.51 1.26 ± 0.15 4.95 ± 2.31 1.79 ± 0.75 1.79 ± 0.72 2.84 ± 1.55 2.22 ± 1.06 2.21 ± 0.49 6.62 ± 2.08 1.09 ± 0.69 66.74 ± 0.84 46.45 ± 4.3 0.11 ± 0.02 1.12 ± 0.35 0.68 ± 0.38 6.23 ± 2.84 4.79 ± 2 23.75 ± 1.03 1.78 ± 0.73 27.94 ± 1.51 32.67 ± 2 2.39 ± 0.38 12.01 ± 0.83 1.57 ± 0.54 2.51 ± 0.18 0.33 ± 0.18
57.8 ± 2.22 57.79 ± 0.4 58.69 ± 3.76 59.92 ± 4.41 60.34 ± 2.85 55.44 ± 5.13 59.33 ± 4.79 61.94 ± 1.71 64.05 ± 0.83 64.14 ± 2.38 65.38 ± 0.12 65.79 ± 1.47 66.38 ± 1.24 66.81 ± 0.96 68.05 ± 2.69 68.54 ± 5.53 72.28 ± 4.62 77.24 ± 2.98 77.51 ± 1.64 79.64 ± 2.85 81.08 ± 5 81.29 ± 1.16 85.67 ± 3.7 88.05 ± 2.17 89.51 ± 1.7 91.34 ± 1.99
S S S S S S S S S S HS HS HS HS HS HS HS HS HS HS HS HS HS HS HS HS
Note: HR: High resistant; R: Resistant; MR: Moderately resistant; S: Susceptible; HS: High susceptible.
Fig. 1. Resistance of the 331 genotypes sand pear to A. alternata under natural and artificial inoculation. The Y axis represents the disease indexes, and the X axis represents 331 sand pear germplasm.
100 pear genotpypes. The numbers of alleles ranged from 5 (15305A) to 17 (3918 and 12717A), with an average value of 11.73. The expected heterozygosity (He) ranged from 0.272 (12717B) to 0.876 (12717A), with a mean value of 0.70. The observed heterozygosity (Ho) ranged from 0.041 (15305A) to 0.73 (6643A), with an average value of 0.42. The polymorphism information content (PIC) ranged from 0.261 (12717B) to 0.859 (12717A), with an average value of 0.66 (Table 4). We further analyzed the frequency distribution of specific alleles in 100 pear genotypes (50 resistant and 50 susceptible). As a result, the proportions of SSR loci 6167B and 15091C were higher in disease-resistant varieties, and those of SSR loci 6484A, 6643A and 12717A were higher in disease-susceptible varieties (Table 5). Fig. 2. The number of different resistant sand pear germplasm to A. alternata under artificial inoculation. The Y axis represents the number of sand pear germplasm, and the X axis represents classification criteria for different resistant genotypes.
4. Discussion Pear is one of the most important fruit crops for its high productivity 5
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Fig. 3. Resistance of breeding line, improved cultivar and landrace of sand pear germplasm. Disease index of different biological status to artificial inoculation in the field were significantly different. The same letter at the tops of column indicates that there is no significant difference from each other according to Duncan's multiple range test, p = 0.05.
Table 3 Correlation between resistance to A. alternata and 16 botanical/biological characteristics of sand pear genotypes. Variable
Parameter Estimate
Standard Error
t Value
Pr > |t|
Standard Estimate
Intercept Stalk length Branching ability Duration of fruit development Fruit weight Soluble solids content
0.03217 0.08916 0.11982 −0.11814
0.05598 0.05440 0.05691 0.05505
0.57 1.64 2.11 −2.15
0.5659 0.1022 0.0360 0.0326
0 0.08916 0.11498 −0.11809
−0.10996 −0.08111
0.05448 0.05490
−2.02 −1.48
0.0444 0.1406
−0.10992 −0.08005
Table 5 Frequency distribution of specific alleles in resistant and susceptible sand pear genotypes.
All variables significant at the 0.1500 level were retained in the model, while other variables were excluded. Among the 16 evaluated botanical and biological characteristics possibly related to A. alternata resistance, including leaf length, leaf width, petiole length, stalk length, stalk thickness, branching ability, duration of fruit development, duration of vegetative growth, fruit weight, fruit diameter, fruit length, flesh firmness, soluble solid content, soluble sugar content, titratable acidity and vitamin C, five characteristics including stalk length, branching ability, duration of fruit development, fruit weight and soluble solid content were highly correlated with the resistance as calculated using the method of multiple linear stepwise regressions.
SSR loci
Specific alleles
Frequency distribution in resistant varieties (%)
Frequency distribution in susceptible varieties (%)
Distribution ratio of resistant varieties to susceptible varieties
3436A 3918 6167B 6484A 6643A 6643D 12717A 12717B 15091B 15091C 15305A
387 327 301 400 245 401 296 356 276 327 335
55 39 37 17 7 43 8 67 45 32 56
44 28 16 39 23 29 18 81 42 14 48
1.25 1.39 2.31 0.44 0.30 1.48 0.44 0.83 1.07 2.29 1.17
Frequency distribution of specific alleles in 100 pear genotypes (50 resistant and 50 susceptible) was analyzed. The proportions of SSR loci 6167B and 15091C were higher in disease-resistant varieties, and those of SSR loci 6484A, 6643A and 12717A were higher in disease-susceptible varieties.
Table 4 Relationship between SSR markers and disease resistance of sand pear genotypes. SSR loci
No. of putative alleles
Expected heterozygosity
Observed heterozygosity
Polymorphism information content
3436A 3918 6167B 6484A 6643A 6643D 12717A 12717B 15091B 15091C 15305A Mean
7 17 13 13 16 11 17 9 9 12 5 11.73
0.583 0.767 0.698 0.768 0.87 0.781 0.876 0.272 0.733 0.824 0.561 0.70
0.327 0.663 0.352 0.552 0.73 0.619 0.5 0.092 0.28 0.5 0.041 0.42
0.499 0.734 0.654 0.729 0.851 0.752 0.859 0.261 0.701 0.795 0.468 0.66
A total of 100 pear genotypes (50 resistant and 50 susceptible) were analyzed by SSR markers in this study. Eleven SSR markers from pear transcriptome sequencing were used for PCR amplification. The PCR products were analyzed by an ABI 3730 sequencer system (Applied Biosystems, Inc., USA). The putative allele number (NO.), the expected heterozygosity (He), the observed heterozygosity (Ho), and the polymorphism information content (PIC) were calculated for the 11 SSR loci by Popgene version 1.31 software.
Fig. 4. Frequency distribution diagram of disease indexes of 331 sand pear germplasm under artificial inoculation. The X axis represents the disease indexes, and linear map represents the partial normal distribution curve. The value of Kolmogorov-Smirnov Z is 2.058.
6
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
solids content. That meant BSD-resistance of sand pear was correlation to these characters in natural evolution. Evaluation of the pathogen resistance of different plant genotypes was mainly based on natural pathogen inoculation in previous studies (Abe et al., 2010; Chandelier et al., 2016; Hajano et al., 2016). In this study, improved cultivars, landrace and breeding lines of sand pear showed different susceptibilities to BSD under both natural infection and artificial inoculation (Fig. 3). We identified four relatively more resistant lines from improved cultivars, including ‘Huangguan’, ‘Huali NO.2′, ‘JinshuiNo.1′ and ‘Erli No.2′, which could be further popularized in production area. Resistant breeding lines such as 29-6-19, 29-6-29 and 26-4-2 could be used as breeding materials. The cultivars such as ‘Cuiguan’, ‘Kousui’ and ‘Huali No.1′ are susceptible to BSD, and thus special attention should be paid to the prevention and control of BSD in the planting of these cultivars. Besides, we also identified some highly resistant genotypes such as ‘Weiningxiangmian’ and ‘Jinjing’, and some highly susceptible genotypes such as ‘Shaotongxiaohuangli’ and ‘Hongfen’, which could be used for studies of the resistance mechanism of sand pear in the future. A single-nucleotide polymorphism (SNP) was identified in the MdhpRNA277 promoter region between ‘Golden Delicious’ (pMdhpRNA277-GD) and ‘Hanfu’ (pMdhpRNA277-HF) to distinguish among apple varieties that are resistant or susceptible to A. alternata leaf spot (Zhang et al., 2018a, 2018b). 34 microsatellites were identified from resistance cultivar ‘Jinjing’ (J-CK/J-P) compared with the susceptible cultivar ‘Hongfen’ (H-CK/H–P) by RNA-Seq, and 11 primer pairs were able to distinguish ‘Jinjing’ from ‘Hongfen’ pear (Yang et al., 2015). In previous study, SSR marker have been taken as a powerful tool to evaluate the genetic diversity in plant genotypes for resistance against Alternaria disease, such as Indian mustard (Pratap et al., 2016), groundnut (Shoba et al., 2012; Zongo et al., 2017), To further verify the correlation of 11 SSR markers with BSD- resistance, 50 resistant and 50 susceptible germplasms were analyzed by these 11 SSR markers in this study. The results showed (Table 5) the proportion of SSR loci 6167B and 15091C were higher in disease-resistant varieties, and the proportion of SSR loci 6484A, 6643A and 12717A were higher in diseasesusceptible varieties. That means the SSR loci 6167B and 15091C are related to BSD resistance, while the SSR loci 6484A, 6643A and 12717A are associated with BSD susceptibility in pear. As a whole, this study provides some SSR markers for the molecular breeding of disease resistant pear varieties, as well as some germplasm resources for research on the molecular mechanism of BSD resistance of pear in the future.
and economic value. However, its production is often severely affected by many fungal diseases. BSD caused by the fungus A. alternata is one of the most serious diseases in pear (Terakami et al., 2007, 2016). Planting of resistant cultivars and application of fungicides are the major approaches to manage BSD in pear (Kan et al., 2017; Yang et al., 2015; Yamamoto et al., 2016). In this study, the resistance of 331 sand pear genotypes to A. alternata was evaluated under both natural infection and artificial inoculation. We found that no sand pear genotypes were immune to A. alternata, which could be due to the production of hostselective toxins by the fungus (Tsuge et al., 2013). All tissues of improved cultivars, breeding lines and landraces of sand pear are highly susceptible to BSD due to the production of AK-toxin by A. alternata (Tanaka and Tsuge, 2000). It has been proposed that the susceptibility is controlled by a single dominant gene designated as A, and a heterozygous genotype (A/a) was observed in susceptible cultivars (Terakami et al., 2007). The disease indexes of 331 sand pear genotypes followed an overall partial normal distribution (Fig. 4), further indicating that all the genotypes are susceptible to A. alternata, and the susceptibility is controlled by dominant genes. Conidia can infect crops during all seasons, and the conidial concentration in the air over the crop is closely related to the environmental conditions (Blanco et al., 2006). Because the conidial concentration of black spot fungus is very low in the air, it is difficult to distinguish different resistance levels of various sand pear genotypes to BSD under natural infection. Since the conidial concentration of pathogens is high under artificial inoculation and the leaves are more easily infected, different resistance levels of the genotypes to black spot fungus could be more accurately and efficiently determined. However, ‘Hongfenli’ and ‘Shilixiang’ were two exceptional genotypes for their high disease indexes under both natural infection and artificial inoculation, possibly because they could be infected at extremely low conidial concentrations. The disease indexes of sand pear genotypes varied significantly among the 11 regions under artificial inoculation in the field (Table 1). Plants defend against pathogens in complex ways, and resistance (R) genes perform a pivotal role in defense response initiation (Yang et al., 2015; Zhang et al., 2018a, 2018b). Among all known types of R genes, nucleotide-binding site leucine rich repeats (NBS-LRR) genes represent for about 80% of the characterized R genes, including TIR (Toll/interleukin-1 receptor) -NBS-LRR and the non-TIR-NBS-LRR (Cannon et al., 2002). Sand pear germplasms from different regions might have undergone different pressures from native A. alternata, and thus may have maintained different homologous R genes. Therefore, genotypes from different regions showed different disease incidence when inoculated by the same concentration of black spot spores. Plant surface is the first barrier for plant against microbial invasion. In a previous study, pear fruit cuticular wax, surface hydrophobicity and ethylene signaling were reported to be affected by A. alternata infection (Tang et al., 2017; Sun et al., 2017). MLS regression analysis showed that the BSD resistance of sand pear genotypes to A. alternata was correlated with five main botanical and biological characteristics (Table 3), including stalk length, branching ability, duration of fruit development, fruit weight, and soluble solid content. A. alternata resistance of the genotypes was negatively correlated with branching ability, the possible reason is that pear branching ability is the stronger, the pear tree will grow more branches, and canopy of the pear tree is airtight, therefore, pear leaves are seriously affected. A. alternata resistance of the genotypes was positively correlated with duration of fruit development, fruit weight and soluble solid content. As improved cultivar, fruit development, fruit weight and soluble solids content were positively correlating with BDS resistance merely because they were selected, during the breeding program from the original germplasm. However, besides 18 breeding line and 72 improved cultivars, 241 Landrace were also done correlation analysis with BDS resistance. The result showed that the BSD-resistance of the 241 landraces were positively related to days of fruit development, fruit weight, and soluble
5. Conclusion Black spot disease caused by the fungus Alternaria alternata is one of the most devastating diseases in pear. In this study, 331 sand pear germplasm were evaluated for their resistance to BSD under both natural infection and artificial inoculation conditions in three consecutive years. We screened nine highly resistant, 71 resistant, 165 moderately resistant, 68 susceptible and 18 highly susceptible sand pear germplasm to BSD. Multiple linear stepwise regression analysis indicated that susceptibility of sand pear to BSD was related to five main botanical and biological characteristics, stalk length, branching ability, days of fruit development, fruit weight, and soluble solids content. 11 simple sequence repeat (SSR) markers from pear RNA-Seq data were performed genetic diversity and resistance relationships analysis. SSR loci 6167B and 15091C were correlated with pear resistance, and SSR loci 6484A, 6643A and 12717A were correlated with pear susceptible. Results of this study present important information about the resistant pear accessions which can contribute to future breeding programs. Acknowledgments This research was financially supported by the National Natural Science Fund of China (no. 31601721), Hubei Agricultural Science and 7
Scientia Horticulturae 259 (2020) 108838
X. Yang, et al.
Technology Innovation Fund (no. 2016-620-000-001-029), Supported project of Hubei Academy of Agricultural Sciences (2019fcxjh05), Hubei Laboratory of Crop Diseases, Insect Pests and Weeds Control Open project (2017ZTSJJ1) and China Agriculture Research System (no.CARS-28-39). We thank Prof. Zuoxiong Liu from the Foreign Language School of HZAU for proof-reading and revising the English language of the manuscript.
807–815. Pratap, P., Thakur, A.K., Meena, P., Meena, H.S., Sharma, P., Singh, D., Majumdar, R., 2016. Genetic diversity assessment in Indian mustard (Brassica juncea L) for Alternaria blight tolerance using SSR markers. J. Oilseed Brassica. 6, 175–182. Sanchez-Vallet, A., Fouche, S., Fudal, I., Hartmann, F.E., Soyer, J.L., Tellier, A., Croll, D., 2018. The genome biology of effector gene evolution in filamentous plant pathogens. Annu. Rev. Phytopathol. 56, 21–40. Shoba, D., Manivannan, N., Nigam, S.N., 2012. SSR markers associated for late leaf spot disease resistance by bulked segregant analysis in groundnut (Arachis hypogaea L.). Euphytica 188, 265–272. Sun, H., Song, N., Ma, L., Li, J., Ma, L., Wu, J., Wu, J., 2017. Ethylene signalling is essential for the resistance of Nicotiana attenuata against Alternaria alternata and phytoalexin scopoletin biosynthesis. Plant Pathol. 66, 277–284. Tanaka, A., Tsuge, T., 2000. Structural and functional complexity of the genomic region controlling AK-toxin biosynthesis and pathogenicity in the Japanese pear pathotype of Alternaria alternata. Mol. Plant Microbe Interact. 13, 975–986. Tang, Y., Li, Y., Bi, Y., Wang, Y., 2017. Role of pear fruit cuticular wax and surface hydrophobicity in regulating the prepenetration phase of Alternaria alternata infection. J. Phytopathol. 165, 313–322. Terakami, S., Adachi, Y., Iketani, H., Sato, Y., Sawamura, Y., Takada, N., Yamamoto, T., 2007. Genetic mapping of genes for susceptibility to black spot disease in Japanese pears. Genome 50, 735–741. Terakami, S., Moriya, S., Adachi, Y., Kunihisa, M., Nishitani, C., Saito, T., Abe, K., Yamamoto, T., 2016. Fine mapping of the gene for susceptibility to black spot disease in Japanese pear (Pyrus pyrifolia Nakai). Breeding Sci. 66, 271–280. Tsuge, T., Harimoto, Y., Akimitsu, K., Ohtani, K., Kodama, M., Akagi, Y., Egusa, M., Yamamoto, M., Otani, H., 2013. Host-selective toxins produced by the plant pathogenic fungus Alternaria alternata. FEMS Microbiol. Rev. 37, 44–66. Wang, L., Zhuang, W., 2007. Phylogenetic analyses of Penicillia based on partial calmodulin gene sequences. BioSystems. 88, 113–126. Wei, M., Wang, S., Dong, H., Cai, B., Tao, J., 2016. Characterization and comparison of the CPK gene family in the apple (Malus × domestica) and other Rosaceae species and its response to Alternaria alternata infection. PLoS One 11, e0155590. Wu, J., Wang, Y., Xu, J., Korban, S.S., Fei, Z., Tao, S., et al., 2018. Diversification and independent domestication of Asian and European pears. Genome Biol. 19, 77. Yamamoto, M., Terakami, S., Takada, N., Yamamoto, T., 2016. Physical mapping of black spot disease resistance/susceptibility-related genome regions in Japanese pear (Pyrus pyrifolia) by BAC-FISH. Breeding Sci. 66, 444–449. Yang, R.C., Yeh, F.C., 1993. Multilocus structure in Pinus contorta Dougl. Theor. Appl. Genet. 87, 568–576. Yang, X., Hu, H., Yu, D., Sun, Z., He, X., Zhang, J., Chen, Q., Tian, R., Fan, J., 2015. Candidate resistant genes of sand pear (Pyrus pyrifolia Nakai) to Alternaria alternata revealed by transcriptome sequencing. PLoS One 10, e0135046. Zhang, L., Jia, C., Liu, L., Zhang, Z., Li, C., Wang, Q., 2011. The involvement of jasmonates and ethylene in Alternaria alternata f. Sp. Lycopersici toxin-induced tomato cell death. J. Exp. Bot. 62, 5405–5418. Zhang, Q., Li, Y., Zhang, Y., Wu, C., Wang, S., Hao, L., Wang, S., Li, T., 2017. MdEmiR156ab and MdEmiR395 target WRKY transcription factors to influence apple resistance to leaf spot disease. Front. Plant Sci. 8, 526. Zhang, Q., Ma, C., Zhang, Y., Gu, Z., Li, W., Duan, X., Wang, S., Hao, L., Wang, Y., Wang, S., Li, T., 2018a. A single nucleotide polymorphism in the promoter of a hairpin RNA contributes to Alternaria leaf spot resistance in apple (Malus × domestica Borkh.). Plant Cell 30, 1924–1942. Zhang, Q., Ma, C., Zhang, Y., Gu, Z., Li, W., Duan, X., Wang, S., Hao, L., Wang, Y., Wang, S., Li, T., 2018b. A single-nucleotide polymorphism in the promoter of a hairpin RNA contributes to Alternaria alternata leaf spot resistance in apple (Malus × domestica). Plant Cell 30, 1924–1942. Zongo, A., Khera, P., Sawadogo, M., Shasidhar, Y., Sriswathi, M., Vishwakarma, M.K., Sankara, P., Ntare, B.R., Varshney, R.K., Pandey, M.K., Desmae, H., 2017. SSR markers associated to early leaf spot disease resistance through selective genotyping and single marker analysis in groundnut (Arachis hypogaea L.). Biotechnol. Rep. Amst. 15, 132–137.
Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2019.108838. References Abe, K., Iwanami, H., Kotoda, N., Moriya, S., Takahashi, S., 2010. Evaluation of apple genotypes and Malus species for resistance to Alternaria blotch caused by Alternaria alternata apple pathotype using detached-leaf method. Plant Breed. 129, 208–218. Baudry, A., Morzières, J.P., Larue, P., 1993. First report of Japanese pear black spot caused by Alternaria kikuchiana in France. Plant Dis. 77, 19–22. Blanco, C., los de Santos, B., Romero, 2006. Relationship between concentrations of Botrytis cinerea conidia in air, environmental conditions, and the incidence of grey mould in strawberry flowers and fruits. Eur. J. Plant Pathol. 114, 415–425. Cannon, S.B., Zhu, H., Baumgarten, A.M., Spangler, R., May, G., Cook, D.R., Young, N.D., 2002. Diversity, distribution, and ancient taxonomic relationships within the TIR and non-TIR NBS-LRR resistance gene subfamilies. J. Mol. Evol. 54, 548–562. Cao, Y., Liu, F., Hu, H., Zhang, B., 2006. Description and Data Standard for Pear (Pyrus spp.). China Agricultural Press, Beijing (in Chinese). Chandelier, A., Husson, C., Druart, P., Marçais, B., 2016. Assessment of inoculation methods for screening black alder resistance to Phytophthora × alni. Plant Pathol. 65, 441–450. Fu, Z., Song, J., Paula, J., 2017. A rapid and cost effective protocol for plant genomic DNA isolation using regenerated silica columns in combination with CTAB extraction. J. Integr. Agric. 16 (8), 1682–1688. Hajano, J.U.D., Zhang, H.B., Ren, Y.D., Lu, C.T., Wang, X.F., 2016. Screening of rice (Oryza sativa) cultivars for resistance to rice black streaked dwarf virus using quantitative PCR and visual disease assessment. Plant Pathol. 65, 1509–1517. Huang, K., Zhong, Y., Li, Y., Zheng, D., Cheng, Z.-M., 2016. Genome-wide identification and expression analysis of the apple ASR gene family in response to Alternaria alternataf. sp. mali. Genome 59, 866–878. Kan, J., Liu, T., Ma, N., Li, H., Li, X., Wang, J., Zhang, B., Chang, Y., Lin, J., 2017. Transcriptome analysis of Callery pear (Pyrus calleryana) reveals a comprehensive signalling network in response to Alternaria alternata. PLoS One 12, e0184988. Kohmoto, K., Otani, H., Cavanni, P., Bugiani, R., 1992. Occurrence of the japanese pear pathotype of Alternaria alternata in japanese pear orchards in Italy. Phytopathol. Mediterr. 31, 141–147. Kumar, S., Kirk, C., Deng, C., Wiedow, C., Knaebel, M., Brewer, L., 2017. Genotyping-bysequencing of pear (Pyrus spp.) accessions unravels novel patterns of genetic diversity and selection footprints. Hortic. Res. 4, 17015. Liu, Q., Song, Y., Liu, L., Zhang, M., Sun, J., Zhang, S., Wu, J., 2015. Genetic diversity and population structure of pear (Pyrus spp.) collections revealed by a set of core genomewide SSR markers. Tree Genet. Genomes 11, 1–22. Liu, P., Shi, Y., Zhu, L., 2018. Geneticvariation in resistance to valsa canker is related to arbutin and gallic acid content in Pyrus bretschneideri. Horticul. Plant J. 4, 233–238. Martina, I., Ghania, Md., Ahmadb, S., 2010. Stepwise multiple regression method to forecast fish landing. Procedia Soc. Behav. Sci. 8, 549–554. Nakashima, T., Ueno, T., Fukami, H., Taga, T., Masuda, H., Osaki, K., Nishimura, S., 1985. Isolation and structures of AK-toxin I and II, host-specific phytotoxic metabolites produced by Alternaria alternata Japanese pear pathotype. Agr. Biol. Chem. 49,
8