Selective Modification of Antigen-Specific CD4+ T Cells by Retroviral-Mediated Gene Transfer and in Vitro Sensitization with Dendritic Cells

Clinical Immunology Vol. 104, No. 1, July, pp. 58 – 66, 2002 doi:10.1006/clim.2002.5229

Selective Modification of Antigen-Specific CD4 ⫹ T Cells by RetroviralMediated Gene Transfer and in Vitro Sensitization with Dendritic Cells Chun-Ming Lin 1 and Fu-Hwei Wang Department of Microbiology, Soochow University, Taipei, Taiwan, Republic of China

defined epitopes. A common strategy is to isolate from patients T cell clones with desired specificities and then expand them by stimulating them with specific antigens and interleukin-2 (IL-2). A representative example is tumor-infiltrating lymphocytes (1, 4). However, this process may select T cells for proliferative ability rather than for characteristics such as immune competence and multispecificity. Moreover, as patients represent a population of individuals who have apparently failed to elicit an effective immune response to the growing tumor or infection, it is anticipated that T cells isolated from patients would be limited in number and poor in immune reactivities (5–7). An alternative solution is to generate and expand antigen-specific T cells ex vivo, when the antigenic targets of T cells are known (8, 9). This is attractive in that effector T cells can be stimulated and expanded in vitro without tumor/virus-induced suppression mechanisms. The induction and expansion of antigen-specific T cells requires optimal antigen presentation and T cell costimulation. Currently, antigen-presenting cells (APCs) such as virally infected B cells, artificial APCs, and peptide-pulsed dendritic cells (DCs) are used to generate antigen-specific T cells for adoptive cell therapy (9 –11). Many studies have demonstrated the effectiveness of DCs in the activation of antigen-specific T cells ex vivo (12–14). Even without the knowledge of tumor antigens, tumor-specific T cells can be activated with DCs loaded with tumor lysate/RNA or killed tumor cells (14 –16). Besides, the use of DCs might overcome the problem of T cell downregulation, since the ability of DC immunization to break immune tolerance or reverse immune incapability is well documented (17–19). Nevertheless, the effectiveness of adoptive cell therapy is further limited by in vivo factors. Several clinical and animal studies showed that infused antigen-specific cytotoxic T lymphocytes mediated a transient therapeutic effect and then lost activity due to the shortened survival of these T cells after in vivo target recognition (20 –22). Moreover, adoptively transferred lymphocytes are prone to cell death secondary to IL-2 withdrawal (23, 24). Very recently, adoptive therapy

Adoptive therapy with antigen-specific T cells is a potential treatment against cancers and viral diseases. To establish a system to modify the genes of these cells to increase their effectiveness, we examined whether the combined use of retroviral vector, which only infects dividing cells, and in vitro sensitization of T cells with antigen-loaded dendritic cells (DCs) could selectively modify antigen-specific T cells with a bcl-2 gene. Human CD4 ⴙ T cells were used as target cells. Autologous DCs transfected with genes of hepatitis B virus (HBV) stimulated a specific T cell proliferation. Importantly, these proliferating T cells were selectively transduced by a bcl-2-retrovirus, and CD25 ⴙ T cells isolated from them contained higher levels of integrated provirus. To select bcl-2-transduced, activated T cells, cells were subjected to interleukin-2 (IL-2) withdrawal. In contrast to CD25 ⴚ and mock-infected CD25 ⴙ T cells, 70% of CD25 ⴙ T cells transduced with bcl-2-retrovirus survived IL-2 withdrawal. These surviving T cells were demonstrated to contain integrated bcl-2 provirus and exhibited HBVspecific proliferation and interferon-␥ secretion. In addition, bcl-2 overexpression protected HBV-specific T cells from transforming growth factor (TGF)-␤-induced cell death. These results demonstrate the feasibility of our strategy in the generation of genetically modified antigen-specific CD4 ⴙ T cells and show that bcl-2-transduced antigen-specific T cells survive IL-2 withdrawal and TGF-␤-induced apoptosis. © 2002 Elsevier Science (USA)

Key Words: retroviral vector; gene transfer; antigenspecific T lymphocyte.

INTRODUCTION

The infusion of antigen-specific T lymphocytes is a potential therapy against certain cancers and viral diseases (1–3). One limitation to its broad usage is the availability of autologous T cells directed against well1 To whom correspondence should be addressed at the Department of Microbiology, Soochow University, Wai Shuang Hsi, Shih Lin, Taipei, Taiwan 11102, Republic of China. Fax: 886-2-883-1193. E-mail: [email protected].

1521-6616/02 $35.00 © 2002 Elsevier Science (USA) All rights reserved.

58

GENE TRANSFER INTO DC-ACTIVATED T CELLS

with CD4 ⫹ and CD8 ⫹ T cells from transgenic mice expressing dominant-negative transforming growth factor-␤ (TGF-␤) receptor type II demonstrated that TGF-␤, an immunosuppressive cytokine found at the site of most tumors (25), plays a significant role in the inhibition of tumor-specific T cell responses (26). One potential solution to problems like these is the utilization of genetically modified antigen-specific T cells. For example, transduction of an IL-2 gene into human melanoma-reactive CD8 ⫹ T cells has resulted in their continued growth in the absence of IL-2 (27), and selective blockade of TGF-␤ signaling in tumor-specific T cells with a dominant-negative DNA against TGF-␤ receptor may exempt these T cells from TGF-␤ constraints (26). The present study was initiated to investigate whether antigen-specific T cells can be selectively modified by the combined use of retroviral-mediated gene transfer, which selectively delivers genes to dividing cells (28, 29), and in vitro sensitization of autologous T cells with antigen-loaded DCs, which stimulates antigen-specific T cells to proliferate. Human CD4 ⫹ T cells were exploited as target cells, because numerous studies have indicated the importance of CD4 ⫹ T cells in the design of T cell-related therapeutic modalities (30 – 33). The bcl-2 gene was used as a model transgene due to the demonstration that Bcl-2 overexpression can prevent apoptotic cell death from a wide array of adverse stimuli, including hypoxia, which prevail in solid tumors and protect T cells against IL-2 withdrawalinduced apoptosis (34 –36). MATERIALS AND METHODS

Generation and transfection of DCs. In all experiments, peripheral blood mononuclear cells (PBMCs) were prepared from the peripheral blood (50 ml) of hepatitis B virus (HBV)-negative donors by using Ficoll–Hypaque (Pharmacia, Uppsala, Sweden) density centrifugation. DCs were generated from PBMCs as described previously (37). Briefly, PBMCs were resuspended in RPMI 1640 plus 1% autologous serum in six-well plates (Costar, Cambridge, MA) and allowed to adhere to plastic dishes. After 2 h at 37°C, the nonadherent cells were removed and the adherent cells were subsequently cultured for 7 days with granulocytemacrophage colony-stimulating factor (1000 U/ml, PeproTech, London, UK) and interleukin-4 (IL-4; 500 U/ml, PeproTech). Cytokines were replenished every other day and phenotypic changes were monitored by light microscopy. On day 5, DCs were transfected. The lipidic formulations lipofectAMINE and lipofectAMINE PLUS (GIBCO–Life Technologies, Paisley, UK) were used to deliver genes into DCs (38). The DNA/lipid compound ratio and the incubation time were selected according to the manufacturer’s recommendation. OPTI-MEM I

59

(GIBCO–Life Technologies) was used as transfection medium. Briefly, on day 5 of culture DCs were harvested and washed twice in PBS, and then the pellet was gently resuspended in the plasmid DNA–liposomal complexes (200 ␮l/10 6 cells) and left for 1 min at room temperature. OPTI-MEM I medium was then added (800 ␮l/10 6 cells), and the cells were incubated at 37°C for 3– 4 h. After incubation, DCs were washed and returned to culture medium for another 2–3 days. The plasmid DNA used was derived from pcDNA3 (Invitrogen Corp., Carlsbad, CA), in which the neomycin phosphotransferase (neo) gene of the original plasmid was deleted, and the gene encoding the lacZ reporter protein, surface, or core antigen of HBV or the VP1 protein of swine vesicular disease virus was placed under the control of the cytomegalovirus promoter. Both HBV genes were kindly provided by Dr. Szecheng J. Lo (Yang-Ming University, Taipei, Taiwan). The control plasmid used in DC transfection was neo-deleted pcDNA3. These derived plasmids were purified by Endotoxin Free Qiagen Maxi Prep Kit (Qiagen Ltd., Crawley, UK). T cell proliferation assay. Transfected DCs were prepared fresh as described above and irradiated (2500 Rad). Autologous CD4 ⫹ T cells were prepared from PBMCs with CD4 Dynabeads (Dynal, Oslo, Norway), and their purity was demonstrated to be ⬎95% by a flow cytometry analysis. A proliferation assay was set up in triplicate wells by coculturing T cells (2– 4 ⫻ 10 5 cells/well) with DCs (1 ⫻ 10 4 cells/well) in 200 ␮l of RPMI 1640 supplemented with 1% autologous serum. As negative controls, T cells (2– 4 ⫻ 10 5 cells/well) or DCs (1 ⫻ 10 4 cells/well) were cultured in medium alone. The microcultures were incubated in a humidified CO 2 incubator at 37°C. On day 5, each well was pulsed with 1 ␮Ci [ 3H]thymidine (Amersham, Arlington Heights, IL) for 12 h, and cells were then harvested and counted. Results were expressed as the means ⫾ SD. Retroviral transduction protocols. Retroviral vectors based on Moloney murine leukemia virus (MMLV) can only infect dividing cells (28, 29). Therefore, autologous CD4 ⫹ T cells were first activated by DCs transfected with HBV surface (HBVS) or/and core (HBVC) genes for 4 days. Activated T cells (1 ⫻ 10 6 cells/ml) were then transduced by replacing half the T cell medium with filtrated supernatants containing bcl-2-retrovirus and exposed to retroviral supernatants for 12 h at 37°C in the presence of the stimulating DCs in a 5% CO 2 incubator. The bcl-2-containing retrovirus was derived from the LXSN retroviral vector with the bcl-2 and neo cDNA under the transcriptional control of the viral long-terminal repeat promoter and SV40 promoter, respectively (39), and produced by a PG13 pack-

60

LIN AND WANG

aging cell line, with a viral titer of 1 ⫻ 10 6 infectious particles per milliliter. The multiplicity of infection used in all transduction experiments was 1. To enhance gene transfer into T cells, the following manipulations of cells and retroviral vectors were applied. (i) Phosphate depletion of cells (40): Prior to the transduction start point, cells were washed with RPMI 1640 phosphate free (GIBCO–Life Technologies) and then depleted for phosphate by incubation of cells at 1 ⫻ 10 6 cells/ml in RPMI 1640 phosphate free containing 1% autologous serum and the stimulating DCs for 12 h at 37°C. (ii) Encapsulation of retrovirus with cationic lipid (41): Viral supernatant was mixed 1:1 with 8 ␮M LipofectAMINE reagent in OPTI-MEM I, equilibrated at room temperature for 30 min, and then used for transduction. (iii) Cocentrifugation of retrovirus and T cell (42): At the beginning of transduction, the phosphate-starved T cells were cocentrifuged with encapsulated retrovirus at 2400g at 37°C for 1 h, and then transduction was allowed to proceed for another 12 h. Gene transfer analysis. The demonstration of successful gene transfer was performed by polymerase chain reaction (PCR) amplification of the proviral neo sequence in genomic DNA. At day 5 posttransduction, cells were harvested and genomic DNA was extracted by the use of a commercially available kit from Invitrogen. Genomic DNA were subjected to 30 cycles of PCR amplification (MiniCycler, MJ Research, Waltham, MA) with primers specific to the neo sequence (forward, GGTGGAGAGGCTATTCGGCTATGA; reverse, ATCCTGATCGACAAGACCGGCTTC) and quantified by an automated DNA analyzer (UVP, ImageStore 7500). Conditions used for PCR amplification were as follows: a total of 30 cycles of amplification, each cycle with denaturation (at 94°C for 2 min), annealing (at 59°C for 1 min), and elongation (at 72°C for 2 min); a final reaction at 72°C for 5 min; and then a slow cooling to 4°C. The PCR amplification of ␤-actin was used to normalize the levels of the neo proviral sequence. The primers for ␤-actin were forward, ATGGCCACGGCTGCTTCCAGC, and reverse, CATGGTGGTGCCGCCAGACAG. The amplified products were analyzed on 2% ethidium bromide agarose gels. The authenticity of the amplified products was confirmed by DNA sequencing. Expression of transgenes. Bcl-2 transgene expression was examined by reverse transcriptase (RT)linked PCR analysis of transcription products. Total cellular RNA from transduced T cells was isolated using the Ultraspec reagent (Biotecx Laboratories, Houston, TX) according to the manufacturer’s instructions. The first-strand cDNA was synthesized with GeneAmp (Perkin–Elmer, Palo Alto, CA) according to the manufacturer’s instructions with the reverse primer specific to the bcl-2. The cDNA was amplified by PCR with

specific primers to indicate its derivation from the vector sequence (forward, TTGATGAAGCTTTGGGTTTGCC, which is specific to the vector ␺ sequence; reverse, CCGCATGCTGGGGCCGTACAGTTCC, which is specific to the bcl-2). The authenticity of the amplified products was confirmed by DNA sequencing. For assay expression of the lacZ reporter gene, cells were washed once with PBS and fixed with 1% formaldehyde/0.2% glutaraldehyde (Sigma Chemical Co., St. Louis, MO) in PBS for 10 min at room temperature. Fixed cells were rinsed twice with PBS and stained with X-Gal substrate solution (Sigma) for 6 h. The percentage of blue cells was assessed using light microscopy. In vitro cell death assays. HBV-specific T cells were activated and transduced with bcl-2 or a control retrovirus (containing methylmalonyl-CoA mutase cDNA instead of bcl-2) as described above. Four days posttransduction, activated T cells were isolated with antiCD25 antibodies and magnetic beads (Dynal), according to the manufacturer’s instructions. To assay the induction of cell death by IL-2 withdrawal, 3–5 ⫻ 10 5 CD25 ⫹ T cells were cultured in 1 ml of medium for 4 days without an IL-2 supplement. At daily intervals, the levels of T cell survival were assessed by the trypan blue excretion method. For the assay of TGF-␤-induced apoptosis, experiments were carried out in the presence of 2 U/ml of IL-2 (PeproTech) and 25 ng/ml of TGF-␤ (PeproTech). Cytokine production assay. T cells that survived IL-2 withdrawal were expanded for 3 days in the presence of 50 U/ml of IL-2. After expansion, T cells (10 6 cells/ml) were restimulated with HBVS/C- or VP1transfected DCs for 48 h, and the conditioned medium was collected and assayed for IFN-␥ production using a commercial ELISA kit (R&D Systems, Wiesbaden, Germany). The minimum detection limit was 15 pg/ml. RESULTS

HBV-transfected DCs stimulate a specific T cell response. The induction and expansion of antigen-specific T cells requires APCs presenting well-defined epitopes. To generate such APCs, a cationic lipid, LipofectAMINE PLUS, was used to transfect DCs differentiated from human PBMCs with antigen-encoding plasmid DNA. The surface and core proteins of HBV were used as model antigens. Expression of the transgenes in HBV gene-modified DCs was established at the mRNA level by RT–PCR (data not shown). To evaluate the proportion of DCs that was transfected, DCs were transfected with a plasmid encoding ␤-galactosidase and stained for ␤-galactosidase activity using XGal. A transfection efficiency of 18 ⫹ 4% was obtained. In addition, transfected DCs were equivalent to un-

GENE TRANSFER INTO DC-ACTIVATED T CELLS

treated DCs at stimulating the proliferation of allogeneic T cells (data not shown), indicating that the transfection did not affect the immunostimulatory potential of DCs. In response to antigen stimulation, antigen-specific T cells exhibit extensive clonal expansion. Thus, to determine the ability of HBV-transfected DCs to activate HBV-specific CD4 ⫹ T cells, HBV-transfected DCs were cocultured with autologous CD4 ⫹ T cells from HBV-negative donors, and the proliferation of autologous T cells was analyzed after 5 days by [ 3H]thymidine incorporation. As controls, the CD4 ⫹ T cells were cultured alone or cocultured with mock-transfected DCs. Compared to that of control cells, autologous CD4 ⫹ T cells stimulated by DCs transfected with either HBV gene displayed increased incorporation of [ 3H]thymidine (P ⬍ 0.05); a more profound proliferation of CD4 ⫹ T cells was observed when DCs transfected with both HBVS and HBVC (HBVS/C) were used as stimulators (P ⬍ 0.01) and the responder/ stimulator (R/S) ratio was increased to 40 (Fig. 1). These results demonstrate that HBV-transfected DCs stimulate a specific T cell response. Retroviral vector selectively transduces DC-activated autologous CD4 ⫹ T cells. Retroviral vectors based on MMLV only infect dividing cells. We then investigated whether retroviral vectors could selectively transduce HBV-specific T cells, which specifically proliferated in response to HBV antigen stimulation within a polyclonal population, as shown in Fig. 1. A retroviral vector containing both bcl-2 and neo genes was used. Four days after initial stimulation with HBVS/C-transfected DCs, autologous CD4 ⫹ T cells were transduced with the bcl-2-retrovirus. T cells cultured alone or activated with mock-transfected DCs were also transduced to serve as controls. Because the retroviral vector contains the neo gene, a PCR analysis of the neo proviral sequence was used to demonstrate successful gene transfer, and a representative result is shown in Fig. 2. The intensity of the PCR signal amplified from the genomic DNA of transduced T cells stimulated with HBVS/C-transfected DCs was higher than that of controls. This PCR amplification result correlated with that of DC-activated T cell proliferation, indicating that DC-activated CD4 ⫹ T cells were selectively transduced. HBVS/C–DC-activated and bcl-2-transduced CD4 ⫹ T cells resist IL-2 withdrawal and respond specifically to HBV antigens. To demonstrate that the HBV-specific CD4 ⫹ T cells were indeed transduced, the following manipulations of T cells were carried out. CD4 ⫹ T cells activated by HBVS/C-transfected DCs were transduced with the bcl-2-retrovirus or a control retrovirus, and then activated T cells were isolated from the transduced bulk population with antibodies to CD25 activa-

61

FIG. 1. Stimulation of autologous CD4 ⫹ T cell proliferation by HBV-transfected DCs. Autologous CD4 ⫹ T cells were incubated with mock- or HBV-transfected DCs at a responder/stimulator (R/S) ratio of 20 for 4 days, except as indicated. At day 5, T cell proliferation was quantified by [ 3H]thymidine incorporation. Each experiment had three replicates and was repeated five times. The results are expressed as means ⫹ SD.

tion molecules and magnetic beads. Compared to bulk culture, the bcl-2-transduced CD25 ⫹ cells contained more neo proviral sequences (Fig. 2), confirming that CD4 ⫹ T cells activated by HBVS/C-transfected DCs were selectively transduced. Subsequently, both CD25 ⫹ and nonspecific CD25 ⫺ T cells were subjected to IL-2 withdrawal to select for bcl-2-transduced cells, since it was reported that bcl-2-expressing T cells could resist IL-2 withdrawal (43). After 4 days of IL-2 withdrawal, live CD25 ⫺ or mock-infected CD25 ⫹ cells were rarely detected. In contrast, almost 70% of bcl-2-transduced CD25 ⫹ cells were alive, estimated by the trypan blue excretion method (Fig. 3). Results were confirmed by propidium iodide uptake and FACScan analysis (data not shown). These data were in parallel with the levels of bcl-2 expression determined by a RT–PCR analysis (Fig. 4). The detected bcl-2 transcripts were derived from integrated vectors, since primers specific to the vector ⌿ sequences and bcl-2 sequence were used. As expected, the surviving CD25 ⫹ cells expressed bcl-2 at the highest levels and had the largest amount of neo PCR product (Figs. 2, 4). Altogether, these data indicate that the survived CD25 ⫹/CD4 ⫹ T cells are composed of bcl-2-transduced activated T cells and that IL-2 withdrawal can be used for the selection of bcl-2transduced T cells. Finally, this bcl-2-enriched T cell population was restimulated with DCs transfected with HBVS/C or the VP1 gene of swine vesicular disease virus for 48 h, and

62

LIN AND WANG

FIG. 2. PCR analysis of the neo proviral sequence of transduced CD4 ⫹ T cells. Autologous CD4 ⫹ T cells were first stimulated with mock- or HBVS/C-transfected DCs at a R/S ratio of 40 for 4 days and then transduced with bcl-2-retrovirus. Four days posttransduction, genomic DNA was extracted from transduced CD4 ⫹ T cells and subjected to PCR amplification. (A) A representative result of PCR analysis. (B) A densitometer and the ImageQuant software were used to measure the intensity of specific DNA bands. The intensity of each band was normalized to that of the corresponding ␤-actin band. The increase of the proviral sequence is shown as the ratio of the normalized band intensity of the indicated sample to the normalized intensity of the relevant band in the “none” control. Negative, nontransduced T cells; none, T cells not activated; CD25 ⫹, CD25 ⫹ T cells isolated from transduced bulk culture; survived, CD25 ⫹ T cells surviving from IL-2 withdrawal.

FIG. 3. In vitro cell survival assay. Autologous CD4 ⫹ T cells were first stimulated with HBVS/C-transfected DCs at a R/S ratio of 40 for 4 days and then transduced. Four days posttransduction, CD25 ⫹ T cells were isolated from mock-infected (open circles) or bcl-2-transduced (solid circles) bulk culture. Subsequently, CD25 ⫹ T cells and CD25 ⫺ T cells (open squares) from bcl-2-transduced bulk culture were cultured in medium without IL-2 suppzlement for 0 – 4 days to assess cell survival.

involving inhibition of IL-2 receptor ␣- and ␤-chain expression, Jak-1 kinase, and Stat-5 activity (47– 49). Collectively, it is reasonable to hypothesize that the effect of TGF-␤ on activated T cells is similar to that of

the conditioned medium was then collected and assayed for IFN-␥ production. In response to HBV antigen restimulation, surviving CD25 ⫹/CD4 ⫹ T cells produced larger quantities of IFN-␥ and displayed profound [ 3H]thymidine incorporation (P ⬍ 0.01) (Fig. 5). The specificity of this IFN-␥ production and [ 3H]thymidine incorporation was confirmed by the poor ability of VP1-transfected DCs to do so. These antigen-specific responses demonstrate that the surviving bcl-2-transduced CD25 ⫹/CD4 ⫹ T cells are indeed HBV-specific T cells. TGF-␤-induced apoptosis is reduced in bcl-2-transduced HBV-specific CD4 ⫹ T cells. TGF-␤ induces apoptosis in activated T cells (44, 45). Consistent with these data, in a previous study, we showed that TGF-␤ induced apoptosis in CD4 ⫹ T cells activated by allogeneic DCs (46). Other studies demonstrate that TGF-␤mediated immunosuppression is linked to the impairment of the IL-2 receptor signal transduction pathway,

FIG. 4. Analysis of bcl-2 expression in transduced CD25 ⫹ T cells by RT–PCR. (A) A representative result of RT–PCR analysis. (B) Increase of transgene expression. Data were manipulated as described for Fig. 2 and relative to that of CD25 ⫹/bcl-2 cells.

GENE TRANSFER INTO DC-ACTIVATED T CELLS

FIG. 5. Antigen-specific cell proliferation and IFN-␥ secretion by surviving CD25 ⫹ T cells. IFN-␥ secretion (white bars) was measured 48 h after restimulation and cell proliferation (black bars) was assessed by [ 3H]thymidine incorporation 4 days after restimulation. Each experiment had three replicates and was repeated five times. The results are expressed as means ⫹ SD.

IL-2 withdrawal. Thus, Bcl-2 overexpression might protect activated CD4 ⫹ T cells form TGF-␤-mediated apoptosis. To test this, mock-infected and bcl-2-transduced CD25 ⫹/CD4 ⫹ HBV-specific T cells were treated with 25 ng/ml of TGF-␤ for 3 days in the presence of 2 U/ml of IL-2, and cell viability was then measured. As shown in Fig. 6, bcl-2-transduced HBV-specific T cells exhibited enhanced survival upon exposure to TGF-␤ (P ⬍ 0.05). Results were confirmed by propidium iodide uptake and FACScan analysis (data not shown).

63

ery method in the preparation of HBV antigen-loaded DCs, which is convenient, flexible, and suitable for preparing APCs for ex vivo generation of virus-specific T cells because most viral genes have been cloned. These HBV gene-modified DCs activated a specific CD4 ⫹ T cell response. The explanation for the activation of a specific CD4 ⫹ T cell response by endogenously expressed antigens comes from the observation that endogenously expressed antigens that have access to the endoplasmic reticulum can also gain access, to a limited extent, to the class II presentation pathway (55). The identification of tumor antigens depends on the ability to generate human T cells capable of recognizing cancer cells. In a technique referred to as reverse immunology, in vitro sensitization techniques are used to generate T cells that are reactive against specific candidate antigens. If these in vitro generated T cells can specifically recognize intact human cancer cells, the candidate antigen is considered to be a tumor antigen (56). To permit identification of class II-restricted human tumor antigens, human CD4 ⫹ T cells are in vitro activated by APCs transfected with candidate genes fused to genes encoding invariant chain sequences designed to guide the transfected proteins into the class II presentation pathway (56). Our results might facilitate the progress in this field by providing an alternative method for the recovery of antigen-specific human CD4 ⫹ T cells from bulk culture. Usually, to enrich in vitro generated antigen-specific T cells, au-

DISCUSSION

Taking advantage of the selective targeting property of retroviral vector to dividing cells, we demonstrate that HBV-specific T cells activated by HBV gene-modified DCs can be selectively modified with bcl-2 in the sensitization phase. By changing the antigens loaded into DCs and genes expressed by retroviral vector, this system can be adapted to rapidly equip various antigen-specific T cell characteristics that can enhance their therapeutic effect. The uses of retroviral vector and DCs have already been validated for clinical applications (50 –52). Compared to preparation of other APCs, the generation of DCs is a clinically manageable process, in which mature DCs can be generated from patients by culturing adherent PBMCs for 10 days in the presence of cytokines (51, 52), and the loading of DCs with antigen is easy and well established (11, 12, 53, 54). In this study, we adopted a cationic lipidmediated DNA transfection of DC as the antigen deliv-

FIG. 6. Resistance to TGF-␤-induced cell death by bcl-2-transduction. Mock- (white bars) and bcl-2-transduced (black bars) CD25 ⫹/CD4 ⫹ T cells were obtained as described for Fig. 3. Then, in the presence of 2 U/ml of IL-2, cells were treated with 0 (control cells) or 25 ng/ml of TGF-␤ for 3 days to assess cell survival. Each experiment had three replicates and was repeated four times. The results are expressed as means ⫹ SD.

64

LIN AND WANG

tologous T cells are cultured in the presence of Epstein–Barr virus (EBV)-transformed B cells or antigenloaded DCs for at least 4 –5 weeks to adequately deplete contaminating nonspecific T cells (9, 11). In contrast, we showed that the combined use of retroviral-mediated bcl-2 gene transfer and IL-2 withdrawal can rapidly enrich HBV-specific T cells within 4 days, and these enriched T cells maintained their response to antigen restimulation. Compared to other described purification methods (9, 57–59), our strategy does not require sophisticated equipment such as that for flow cytometry. However, as a method for enriching antigen-specific T cells for adoptive therapy, the oncogenic nature of Bcl-2 raises a safety concern. To our knowledge, spontaneous transformation of T cells in bcl-2 transgenic mice is minimal, and bcl-2-transgenic T cells remain sensitive to Fas-mediated apoptosis (35, 60). Furthermore, through the use of a retrovirus that incorporates an inducible promoter to regulate bcl-2 expression and a safety control, such as a suicide gene, the safety issue about the utilization of bcl-2-transduced T cells could be significantly improved. If this safety issue can be resolved, bcl-2-transduced antigenspecific T cells might have other advantages. In sepsis, extended T cell apoptosis was observed. Transgenic mice in which bcl-2 was overexpressed in T cells had complete protection against sepsis-induced T cell apoptosis and survived sepsis (36). In solid tumors, hypoxia is prevailing (61). The protein product Bcl-2 can prevent apoptotic cell death caused by hypoxia (34, 43). Thus, adoptive transfer of bcl-2-transduced antigen-specific T cells might provide clinical benefits to these clinical conditions, in addition to the prevention of T cell death secondary to IL-2 withdrawal and TGF-␤ exposure. The results of this study establish a general approach to selectively modifying antigen-specific T cells. In practicing such an approach, it will be critical not only to evaluate the transduction of all T cells specific to the antigen in order to maintain multispecificity, but also to consider the possible consequence of enhanced susceptibility to autoimmune diseases because of the controversy in the potential of DC immunization to induce autoimmune responses (15, 62, 63). To modify all antigen-specific T cells requires highly efficient retroviral-mediated gene transfer. A transduction efficiency of 35% was obtained for HBVS/C-activated autologous CD4 ⫹ T cells in this study, estimated by a semiquantitative PCR analysis of the proviral neo sequence in CD25 ⫹ T cells (data not shown). This can be improved to make genetic modification of all antigenspecific T cells feasible, in view of a 95% T cell transduction efficiency that is now achieved in human primary T cells (64). Under the conditions used in our experiments, small numbers of T cells reactive to other antigens were indeed transduced. The answer to this

concern might reside in the utilization of a bicistronic retroviral vector that integrates a suicide gene as a safety control. Finally, this study finds a special niche for retroviral vectors in the selective modification of antigen-specific T cells. REFERENCES 1. Rosenberg, S. A., Immunotherapy and gene therapy of cancer. Cancer Res. 51, 5074s–5079s, 1991. 2. Melief, C. J., and Kast, W. M., T cell immunotherapy of tumors by adoptive transfer of cytotoxic T lymphocytes and by vaccination with minimal essential epitopes. Immunol. Rev. 145, 167– 177, 1995. 3. Riddell, S. R., and Greenberg, P. D., Principles for adoptive T cell therapy of human viral diseases. Annu. Rev. Immunol. 13, 545– 586, 1995. 4. Ettinghausen, S. E., and Rosenberg, S. A., Immunotherapy and gene therapy of cancer. Adv. Surg. 28, 223–254, 1995. 5. Mizoguchi, H., O’Shea, J. J., Longo, D. L., Loeffler, C. M., McVicar, D. W., and Ochoa, A. C., Alterations in signal transduction molecules in T lymphocytes from tumor-bearing mice. Science 258, 1795–1798, 1992. 6. Nakagomi, H., Petersson, M., Magnusson, I., Juhlin, C., Matsuda, M., Mellstedt, H., Taupin, J. L., Vivier, E., Anderson, P., and Kiessling, R., Decreased expression of the signal-transducing zeta chains in tumor-infiltrating T cells and NK cells of patients with colorectal carcinoma. Cancer Res. 53, 5610 –5612, 1993. 7. Matsuda, M., Petersson, M., Lenkei, R., Taupin, J. L., Magnusson, I., Mellstedt, H., Anderson, P., and Kiessling, R., Alterations in the signal-transducing molecules of T cells and NK cells in colorectal tumor-infiltrating, gut mucosal and peripheral lymphocytes: Correlation with the stage of the disease. Int. J. Cancer 61, 765–772, 1995. 8. Heslop, H. E., Ng, C. Y. C., Li, C., Smith, C. A., Loftin, S. K., Krance, R. A., Brenner, M. K., and Rooney, C. M., Long-term restoration of immunity against Epstein–Barr virus infection by adoptive transfer of gene-modified virus-specific T lymphocytes. Nature Med. 2, 551–555, 1996. 9. Koehne, G., Gallardo, H. F., Sadelain, M., and O’Reilly, R. J., Rapid selection of antigen-specific T lymphocytes by retroviral transduction. Blood 96, 109 –117, 2000. 10. Latouche, J.-B., and Sadelain, M., Induction of human cytotoxic T lymphocytes by artificial antigen-presenting cells. Nat. Biotechnol. 18, 405– 409, 2000. 11. Kleihauer, A., Grigoleit, U., Hebart, H., Moris, A., Brossart, P., Muhm, A., Stevanovic, S., Rammensee, H. G., Sinzger, C., Reieglor, S., Jahn, G., Kanz, L., and Einsele, H., Ex vivo generation of human cytomegalovirus-specific cytotoxic T cells by peptide-pulsed dendritic cells. Brit. J. Haematol. 113, 231–239, 2001. 12. Hoffmann, T. K., Meidenbauer, N., Dworacki, G., Kanaya, H., and Whiteside, T. L., Generation of tumor-specific T lymphocytes by cross-priming with human dendritic cells ingesting apoptotic tumor cells. Cancer Res. 60, 3542–3549, 2000. 13. Jenne, L., Arrighi, J.-F., Jonuleit, H., Saurat, J.-H., and Hauser, C., Dendritic cells containing apoptotic melanoma cells prime human CD8 ⫹ T cells for efficient tumor cell lysis. Cancer Res. 60, 4446 – 4452, 2000. 14. Nouri-Shirazi, M., Banchereau, J., Bell, D., Burkeholder, S., Kraus, E. T., Davoust, J., and Palucka, K. A., Dendritic cells capture killed tumor cells and present their antigens to elicit

GENE TRANSFER INTO DC-ACTIVATED T CELLS

15.

16.

17.

18.

19.

20. 21.

22.

23.

24.

25. 26.

27.

28.

29.

30.

31.

tumor-specific immune responses. J. Immunol. 165, 3797–3803, 2000. Heiser, A., Maurice, M. A., Yancey, D. R., Coleman, D. M., Dahm, P., and Vieweg, J., Human dendritic cells transfected with renal tumor RNA stimulate polyclonal T-cell responses against antigens expressed by primary and metastatic tumors. Cancer Res. 61, 3388 –3393, 2001. Muller, L., Provenzani, C., Faul, C., and Pawelec, G., Recognition of chronic myelogenous leukemia cells by autologous T lymphocytes primed in vitro against the patient’s dendritic cells. Brit. J. Haematol. 112, 740 –748, 2001. Gong, J., Chen, D., Kashiwaba, M., Li, Y., Chen, L., Takeuchi, H., Qu, H., Rowse, G. J., Gendler, S. J., and Kufe, D., Reversal of tolerance to human MUC1 antigen in MUC1 transgenic mice immunized with fusions of dendritic and carcinoma cells. Proc. Natl. Acad. Sci. USA 95, 6279 – 6283, 1998. Shimizu, Y., Guidotti, L. G., Fowler, P., and Chisari, F. V., Dendritic cell immunization breaks cytotoxic T lymphocyte tolerance in hepatitis B virus transgenic mice. J. Immunol. 161, 4520 – 4529, 1998. Doan, T., Herd, K. A., Lambert, P. F., Fernando, G. J. P., Street, M. D., and Tindle, R. W., Peripheral tolerance to human papillomavirus E7 oncoprotein occurs by cross-tolerization, is largely Th-2-independent, and is broken by dendritic cell immunization. Cancer Res. 60, 2810 –2815, 2000. Zhang, L., The fate of adoptively transferred antigen-specific T cells in vivo. Eur. J. Immunol. 26, 2208 –2214, 1996. Brodie, S., Lewinsohn, D., Patterson, B., Jiyamapa, D., Krieger, J., Corey, L., Greeberg, P., and Riddell, S., In vivo migration and function of HIV-1-specific cytotoxic T cells. Nat. Med. 5, 34 – 41, 1999. Mckinney, D. M., Lewinsohn, D. A., Riddell, S. R., Greenberg, P. D., and Mosier, D. E., The antiviral activity of HIV-specific CD8 ⫹ CTL clone is limited by elimination due to encounter with HIV-infected targets. J. Immunol. 163, 861– 867, 1999. Duke, R. C., and Cohen, J. J., IL-2 addiction: Withdrawal of growth factor activates a suicide program in dependent T cells. Lymphokine Res. 5, 289 –299, 1986. Lenardo, M., Chan, F. K. M., Hornung, F., Mcfarland, H., Siegel, R., Wang, J., and Zheng, L., Mature T lymphocyte apoptosisimmune regulation in a dynamic and unpredictable antigenic environment. Annu. Rev. Immunol. 17, 221–253, 1999. Pasche, B., Role of transforming growth factor-␤ in cancer. J. Cell. Physiol. 186, 153–168, 2001. Gorelik, L., and Flavell, R. A., Immune-mediated eradication of tumors through the blockade of transforming growth factor-␤ signaling in T cells. Nat. Med. 7, 1118 –1122, 2001. Liu, K., and Rosenberg, S. A., Transduction of an IL-2 gene into human melanoma-reactive lymphocytes results in their continued growth in the absence of exogenous IL-2 and maintenance of specific antitumor activity. J. Immunol. 167, 6356 – 6365, 2001. Miller, D. G., Adam, M. A., and Miller, A. D., Gene transfer by retrovirus vectors occurs only in cells that are actively replicating at the time of infection. Mol. Cell. Biol. 10, 4239 – 4242, 1990. Roe, T., Reynolds, T. C., Yu, G., and Brown, P. O., Integration of murine leukemia virus DNA depends on mitosis. EMBO J. 12, 2099 –2018, 1993. Kalams, S. A., and Walker, B. D., The critical need for CD4 help in maintaining effective cytotoxic T lymphocyte response. J. Exp. Med. 188, 2199 –2204, 1998. Toes, R. E., Ossendrop, F., Offringa, R., and Melief, C. J., CD4 T cells and their role in antitumor immune responses. J. Exp. Med. 189, 753–756, 1999.

65

32. Frey, A. B., Rat mammary adenocarcinoma 13762 expressing IFN-gamma elicits antitumor CD4 ⫹ MHC class II-restricted T cells that are cytotoxic in vitro and tumoricidal in vivo. J. Immunol. 154, 4613– 4622, 1995. 33. Mumberg, D., Monach, P. A., Wanderling, S., Philip, M., Toledano, A. Y., Schreiber, R. D., and Schreiber, H., CD4 ⫹ T cells eliminate MHC class I-negative cancer cells in vivo by indirect effects of IFN-␥. Proc. Natl. Acad. Sci. USA 96, 8633– 8638, 1999. 34. Kroemer, G., The proto-oncogene Bcl-2 and its role in regulating apoptosis. Nat. Med. 3, 614 – 619, 1997. 35. Parijs, L. V., Peterson, D. A., and Abbas, A. K., The Fas/Fas ligand pathway and Bcl-2 regulate T cell responses to model self and foreign antigens. Immunity 8, 265–274, 1998. 36. Hotchkiss, R. S., Swanson, P. E., Knudson, C. M., Chang, K. C., Cobb, J. P., Osborne, D. F., Zollner, K. M., Buchman, T. G., Korsmeyer, S. J., and Karl, I. E., Overexpression of Bcl-2 in transgenic mice decreases apoptosis and improved survival in sepsis. J. Immunol. 162, 4148 – 4156, 1999. 37. Reddy, A., Sapp, M., Feldman, M., Subklewe, M., and Bhardwaj, N., A monocyte conditioned medium is more effective than defined cytokines in mediating the terminal maturation of human dendritic cells. Blood 90, 3640 –3646, 1997. 38. Rughetti, A., Biffoni, M., Sabbatucci, M., Rahimi, H., Pellicciotta, I., Fattorossi, A., Pierelli, L., Scambia, G., Lavitrano, M., Frati, L., and Nuti, M., Transfected human dendritic cells to induce antitumor immunity. Gene Ther. 7, 1458 –1466, 2000. 39. Miller, A. D., and Rosman, G. J., Improved retroviral vectors for gene transfer and expression. Biotechniques 7, 980 –988, 1989. 40. Bunnell, B. A., Muul, L. M., Donahue, R. E., Blaese, R. M., and Morgan, R. A., High-efficiency retroviral-mediated gene transfer into human and nonhuman primate peripheral blood lymphocytes. Proc. Natl. Acad. Sci. USA 92, 7739 –7743, 1995. 41. Hodgson, C. P., and Solaiman, F., Virosomes: Cationic liposomes enhance retroviral transduction. Nat. Biotechnol. 14, 339 –342, 1996. 42. Bahnson, A. B., Dunigan, J. T., Baysal, B. E., Mohney, T., Atchison, R. W., Nimgaonkar, M. T., Ball, E. D., and Barranger, J. A., Centrifugal enhancement of retroviral-mediated gene transfer. J. Virol. Methods 54, 131–143, 1995. 43. Cory, S. (1995) Regulation of lymphocyte survival by the bcl-2 gene family. Annu. Rev. Immunol. 13, 513–543, 1995. 44. Mendez-Samperio, P., Hernandez-Garay, M., and Garcia-Martinez, E., Induction of apoptosis in Bacillus Calmette-Guerinactivated T cells by transforming growth factor-␤. Cell. Immunol. 202, 103–112, 2000. 45. Sillett, H. K., Cruickshank, S. M., and Trejdosiewicz, L. K., Transforming growth factor-␤ promotes death by neglect in postactivated human T cells. Immunology 102, 310 –316, 2001. 46. Lin, C.-M., Wang, F.-W., and Lee, P.-K., Activated human CD4 ⫹ T cells induced by dendritic cell stimulation are most sensitive to transforming growth factor-␤: Implications for dendritic cell immunization against cancer. Clin. Immunol. 102, 96 –105, 2002. 47. Santambrogio, L., Hochwald, G. M., Saxena, B., Leu, C., Martz, J. E., Carlino, J. A., Ruddle, N. H., Palladino, M. A., Gold, L. I., and Thorbecke, G. J., Studies on the mechanisms by which transforming growth factor-␤ (TGF-␤) protects against allergic encephalomyelitis. J. Immunol. 151, 1116 –1127, 1993. 48. Bright, J. J., Ker, L. D., and Sriram, S., TGF-␤ inhibits IL-2induced tyrosine phosphorylation and activation of Jak-1 and Stat 5 in T lymphocytes. J. Immunol. 159, 175–183, 1997. 49. Cook, G., Campbell, J. D. M., Carr, C. E., Boyd, K. S., and Franklin, I. M., Transforming growth factor ␤ from multiple myeloma cells inhibits proliferation and IL-2 responsiveness in T lymphocytes. J. Leukocyte Biol. 66, 981–988, 1999.

66

LIN AND WANG

50. Cavazzana-Calvo, M., Hacein-Bey, S., De Saint Basile, G., Gross, F., Yvon, E., Nusbaum, P., Selz, F., Hue, C., Certain, S., Casanova, J. L., Bousso, P., Deist, F. L., and Fischer, A., Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288, 669 – 672, 2000. 51. Hsu, F. J., Benike, C., Fagnoni, F., Liles, T. M., Czerwinski, D., Taidi, B., Engleman, E. G., and Levy, R., Vaccination of patients with B-cell lymphoma using autologous antigen-pulsed dendritic cells. Nat. Med. 2, 52–58, 1996. 52. Nestle, F. O., Alijagic, S., Gilliet, M., Sun, Y., Grabbe, S., Dummer, R., Burg, G., and Schadendorf, D., Vaccination of melanoma patients with peptide- or tumor lysate-pulsed dendritic cells. Nat. Med. 4, 328 –332, 1998. 53. Kirk, C. J., and Mule, J. J., Gene-modified dendritic cells for use in tumor vaccines. Hum. Gene Ther. 11, 797– 806, 2000. 54. Kugler, A., Stuhler, G., Walden, P., Zoller, G., Zobywalski, A., Brossart, P., Trefzer, U., Ullrich, S., Muller, C. A., Becker, V., Gross, A. J., Hemmerlein, B., Kanz, L., Muller, G. A., and Ringert, R.-H., Regression of human metastatic renal cell carcinoma after vaccination with tumor cell-dendritic cell hybrids. Nat. Med. 6, 332–336, 2000. 55. Lechler, R., Aichinger, G., and Lightstone, L., The endogenous pathway of MHC class II antigen presentation. Immunol. Rev. 151, 51–79, 1996. 56. Rosenberg, S. A., Progress in human tumour immunology and immunotherapy. Nature 411, 380 –384, 2001. 57. Altman, J. D., Moss, P. A. H., Goulder, P. J. R., Barouch, D. H., McHeyzer-Williams, M. G., Bell, J. I., McMichael, A. J., and Davis, M. M., Phenotypic analysis of antigen-specific T lymphocytes. Science 274, 94 –96, 1996. 58. Brosterhus, H., Brings, S., Leyendeckers, H., Manz, R. A., Miltenyi, S., Radbruch, A., Assenmacher, M., and Scmitz, J., Received February 11, 2002; accepted with revision April 26, 2002

59.

60.

61.

62.

63.

64.

Enrichment and detection of live antigen-specific CD4 ⫹ and CD8 ⫹ T cells based on cytokine secretion. Eur. J. Immunol. 29, 4053– 4059, 1999. Gallot, G., Vivien, R., Ibisch, C., Lule, J., Davrinche, C., Gaschet, J., and Vie, H., Purification of Ag-specific T lymphocytes after direct peripheral blood mononuclear cell stimulation followed by CD25 selection. I. Application to CD4 ⫹ and CD8 ⫹ cytomegalovirus phosphoprotein pp65 epitope determination. J. Immunol. 167, 4196 – 4206, 2001. Strasser, A., Harris, A. W., and Cory, S., E␮-bcl-2 transgene facilitates spontaneous transformation of early pre-B and immunoglobulin-secreting cells but not T cells. Oncogene 8, 1–9, 1993. Dang, L. H., Bettegowda, C., Huso, D. L., Kinzler, K. W., and Vogelstein, B., Combination bacteriolytic therapy for the treatment of experimental tumors. Proc. Natl. Acad. Sci. USA 98, 15155–15160, 2001. Ludewig, B., Ochsenbein, A. F., Odermatt, B., Paulin, D., Hengartner, H., and Zinkernagel, R. M., Immunotherapy with dendritic cells directed against tumor antigens shared with normal host cells results in severe autoimmune disease. J. Exp. Med. 191, 795– 803, 2000. Nair, S. K., Heiser, A., Boczkowski, D., Majumdar, A., Naoe, M., Lebkowski, J. S., Vieweg, J., and Gilboa, E., Induction of cytotoxic T cell responses and tumor immunity against unrelated tumors using telomerase reverse transcriptase RNA transfected dendritic cells. Nat. Med. 6, 1011–1017, 2000. Movassagh, M., Boyer, O., Burland, M.-C., Leclercq, V., Klatzmann, D., and Lemoine, F. M., Retrovirus-mediated gene transfer into T cells: 95% transduction efficiency without further in vitro selection. Hum. Gene Ther. 11, 1189 –1200, 2000.