- Email: [email protected]
SENP1 inhibits the IH-induced apoptosis and nitric oxide production in BV2 microglial cells
Biochemical and Biophysical Research Communications 467 (2015) 651e656
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
SENP1 inhibits the IH-induced apoptosis and nitric oxide production in BV2 microglial cells Song Liu a, *, Zhong-hua Wang b, Bo Xu c, Kui Chen d, Jin-yuan Sun a, Lian-ping Ren a a
Department of Respiratory Medicine, Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai, 200092, China Department of Medical Oncology, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 200032, China c Department of Respiratory Medicine, Beijing Friendship Hospital, Capital Medical University, Beijing, 100050, China d Department of Neurology, Beijing Friendship Hospital, Capital Medical University, Beijing, 100050, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 October 2015 Accepted 19 October 2015 Available online 21 October 2015
To reveal SUMOylation and the roles of Sentrin-specific proteases (SENP)s in microglial cells under Intermittent hypoxia (IH) condition would provide more intensive view of understanding the mechanisms of IH-induced central nervous system (CNS) damage. Hence, in the present study, we detected the expression levels of SENPs in microglial cells under IH and normoxia conditions via RT-PCR assay. We found that SENP1 was significantly down-regulated in cells exposure to IH. Subsequently, the effect of IH for the activation of microglia and the potential roles of SENP1 in the SENP1-overexpressing cell lines were investigated via Western blotting, RT-PCR and Griess assay. The present study demonstrated the apoptosis-inducing and activating role of IH on microglia. In addition, we revealed that the effect of IH on BV-2 including apoptosis, nitric oxide synthase (iNOS) expression and nitric oxide (NO) induction can be attenuated by SENP1 overexpression. The results of the present study are of both theoretical and therapeutic significance to explore the potential roles of SENP1 under IH condition and elucidated the mechanisms underlying microglial survival and activation. © 2015 Elsevier Inc. All rights reserved.
Keywords: Intermittent hypoxia Microglia SENP1 CNS damage
1. Introduction Intermittent hypoxia (IH), as a hallmark of obstructive sleep apnea, has been reported that could induce oxidative stress [1] and inflammation [2]. The long-term IH will result in neuronal cell death [3] and eventually central nervous system (CNS) degeneration. CNS impairments arising from neuronal apoptosis in the learning and memory regions of the brain bring to significant cognitive and behavioral deficits [1,4,5]. Several studies have focused on the roles of IH in multiple pathophysiological processes. However, the molecular mechanisms underlying the IH-induced neuronal apoptosis remain largely unknown. It has been reported that IH induces the activation of microglial cells [5]. Microglial cells in CNS are macrophage-like resident immune cells, which can be activated upon trauma, stroke and infection through responding to various cellular factors, including cytokines, chemokines, nitric oxide (NO), and reactive oxygen
* Corresponding author. E-mail address: [email protected] (S. Liu). http://dx.doi.org/10.1016/j.bbrc.2015.10.092 0006-291X/© 2015 Elsevier Inc. All rights reserved.
intermediates [6e8]. Microglial cells show a ‘resting’ phenotype characterized by ramified morphology in the healthy adult CNS [9]. It plays important role in the maintenance and resolution of brain tissue homeostasis [10], as well as clearance of dead cells and secretion of neurotrophins in the normal conditions [11]. While in the pathological conditions, microglial cells are activated for increasing the production of inflammatory cytokines [12]. Further, the hyper-activated microglial cells will activate the surrounding normal microglia and propagate the production of proinflammatory factors via a feed-forward manner [13]. Besides, IH induces the expression of nitric oxide synthase (iNOS) to produce reactive nitrogen species and abnormal high levels of glutamate, which ultimately result in excitotoxicity in CNS especially in hippocampal neurons [5]. As reported, microglial cells are major sources of iNOS in the CNS neuroinflammation [14]. Additionally, iNOS has been shown that was expressed in microglia upon ischemia-induced hypoxia [12]. Taken together, identification of compounds that modulate microglial reaction under pathological conditions is highly desirable for the development of therapeutic agents [10]. SUMOylation has been shown as a modulator of hypoxic
652
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
response [15]. Sentrin-specific proteases (SENP)s are proteases that participate in the regulation of SUMOylation by generating mature small ubiquitin-related modifiers (SUMO) for protein conjugation (endopeptidase activity) and removing conjugated SUMO from targets (isopeptidase activity) [16]. So it's essential to reveal SUMOylation and the roles of SENPs in microglial cells under IH condition. Hence, uncovering the potential roles of SENPs in IH conditions would provide more intensive view of understanding the mechanisms of IH-induced CNS damage. In this study, we firstly detected the expression levels of SENPs in microglial cells under IH and normoxia conditions. We found that SENP1 was significantly down-regulated in cells exposure to IH. Subsequently, we detected the effect of IH for the activation of microglia and investigated the potential roles of SENP1 in the SENP1-overexpressing cell lines. We found the apoptosis-inducing and activating role of IH on microglia. Additionally, the effect of IH on BV-2 including apoptosis, iNOS expression and NO induction can be attenuated by SENP1 overexpression. The results of the present study are of both theoretical and therapeutic significance to explore the potential roles of SENP1 under IH condition and elucidated the mechanisms underlying microglial survival and activation. 2. Material and methods 2.1. Cell culture BV2 microglia cells were gifts from Professor Zeng-qiang Yuan (State Key Laboratory of Brain and Cognitive Science, Institute of Biophysics, Chinese Academy of Sciences). The cells were plated onto 6-well cell culture plates in Dulbecco's Modified Eagle Medium (Gibco, Grand Island, NY, USA) containing 1% penicillin and streptomycin (Invitrogen, Carlsbad, CA, USA) and 10% fetal bovine serum (Gibco, Grand Island, NY, USA) in an incubator with 5% CO2 at 37 C. Cells were fed with fresh medium for treatment 24 h after incubation.
antibody (GeneTex, San Antonio, TX, USA) was used to normalize sample loading and transfer. The intensities of the bands were quantified using NIH ImageJ software package (http://rsb.info.nih. gov/ij/). 2.4. Real-time PCR Total RNA from BV2 cells was extracted using the Trizol reagent (Invitrogen, Carlsbad, USA). Complementary DNA (cDNA) was synthesized using Takara RNA PCR kit (Japan) according to the manufacturer's instructions. Real-time PCR was performed for quantification of iNOS and SENP1 with a quantitative thermal cycler (Millipore, Billerica, MA, USA). Relative expression values were calculated as the ratio of target cDNA to GAPDH. Relative gene expression was determined by delta delta CT method (ABI, Applied Biosystems) with b-actin as the endogenous control, and the cycling program was conducted as follows: 50 C for 2 min, 95 C for 10 min and subsequent forty cycles of 95 C for 15 s, 60 C for 1 min. All data were analyzed using GraphPad Prism 5 software. The primer sequences are listed in Table 1. 2.5. Griess assay Accumulation of NO in cultured media samples was analyzed by measuring nitrite levels as described previously [17]. Briefly, fresh supernatants of the cultured cells was collected after the indicated time, and the culture supernatant (100 ml) were mixed with 100 ml Griess Reagent (equal volume of 1% sulfanilamide in 5% phosphoric acid and 0.1% naphthylethylenediamine dihydrochloride in water) (Promega, Madison, WI, USA). The amount of nitrite was calculated from a NaNO2 standard curve (0e200 mM). After 10 min incubation at room temperature, the absorbance was measured at 540 nm (Bio-Rad Laboratories, Hercules, CA, USA). The background absorbance is subtracted from the samples. Results are expressed as mM of nitrite in BV2 culture supernatant.
2.2. IH exposure 2.6. Infection of cells with SENP1 adenovirus Cultured BV-2 cells were exposed to the IH cell culture box, which is a controlled gas chamber, regulated the flow of nitrogen and oxygen. The O2 levels in the chamber were alternated between 1% and 21% for 400 s/cycle. In the control group, cells were maintained in normoxic conditions (with O2 levels of 21%). Cells were collected for future assays after exposure to IH for 8 h. 2.3. Western blot BV2 cells were harvested and lysed in radio immunoprecipitation assay (RIPA) buffer (Millipore, Temecula, CA, USA) for 30 min on ice. The protein concentration was measured by Dc Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). Samples containing 30 mg protein was separated by 10% SDS- PAGE (Invitrogen, Carlsbad, CA, USA), and then transferred to nitrocellulose membranes (Millipore, CA, USA). The membranes were incubated overnight with rabbit anti-iNOS antibody (Proteintech, Rocky Hill, NJ, USA). Rabbit polyclonal anti-SENP1antibody (Bioworld Technology Co., Ltd, Nanjing, China), rabbit anti-caspase-3 antibody, rabbit anti-caspase-8 antibody, cleaved caspase-3 antibody, cleaved caspase-8 antibody, and rabbit anti-Bax antibody, which was purchased from Cell Signaling Technology (CST) Inc. (Beverly, MA, USA), and rabbit anti-Bcl-2 antibody (Bioworld Technology Co., Ltd, Nanjing, China), then incubated with appropriate HRP-conjugated secondary antibody (Bioworld Technology Co., Ltd, Nanjing, China). After that, the blots were visualized by enhanced chemiluminescence (ECL; Santa Cruz Biotechnology). An anti b-actin
Cells were infected with SENP1 adenovirus, and then exposed to hypoxia or noxmia. Briefly, SENP1 gene amplification was used by PCR. Afterwards, the gene amplification products were inserted into the lentiviral vector pCDH and to co-transfect BV2 cells. 25,000 BV2 cells per well were seeded in 24-well plates and maintained for 24 h. 900 ml of the medium was removed from the cells leaving 100 ml on the cells onto which 2 ml of SENP1 adenovirus or 1 ml of GFP adenovirus control were added and left for 2 h before adding
Table 1 The primers used for RT-PCR assay. Primer name
Sequence
Length
iNOS-F iNOS-R SENP1-F SENP1-R SENP2-F SENP2-R SENP3-F SENP3-R SENP5-F SENP5-R SENP6-F SENP6-R SENP7-F SENP7-R
GGACGAGACGGATAGGCA AAGGGAACTCTTCAAGCACC CAGCACAGCAGAAGAGACAG TGGAACTAAGACACCGAGACA GCCAAAAGGCCAAGATTAGA TCCGTGTTCCATTACAAGCA AAGGTGGACCCCAAAGTCTC GAAAAAGTTCCTGAGCCACG AAATGTCAGGTGGCAAGAGC CTGAGTGGGACCAGACTTCC CAGACAAAGATGGGGCAAAT AGTCTTGCTCCGCCTTACAT GCAAGGTGCAATCAGACTCA CTGGGTGTCCTTTCGGATAA
18 20 20 21 20 20 20 20 20 20 20 20 20 20
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
900 ml of medium. The expression of SENP1 was detected by western blotting and RT-PCR. Infected cells were left in the incubator for 48 h, medium was replaced before being exposed to IH condition or left in normoxia.
2.7. Flow cytometry Apoptotic cells were examined by flow cytometry. Cells were washed twice with cold PBS and then the cells were suspended in 5 ml of fluorescein isothiocyanate (FITC)-labeled Annexin V (R&D Systems, Minneapolis, MN) and 200 ml of 1 binding buffer for 20 min in the dark. Afterwards, 300 ml of 1 binding buffer and 5 ml of propidium iodide (Sigma, St. Louis, MO) were added to each sample. Cells were analyzed for apoptosis on a FACScan flow cytometer with Cell Quest software (Becton Dickinson) after incubation at RT (25 uC) for 10 min in the dark. All data are representative of three independent experiments.
2.8. Statistical analysis The data are expressed as mean ± SD and analyzed using GraphPad Prism 5 software (GraphPad Software Inc., San Diego, CA, USA). The data were compared between two groups using the twotailed Student's t-test. P values less than 0.05 were considered statistically significant.
653
3. Results 3.1. SENP1 is downregulated in BV2 cells exposure to IH We detected the expression levels of SENPs in BV2 cells treated in different conditions: IH condition and normoxia condition for 8 h via RT-PCR assay. As shown in the Fig. 1A, the expression of SENP1, rather than other SENPs, was significantly decreased by IH (the relative expression levels were decreased from 1 to 0.22 ± 0.08) compared to the normoxia condition. The following Western blotting assay also showed that the levels of SENP1 were decreased in BV2 under IH condition (the normalized protein expression levels were decreased from 1.56 ± 0.14 to 0.71 ± 0.08) (Fig. 1C). Together, these results indicated the potential roles of SENP1 in microglia cells under IH condition. 3.2. IH induced activation of BV2 To explore the effect of IH on BV2 in vitro, we performed Western blotting, RT-PCR and Griess assays to detect the mRNA and protein levels of iNOS in BV2 cells and concentration of NO derived from BV2. We found that the expression of iNOS in BV2 cells exposure to IH for 8 h were significantly increased both in protein levels (from 2.90 ± 0.27 to 4.48 ± 0.48) and mRNA levels (relatively expressed about 3 folds) compared to the wild type control (Fig. 1B, C). Additionally, more NO was released from BV2 cells treated by IH (from 0.12 ± 0.03 mM to 0.27 ± 0.04 mM) (Fig. 1D). The increased
Fig. 1. IH induced decreased expression of SENP1 and activation of BV2 cells. (A) Decreased expression of SENP1 in BV2 cells exposure to IH detected by using RT-PCR. The expression levels of iNOS were detected by using RT-PCR (B) and Western blotting (C), respectively. (D) The concentration of NO released from BV2 was detected by Griess assay. Normoxia: BV2 cells were cultured in normoxia condition; IH: BV2 cells exposure to IH. *, P < 0.05.
654
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
expression of iNOS and the release of NO suggested that BV2 cells were activated by IH. 3.3. Overexpression of SENP1 attenuated the IH-induced apoptosis of BV2 The SENP1 overexpressing vector was constructed for exploring the potential roles of SENP1 in BV2 cells under IH condition. Firstly, we confirmed the transfection efficiency by using western blotting and RT-PCR assay. For illustrating the survival rate of microglia under IH condition, flow cytometry were adopted to detect the cell apoptosis of SENP1 over-expressing or normal BV2 in IH condition. As shown in Fig. 2A and B, the protein and mRNA levels of SENP1overexpressing cells were approximately increased to 3 folds and 4 folds, respectively. Fig. 2C showed an apoptosis-inducing effect (apoptotic cells increased from 4.67 ± 2.52% to 26.71 ± 9.07%) of IH on BV2. This effect can be attenuated by SENP1 overexpression (apoptotic cells decreased to 7.67 ± 1.53%). 3.4. Caspase-8 pathway and mitochondrial apoptosis pathway involved in apoptosis induced by IH To determine the molecular mechanisms of IH-induced cell apoptosis in BV2, the expression levels of caspase 8, cleaved caspase 8, caspase 3, cleaved caspase 3, Bax, and Bcl-2 were detected by using Western blotting assay. As shown in Fig. 3, IH significantly induced the activation of caspase 8 and caspase 3, as well as the expression of Bax and Bcl-2. In addition, the effects of IH on those proteins were repressed by SENP1 overexpression. Basing on the above results, we hypothesized that the IH-induced BV2 apoptosis was triggered via both death receptor signaling and mitochondrial apoptosis pathway.
3.5. Overexpression of SENP1 attenuated the activation of BV2 induced by IH The expression levels of iNOS and concentration of released NO were detected to indicate the potential roles of SENP1 in IHinduced BV2 apoptosis. Obviously, overexpression of SENP1 significantly decreased the expression of iNOS (Fig. 4A, B) and the release of NO (Fig. 4C) (from 0.24 ± 0.12 mM to 0.12 ± 0.06 mM) in BV2 cells exposure to IH.
4. Discussion In the present study, we revealed that IH triggers the expression of iNOS, as well as the production of NO in microglial cells. Since iNOS was expressed only in microglia cells under inflammatory conditions, the release of iNOS was considered as a significant marker of microglial activation [12]. High expression levels of iNOS in microglia causes NO inhibition of neuronal respiration and results in neuronal depolarization and glutamate release, which induce neuronal death and CNS dysfunction [5]. Once a neuron dead, more activated microglia would be aroused. Then, they activated the surrounding quiescent microglial cells. This feed-forward manner leads to the over-activation of microglia and disrupts the homeostasis of the micro-environment. Excessive activation of microglia produces inflammatory reactions in the brain [10]. Further, the inflammatory reactions caused CNS damage and death, which eventually resulted in a vicious cycle [13]. Activated microglia also produce NO, which contributed to the pathology of neurodegenerative diseases [18]. Metabolism of NO in brain appears vital for normal cerebral function. While inappropriate production of NO has toxic effects on astrocytes, as well as neurons [19]. NO toxicity is usually induced by the DNA damage-p53
Fig. 2. SENP1 attenuated the apoptosis-inducing effect of IH on BV2. The expression levels of SENP1 in infected cells were confirmed by Western blotting (A) and RT-PCR (B). SENP1 overexpression led to a significant decreasing of the apoptotic rate of BV2 cells induced by IH, as assessed by flow cytometry assay (C). Normoxia: BV2 cells cultured in normoxia condition; IH: BV2 cells exposure to IH; SENP1 over: BV2 cells infected with SENP1 overexpression vector. NC: non-specific control. *, P < 0.05.
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
655
Fig. 3. Caspases pathways and mitochondrial apoptosis pathway involved in apoptosis induced by IH. (A) Several key factors associated with main pathways involved in cell apoptosis were detected by Western blotting. (B) The intensities of the bands were quantified using NIH ImageJ. Normoxia: BV2 cells cultured in normoxia condition; IH: BV2 cells exposure to IH; SENP1 over: BV2 cells infected with SENP1 overexpression vector. *, P < 0.05.
pathway or mitochondrial dysfunction [20]. In addition, NO mediates the neurotoxicity by conversion to its more toxic metabolite peroxynitrite (ONOO) [21].
Fig. 4. Overexpression of SENP1 attenuated the activation of BV2 induced by IH. Overexpression of SENP1 decreased the expression of iNOS induced by IH both in protein level (A) and mRNA level (B). (C) The release of NO in BV2 cells exposure to IH was also decreased resulted from the overexpression of SENP1. Normoxia: BV2 cells cultured in normoxia condition; IH: BV2 cells exposure to IH; SENP1 over: BV2 cells infected with SENP1 overexpression vector. *, P < 0.05.
NO has been shown that plays important roles in cell apoptosis [22]. Additionally, it was reported that NO production aggravates the LPS- and interferon-g-triggered cell death in N9 microglial cells and primary microglia cells [23]. NO derived from iNOS in macrophages resulting in endothelial cell death via p53 phosphorylation [24]. Thus, we detected the BV2 apoptosis under IH and normoxia conditions. As our results shown, IH remarkably increased the apoptosis of BV2 (Fig. 2). Given that the activation of caspase-3 was required for the execution of apoptosis [25], and a profuse nonnuclear activation of cleaved caspases 8 and 3 was found in reactive microglia in previous research [26], the cleavage of caspases 8 and 3 was investigated in our study. Previous studies indicated that microglia apoptosis was accompanied by the disruption of mitochondrial membrane potential [27]. Additionally, prolonged production of NO associated with the release of cytochrome c from the mitochondria, activation of caspase, modulation of anti-apototic Bcl-2 proteins, and increase in p53 expression [28]. So, we examined the effect of IH on the mitochondrial apoptosis pathway. Our results showed increasing levels of cleaved-caspase 8 and Bax1 and decreasing levels of Bcl-2, which led to caspase-3 activation in BV2. Studies revealed that activation of microglia triggers apoptosis through induction of autocrine cytokine [29,30]. Thus, the results of this study suggested the IH-induced apoptosis might be mediated by the iNOS and NO derived from activated microglia. In present study, the effect of IH on BV-2 including apoptosis, iNOS expression and NO induction were attenuated by SENP1 overexpression. SUMOylation is a dynamic process, catalyzed by SUMO-specific ligases and reversed by SENPs [31]. Both iNOS inhibitors and iNOS knockout mice presented a strong brainprotecting effect on nerve injury [12]. For instance, inhibition of iNOS using aminoguanidine had beneficial effects in the brain with focal cerebral ischemic damage in rats [32] and in the MPTP model of Parkinson disease [33]. We found that iNOS was induced by IH in BV2 cells. This ectopic expression can be attenuated by SENP1 overexpression, indicating the protecting roles of SENP1 in IHcaused CNS damage. It was reported that hypoxia induces HIF1a SUMOylation. SENP1 plays a key role in the regulation of the hypoxic response through regulation of HIF1a stability [31]. Another study revealed SUMOylation attenuates hypoxia-induced injury [34]. Combine the previous studies and our findings, we proposed that SUMOylation was occurred in underlying mechanisms of BV-2 response to IH. By further flow cytometry assay, we found that SENP1 attenuated the apoptosis-inducing effect of IH in BV-2 cell line. Microglia
656
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
are known to be susceptible to apoptosis, which has been suggested as an important mode of microglial population control [35]. Several authors have reported that microglia undergo apoptosis following damage to the nervous system [36]. While, other researches claimed that over-activation-induced apoptosis may be an essential self-regulatory mechanism for microglia in order to limit bystander killing of vulnerable neurons [20]. These contradictory statements might be aroused by the dual roles of microglial cells in IH condition. How to harness the positive side of microglia, as well as to suppress their negative side needs to be resolved [37]. Therefore, the specific protective or detrimental effect of SENP1 on microglia and further impact on neuron needs to be further investigated. Taken together, this study demonstrated the apoptosis-inducing and activating role of IH on microglia. Moreover, the effect of IH on BV-2 including apoptosis, iNOS expression and NO induction can be attenuated by SENP1 overexpression. Given that microglia play critical roles in the pathologies of many neurological disorders, and the major effects of SENP1 on the cell activation and survival of microglia, our study suggested that SENP1 may a potential therapeutic target for this kinds of disorders.
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
Acknowledgments This work was supported by the Science Foundation of Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. We thanks to Prof. Dr. Jin-ke Cheng (Department of Biochemistry and Molecular Cell Biology, Shanghai Jiao Tong University School of Medicine) for his assistance in this study. Transparency document
[21] [22] [23]
[24]
[25]
Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2015.10.092.
[26]
References
[27]
[1] B.W. Row, R. Liu, W. Xu, L. Kheirandish, D. Gozal, Intermittent hypoxia is associated with oxidative stress and spatial learning deficits in the rat, Am. J. Respir. Crit. Care. Med. 167 (2003) 1548e1553. [2] R.C. Li, B.W. Row, L. Kheirandish, K.R. Brittian, E. Gozal, et al., Nitric oxide synthase and intermittent hypoxia-induced spatial learning deficits in the rat, Neurobiol. Dis. 17 (2004) 44e53. [3] K.J. Banasiak, G.G. Haddad, Hypoxia-induced apoptosis: effect of hypoxic severity and role of p53 in neuronal cell death, Brain Res. 797 (1998) 295e304. [4] E. Gozal, B.W. Row, A. Schurr, D. Gozal, Developmental differences in cortical and hippocampal vulnerability to intermittent hypoxia in the rat, Neurosci. Lett. 305 (2001) 197e201. [5] Q. Yang, Y. Wang, J. Feng, J. Cao, B. Chen, Intermittent hypoxia from obstructive sleep apnea may cause neuronal impairment and dysfunction in central nervous system the potential roles played by microglia, Neuropsychiatr. Dis. Treat. 9 (2013) 1077e1086. [6] H.I. Magazine, Y. Liu, T.V. Bilfinger, G.L. Fricchione, G.B. Stefano, Morphineinduced conformational changes in human monocytes, granulocytes, and endothelial cells and in invertebrate immunocytes and microglia are mediated by nitric oxide, J. Immunol. 156 (1996) 4845e4850. [7] J. Gehrmann, Y. Matsumoto, G.W. Kreutzberg, Microglia: intrinsic immuneffector cell of the brain, Brain Res. Rev. 20 (1995) 269e287. [8] V.H. Perry, J.A. Nicoll, C. Holmes, Microglia in neurodegenerative disease, Nat. Rev. Neurol. 6 (2010) 193e201. [9] A. Nimmerjahn, F. Kirchhoff, F. Helmchen, Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo, Science 308 (2005) 1314e1318. [10] H.E. Han, T.K. Kim, H.J. Son, W.J. Park, P.L. Han, Activation of autophagy pathway suppresses the expression of iNOS, IL6 and cell death of LPSstimulated microglia cells, Biomol. Ther. 21 (2013) 21e28. [11] S.A. Khan, J. Nanduri, G. Yuan, et al., NADPH oxidase 2 mediates intermittent
[28]
[29]
[30]
[31] [32] [33]
[34]
[35]
[36] [37]
hypoxia-induced mitochondrial complex I inhibition: relevance to blood pressure changes in rats, Antioxid. Redox Signal 14 (2011) 533e542. Y. Qiao, Z. Liu, X. Yan, C. Luo, Effect of intermittent hypoxia on neurofunctional recovery post brain ischemia in mice, J. Mol. Neurosci. 55 (2015) 923e930. J.A. Smith, A. Das, S.K. Ray, N.L. Banik, Role of pro-inflammatory cytokines released from microglia in neurodegenerative diseases, Brain Res. Bull. 87 (2012) 10e20. A. Ghoshal, S. Das, S. Ghosh, M.K. Mishra, V. Sharma, et al., Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis, Glia 55 (2007) 483e496. H.V. Nguyen, J.L. Chen, J. Zhong, K.J. Kim, E.D. Crandall, Z. Borok, Y. Chen, D.K. Ann, SENP1 induces prostatic intraepithelial neoplasia through multiple mechanisms, Am. J. Pathol. 168 (2006) 1452e1463. s, et al., Small ubiquitin-related modifier M. Jowita, G. Marcin, B. Miklo (SUMO)-specific proteases: profiling the specificities and activities of human SENPs, J. Biol. Chem. 282 (2007) 26217e26224. E. Ha, K.H. Jung, B.K. Choe, J.H. Bae, D.H. Shin, S.V. Yim, H.H. Baik, Fluoxetine increases the nitric oxide production via nuclear factor kappa B-mediated pathway in BV 2 murine microglial cells, Neurosci. Lett. 397 (2006) 185e189. K. Kjaer, D. Strøbaek, P. Christophersen, L.C. Rønn, Chloride channel blockers inhibit iNOS expression and NO production in IFNg-stimulated microglial BV2 cells, Brain Res. 1281 (2009) 15e24. C.C. Chao, S. Hu, T.W. Molitor, E.G. Shaskan, P.K. Peterson, Activated microglia mediate neuronal cell injury via a nitric oxide mechanism, J. Immunol. 149 (1992) 2736e2741. K. Kawahara, M. Mori, H. Nakayama, NO-induced apoptosis and ER stress in microglia, Nihon Yakurigaku Zasshi 124 (2004) 399e406. S.A. Lipton, J. Stamler, Method of Preventing NMDA Receptor Complexmediated Neuronal Damage, 2000. US. B. Brüne, A. von Knethen, K.B. Sandau, Nitric oxide and its role in apoptosis, Eur. J. Pharmacol. 351 (1998) 261e272. L. Mayo, R. Stein, Characterization of LPS and interferongamma triggered activation-induced cell death in N9 and primary microglial cells: induction of the mitochondrial gateway by nitric oxide, Cell Death Differ. 14 (2007) 183e186. L.A. Ridnour, J.S. Isenberg, M.G. Espey, D.D. Thomas, D.D. Roberts, D.A. Wink, Nitric oxide regulates angiogenesis through a functional switch involving thrombospondin-1, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 13147e13152. S. Mazumder, D. Plesca, A. Almasan, Caspase-3 activation is a critical determinant of genotoxic stress-induced apoptosis, Methods Mol. Biol. 414 (2008) 13e21. N. Viceconte, M.A. Burguillos, A.J. Herrera, R.M. De Pablos, B. Joseph, J.L. Venero, Neuromelanin activates proinflammatory microglia through a caspase-8-dependent mechanism, J. Neuroinflammation 14 (2015) 5. P.S. Chen, C.C. Wang, C.D. Bortner, G.S. Peng, X. Wu, H. Pang, et al., Valproic acid and other histone deacetylase inhibitors induce microglial apoptosis and attenuate lipopolysaccharide-induced dopaminergic neurotoxicity, Neuroscience 149 (2007) 203e212. B.M. Choi, H.O. Pae, S.I. Jang, Y.M. Kim, H.T. Chung, Nitric oxide as a proapoptotic as well as anti-apoptotic modulator, J. Biochem. Mol. Biol. 35 (2002) 116e126. H. Nagashima, T. Fujimu ra, Y.T. ak ahagi, et al., Development of efficient strategies for the production of genetically modified pigs, Theriogenology 59 (2003) 95e106. C. Snch ez, J. Diaz-Nido, J. Avila, Phosphorylation of microtubule-associated protein 2 (MAP2) and its relevance for the regulation of the neuronal cytoskeleton function, Prog. Neurobiol. 61 (2000) 133e168. J. Cheng, X. Kang, S. Zhang, E.T. Yeh, SUMO-specific protease 1 is essential for stabilization of HIF1a during hypoxia, Cell 131 (2007) 584e595. S.W. Kim, J.K. Lee, NO-induced downregulation of HSP10 and HSP60 expression in the postischemic brain, J. Neurosci. Res. 85 (2007) 1252e1259. D.C. Wu, V. Jackson-Lewis, M. Vila, K. Tieu, P. Teismann, C. Vadseth, D.K. Choi, H. Ischiropoulos, S. Przedborski, Blockade of microglial activation is neuroprotective in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson disease, J. Neurosci. 22 (2002) 1763e1771. N. Ha-Van, C. Jo-Lin, Z. Jenny, et al., Sumoylation attenuates sensitivity toward hypoxia- or desferroxamine-induced injury by modulating adaptive responses in salivary epithelial cells, Am. J. Pathology 168 (2006) 1452e1463. M. Wirenfeldt, L. Dissing-Olesen, A. Anne Babcock, M. Nielsen, et al., Population Control of resident and immigrant microglia by mitosis and apoptosis, Am. J. Pathol. 171 (2007) 617e631. J. Gehrmann, Y. Matsumoto, G.W. Kreutzberg, Microglia: intrinsic immuneffector cell of the brain, Brain Res. Rev. 20 (1995) 269e287. R.B. Rock, P.K. Peterson, Microglia as a pharmacological target in infectious and inflammatory diseases of the brain, J. Neuroimmune Pharmacol. 1 (2006) 117e126.
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
SENP1 inhibits the IH-induced apoptosis and nitric oxide production in BV2 microglial cells Song Liu a, *, Zhong-hua Wang b, Bo Xu c, Kui Chen d, Jin-yuan Sun a, Lian-ping Ren a a
Department of Respiratory Medicine, Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai, 200092, China Department of Medical Oncology, Fudan University Shanghai Cancer Center, Department of Oncology, Shanghai Medical College, Fudan University, Shanghai, 200032, China c Department of Respiratory Medicine, Beijing Friendship Hospital, Capital Medical University, Beijing, 100050, China d Department of Neurology, Beijing Friendship Hospital, Capital Medical University, Beijing, 100050, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 12 October 2015 Accepted 19 October 2015 Available online 21 October 2015
To reveal SUMOylation and the roles of Sentrin-specific proteases (SENP)s in microglial cells under Intermittent hypoxia (IH) condition would provide more intensive view of understanding the mechanisms of IH-induced central nervous system (CNS) damage. Hence, in the present study, we detected the expression levels of SENPs in microglial cells under IH and normoxia conditions via RT-PCR assay. We found that SENP1 was significantly down-regulated in cells exposure to IH. Subsequently, the effect of IH for the activation of microglia and the potential roles of SENP1 in the SENP1-overexpressing cell lines were investigated via Western blotting, RT-PCR and Griess assay. The present study demonstrated the apoptosis-inducing and activating role of IH on microglia. In addition, we revealed that the effect of IH on BV-2 including apoptosis, nitric oxide synthase (iNOS) expression and nitric oxide (NO) induction can be attenuated by SENP1 overexpression. The results of the present study are of both theoretical and therapeutic significance to explore the potential roles of SENP1 under IH condition and elucidated the mechanisms underlying microglial survival and activation. © 2015 Elsevier Inc. All rights reserved.
Keywords: Intermittent hypoxia Microglia SENP1 CNS damage
1. Introduction Intermittent hypoxia (IH), as a hallmark of obstructive sleep apnea, has been reported that could induce oxidative stress [1] and inflammation [2]. The long-term IH will result in neuronal cell death [3] and eventually central nervous system (CNS) degeneration. CNS impairments arising from neuronal apoptosis in the learning and memory regions of the brain bring to significant cognitive and behavioral deficits [1,4,5]. Several studies have focused on the roles of IH in multiple pathophysiological processes. However, the molecular mechanisms underlying the IH-induced neuronal apoptosis remain largely unknown. It has been reported that IH induces the activation of microglial cells [5]. Microglial cells in CNS are macrophage-like resident immune cells, which can be activated upon trauma, stroke and infection through responding to various cellular factors, including cytokines, chemokines, nitric oxide (NO), and reactive oxygen
* Corresponding author. E-mail address: [email protected] (S. Liu). http://dx.doi.org/10.1016/j.bbrc.2015.10.092 0006-291X/© 2015 Elsevier Inc. All rights reserved.
intermediates [6e8]. Microglial cells show a ‘resting’ phenotype characterized by ramified morphology in the healthy adult CNS [9]. It plays important role in the maintenance and resolution of brain tissue homeostasis [10], as well as clearance of dead cells and secretion of neurotrophins in the normal conditions [11]. While in the pathological conditions, microglial cells are activated for increasing the production of inflammatory cytokines [12]. Further, the hyper-activated microglial cells will activate the surrounding normal microglia and propagate the production of proinflammatory factors via a feed-forward manner [13]. Besides, IH induces the expression of nitric oxide synthase (iNOS) to produce reactive nitrogen species and abnormal high levels of glutamate, which ultimately result in excitotoxicity in CNS especially in hippocampal neurons [5]. As reported, microglial cells are major sources of iNOS in the CNS neuroinflammation [14]. Additionally, iNOS has been shown that was expressed in microglia upon ischemia-induced hypoxia [12]. Taken together, identification of compounds that modulate microglial reaction under pathological conditions is highly desirable for the development of therapeutic agents [10]. SUMOylation has been shown as a modulator of hypoxic
652
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
response [15]. Sentrin-specific proteases (SENP)s are proteases that participate in the regulation of SUMOylation by generating mature small ubiquitin-related modifiers (SUMO) for protein conjugation (endopeptidase activity) and removing conjugated SUMO from targets (isopeptidase activity) [16]. So it's essential to reveal SUMOylation and the roles of SENPs in microglial cells under IH condition. Hence, uncovering the potential roles of SENPs in IH conditions would provide more intensive view of understanding the mechanisms of IH-induced CNS damage. In this study, we firstly detected the expression levels of SENPs in microglial cells under IH and normoxia conditions. We found that SENP1 was significantly down-regulated in cells exposure to IH. Subsequently, we detected the effect of IH for the activation of microglia and investigated the potential roles of SENP1 in the SENP1-overexpressing cell lines. We found the apoptosis-inducing and activating role of IH on microglia. Additionally, the effect of IH on BV-2 including apoptosis, iNOS expression and NO induction can be attenuated by SENP1 overexpression. The results of the present study are of both theoretical and therapeutic significance to explore the potential roles of SENP1 under IH condition and elucidated the mechanisms underlying microglial survival and activation. 2. Material and methods 2.1. Cell culture BV2 microglia cells were gifts from Professor Zeng-qiang Yuan (State Key Laboratory of Brain and Cognitive Science, Institute of Biophysics, Chinese Academy of Sciences). The cells were plated onto 6-well cell culture plates in Dulbecco's Modified Eagle Medium (Gibco, Grand Island, NY, USA) containing 1% penicillin and streptomycin (Invitrogen, Carlsbad, CA, USA) and 10% fetal bovine serum (Gibco, Grand Island, NY, USA) in an incubator with 5% CO2 at 37 C. Cells were fed with fresh medium for treatment 24 h after incubation.
antibody (GeneTex, San Antonio, TX, USA) was used to normalize sample loading and transfer. The intensities of the bands were quantified using NIH ImageJ software package (http://rsb.info.nih. gov/ij/). 2.4. Real-time PCR Total RNA from BV2 cells was extracted using the Trizol reagent (Invitrogen, Carlsbad, USA). Complementary DNA (cDNA) was synthesized using Takara RNA PCR kit (Japan) according to the manufacturer's instructions. Real-time PCR was performed for quantification of iNOS and SENP1 with a quantitative thermal cycler (Millipore, Billerica, MA, USA). Relative expression values were calculated as the ratio of target cDNA to GAPDH. Relative gene expression was determined by delta delta CT method (ABI, Applied Biosystems) with b-actin as the endogenous control, and the cycling program was conducted as follows: 50 C for 2 min, 95 C for 10 min and subsequent forty cycles of 95 C for 15 s, 60 C for 1 min. All data were analyzed using GraphPad Prism 5 software. The primer sequences are listed in Table 1. 2.5. Griess assay Accumulation of NO in cultured media samples was analyzed by measuring nitrite levels as described previously [17]. Briefly, fresh supernatants of the cultured cells was collected after the indicated time, and the culture supernatant (100 ml) were mixed with 100 ml Griess Reagent (equal volume of 1% sulfanilamide in 5% phosphoric acid and 0.1% naphthylethylenediamine dihydrochloride in water) (Promega, Madison, WI, USA). The amount of nitrite was calculated from a NaNO2 standard curve (0e200 mM). After 10 min incubation at room temperature, the absorbance was measured at 540 nm (Bio-Rad Laboratories, Hercules, CA, USA). The background absorbance is subtracted from the samples. Results are expressed as mM of nitrite in BV2 culture supernatant.
2.2. IH exposure 2.6. Infection of cells with SENP1 adenovirus Cultured BV-2 cells were exposed to the IH cell culture box, which is a controlled gas chamber, regulated the flow of nitrogen and oxygen. The O2 levels in the chamber were alternated between 1% and 21% for 400 s/cycle. In the control group, cells were maintained in normoxic conditions (with O2 levels of 21%). Cells were collected for future assays after exposure to IH for 8 h. 2.3. Western blot BV2 cells were harvested and lysed in radio immunoprecipitation assay (RIPA) buffer (Millipore, Temecula, CA, USA) for 30 min on ice. The protein concentration was measured by Dc Protein Assay (Bio-Rad Laboratories, Hercules, CA, USA). Samples containing 30 mg protein was separated by 10% SDS- PAGE (Invitrogen, Carlsbad, CA, USA), and then transferred to nitrocellulose membranes (Millipore, CA, USA). The membranes were incubated overnight with rabbit anti-iNOS antibody (Proteintech, Rocky Hill, NJ, USA). Rabbit polyclonal anti-SENP1antibody (Bioworld Technology Co., Ltd, Nanjing, China), rabbit anti-caspase-3 antibody, rabbit anti-caspase-8 antibody, cleaved caspase-3 antibody, cleaved caspase-8 antibody, and rabbit anti-Bax antibody, which was purchased from Cell Signaling Technology (CST) Inc. (Beverly, MA, USA), and rabbit anti-Bcl-2 antibody (Bioworld Technology Co., Ltd, Nanjing, China), then incubated with appropriate HRP-conjugated secondary antibody (Bioworld Technology Co., Ltd, Nanjing, China). After that, the blots were visualized by enhanced chemiluminescence (ECL; Santa Cruz Biotechnology). An anti b-actin
Cells were infected with SENP1 adenovirus, and then exposed to hypoxia or noxmia. Briefly, SENP1 gene amplification was used by PCR. Afterwards, the gene amplification products were inserted into the lentiviral vector pCDH and to co-transfect BV2 cells. 25,000 BV2 cells per well were seeded in 24-well plates and maintained for 24 h. 900 ml of the medium was removed from the cells leaving 100 ml on the cells onto which 2 ml of SENP1 adenovirus or 1 ml of GFP adenovirus control were added and left for 2 h before adding
Table 1 The primers used for RT-PCR assay. Primer name
Sequence
Length
iNOS-F iNOS-R SENP1-F SENP1-R SENP2-F SENP2-R SENP3-F SENP3-R SENP5-F SENP5-R SENP6-F SENP6-R SENP7-F SENP7-R
GGACGAGACGGATAGGCA AAGGGAACTCTTCAAGCACC CAGCACAGCAGAAGAGACAG TGGAACTAAGACACCGAGACA GCCAAAAGGCCAAGATTAGA TCCGTGTTCCATTACAAGCA AAGGTGGACCCCAAAGTCTC GAAAAAGTTCCTGAGCCACG AAATGTCAGGTGGCAAGAGC CTGAGTGGGACCAGACTTCC CAGACAAAGATGGGGCAAAT AGTCTTGCTCCGCCTTACAT GCAAGGTGCAATCAGACTCA CTGGGTGTCCTTTCGGATAA
18 20 20 21 20 20 20 20 20 20 20 20 20 20
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
900 ml of medium. The expression of SENP1 was detected by western blotting and RT-PCR. Infected cells were left in the incubator for 48 h, medium was replaced before being exposed to IH condition or left in normoxia.
2.7. Flow cytometry Apoptotic cells were examined by flow cytometry. Cells were washed twice with cold PBS and then the cells were suspended in 5 ml of fluorescein isothiocyanate (FITC)-labeled Annexin V (R&D Systems, Minneapolis, MN) and 200 ml of 1 binding buffer for 20 min in the dark. Afterwards, 300 ml of 1 binding buffer and 5 ml of propidium iodide (Sigma, St. Louis, MO) were added to each sample. Cells were analyzed for apoptosis on a FACScan flow cytometer with Cell Quest software (Becton Dickinson) after incubation at RT (25 uC) for 10 min in the dark. All data are representative of three independent experiments.
2.8. Statistical analysis The data are expressed as mean ± SD and analyzed using GraphPad Prism 5 software (GraphPad Software Inc., San Diego, CA, USA). The data were compared between two groups using the twotailed Student's t-test. P values less than 0.05 were considered statistically significant.
653
3. Results 3.1. SENP1 is downregulated in BV2 cells exposure to IH We detected the expression levels of SENPs in BV2 cells treated in different conditions: IH condition and normoxia condition for 8 h via RT-PCR assay. As shown in the Fig. 1A, the expression of SENP1, rather than other SENPs, was significantly decreased by IH (the relative expression levels were decreased from 1 to 0.22 ± 0.08) compared to the normoxia condition. The following Western blotting assay also showed that the levels of SENP1 were decreased in BV2 under IH condition (the normalized protein expression levels were decreased from 1.56 ± 0.14 to 0.71 ± 0.08) (Fig. 1C). Together, these results indicated the potential roles of SENP1 in microglia cells under IH condition. 3.2. IH induced activation of BV2 To explore the effect of IH on BV2 in vitro, we performed Western blotting, RT-PCR and Griess assays to detect the mRNA and protein levels of iNOS in BV2 cells and concentration of NO derived from BV2. We found that the expression of iNOS in BV2 cells exposure to IH for 8 h were significantly increased both in protein levels (from 2.90 ± 0.27 to 4.48 ± 0.48) and mRNA levels (relatively expressed about 3 folds) compared to the wild type control (Fig. 1B, C). Additionally, more NO was released from BV2 cells treated by IH (from 0.12 ± 0.03 mM to 0.27 ± 0.04 mM) (Fig. 1D). The increased
Fig. 1. IH induced decreased expression of SENP1 and activation of BV2 cells. (A) Decreased expression of SENP1 in BV2 cells exposure to IH detected by using RT-PCR. The expression levels of iNOS were detected by using RT-PCR (B) and Western blotting (C), respectively. (D) The concentration of NO released from BV2 was detected by Griess assay. Normoxia: BV2 cells were cultured in normoxia condition; IH: BV2 cells exposure to IH. *, P < 0.05.
654
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
expression of iNOS and the release of NO suggested that BV2 cells were activated by IH. 3.3. Overexpression of SENP1 attenuated the IH-induced apoptosis of BV2 The SENP1 overexpressing vector was constructed for exploring the potential roles of SENP1 in BV2 cells under IH condition. Firstly, we confirmed the transfection efficiency by using western blotting and RT-PCR assay. For illustrating the survival rate of microglia under IH condition, flow cytometry were adopted to detect the cell apoptosis of SENP1 over-expressing or normal BV2 in IH condition. As shown in Fig. 2A and B, the protein and mRNA levels of SENP1overexpressing cells were approximately increased to 3 folds and 4 folds, respectively. Fig. 2C showed an apoptosis-inducing effect (apoptotic cells increased from 4.67 ± 2.52% to 26.71 ± 9.07%) of IH on BV2. This effect can be attenuated by SENP1 overexpression (apoptotic cells decreased to 7.67 ± 1.53%). 3.4. Caspase-8 pathway and mitochondrial apoptosis pathway involved in apoptosis induced by IH To determine the molecular mechanisms of IH-induced cell apoptosis in BV2, the expression levels of caspase 8, cleaved caspase 8, caspase 3, cleaved caspase 3, Bax, and Bcl-2 were detected by using Western blotting assay. As shown in Fig. 3, IH significantly induced the activation of caspase 8 and caspase 3, as well as the expression of Bax and Bcl-2. In addition, the effects of IH on those proteins were repressed by SENP1 overexpression. Basing on the above results, we hypothesized that the IH-induced BV2 apoptosis was triggered via both death receptor signaling and mitochondrial apoptosis pathway.
3.5. Overexpression of SENP1 attenuated the activation of BV2 induced by IH The expression levels of iNOS and concentration of released NO were detected to indicate the potential roles of SENP1 in IHinduced BV2 apoptosis. Obviously, overexpression of SENP1 significantly decreased the expression of iNOS (Fig. 4A, B) and the release of NO (Fig. 4C) (from 0.24 ± 0.12 mM to 0.12 ± 0.06 mM) in BV2 cells exposure to IH.
4. Discussion In the present study, we revealed that IH triggers the expression of iNOS, as well as the production of NO in microglial cells. Since iNOS was expressed only in microglia cells under inflammatory conditions, the release of iNOS was considered as a significant marker of microglial activation [12]. High expression levels of iNOS in microglia causes NO inhibition of neuronal respiration and results in neuronal depolarization and glutamate release, which induce neuronal death and CNS dysfunction [5]. Once a neuron dead, more activated microglia would be aroused. Then, they activated the surrounding quiescent microglial cells. This feed-forward manner leads to the over-activation of microglia and disrupts the homeostasis of the micro-environment. Excessive activation of microglia produces inflammatory reactions in the brain [10]. Further, the inflammatory reactions caused CNS damage and death, which eventually resulted in a vicious cycle [13]. Activated microglia also produce NO, which contributed to the pathology of neurodegenerative diseases [18]. Metabolism of NO in brain appears vital for normal cerebral function. While inappropriate production of NO has toxic effects on astrocytes, as well as neurons [19]. NO toxicity is usually induced by the DNA damage-p53
Fig. 2. SENP1 attenuated the apoptosis-inducing effect of IH on BV2. The expression levels of SENP1 in infected cells were confirmed by Western blotting (A) and RT-PCR (B). SENP1 overexpression led to a significant decreasing of the apoptotic rate of BV2 cells induced by IH, as assessed by flow cytometry assay (C). Normoxia: BV2 cells cultured in normoxia condition; IH: BV2 cells exposure to IH; SENP1 over: BV2 cells infected with SENP1 overexpression vector. NC: non-specific control. *, P < 0.05.
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
655
Fig. 3. Caspases pathways and mitochondrial apoptosis pathway involved in apoptosis induced by IH. (A) Several key factors associated with main pathways involved in cell apoptosis were detected by Western blotting. (B) The intensities of the bands were quantified using NIH ImageJ. Normoxia: BV2 cells cultured in normoxia condition; IH: BV2 cells exposure to IH; SENP1 over: BV2 cells infected with SENP1 overexpression vector. *, P < 0.05.
pathway or mitochondrial dysfunction [20]. In addition, NO mediates the neurotoxicity by conversion to its more toxic metabolite peroxynitrite (ONOO) [21].
Fig. 4. Overexpression of SENP1 attenuated the activation of BV2 induced by IH. Overexpression of SENP1 decreased the expression of iNOS induced by IH both in protein level (A) and mRNA level (B). (C) The release of NO in BV2 cells exposure to IH was also decreased resulted from the overexpression of SENP1. Normoxia: BV2 cells cultured in normoxia condition; IH: BV2 cells exposure to IH; SENP1 over: BV2 cells infected with SENP1 overexpression vector. *, P < 0.05.
NO has been shown that plays important roles in cell apoptosis [22]. Additionally, it was reported that NO production aggravates the LPS- and interferon-g-triggered cell death in N9 microglial cells and primary microglia cells [23]. NO derived from iNOS in macrophages resulting in endothelial cell death via p53 phosphorylation [24]. Thus, we detected the BV2 apoptosis under IH and normoxia conditions. As our results shown, IH remarkably increased the apoptosis of BV2 (Fig. 2). Given that the activation of caspase-3 was required for the execution of apoptosis [25], and a profuse nonnuclear activation of cleaved caspases 8 and 3 was found in reactive microglia in previous research [26], the cleavage of caspases 8 and 3 was investigated in our study. Previous studies indicated that microglia apoptosis was accompanied by the disruption of mitochondrial membrane potential [27]. Additionally, prolonged production of NO associated with the release of cytochrome c from the mitochondria, activation of caspase, modulation of anti-apototic Bcl-2 proteins, and increase in p53 expression [28]. So, we examined the effect of IH on the mitochondrial apoptosis pathway. Our results showed increasing levels of cleaved-caspase 8 and Bax1 and decreasing levels of Bcl-2, which led to caspase-3 activation in BV2. Studies revealed that activation of microglia triggers apoptosis through induction of autocrine cytokine [29,30]. Thus, the results of this study suggested the IH-induced apoptosis might be mediated by the iNOS and NO derived from activated microglia. In present study, the effect of IH on BV-2 including apoptosis, iNOS expression and NO induction were attenuated by SENP1 overexpression. SUMOylation is a dynamic process, catalyzed by SUMO-specific ligases and reversed by SENPs [31]. Both iNOS inhibitors and iNOS knockout mice presented a strong brainprotecting effect on nerve injury [12]. For instance, inhibition of iNOS using aminoguanidine had beneficial effects in the brain with focal cerebral ischemic damage in rats [32] and in the MPTP model of Parkinson disease [33]. We found that iNOS was induced by IH in BV2 cells. This ectopic expression can be attenuated by SENP1 overexpression, indicating the protecting roles of SENP1 in IHcaused CNS damage. It was reported that hypoxia induces HIF1a SUMOylation. SENP1 plays a key role in the regulation of the hypoxic response through regulation of HIF1a stability [31]. Another study revealed SUMOylation attenuates hypoxia-induced injury [34]. Combine the previous studies and our findings, we proposed that SUMOylation was occurred in underlying mechanisms of BV-2 response to IH. By further flow cytometry assay, we found that SENP1 attenuated the apoptosis-inducing effect of IH in BV-2 cell line. Microglia
656
S. Liu et al. / Biochemical and Biophysical Research Communications 467 (2015) 651e656
are known to be susceptible to apoptosis, which has been suggested as an important mode of microglial population control [35]. Several authors have reported that microglia undergo apoptosis following damage to the nervous system [36]. While, other researches claimed that over-activation-induced apoptosis may be an essential self-regulatory mechanism for microglia in order to limit bystander killing of vulnerable neurons [20]. These contradictory statements might be aroused by the dual roles of microglial cells in IH condition. How to harness the positive side of microglia, as well as to suppress their negative side needs to be resolved [37]. Therefore, the specific protective or detrimental effect of SENP1 on microglia and further impact on neuron needs to be further investigated. Taken together, this study demonstrated the apoptosis-inducing and activating role of IH on microglia. Moreover, the effect of IH on BV-2 including apoptosis, iNOS expression and NO induction can be attenuated by SENP1 overexpression. Given that microglia play critical roles in the pathologies of many neurological disorders, and the major effects of SENP1 on the cell activation and survival of microglia, our study suggested that SENP1 may a potential therapeutic target for this kinds of disorders.
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
Acknowledgments This work was supported by the Science Foundation of Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine. We thanks to Prof. Dr. Jin-ke Cheng (Department of Biochemistry and Molecular Cell Biology, Shanghai Jiao Tong University School of Medicine) for his assistance in this study. Transparency document
[21] [22] [23]
[24]
[25]
Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.bbrc.2015.10.092.
[26]
References
[27]
[1] B.W. Row, R. Liu, W. Xu, L. Kheirandish, D. Gozal, Intermittent hypoxia is associated with oxidative stress and spatial learning deficits in the rat, Am. J. Respir. Crit. Care. Med. 167 (2003) 1548e1553. [2] R.C. Li, B.W. Row, L. Kheirandish, K.R. Brittian, E. Gozal, et al., Nitric oxide synthase and intermittent hypoxia-induced spatial learning deficits in the rat, Neurobiol. Dis. 17 (2004) 44e53. [3] K.J. Banasiak, G.G. Haddad, Hypoxia-induced apoptosis: effect of hypoxic severity and role of p53 in neuronal cell death, Brain Res. 797 (1998) 295e304. [4] E. Gozal, B.W. Row, A. Schurr, D. Gozal, Developmental differences in cortical and hippocampal vulnerability to intermittent hypoxia in the rat, Neurosci. Lett. 305 (2001) 197e201. [5] Q. Yang, Y. Wang, J. Feng, J. Cao, B. Chen, Intermittent hypoxia from obstructive sleep apnea may cause neuronal impairment and dysfunction in central nervous system the potential roles played by microglia, Neuropsychiatr. Dis. Treat. 9 (2013) 1077e1086. [6] H.I. Magazine, Y. Liu, T.V. Bilfinger, G.L. Fricchione, G.B. Stefano, Morphineinduced conformational changes in human monocytes, granulocytes, and endothelial cells and in invertebrate immunocytes and microglia are mediated by nitric oxide, J. Immunol. 156 (1996) 4845e4850. [7] J. Gehrmann, Y. Matsumoto, G.W. Kreutzberg, Microglia: intrinsic immuneffector cell of the brain, Brain Res. Rev. 20 (1995) 269e287. [8] V.H. Perry, J.A. Nicoll, C. Holmes, Microglia in neurodegenerative disease, Nat. Rev. Neurol. 6 (2010) 193e201. [9] A. Nimmerjahn, F. Kirchhoff, F. Helmchen, Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo, Science 308 (2005) 1314e1318. [10] H.E. Han, T.K. Kim, H.J. Son, W.J. Park, P.L. Han, Activation of autophagy pathway suppresses the expression of iNOS, IL6 and cell death of LPSstimulated microglia cells, Biomol. Ther. 21 (2013) 21e28. [11] S.A. Khan, J. Nanduri, G. Yuan, et al., NADPH oxidase 2 mediates intermittent
[28]
[29]
[30]
[31] [32] [33]
[34]
[35]
[36] [37]
hypoxia-induced mitochondrial complex I inhibition: relevance to blood pressure changes in rats, Antioxid. Redox Signal 14 (2011) 533e542. Y. Qiao, Z. Liu, X. Yan, C. Luo, Effect of intermittent hypoxia on neurofunctional recovery post brain ischemia in mice, J. Mol. Neurosci. 55 (2015) 923e930. J.A. Smith, A. Das, S.K. Ray, N.L. Banik, Role of pro-inflammatory cytokines released from microglia in neurodegenerative diseases, Brain Res. Bull. 87 (2012) 10e20. A. Ghoshal, S. Das, S. Ghosh, M.K. Mishra, V. Sharma, et al., Proinflammatory mediators released by activated microglia induces neuronal death in Japanese encephalitis, Glia 55 (2007) 483e496. H.V. Nguyen, J.L. Chen, J. Zhong, K.J. Kim, E.D. Crandall, Z. Borok, Y. Chen, D.K. Ann, SENP1 induces prostatic intraepithelial neoplasia through multiple mechanisms, Am. J. Pathol. 168 (2006) 1452e1463. s, et al., Small ubiquitin-related modifier M. Jowita, G. Marcin, B. Miklo (SUMO)-specific proteases: profiling the specificities and activities of human SENPs, J. Biol. Chem. 282 (2007) 26217e26224. E. Ha, K.H. Jung, B.K. Choe, J.H. Bae, D.H. Shin, S.V. Yim, H.H. Baik, Fluoxetine increases the nitric oxide production via nuclear factor kappa B-mediated pathway in BV 2 murine microglial cells, Neurosci. Lett. 397 (2006) 185e189. K. Kjaer, D. Strøbaek, P. Christophersen, L.C. Rønn, Chloride channel blockers inhibit iNOS expression and NO production in IFNg-stimulated microglial BV2 cells, Brain Res. 1281 (2009) 15e24. C.C. Chao, S. Hu, T.W. Molitor, E.G. Shaskan, P.K. Peterson, Activated microglia mediate neuronal cell injury via a nitric oxide mechanism, J. Immunol. 149 (1992) 2736e2741. K. Kawahara, M. Mori, H. Nakayama, NO-induced apoptosis and ER stress in microglia, Nihon Yakurigaku Zasshi 124 (2004) 399e406. S.A. Lipton, J. Stamler, Method of Preventing NMDA Receptor Complexmediated Neuronal Damage, 2000. US. B. Brüne, A. von Knethen, K.B. Sandau, Nitric oxide and its role in apoptosis, Eur. J. Pharmacol. 351 (1998) 261e272. L. Mayo, R. Stein, Characterization of LPS and interferongamma triggered activation-induced cell death in N9 and primary microglial cells: induction of the mitochondrial gateway by nitric oxide, Cell Death Differ. 14 (2007) 183e186. L.A. Ridnour, J.S. Isenberg, M.G. Espey, D.D. Thomas, D.D. Roberts, D.A. Wink, Nitric oxide regulates angiogenesis through a functional switch involving thrombospondin-1, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 13147e13152. S. Mazumder, D. Plesca, A. Almasan, Caspase-3 activation is a critical determinant of genotoxic stress-induced apoptosis, Methods Mol. Biol. 414 (2008) 13e21. N. Viceconte, M.A. Burguillos, A.J. Herrera, R.M. De Pablos, B. Joseph, J.L. Venero, Neuromelanin activates proinflammatory microglia through a caspase-8-dependent mechanism, J. Neuroinflammation 14 (2015) 5. P.S. Chen, C.C. Wang, C.D. Bortner, G.S. Peng, X. Wu, H. Pang, et al., Valproic acid and other histone deacetylase inhibitors induce microglial apoptosis and attenuate lipopolysaccharide-induced dopaminergic neurotoxicity, Neuroscience 149 (2007) 203e212. B.M. Choi, H.O. Pae, S.I. Jang, Y.M. Kim, H.T. Chung, Nitric oxide as a proapoptotic as well as anti-apoptotic modulator, J. Biochem. Mol. Biol. 35 (2002) 116e126. H. Nagashima, T. Fujimu ra, Y.T. ak ahagi, et al., Development of efficient strategies for the production of genetically modified pigs, Theriogenology 59 (2003) 95e106. C. Snch ez, J. Diaz-Nido, J. Avila, Phosphorylation of microtubule-associated protein 2 (MAP2) and its relevance for the regulation of the neuronal cytoskeleton function, Prog. Neurobiol. 61 (2000) 133e168. J. Cheng, X. Kang, S. Zhang, E.T. Yeh, SUMO-specific protease 1 is essential for stabilization of HIF1a during hypoxia, Cell 131 (2007) 584e595. S.W. Kim, J.K. Lee, NO-induced downregulation of HSP10 and HSP60 expression in the postischemic brain, J. Neurosci. Res. 85 (2007) 1252e1259. D.C. Wu, V. Jackson-Lewis, M. Vila, K. Tieu, P. Teismann, C. Vadseth, D.K. Choi, H. Ischiropoulos, S. Przedborski, Blockade of microglial activation is neuroprotective in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson disease, J. Neurosci. 22 (2002) 1763e1771. N. Ha-Van, C. Jo-Lin, Z. Jenny, et al., Sumoylation attenuates sensitivity toward hypoxia- or desferroxamine-induced injury by modulating adaptive responses in salivary epithelial cells, Am. J. Pathology 168 (2006) 1452e1463. M. Wirenfeldt, L. Dissing-Olesen, A. Anne Babcock, M. Nielsen, et al., Population Control of resident and immigrant microglia by mitosis and apoptosis, Am. J. Pathol. 171 (2007) 617e631. J. Gehrmann, Y. Matsumoto, G.W. Kreutzberg, Microglia: intrinsic immuneffector cell of the brain, Brain Res. Rev. 20 (1995) 269e287. R.B. Rock, P.K. Peterson, Microglia as a pharmacological target in infectious and inflammatory diseases of the brain, J. Neuroimmune Pharmacol. 1 (2006) 117e126.