Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation

BBAGRM-00723; No. of pages: 17; 4C: 12, 13 Biochimica et Biophysica Acta xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbagrm

F

5 6

a

7

a r t i c l e

8 9 10 11 12

Article history: Received 13 November 2013 Received in revised form 2 May 2014 Accepted 5 May 2014 Available online xxxx

13 14 15 16 17 18

Keywords: HNF1α ATM Phosphorylation Transcription regulation Glucose metabolism

Beijing Institute of Radiation Medicine, Beijing, 100850, China State Key Laboratory of Proteomics, Beijing Proteome Research Center, Beijing Institute of Radiation Medicine, Beijing, 102206, China

i n f o

a b s t r a c t

Hepatocyte nuclear factor-1 alpha (HNF1α) exerts important effects on gene expression in multiple tissues. Several studies have directly or indirectly supported the role of phosphorylation processes in the activity of HNF1α. However, the molecular mechanism of this phosphorylation remains largely unknown. Using microcapillary liquid chromatography MS/MS and biochemical assays, we identified a novel phosphorylation site in HNF1α at Ser249. We also found that the ATM protein kinase phosphorylated HNF1α at Ser249 in vitro in an ATM-dependent manner and that ATM inhibitor KU55933 treatment inhibited phosphorylation of HNF1α at Ser249 in vivo. Coimmunoprecipitation assays confirmed the association between HNF1α and ATM. Moreover, ATM enhanced HNF1α transcriptional activity in a dose-dependent manner, whereas the ATM kinase-inactive mutant did not. The use of KU55933 confirmed our observation. Compared with wild-type HNF1α, a mutation in Ser249 resulted in a pronounced decrease in HNF1α transactivation, whereas no dominant-negative effect was observed. The HNF1αSer249 mutant also exhibited normal nuclear localization but decreased DNA-binding activity. Accordingly, the functional studies of HNF1αSer249 mutant revealed a defect in glucose metabolism. Our results suggested that ATM regulates the activity of HNF1α by phosphorylation of serine 249, particularly in glucose metabolism, which provides valuable insights into the undiscovered mechanisms of ATM in the regulation of glucose homeostasis. © 2014 Published by Elsevier B.V.

E

T

E

C

b

O

4

Long Zhao a, Hui Chen a,b, Yi-Qun Zhan a,b, Chang-Yan Li a,b, Chang-Hui Ge a,b, Jian-Hong Zhang a, Xiao-Hui Wang a,b, Miao Yu a,b,⁎, Xiao-Ming Yang a,b,⁎

R O

3Q1

P

2

Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation

D

1

34

R

38 36 35

R

37

1. Introduction

40 41

HNF1α is a homeodomain-containing transcription factor that is important for diverse metabolic functions in the liver, pancreatic islets, kidneys, and intestines [1–4]. Gene knockout studies have indicated that HNF1α-deficient mice developed type II diabetes, dwarfism, renal Fanconi syndrome, hepatic dysfunction and hypercholesterolemia [5]. The phenotype of HNF1−/− mice has also revealed that this transcription factor was crucial for the transcriptional activation of genes that played key roles in pancreatic β-cell glucose-sensing and renal proximal tubular reabsorption of glucose and several other metabolites, such as insulin and the glucose transporter Glut2 [6]. Thus, HNF1α can be considered a transcription factor at the crossroads of the regulation of

46 47 48 49 50

U

44 45

N C O

39

42 43

19 20 21 22 23 24 25 26 27 28 29 30 31 32 33

Abbreviations: HNF, hepatocyte nuclear factor; MODY, maturity onset diabetes of the young; ATM, ataxia telangiectasia mutated; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; IB, immunoblot; R.L.U, relative luciferase units ⁎ Corresponding authors at: Beijing Institute of Radiation Medicine, 27 Taiping Road, Beijing, 100850, P.R. China. Tel./fax: +86 10 68176833. E-mail addresses: [email protected] (M. Yu), [email protected] (X.-M. Yang).

glucose homeostasis [7]. In humans, mutations in HNF1α cause MODY3, a type of maturity-onset diabetes of the young, which is characterized by autosomal dominant inheritance, and these mutations also lead to severe impairment of glucose-stimulated insulin secretion and elevated blood glucose levels [8]. More than 120 different mutations in the HNF1α gene have been identified in subjects of different ethnic background [9]. The functional researches of molecular mechanisms underlying MODY3 revealed that the loss-of function of mutants caused HNF1α impaired DNA binding, decreased transcriptional activation, and defects in subcellular localization [9]. Since patients with HNF1α mutations have high frequency of late-diabetic complications, early diagnosis with appropriate treatment may reduce or delay the diabetes complication occurrence. HNF1α contains three functional domains: an N terminal dimerization domain (amino acids 1–32), a DNA-binding domain (amino acids 150–280), and a C-terminal transactivation domain (amino acids 281–631). The ability of various HNF1a domains to interact with multiple transcription factors, such as GATA5 [10], HMGB1 [11], Cdx2 [12], and the coactivators possess intrinsic histone acetyltransferase activities such as CBP [13] and P/CAF [13], allows the formation of a platform for recruitment of a transcriptional complex, leading to a strong

http://dx.doi.org/10.1016/j.bbagrm.2014.05.001 1874-9399/© 2014 Published by Elsevier B.V.

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71

81 82 83 84 85 86 87 88 89 90 91 92 93

2. Materials and methods

95

2.1. Cell lines, plasmids and reagents

96

122 123

Human hepatocarcinoma cell line, HepG2 and human cervical cancer cell line, Hela were cultured in Dulbecco’s modified Eagle’s medium (Gibco/BRL, Rockville, MD) with 10% fetal bovine serum (MDgenics Inc). Rat insulinoma cell line, RINm5F cells were cultured in RPMI1640 supplemented with 10% fetal bovine serum. Human A-T fibroblast cell line, SV40-transformed, AT5BIVA (ATM−/−) were kindly supplied by Prof. Song Yi (Beijing Institute of Radiation Medcine, Beijing, China). The vector GST-HNF1α(92–283) was amplified by polymerase chain reaction (PCR) from the human liver cDNA using primers 5′-CGGGATCC CTCAGCCCTGAGGAGG-3′ and 5′-CCGCTCGAGATGGCCAGCTTGTGCC-3′ and subcloned into pGEX-4 T-2 (Amersham) in the BamHI and XhoI site. Plasmids pCDNA3.1-HNF1α-Myc and pGL3-AFP has been reported [11]. Reporter plasmids pGL3-GLUT2 and β28-Luc were gifted by Prof. Maria-Angeles Navas [18]. Plasmids Flag-ATM and ATM kinase dead (kd) mutant were from M. Kastan (St. Judes Children’s Hospital, Memphis, TN). HNF1αS247A, HNF1αS249A and HNF1αS247A/S249A represent mutant HNF1α expression vectors, in which the designated amino acids were mutated to an alanine residue. All the mutant vectors were generated by using Muta-direct™ Site-Directed Mutagenesis Kit (SBS Genetech Co., Ltd., Beijing, China) and primers, described as follows: S247A, 5′-TCCAGAGAGGGGTGGCCCCATCACAGGCAC-3′ and 5′-GTGC CTGTGATGGGGCCACCCCTCTCTGGA-3′; and S249A, 5′-GAGAGGGGTG TCCCCAGCACAGGCACAGGGGCTG-3′ and 5′-CAGCCCCTGTGCCTGTGC TGGGGACACCCCTCTC-3′. To inhibit ATM kinase, the cells were pretreated with KU-55933 at indicated concentrations (Sigma–Aldrich, St. Louis, MO, USA) at 37 °C in complete DMEM during cell culture.

124

2.2. Animals

125 126

Male BALB/c mice (18–22 g body weight) were offered by the Beijing Institute of Radiation Medicine Animal Center (Beijing, China). Mice were fed a normal diet with free access to food and water. All surgical procedures were approved by the Animal Care Committee of BIRM. Animals received humane care according to the criteria outlined in the “EU Directive 2010/63/EU for animal experiments”.

110 111 112 113 114 115 116 117 118 119 120 121

C

E

R

108 109

R

107

O

105 106

C

103 104

N

101 102

U

99 100

Immunoprecipitation and western blotting were performed as de- 136 scribed previously [11]. 137

Subcellular localization assays were performed as described previ- 139 ously [11]. 140

2.6. In vitro kinase assay

142 143 144 145 146 147 148 149 150

151

2.7. Luciferase assays Luciferase assays were performed as described previously [11].

152

t1:1 t1:2

Table 1 Sequences of primers used for real-time PCR. Gene Symbol

Sequence(5′-3′)

Specimen

t1:3

ApoC2

5′-CCTCCCAGCTCTGTTTCTTG-3′ 5′-GCTGCTGTGCTTTTGCTGTA-3′ 5′-AGTCTCGAACCCGAGGATTT-3′ 5′-GTCATGCAGCAAGTGGCTTA-3′ 5′-TGAAGGGGACAAGGAAGATG-3′ 5′-ACAGGTTCATGGCGTGTGTA-3′ 5′-TCAGGCGGCTGAAGAAGTAT-3′ 5′-ACGTAGGGTGAATCCGTCAG-3′ 5′-CTCACACTTTGATGCGGATG-3′ 5′-TTGTTCCCCACCATCATCTT-3′ 5′-CTAAAGGACGAACCTGA-3′ 5′-TGGCCTGCAGTAATGTT-3′ 5′-ACGCCATTAAGACCATCCAG-3′ 5′-TTCGTAGACAAGGGGGACAC-3′ 5′-CAGCACCTTTGTGGTTCTCA-3′ 5′-CAGTGCCAAGGTCTGAAGGT-3′ 5′-TTTCGTGCTCTGAGCACTGG-3′ 5′-CTTGCCATTCCTGGACCCAA-3′ 5′-CTAAAGGACGAACCTGA-3′ 5′-TGGCCTGCAGTAATGTT-3′ 5′- CGGATGCCAATTACCGACAG-3′ 5′- AGAACTGCTGGGCCATGTG-3′ 5′- GTTTCCAGCAGATCGGCTCT-3′ 5′- GCTAGGACCAGTGTTCCAGTCAC-3′ 5′- GGGACATGTGCAGCCAAGA-3′ 5′- AAGAGGCTGGTCCTCACCAA-3′ 5′- TATGGCTGCTACTTCGT-3′ 5′- TATTGCTGGTCATTCCT-3′ 5′- CTGCAAGGGAGAACTCAGCAA-3′ 5′- GACCAAGGAAGCCACAATGC-3′ 5′- AGAGGGAAATCGTGCGTGAC-3′ 5′- CAATAGTGATGACCTGGCCGT-3′

Human

t1:4

Human

t1:5

Human

t1:6

Human

t1:7

Human

t1:8

Human

t1:9

Rat

t1:10

Rat

t1:11

Rat

t1:12

Rat

t1:13

Mice

t1:14

Mice

t1:15

Mice

t1:16

Mice

t1:17

Mice

t1:18

Mice

t1:19

GK ALDH2 PCK1 calcineurin mitATPase PCK1 INS2 cyclophilin mitATPase Glut2

Pgc-1α

129 130

141

The purifed GST or GST-HNF1α(92–283) or GST-HNF1α(92–283) S247A or GST-HNF1α(92–283)S249A recombinant protein were resuspended in kinase buffer (50 mmol/L HEPES, pH 7.5, 150 mmol/L NaCl, 1% Tween 20, 0.2% NP-40, 1 mmol/L NaF, 1 mmol/L Na3VO4, 1 mmol/L DTT, 10 mmol/L MgCl2) and incubated with ATM protein, which were immunoprecipitated with goat polyclonal antibodies against ATM (sc-7129, Santa Cruz Biotechnology), and 2 μCi [γ-32P]ATP for 20 min at 30 °C. Protein complexes were separated by SDS-PAGE followed by autoradiography.

Glut4

127 128

138

2.5. Subcellular localization assays

T

94

97 98

135

2.4. Immunoprecipitation and western blotting

F

79 80

O

78

Reverse-transcription and real-time PCR were performed as de- 132 scribed previously [11]. Specific primers for each gene were listed in 133 Table 1. 134

P

76 77

131

2.3. Reverse-transcription and real-time PCR

D

74 75

enhancement of transcription. Several studies have reported the direct or indirect implication of phosphorylation processes in the activity of HNF1α. HNF1α was reported to be a phosphoprotein in HepG2 and Hep3B hepatoma cell lines [14]; Its DNA-binding activity could be inhibited by protein phosphatases1/2A okadaic acid in phosphorylationdependent manner [15]. Moreover MKK3-mediated stress signals enhanced HNF1α transcriptional activity via activation of Mirk, an arginine-directed serine/threonine protein kinase, which was involved in phosphorylation of HNF1α at Ser247 [16]. Our previous study showed that the association between HNF1α and 14-3-3ζ is phosphorylation-dependent [17]. Furthermore, evaluation of the HNF1α sequence revealed a number of potential phosphorylation sites; however, the molecular mechanisms involved in HNF1α phosphorylation processes remain largely unknown. In the present study, we identified a novel putative phosphorylation site in HNF1α at Ser249 and determined that the ATM protein kinase, the protein product of the ATM gene, which is mutated in the disease ataxia telangiectasia, was involved in HNF1α Ser249 phosphorylation. Our data suggested that phosphorylation on this site contributed to the regulation of DNA-binding and transactivation potential of HNF1α, particularly in glucose metabolism. These findings indicated that HNF1α is a potential ATM target in metabolic pathways.

E

72 73

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

R O

2

Gyk G6pc β-actin

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

172 173

ChIP assay was performed as described previously [11] with modifications. Briefly, RINm5F cells were transfected with pCDNA3.1-HNF1αMyc or pCDNA3.1-HNF1αS249A-Myc or pCDNA3.1-His/Myc-B. 24 h later, the cells were cross-linked with 1% formaldehyde at room temperature. Chromatin was extracted, sonicated, and immunoprecipitated with anti-Myc antibody. We amplified immunoprecipitated DNA using promoter-specific primers covering HNF1α sites within the Tmem2, Kif12, Tmed6, Gc, Fbp1, Glut2, Ins, and HNF4α promoters and quantified it using real-time PCR. The enrichment of target genes was calculated using Actb promoters as a reference. The primer sequences are available in Table. 2

174

2.10. LC-MS/MS analysis

175

197 198

Bands of interest were excised, destained, dried, and digested with sequencing grade trypsin (Promega, Madison, WI) at 37 °C for 16 h. The peptides were solved with 98%H2O, 2%ACN, 0.1%TFA followed by centrifugation at 20,000 g for 30 min. The supernatant was injected onto a Dionex C18 PePMap300 column. Angilent1100 liquid systems and Finnigan LTQ mass spectrometer were used for LC/MS/MS analysis in Beijing Proteomics Research Center. The eluents used were: A, 98% H2O, 2% ACN, 0.1%TFA; and B, 20% H2O, 80%ACN, 0.1%TFA. The column was developed at the flow rate of 0.3 μl/min, with a concentration gradient of ACN: from 5%B to 50%B for 85 min, then from 50%B to 95%B for 10 min, maintained in 95%B for 30 min, from 95%B to 5%B for 1 min, and finally re-equilibrating with 5%B for 10 min. Effluents were introduced into the mass spectrometer, the ESI voltage was 2.2KV and the transfer capillary of the LTQ inlet was heated to 200 °C. The mass spectrometer was operated in a data-dependent acquisition mode, in which the MS acquisition with a mass range of m/z 400–1600 was automatically switched to MS/MS acquisition. The raw data were processed with pXtract (Ver.1.0) software. For peptide sequence searching, the mass spectra were processed and analyzed using the MASCOT (Ver. 2.1.0) pXtract (Ver.1.0) against the human International Protein Index database version 3.56 (76,539 entries), allowing for cysteine modification with methyl methanethiosulfate and oxidation of methionines with mass tolerances of 1.5 Da for MS and 0.8 Da for MS/MS, allowing for two missed (trypsin) cleavage, and including peptides with a

t2:1 t2:2

Table 2 Sequences of primers used for ChIP.

179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196

C

177 178

E

176

R

170 171

R

168 169

N C O

167

U

165 166

t2:3

Gene Symbol

Forward Sequence (5′-3′)

Reverse Sequence (5′-3′)

t2:4 t2:5 t2:6 t2:7 t2:8 t2:9 t2:10 t2:11

Actb Tmed6 Tmem27 Fbp1 Gc Slc2a2 Tbp Hnf4a (P2 promoter) Kif12 Ins

GATCTGGCACCACACCTTCTACAA ACAATGGCTCTGAAACTGGTCCT GGGATGGTTCGCTTCTATGGA AAGGTTCCCAACAGTTCTCCAAC CTTGGCTTTTCCCAGTGACAA CACTCTGGCTGGTCAGCTATTCAT ATCAGATGTGCGTCAGGCGTT CGGTGGCCCCTTTGCTGCTGTG

CGTCACCGGAGTCCATCACAA GCAGGTGAGCTGCTCACAATC CCCGGATTAGGGTATCGGAGA CATCTCCTGGGAAATGGATTCTC GCAAGGGACAATCAGCCTTG TAGATTCCCAACCTCCTCAAAACC TGCGGAGAAAATGACGCGA CATAAGGACTCGCCACTGGAG

AAACCCCCCTAGCTGGAATG ACAGCAGCGCAAAGAGCCCCG

ATACTGCAGCCTGCCCAGAG TTCTGATGCAGCCTGTCCTGGA

t2:12 t2:13

Plasmids pCDNA3.1-HNF1α-Myc (WT) or pCDNA3.1-HNF1αS249AMyc (S249A) or pCDNA3.1-His/MycB (ctrl) were transfected into the mouse liver using the TransIT In Vivo Gene Delivery System (Mirus, Madison, WI) by mouse tail vein injections according to the manufacturer’s directions. In brief, 5.1-μl polymer solutions were incubated with 20 μg of plasmids in 200 μl of sterile water for 5 min at room temperature. The mixture was added to 1.9 ml of 1 × delivery solution and incubated for 10–15 min, and the contents were delivered via syringe to the tail vein at a constant rate for 4–7 s. 24 h after injection, the mice were fasted for 24 h following with a 3-h refeeding, and then the mice were killed. Hepatic Glycogen Detection Kit (Nanjing Jiancheng Bioengineering Institute, Nanjingn, China) was used to examine glycogen level. Immediately after excision from the mice, approximately 100 mg of liver was dropped into 0.3 ml 30% KOH solution. The tissue was then digested to extract glycogen by heating the tube for 20 min in a boiling water bath, and following this the digest was cooled. Glycogen extract was diluted in H2O so as to yield a solution of glycogen concentration of 3–30 μg/ml. and the amount of glycogen in the aliquot was determined with anthrone reaction. Six replicates were used for determination of color stability. The results represent the mean of at least three independent transfection experiments; two individual mice were treated in every experiment, and three lobes of the liver, representing three different sites in the liver, were taken from each mouse. Periodic Acid-Schiff staining for cellular glycogen was performed according to the manufacture (Sigma-Aldrich). Briefly, the slides were deparaffinized, rehydrated, and treated with 1% (wt/vol) periodic acid (Sigma) in distilled H2O for 5 min at room temperature. Slides were washed in running water, incubated in Schiff’s reagent (Sigma) for 10 min at room temperature, rinsed in running tap water, counterstained with Gill’s no. 3 hematoxylin (Sigma), dehydrated, and mounted by reversing the rehydration steps. The PAS stained samples were viewed on a Leica DM3000 microscope (Leica). Images were processed with Leica Application Suite version 3.5.0.

203

2.12. Immunohistochemistry

237

Tissues were fixed in 10% formalin, embedded in paraffin and 4 mm sections were stained with H&E for histopathological analysis. For wildtype HNF1α or S249A detection, sections were blocked with 3% BSA prior to incubation with anti-myc antibody (ab9106, Abcam) for 1 hour. Linking reagent (streptavidin; Covance) was applied for 30 min at room temperature. These sections were incubated in 3% H2O2 for 15 min to bleach endogenous peroxidase activity. Then labeling reagent (HRP, Covance) was applied for 30 min at room temperature. Sections were developed using DAB substrate (AR1002, WuHan BOSTER Biological Technology., LTD, China) and counterstained with hematoxylin.

238

2.13. Statistical analysis

248

F

163 164

159 160

202

O

2.9. Chromatin Immunoprecipitation (ChIP)

158

2.11. Transfection in vivo, glycogen determination and PAS staining

R O

162

156 157

P

161

Nuclear extracts were isolated according to the manufacture’s protocol (Pierce, Rockford, IL). The LightShift chemiluminescent electrophoretic mobility shift assay kit (20148, Pierce) was used to perform electrophoretic mobility shift assays. The oligonucleotides, 5′-CCCCTG GTTAAGACTCTAATGACCCGCTGG-3′, which correspond to the HNF1α recognition consensus sequence in the promoter of insulin, were synthesized and labeled with biotin at the 5′-end. The reaction system was prepared according to the manufacturer’s protocol.

D

154 155

minimum confidence score of 95%. A given protein was considered cor- 199 rect when N2 tryptic peptides were identified meeting or exceeding the 200 aforementioned criteria. 201

E

2.8. Electrophoretic mobility shift assays (EMSA)

T

153

3

204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236

239 240 241 242 243 244 245 246 247

Statistical analysis was performed using the Student’s t-test. A value 249 of p b 0.05 was considered significant. Data were expressed as mean ± 250 SEM. 251 3. Results

252

3.1. Identification of HNF 1α S249 as a novel putative phosphorylation site 253 The amino acid sequence of HNF1α contains several putative Ser 254 phosphorylation sites. To determine whether HNF1α may be 255

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

T C

282

E

280 281

R

278 279

R

276 277

O

271 272

C

269 270

N

267 268

U

265 266

F

As shown in Fig. 2A, serine 249 is a conserved site across human, rat, mouse, chicken, and zebra fish HNF1α. Evaluation of the HNF1α sequence using a peptide-motif based scanning algorithm (_scansite.mit. edu_) suggested that S249 may serve as a potential substrate for ATM, which is a serine/threonine protein kinase and phosphorylates multiple substrates in response to various types of stress [19]. Thus, we investigated whether S249 of HNF1α was indeed phosphorylated by ATM in vitro and in vivo. ATM protein was purified using anti-ATM antibody

263 264

O

275

262

R O

3.2. ATM phosphorylates HNF1α at S249

260 261

P

274

258 259

immunoprecipitation from HepG2 cells, which were treated with or without 10Gy irradiation. GST or recombinant GST-HNF1α (92–283) were coincubated with precipitated ATM in the presence of [γ-32P]ATP. The reaction mixtures were analyzed using autoradiography and western blotting analyses. As shown in Fig. 2B, ATM was efficiently activated by γ-radiation and exhibited no kinase activity on GST itself and compared with control group, when using precipitated ATM from cells treated with 10Gy irradiation, such as a kinase, the phosphorylation signal of GST-HNF1α(92–283) increased significantly. Equal amounts of ATM protein immunoprecipitated from HepG2 cells with or without γ-radiation treatment were also confirmed using western blotting analysis. To assess whether the phosphorylation observed were specifically due to ATM activation, we performed an in vitro kinase assay in the AT5BIVA cell line (ATM−/−), which was derived from an individual with ataxia-telangiectasia [20]. Flag-tagged ATM or control vector (pCMV-Flag) was transfected in the ATM−/− cells, and the cells were stimulated with 10Gy irradiation. Expectedly, HNF1α phosphorylation was detected using the precipitated ATM from the ATM−/− cells that were re-transfected with Flag-ATM as kinase, and no effect was detected in the control group when using the precipitated product from the ATM−/− cells that were re-transfected with pCMV-Flag as a kinase (Fig. 2C). The ATM expression and activation was also monitored. Furthermore, two different mutants of GST-HNF1α(92–283) were generated: GST-HNF1α(92–283)S247A and GST-HNF1α(92–283)S249A, in which the serine residue was mutated to an alanine residue. All three GST fusion proteins, a wild-type form and two mutant forms, were used as substrates for the in vitro ATM kinase assays using ATM immunoprecipitated from the ATM−/− cells, which were transfected with exogenous ATM and treated with 10Gy irradiation. In this case,

E

273

phosphorylated on any of these sites, we first confirmed the phosphorylation status of HNF1α under the physiological condition using western blotting analyses. Total cellular extracts of HepG2 cells, which express endogenous HNF1α, were immunoprecipitated with antiHNF1α antibody, and the immunoprecipitation product was fractionated using SDS-PAGE and detected with anti-HNF1α and anti-pSer antibodies. As shown in Fig. 1A, western blotting with anti-pSer antibody suggested that HNF1α was phosphorylated on Ser sites. To identify the phosphorylation sites of HNF1α, we performed phosphopeptide analysis of HNF1α using microcapillary liquid chromatography MS/MS. HNF1α immunoprecipitation products were separated using SDS–PAGE, and stained with Coomassie bright blue. The differential blue color bands were excised, trypsinized and analyzed using microcapillary liquid chromatography MS/MS followed by protein database searching of the generated spectra, and two phosphorylated serine residues were identified in HNF1α: serine 247 (S247) and serine 249 (S249) (Fig. 1B-C). S247 phosphorylation has been reported in previous study [16]; however, S249 is a novel putative Ser phosphorylation site.

256 257

D

4

Fig. 1. Identification of HNF 1α S249 as a novel putative phosphorylation site. (A) Endogenous HNF1α was immunoprecipitated from HepG2 cells with anti-HNF1α antibody or goat IgG, and immunoblotted with anti-HNF1α and anti-pSer antibodies. (B) HNF1α and control immunoprecipitation products were divided and resolved on 10% SDS-PAGE. The position of HNF1α is indicated by the arrow. The gel-slice was cut out, digested with trypsin, and subjected to LC-MS/MS assays. The unique peptide sequences identified by MS are listed. (C) Phosphorylated Ser247 and Ser249 residues were identified using LC-MS/MS.

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311

5

C

T

E

D

P

R O

O

F

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338

R

P incorporation was detected in GST-HNF1α(92–283) as well as in GST-HNF1α(92–283)S247A, whereas the signal corresponding to ATM kinase-mediated phosphorylation was much fainter in GSTHNF1α(92–283)S249A protein (Fig. 2C). We further examined the dependence of HNF1α phosphorylation on ATM in vivo. HepG2 cells were treated with KU55933, which is a type of specific ATM inhibitor [21], or DMSO (as control), and the extracts were immunoprecipitated using anti-HNF1α antibody. We evaluated HNF1α phosphorylation using western blotting analyses with p-Ser antibody. As shown in Fig. 2D, 20 ng KU55933 could block the phosphorylation of ATM at Ser1981, and the signal intensity of phospho-serine in KU55933-treated cells was nearly 65% lower than that observed in the control group. The phosphorylation status of HNF1α was also determined using MS. As shown in Fig. 2E, in KU55933-treated HepG2 extracts, the phospho-signal was detected in residue Ser247, but not in residue Ser249; whereas phospho-signals were detected in both residues Ser247 and Ser249 in the DMSO group. Moreover, the serine that was followed by a glutamine was S249, which was consistent with the ATM recognition motif – “SQ” [22], suggesting it as the principal target of ATM. The interaction between HNF1α and ATM was evaluated using co-immunoprecipitation. As shown in Fig. 2F, endogenous ATM was effectively immunoprecipitated using an anti-ATM antibody, and the HNF1α protein was present in the anti-ATM antibody immunoprecipitates, but not in the IgG immunoprecipitates. Conversely, ATM also specifically coimmunoprecipitated with HNF1α by anti-HNF1α antibody (Fig. 2G). These results confirmed the association between ATM

R

314 315

32

N C O

313

U

312

E

Fig. 1 (continued).

and HNF1α. Taken together, these data indicated that HNF1α is a new 339 substrate of ATM protein kinase. 340 3.3. Loss of S249 phosphorylation reduces HNF1α transactivity

341

Because the phosphorylation of S249 of HNF1α has never been described, we first detected the effects of S249 mutation on HNF1α activity. The luciferase reporter gene driven by the AFP promoter, which has several binding sites for HNF1α protein, was used to analyze HNF1α transactivity [11]. Wild-type HNF1α or mutant HNF1αS249A, in which the serine residue was mutated to alanine, were co-transfected in increasing amounts along with a set amount of reporter plasmid pGL3AFP into HepG2 cells, which expresses endogenous HNF1α, rat insulinoma cell line RINm5F cells, or Hela cells, which do not express endogenous HNF1α. As shown in Fig. 3A, 10 ng of wild-type HNF1α activated the transcription of pGL3-AFP ~26-fold in HepG2 cells, in contrast to pGL3-Basic, and the addition of HNF1α resulted in an enhancement of reporter activity in a dose-dependent manner. Although the mutant HNF1αS249A also increased AFP-Luc reporter activity in a dose-dependent manner, the induction potential exhibited lower levels. Compared with wild-type HNF1α, 10 ng S249A activated AFP-Luc reporter ~ 14-fold above basal levels. Similar results were observed in RINm5F cells and Hela cells (Fig. 3A). We also compared the ability of S249A mutation to activate two other reporters (GLUT2-luc reporter and β28-Luc reporter [18]) in addition to wild-type HNF1α in HepG2, RINm5F, and Hela cells (Fig. 3B). In HepG2 cells, for the GLUT2-luc reporter, transfection of 20 ng HNF1α alone activated the reporter

342

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363

O R O P D E T C

377

E

375 376

R

373 374

R

371 372

O

370

C

368 369

activity of the S247A, S249A, and S247A/S249A mutations was reduced to various degrees (~47%, ~60%, and ~30% of wild-type HNF1α, respectively, p b 0.05), indicating the role of S249 independent of S247. It has been reported that some mutations in HNF1α acts in a dominantnegative manner [9]. Thus, to examine whether S249A could generate a dominant negative effect on wild-type HNF1α, 50 ng of wild-type HNF1α were cotransfected with 50 ng of the S249A expression vector. In addition, S249A did not interfere with wild-type HNF1α activity (Fig. 3D). HNF1α is a major regulator of glucose homeostasis via the regulation of multiple genes in the liver and pancreas [23]. We detected the expression of ApoC2, GK, ALDH2, PCK1, and calcineurin genes in HepG2 cells and the expression of PCK1, INS2, and cyclophilin in rat insulinoma cell line RINm5F cells, which have been reported to be HNF1α targeted-

N

366 367

~28-fold, transfection of 20 ng HNF1αS249A alone activated the reporter ~17-fold, transcriptional activity of S249A was reduced by 60% compared with the wild-type (p b 0.05); for the β28-luc reporter, transfection of 20 ng HNF1α alone activated the reporter ~4-fold, transfection of 20 ng HNF1αS249A alone activated the reporter ~ 1.7-fold, transcriptional activity of S249A was decreased by ~ 40% (p b 0.05). Similar results were observed in RINm5F cells and Hela cells (Fig. 3B). These results suggested that residue S249 was crucial for HNF1α transactivity. Because the phosphorylation of serine 247 of HNF1α has been previously reported [16], we investigated the cross-talk of residue Ser247 and Ser249. The HNF1αS247A mutant, in which the serine residue was mutated to an alanine, and the Ala247/249 double mutant was constructed. As shown in Fig. 3C, compared to wild-type HNF1α, the

U

364 365

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

F

6

Fig. 2. ATM phosphorylates HNF1α at S249. (A) Alignment of amino acid sequences of HNF1α among six species. Gray shading indicates identical residues, and the red indicates that Ser249 in HNF1α is conserved among six species. (B) HepG2 cells were nearly confluent, then treated with 10 Gy γ-irradiation or left untreated. The ATM−/− cell line, which was obtained from an AT patient, was transfected with Flag-ATM or pCMV-Flag and stimulated with 10 Gy γ-irradiation. 2 hours afterγ-irradiation, ATM was immunoprecipitated from the cells and used in in vitro kinase assays with recombinant GST-HNF1α(92–283) as a substrate. (C) The ATM−/− cell line, which was obtained from an AT patient, was transfected with Flag-ATM and stimulated with 10Gy γ-irradiation. 2 hours later, ATM was immunoprecipitated from the cells and used in in vitro kinase assays with recombinant GST-HNF1α(92–283), GSTHNF1α(92–283)S247A, and GST-HNF1α(92–283)S249A as a substrate. For (B) & (C), the extent of 32P incorporation was assessed by autoradiography. Western blotting analyses was performed to determine the amount of ATM protein and active ATM protein in ATM antibody immunoprecipitation product in each reaction. The expression levels of recombinant proteins were examined using Coomassie blue staining. (D) HepG2 cells were treated with 20 ng/μl KU55933 to block ATM or DMSO for 2 h; extracts were immunoprecipitated against anti-HNF1α antibody or goat IgG. The immunoprecipitation products were immunoblotted with both anti-HNF1α antibody and anti-pSer antibody. Western blotting analyses was performed to determine the amount of ATM protein with anti-ATM antibody and active ATM protein with anti-ATM(S1981) antibody in the cell lysis. The pSer protein amounts in HNF1α immunoprecipitation products were quantified using the Quantity One software (BioRad). The DMSO treatment group was set to 100% and the KU55933 treatment group was quantified. The results were the mean ± SEM of triplicate experiments. Student t test was used to compare the mean relative values between groups (*p b 0.05). (E) The immunoprecipitation products were divided and resolved on 10% SDS-PAGE. The position of p-HNF1α was indicated by an arrow. The gel-slice was cut out, digested with trypsin, and subjected to LC-MS/MS assays. The unique peptide sequences identified by MS are listed. Phosphorylated Ser247 residue was identified by LC-MS/MS in the KU55933 treatment group. (F&G) HepG2 cells were stimulated with 10Gy γ-irradiation, and 2 hours after γ-irradiation, cell lysates were prepared and immunoprecipitations were performed with anti-ATM antibody or anti-HNF1α antibody as indicated. Immunoprecipitates were analyzed with anti-ATM antibody and anti-HNF1α. The positions of ATM, HNF1α and the IgG were indicated by an arrow.

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

378 379 380 381 382 383 384 385 386 387 388 389 390 391

7

T

E

D

P

R O

O

F

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

R

395 396

R

394

genes and are involved in glucose metabolism [24]. As shown in Fig. 3E, in contrast to controls, transfection of wild-type HNF1α increased the gene expression to various degrees, whereas substitution of S249A, resulted in a loss of the ability to stimulate these genes expressions (p b 0.05).

N C O

392 393

E

C

Fig. 2 (continued).

3.4. Loss of S249 phosphorylation decreases HNF1α DNA-binding activity

398 399

The DNA-binding capacity of S249A was examined using the Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation (ChIP) assays. EMSA with nuclear extracts from HepG2 cells which were transfected with pcDNA3.1-His/Myc B or pcDNA3.1HNF1α-Myc or pcDNA3.1-HNF1αS249A-Myc and biotin-labeled oligonucleotides covering the − 230/− 201 of insulin promoter was performed. As shown in Fig. 4A, the specificity of binding was shown by the addition of unlabeled HNF1α recognition sequence (lane 5) and was confirmed by its supershift using a specific anti-HNF1α antibody (lane 6). Compared to the nuclear extracts of HepG2 cells, which were transfected with the control vector, wild-type HNF1α transfected cells showed strong binding signal with probe, whereas the intensity of the DNA–protein complex decreased significantly in nuclear extracts from HepG2 cells that were transfected with S249A in contrast to the band of wild-type HNF1α (lanes 2–4). Similar results were observed in RINm5F cells and Hela cells. Western blotting analysis confirmed equal expression of both wild-type and mutant protein in the nuclear extracts. The nuclear signals of cells transfected with wild-type or mutated HNF1α did not differ in Hela cells when visualized using an anti-Myc antibody followed by confocal microscopy (Fig. 4B).

400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417

U

397

In addition, the ChIP assay was performed in RINm5F cells to study the ability of S249A to bind to promoter sequences of Tmem27, Kif12, Tmed6, Gc, Fbp1, Glut2, Ins, and Hnf4α. Following formaldehyde crosslinking and chromatin precipitation using Myc-antibodies, the recovered DNA was amplified by PCR using specific primers according to a previous report [25]. As shown in Fig. 4C, a great enrichment of wildtype HNF1α in these genes was observed, whereas the S249A binding levels in the genes promoters appeared reduced with various degrees (p b 0.05). Taken together, these data indicated that residue S249 phosphorylation is critical for HNF1α DNA-binding activity.

418 419

3.5. HNF1αS249 mutation causes gluconeogenesis impairment

428

Because HNF1α deficiency can lead to defective liver glucose metabolism [5] and one of the pathways of glucose utilization in the liver is the conversion of glucose into glycogen, we detected the effects of the HNF1αS249 mutation on gluconeogenesis in vivo. Wild-type HNF1α or mutant HNF1αS249A or control vector (pcDNA3.1-His/Myc B) was injected into mouse-tail veins, and 24 h later, the mice were fasted for 24 h following 3-h of refeeding. After a 24-h fasting period, glycogen stores were depleted to the same extent in all groups. Interestingly, after 3-h refeeding following by a 24-h fast, wild-type HNF1α transfected mice showed significantly increase glycogen levels in the liver (p b 0.05) compared the livers of control vector transfected mice, whereas the glycogen in the HNF1αS249A-transfected mouse livers increase slightly (p b 0.05), indicating slower glycogen synthesis (Fig. 5A). This was confirmed using PAS staining, which also revealed that a significant increase in glycogen in livers of wild-type HNF1α transfected mice after 3-h refeeding following a 24-h fast (Fig. 5C). In addition, we

429

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

420 421 422 423 424 425 426 427

430 431 432 433 434 435 436 437 438 439 440 441 442 443 444

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

U

N

C

O

R

R

E

C

T

E

D

P

R O

O

F

8

445 446 447 448 449 450 451 452 453

Fig. 2 (continued).

detected the expression of Glut2, Glut4, Pgc-1α, Gyk, and G6pc, which have been reported to be involved in gluconeogenesis [26]. As shown in Fig. 5D, in contrast to controls, transfection of wild-type HNF1α increased the gene expression to various degrees, whereas substitution of S249A, resulted in a impaired transactivation these genes expressions (p b 0.05). Immunohistochemistry was used to monitor the expression level of the protein obtained after tail injection of mice in situ. As shown in Fig. 5D, exogenous wild-type HNF1α or S249A appeared in the nuclear of hepatocytes, and sense control gave background signals

in cytoplasm. Moreover, in other tissues, including intestine, lung, testis, muscle, spleen, kidney, stomach, heart, and pancreas, exogenous wildtype HNF1α or S249A signal appeared relatively weak, which has no significant difference with control. To verify the transfection efficiency of the in vivo gene deliver system, the GFP vector were delivered by mouse tail vein injection and expressions of GFP in indicated tissues were analyzed by freezing section (Supplement Fig. S1). These data indicated that the residue S249 phosphorylation was critical for HNF1α-mediated biological progresses.

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

454 455 456 457 458 459 460 461 462

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

3.6. ATM enhances the transcriptional activity of HNF1α

464 465

We next investigated whether ATM could alter the activity of HNF1α by affecting HNF1αS249 phosphorylation. As shown in Fig. 6A, in the ATM−/− cell line, transfection of ATM alone could not activate the AFP reporter (data not shown), transfection of 20 ng HNF1α alone activated the reporter ~16-fold, transfection of 20 ng HNF1αS249A alone activated the reporter ~ 8-fold, and co-transfection of 20 ng HNF1α with increasing amounts of ATM resulted in dose-dependent activation of AFP reporter, from ~22 to ~38-fold (p b 0.05), whereas co-transfection of 20 ng HNF1αS249A with increasing amounts of ATM did not lead to pGL3-AFP activation (p N 0.05). Because ATM is a type of serine/

O R O P D E T C E

473

R

471 472

R

469 470

N C O

468

U

466 467

threonine protein kinase, we detected whether its capacity to phosphorylate HNF1α necessary for the activation of this transcription factor by co-transfecting ATM kinase-inactive mutant with HNF1α and pGL3AFP. ATM kinase dead (kd) mutant, in which Asp2870 were mutated to Ala and Asn2875 were mutated to Lys, is a catalytically inactive mutant, which is abolished phosphotransferase activity [27]. Compared with the control group, 800 ng wild-type ATM increased HNF1α activation ~ 38-fold, whereas the ATM kinase-inactive mutant did not enhance HNF1α transactivity or S249A activity (p N 0.05). Because ATM is the principal regulator of DNA damage response in response to ionizing radiation [28] and to confirm our previous observation, we examined the activation of HNF1α in response to ionizing

F

463

9

Fig. 3. Loss of S249 phosphorylation reduces HNF1α transactivity. (A) 200 ng of reporter plasmid pGL3-AFP, 10 ng of pRL-TK, and indicated amounts of pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl) were co-transfected into HepG2 cells, or RINm5F cells, or Hela cells. (B) 200 ng of GLUT2-luc or β28-luc, 10 ng of pRLTK, and 20 ng of pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl) were co-transfected into HepG2 cells, or RINm5F cells, or Hela cells. (C) 200 ng of pGL3-AFP, 10 ng of pRL-TK, and 40 ng of pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS247A-Myc (S247A) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1HNF1αS247A/S249A-Myc (S247A/S249A) were co-transfected into HepG2 cells as indicated. (D) 200 ng of pGL3-AFP, 10 ng of pRL-TK, and indicated amount of pcDNA3.1-HNF1αMyc (WT) and pcDNA3.1-HNF1αS249A-Myc (S249A) and pcDNA3.1-His/Myc B (ctrl) were co-transfected into Hela cells to examine the potential dominant negative effect of the mutated protein. Twenty-four hours after transfection, the luciferase activity was measured. Luciferase activity was normalized by the Renilla activity present in each cellular lysate. All experiments were performed in duplicate and repeated at least 3 times. For (A) and (D), the results are presented as the fold inductions relative to the activity of cells co-transfected with the control vector, pGL3-AFP and pRL-TK only, taken as 1.0. For (B), the results are presented as the fold inductions relative to the activity of cells co-transfected with the control vector, pGL3-AFP and pRL-TK only, taken as 1.0. For (C), normalized luciferase values obtained from cells transfected with wild-type HNF1α were set as 100%. Student t test was used to compare the mean relative values between groups. Error bars indicate SEM (*p b 0.05). (E) Gene expression was measured using real-time PCR in HepG2 cells and RINm5F cells 24 h after transfection with pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl). The mitATPase6 served as a housekeeping gene. The values represent fold inductions relative to the mRNA level of cells transfected with control vector, taken as 1.0. The results were the mean ± SEM of triplicate experiments. Student t test was used to compare the mean relative values between groups (*p b 0.05). Western blotting analysis confirmed equal expression of wild-type HNF1α and mutant protein as indicated.

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

474 475 476 477 478 479 480 481 482 483 484 485

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510

R

O

C

490 491

N

488 489

Fig. 3 (continued).

radiation in the ATM−/− cells. As shown in Fig. 6B, in the ATM−/− cells, irradiation did not stimulate the transactivity of wild-type HNF1α (16 ± 1.78 over the basal level vs. 18 ± 2.22 over the basal level, p N 0.05) or that of S249A (13 ± 1.31 over the basal level vs. 14 ± 1.10 over the basal level, p N 0.05). In ATM re-expressed ATM−/− cells, wild-type HNF1α increased luciferase activity after 10 Gy irradiation (38 ± 6.23 over the basal level vs. 60 ± 5.69 over the basal level, p b 0.05), but irradiation did not enhance S249A transcriptional activity (15 ± 1.01 over the basal level vs. 17 ± 1.43 over the basal level, p N 0.05). Furthermore, we used the ATM kinase specific inhibitor KU-55933 to confirm ATM activity. As shown in Fig. 6C, AFP reporter activity induced by HNF1α was decreased in a dose-dependent manner upon treatment with various amounts of KU-55933. Treatment with 10 ng/μl KU-55933 resulted in 20% inhibition of HNF1α-mediated reporter activity, and 20 ng/μl KU-55933 resulted in ~ 50% reduction (30.1 ± 1.47 over the basal level vs. 15.3 ± 1.75 over the basal level, p b 0.05). In contrast, KU-55933 treatment failed to block S249A-mediated transactivity (16.4 ± 2.28 vs. 14.3 ± 1.78, p N 0.05) (Fig. 6C). In addition, we detected the effect of KU-55933 on the expression of ApoC2, GK, ALDH2, PCK1, and calcineurin genes in HepG2 cells and the expression of PCK1, INS2, and cyclophilin in rat insulinoma cell line RINm5F cells. As shown in Fig. 6D, in contrast to control, treatment with KU-55933 inhibited these gene expressions to various degrees (p b 0.05). These results demonstrated that the kinase activity of ATM was essential for its ability to

U

486 487

R

E

C

T

E

D

P

R O

O

F

10

increase HNF1α function and ATM kinase-mediated HNF1α S249 phosphorylation was essential for enhancement of the transactivation of HNF1α. Thus, ATM can substantially increase the transcriptional activity of HNF1α and may function as a coactivator of HNF1α in vivo.

511 512

4. Discussion

515

Phosphorylation is a key post-translational modification in transcriptional factor regulation via altering its DNA binding activity, transactivation potential, nuclear translocation and degradation [29]. On the basis of its consensus sequences, HNF1α contains a number of potential phosphorylation sites for serine/threonine kinases, but the potential role of each phosphorylable site remains to be determined. In the present study, we identified two phosphorylation sites in HNF1α-S247 and S249 using phosphopeptide analysis of HNF1α and microcapillary liquid chromatography MS/MS. Phosphorylation of S247 in HNF1α has been previously reported [16], which indicated that our IP-MS strategy was effective, and phosphorylation of S249 was first reported. Moreover, we showed that HNF1α was a novel target of ATM protein kinase. HNF1α is a type of POU-homeodomain transcription factor, which is characterized by its binding as a dimer to the palindromic consensus sequence [30]. Compared with classical homeodomain structures, HNF1α homeodomain contains a 21 residue “insertion” region (residue 237–257) between helices Hα2 and Hα3, which extends Hα2 by 8 residues and increases the length of the loop between Hα2 and Hα3 by 13

516

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

513 514

517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533

11

Fig. 3 (continued).

U

N C O

R

R

E

C

T

E

D

P

R O

O

F

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

534 535 536 537 538 539 540 541 542 543 544 545

residues [2,3]. This atypical insertion is involved in HNF1α dimerization via interacting with a complementary insertion in another HNF1α POUs domain (residues 91–181) to stabilize the interface for optimal transcriptional efficiency [3]. Single amino acid substitutions present in HNF1α homeodomain affect the POUs-homeodomain interactions, such as the MODY3 substitution E240Q [3]. The residue S249 is located in the region of homeodomain insertion and it is interesting to speculate that phosphorylation of S249 and the introduction of a negative charge at this site might increase the stability of POUs-homeodomain interaction and transcriptional activity. HNF1α with amino acid substitutions inhibiting DNA-binding have been shown to form non-functional homodimers with the wild-type protein, either by haplo-insufficiency

or dominant-negative mechanisms [31]. In our experiment, mutation in S249 did not affect the dimerization of HNF1α (Supplement Fig. S2), which may form non-functional homodimers to impair transcriptional activity. Previous reports on regulation of HNF1α transactivity have implicated its homeodomain in Cdx2 positive regulating DNA binding through protein–protein interaction [12]. In different cell lines, the expression levels and the types of HNF1α cofactors are different with each other so that the potential activities for HNF1α are different. In our experiment, high fold induction obtained in HepG2 cells may be due to high expression levels and multiple kinds of HNF1α cofactors in HepG2 cells. S249A exhibited lower transactivity regardless of cell type, which reflected that this site may not be involved in

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

546 547 548 549 550 551 552 553 554 555 556 557

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

U

N

C

O

R

R

E

C

T

E

D

P

R O

O

F

12

Fig. 4. Loss of S249 phosphorylation reduces HNF1α DNA binding activity. (A) EMSA was performed using nuclear extracts from HepG2, RINm5F, and Hela cells that were transfected with pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl) as indicated. Probe was biotin-labeled oligonucleotides, which contained the sequence −230/−201 of insulin promoter (5′-CCCCTGGTTAAGACTCTAATGACCCGCTGG-3′). The biotin-labeled oligonucleotides were incubated with the indicated nuclear extracts and/ or antibody, and resolved on a 4% polyacrylamide gel. N represents the lane in which the oligonucleotide probes were not incubated with any nuclear extracts (lane 1). Competition experiments were performed with 50-fold excess of unlabeled insulin oligonucleotide (lane 5). For the supershift experiments, nuclear extracts were incubated with antibodies specific for HNF1α (sc-6547X, Santa Cruz)(lane 6). Western blotting analyses were performed to determine the amount of HNF1α/HNF1αS249A in each reaction. (B) Hela cells were transfected with pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A). Next, cells were decorated with anti-Myc antibody and visualized by laser scanning microscopy 24 h later. Nuclear fractions (N) and total cell lysates (T) of Hela cells that were transfected with pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) were subjected to Western blotting analysis with anti-Myc antibody and anti-LaminA/C antibody. (C) Enrichment of wild-type HNF1α or HNF1αS249A in Tmem27, Kif12, Tmed6, Gc, Fbp1, Glut2, Ins, and Hnf4α promoters in RINm5F cells. A chromatin immunoprecipitation assay was performed as previously described. Gene–specific qPCR signals were calculated as the percentage of input DNA and expressed as the enrichment values relative to the mean values for Actb. The results were the mean ± SEM of triplicate experiments. Student t test was used to compare the mean relative values between groups (*p b 0.05). Western blotting analyses were performed to determine the amount of HNF1α/HNF1αS249A in each reaction.

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

F

O

R O P D

573

E

571 572

T

569 570

C

567 568

E

565 566

R

564

R

562 563

data from EMSA and ChIP also confirmed that loss of S249 phosphorylation decreases HNF1α DNA-binding activity. The reduction in transactivation for mutant S249A was expected, given its weak DNAbinding activity. However, data from real-time PCR was inconsistent with the reporter assay, that transient transfection of S249A mutant did not increase HNF1α target gene expression. Previous studies indicate that HNF1α, HNF4α and HNF6 are at the center of a network of transcription factors that cooperatively regulate numerous developmental and metabolic functions in hepatocytes and islets [34]; HNF4α is a widely acting transcription factor that N40% of the promoters of active genes were bound by HNF4α, and most of the promoters bound by HNF1α were also occupied by HNF4α [35], therefore, the reason might be the genes that we detected might be regulated not only by HNF1α but also by other transcription factors such as HNF4α.. Our ChIP analysis shows that HNF1α may modulate HNF4α expression so that the gene expression changes may be the result of transcriptional hierarchies.

N C O

560 561

HNF1α protein-protein interaction. Another possibility is that phosphorylation of Ser-249 might affect DNA binding directly. Experiments using the recombinant HNF1α DNA binding domain have shown that the changes in homeodomain insertion residues could alter the binding affinity of the HNF1α dimer to its consensus sequence [2]. The involvement of phosphorylation in DNA binding has also been observed in other HNFs. For example, there are at least three serine/threonine rich regions present in the HNF-4 molecule, which are potential casein kinase II phosphorylation sites, and serine/threonine phosphorylation of HNF4α increases the affinity and specificity of DNA binding by altering its tertiary structure [32]; the forkhead/winged-helix DNA binding motif of HNF3β forms a random coil within the minor groove of target sites where it may interact with phosphate residues and stabilize DNA/ protein interactions [33]. Moreover, S249 is strictly conserved in HNF1α genes from fish to man, and it is reasonable to believe that this serine site is essential to the DNA-binding event. In our experiment,

U

558 559

13

Fig. 5. HNF1αS249 mutation causes gluconeogenesis impairment. (A) The mice were injected with plasmid pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl) through tail veins, and 24 h later, the mice were fasted for 24 h following with a 3-h refeeding. Next, the glycogen content in the livers of 24-h fasted and 3-h refed mice was determined. (B) Western blotting analysis confirmed equal expression of wild-type HNF1α and mutant protein as indicated. (C) PAS staining of liver in 3-h refed mice. (D) After 3-h refed, the mice were sacrificed and the gene expression of Glut2, Glut4, Pgc-1α, Gyk, and G6pc in liver was measured using real-time PCR. The β-actin served as a housekeeping gene. The values represent fold inductions relative to the mRNA level of mice injected with control vector, taken as 1.0. (E) After 3-h refed, the mice were sacrificed, and expressions of wild-type HNF1α or mutant protein in indicated tissues were analyzed by H&E staining. Scale bar, 50 μm. The results represented the mean of at least three independent transfection experiments; two individual mice were treated in every experiment, and three lobes of the liver, representing three different sites in the liver, were obtained from each mouse. Student t test was used to compare the mean relative values between groups. Error bars indicate SEM (*p b 0.05).

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

Fig. 5 (continued).

U

N

C

O

R

R

E

C

T

E

D

P

R O

O

F

14

590 591 592 593 594 595 596 597 598 599 600 601

The ATM protein is the principal regulator of the DNA damage response in response to ionizing radiation [25,36]. ATM phosphorylates more than 700 proteins involved in cell cycle control, DNA repair, apoptosis and modulation of chromatin structure, including p53, Brca1, Chk2, 53BP1, SMC-1 and histone H2AX [22]. However, increasing evidence indicated that ATM was also present in glucose metabolism regulation [37,38]. For example, ATM inhibition resulted in decreased GLUT4 translocation in L6 muscle cells in an Akt-dependent manner, whereas ATM did not directly phosphorylate Akt [39–41]. ATM was also present in the insulin signal transduction pathway via phosphorylation of the eukaryotic initiation factor-4E-binding protein 1 [42]. ATM−/− mice exhibited abnormalities in glucose-stimulated insulin

secretion and decreased serum C-peptide levels as they aged [43,44]. In addition, A-T patients also displayed signs of abnormalities in glucose homeostasis and diabetes mellitus (DM) developed in nearly 25% of the A-T patients who survive to age 30 [45,46]. Although symptoms of insulin resistance and an increased incidence of type 2 diabetes have been noted in A-T patients for the past four decades, elucidation of the pathophysiology of DM in ATM has been limited. In this study, our results showed that HNF1α was a new substrate of ATM with an apparent direct phosphorylation of HNF1α at Ser 249 by ATM. Coimmunoprecipitation assays confirmed the association between HNF1α and ATM, and the mutation in S249 did not affect their interaction; ATM kinase dead (kd) mutant interacted with HNF1α and

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

602 603 604 605 606 607 608 609 610 611 612 613

15

N C O

R

R

E

C

T

E

D

P

R O

O

F

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

U

Fig. 6. ATM enhances the transcriptional activity of HNF1α. (A) Various amounts (200, 400, or 800 ng) of Flag-ATM (ATM) or Flag-ATM kinase-dead (ATM (mut)), 20 ng of pcDNA3.1HNF1α-Myc or pcDNA3.1-HNF1αS249A-Myc, 200 ng of pGL3-AFP and 10 ng of pRL-TK were co-transfected into the ATM−/− cells for 24 h. (B) 200 ng of pGL3-AFP, 10 ng of pRL-TK, 20 ng of pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl), and 800 ng of Flag-ATM or control vector (pCMV-Flag) were co-transfected into the ATM−/− cells as indicated. After 24 h, the cells were treated with 10 Gy γ-ray irradiation or left untreated. (C) 200 ng of pGL3-AFP, 10 ng of pRL-TK, and 20 ng of pcDNA3.1-HNF1α-Myc (WT) or pcDNA3.1-HNF1αS249A-Myc (S249A) or pcDNA3.1-His/Myc B (ctrl) were cotransfected into HepG2 cells. After 24 h, the cells were treated with KU-55933 at the indicated concentrations for 6 h. For A-C, luciferase activity was normalized by the Renilla activity present in each cellular lysate; all experiments were performed in duplicate and repeated at least 3 times; the results were presented as fold inductions relative to the activity of cells cotransfected with control vector, pGL3-AFP and pRL-TK only, taken as 1.0. Student t test was used to compare the mean relative values between groups (* p b 0.05). (D) Gene expression was measured using real-time PCR in HepG2 cells and RINm5F cells after treated with 20 ng/μl KU-55933 for 6 h. The mitATPase6 served as a housekeeping gene. The values represent fold inductions relative to the mRNA level of cells treated with DMSO, taken as 1.0. The results were the mean ± SEM of triplicate experiments. Student t test was used to compare the mean relative values between groups (*p b 0.05). Western blotting was executed to manifest the amount of HNF1α/HNF1αS249A in each reaction.

614 615 616 617 618 619 620 621 622

S249A as well (Supplement Fig. S3). The use of a cell line derived from A-T patients, in addition to our observation using inhibitors for ATM in HepG2 cells, which excludes a compensatory mechanism, supports a physiological role for ATM in HNF1α activation. HNF1α controls multiple genes implicated in metabolic functions in the liver, kidney, intestine and pancreatic islets [7]. Previous in vitro and in vivo studies have shown that dominant-negative mutants of HNF1α increase the expression of the cell cycle inhibitor p27, decrease cell proliferation, increase the basal apoptosis rate, and render the cells

vulnerable to activation of the mitochondrial apoptosis pathway [23, 47]. Moreover, dominant-negative suppression of HNF1α caused downregulation of PI-3 K/Akt, resulting in apoptosis in INS-1 cells [47]. Thus, insulin resistance in A-T patients can be partially explained by the lack of HNF1α S249 phosphorylation, and the subsequent decrease in the expression of target genes, such as insulin and GLUT2. Briefly, we documented a novel putative phosphorylation site in HNF1α Ser249 and found that the ATM protein kinase was involved in HNF1α Ser249 phosphorylation in vitro and in vivo. Compared with

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

623 624 625 626 627 628 629 630 631

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

U

N

C

O

R

R

E

C

T

E

D

P

R O

O

F

16

632 633 634 635 636 637 638 639 640 641 642

Fig. 6 (continued).

wild-type HNF1α, a mutation in Ser249 resulted in a pronounced decrease in HNF1α transactivation, whereas no dominant-negative effect was observed. The S249A mutant showed normal nuclear localization but decreased DNA-binding activity. Accordingly, functional studies of HNF1αSer249 mutant revealed a defect in glucose metabolism. Overexpression of ATM but not kinase-dead ATM induces HNF1α activity. Thus, the present findings provided valuable insights into the yetundiscovered mechanisms of ATM in the regulation of glucose homeostasis. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.bbagrm.2014.05.001.

Acknowledgements

643

This work was supported by the Natural Science Foundation of Beijing of China: 7122122, National Natural Science Foundation of China: 31271267, National Program on Key Basic Research Project: 2013CB910800.

644 645

References

648

646 647

[1] D.B. Mendel, G.R. Crabtree, HNF-1, a member of a novel class of dimerizing 649 homeodomain proteins, J. Biol. Chem. 266 (1991) 677–680. 650

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

L. Zhao et al. / Biochimica et Biophysica Acta xxx (2014) xxx–xxx

N C O

R

R

E

C

D

P

R O

O

F

[25] J.M. Servitja, M. Pignatelli, M.A. Maestro, C. Cardalda, S.F. Boj, J. Lozano, E. Blanco, A. Lafuente, M.I. McCarthy, L. Sumoy, R. Guigo, J. Ferrer, Hnf1alpha (MODY3) controls tissue-specific transcriptional programs and exerts opposed effects on cell growth in pancreatic islets and liver, Mol. Cell. Biol. 29 (2009) 2945–2959. [26] A. Peeters, P. Fraisl, S. van den Berg, E. Ver Loren van Themaat, A. Van Kampen, M.H. Rider, H. Takemori, K.W. van Dijk, P.P. Van Veldhoven, P. Carmeliet, M. Baes, Carbohydrate metabolism is perturbed in peroxisome-deficient hepatocytes due to mitochondrial dysfunction, AMP-activated protein kinase (AMPK) activation, and peroxisome proliferator-activated receptor gamma coactivator 1alpha (PGC1alpha) suppression, J. Biol. Chem. 286 (2011) 42162–42179. [27] C.E. Canman, D.S. Lim, K.A. Cimprich, Y. Taya, K. Tamai, K. Sakaguchi, E. Appella, M.B. Kastan, J.D. Siliciano, Activation of the ATM kinase by ionizing radiation and phosphorylation of p53, Science 281 (1998) 1677–1679. [28] Y. Shiloh, E. Tabor, Y. Becker, Abnormal response of ataxia-telangiectasia cells to agents that break the deoxyribose moiety of DNA via a targeted free radical mechanism, Carcinogenesis 4 (1983) 1317–1322. [29] A.J. Whitmarsh, R.J. Davis, Regulation of transcription factor function by phosphorylation, Cell. Mol. Life Sci. 57 (2000) 1172–1183. [30] L. Tomei, R. Cortese, R.A. De Francesco, POU-A related region dictates DNA binding specificity of LFB1/HNF1 by orienting the two XL-homeodomains in the dimer, EMBO J. 11 (1992) 4119–4129. [31] S. Ellard, Hepatocyte nuclear factor 1 alpha (HNF-1 alpha) mutations in maturityonset diabetes of the young, Hum. Mutat. 16 (2000) 377–385. [32] H. Guo, C. Gao, Z. Mi, P.Y. Wai, P.C. Kuo, Phosphorylation of Ser158 regulates inflammatory redox-dependent hepatocyte nuclear factor-4alpha transcriptional activity, Biochem. J. 394 (2006) 379–387. [33] K.L. Clark, E.D. Halay, E. Lai, S.K. Burley, Co-crystal structure of the HNF-3/fork head DNA-recognition motif resembles histone H5, Nature 364 (1993) 412–420. [34] D.T. Odom, N. Zizlsperger, D.B. Gordon, G.W. Bell, N.J. Rinaldi, H.L. Murray, T.L. Volkert, J. Schreiber, P.A. Rolfe, D.K. Gifford, E. Fraenkel, G.I. Bell, R.A. Young, Control of pancreas and liver gene expression by HNF transcription factors, Science 303 (2004) 1378–1381. [35] I. Kyrmizi, P. Hatzis, N. Katrakili, F. Tronche, F.J. Gonzalez, I. Talianidis, Plasticity and expanding complexity of the hepatic transcription factor network during liver development, Genes Dev. 20 (2006) 2293–2305. [36] Y. Xu, D. Baltimore, Dual roles of ATM in the cellular response to radiation and in cell growth control, Genes Dev. 10 (1996) 2401–2410. [37] K. Zhou, C. Bellenguez, C.C. Spencer, A.J. Bennett, R.L. Coleman, R. Tavendale, S.A. Hawley, L.A. Donnelly, C. Schofield, C.J. Groves, L. Burch, F. Carr, A. Strange, C. Freeman, J.M. Blackwell, E. Bramon, M.A. Brown, J.P. Casas, A. Corvin, N. Craddock, P. Deloukas, S. Dronov, A. Duncanson, S. Edkins, E. Gray, S. Hunt, J. Jankowski, C. Langford, H.S. Markus, C.G. Mathew, R. Plomin, A. Rautanen, S.J. Sawcer, N.J. Samani, R. Trembath, A.C. Viswanathan, N.W. Wood, L.W. Harries, A.T. Hattersley, A.S. Doney, H. Colhoun, A.D. Morris, C. Sutherland, D.G. Hardie, L. Peltonen, M.I. McCarthy, R.R. Holman, C.N. Palmer, P. Donnelly, E.R. Pearson, Common variants near ATM are associated with glycemic response to metformin in type 2 diabetes, Nat. Genet. 43 (2011) 117–120. [38] D.Q. Yang, M.J. Halaby, Y. Li, J.C. Hibma, P. Burn, Cytoplasmic ATM protein kinase: an emerging therapeutic target for diabetes, cancer and neuronal degeneration, Drug Discov. Today 16 (2011) 332–338. [39] Q. Wang, R. Somwar, P.J. Bilan, Z. Liu, J. Jin, J.R. Woodgett, A. Klip, Protein kinase B/Akt participates in GLUT4 translocation by insulin in L6 myoblasts, Mol. Cell. Biol. 19 (1999) 4008–4018. [40] J.G. Viniegra, N. Martinez, P. Modirassari, J. Hernandez Losa, C. Parada Cobo, V.J. Sanchez-Arevalo Lobo, C.I. Aceves Luquero, L. Alvarez-Vallina, S. Ramony Cajal, J. M. Rojas, R. Sanchez-Prieto, Full activation of PKB/Akt in response to insulin or ionizing radiation is mediated through ATM, J. Biol. Chem. 280 (2005) 4029–4036. [41] M.J. Halaby, J.C. Hibma, J. He, D.Q. Yang, ATM protein kinase mediates full activation of Akt and regulates glucose transporter 4 translocation by insulin in muscle cells, Cell. Signal. 20 (2008) 1555–1563. [42] D.Q. Yang, M.B. Kastan, Participation of ATM in insulin signalling through phosphorylation of eIF-4E-binding protein 1, Nat. Cell Biol. 2 (2000) 893–898. [43] P.D. Miles, K. Treuner, M. Latronica, J.M. Olefsky, C. Barlow, Impaired insulin secretion in a mouse model of ataxia telangiectasia, Am. J. Physiol. Endocrinol. Metab. 293 (2007) E70–E74. [44] D. Wu, H. Yang, W. Xiang, L. Zhou, M. Shi, G. Julies, J.M. Laplante, B.R. Ballard, Z. Guo, Heterozygous mutation of ataxia-telangiectasia mutated gene aggravates hypercholesterolemia in apoE-deficient mice, J. Lipid Res. 46 (2005) 1380–1387. [45] D.S. Schalch, D.E. McFarlin, M.H. Barlow, An unusual form of diabetes mellitus in ataxia telangiectasia, N. Engl. J. Med. 282 (1970) 1396–1402. [46] R.S. Bar, W.R. Levis, M.M. Rechler, L.C. Harrison, C. Siebert, J. Podskalny, J. Roth, M. Muggeo, Extreme insulin resistance in ataxia telangiectasia: defect in affinity of insulin receptors, N. Engl. J. Med. 298 (1978) 1164–1171. [47] H. Wobser, C. Bonner, J.J. Nolan, M.M. Byrne, J.H. Prehn, Downregulation of protein kinase B/Akt-1 mediates INS-1 insulinoma cell apoptosis induced by dominantnegative suppression of hepatocyte nuclear factor-1alpha function, Diabetologia 49 (2006) 519–526

E

T

[2] T.A. Ceska, M. Lamers, P. Monaci, A. Nicosia, R. Cortese, D. Suck, The X-ray structure of an atypical homeodomain present in the rat liver transcription factor LFB1/HNF1 and implications for DNA binding, EMBO J. 12 (1993) 1805–1810. [3] Y.I. Chi, J.D. Frantz, B.C. Oh, L. Hansen, S. Dhe-Paganon, S.E. Shoelson, Diabetes mutations delineate an atypical POU domain in HNF-1alpha, Mol. Cell 10 (2002) 1129–1137. [4] D.Q. Shih, M. Bussen, E. Sehayek, M. Ananthanarayanan, B.L. Shneider, F.J. Suchy, S. Shefer, J.S. Bollileni, F.J. Gonzalez, J.L. Breslow, M. Stoffel, Hepatocyte nuclear factor-1alpha is an essential regulator of bile acid and plasma cholesterol metabolism, Nat. Genet. 27 (2001) 375–382. [5] M. Pontoglio, J. Barra, M. Hadchouel, A. Doyen, C. Kress, J.P. Bach, C. Babinet, M. Yaniv, Hepatocyte nuclear factor 1 inactivation results in hepatic dysfunction, phenylketonuria, and renal Fanconi syndrome, Cell 84 (1996) 575–585. [6] D.Q. Shih, S. Screenan, K.N. Munoz, L. Philipson, M. Pontoglio, M. Yaniv, K.S. Polonsky, M. Stoffel, Loss of HNF-1alpha function in mice leads to abnormal expression of genes involved in pancreatic islet development and metabolism, Diabetes 50 (2001) 2472–2480. [7] M. Pontoglio, Hepatocyte nuclear factor 1, a transcription factor at the crossroads of glucose homeostasis, J. Am. Soc. Nephrol. 11 (Suppl. 16) (2000) S140–S143. [8] K. Yamagata, N. Oda, P.J. Kaisaki, S. Menzel, H. Furuta, M. Vaxillaire, L. Southam, R.D. Cox, G.M. Lathrop, V.V. Boriraj, X. Chen, N.J. Cox, Y. Oda, H. Yano, M.M. Le Beau, S. Yamada, H. Nishigori, J. Takeda, S.S. Fajans, A.T. Hattersley, N. Iwasaki, T. Hansen, O. Pedersen, K.S. Polonsky, G.I. Bell, Mutations in the hepatocyte nuclear factor1alpha gene in maturity-onset diabetes of the young (MODY3), Nature 384 (1996) 455–458. [9] L. Bjorkhaug, J.V. Sagen, P. Thorsby, O. Sovik, A. Molven, P.R. Njolstad, Hepatocyte nuclear factor-1 alpha gene mutations and diabetes in Norway, J. Clin. Endocrinol. Metab. 88 (2003) 920–931. [10] H.M. van Wering, I.L. Huibregtse, S.M. van der Zwan, M.S. de Bie, L.N. Dowling, F. Boudreau, E.H. Rings, R.J. Grand, S.D. Krasinski, Physical interaction between GATA-5 and hepatocyte nuclear factor-1alpha results in synergistic activation of the human lactase-phlorizin hydrolase promoter, J. Biol. Chem. 277 (2002) 27659–27667. [11] M. Yu, J. Wang, W. Li, Y.Z. Yuan, C.Y. Li, X.H. Qian, W.X. Xu, Y.Q. Zhan, X.M. Yang, Proteomic screen defines the hepatocyte nuclear factor 1alpha-binding partners and identifies HMGB1 as a new cofactor of HNF1alpha, Nucleic Acids Res. 36 (2008) 1209–1219. [12] C. Mitchelmore, J.T. Troelsen, N. Spodsberg, H. Sjostrom, O. Noren, Interaction between the homeodomain proteins Cdx2 and HNF1alpha mediates expression of the lactase-phlorizin hydrolase gene, Biochem. J. 346 (Pt 2) (2000) 529–535. [13] E. Soutoglou, B. Viollet, M. Vaxillaire, M. Yaniv, M. Pontoglio, I. Talianidis, Transcription factor-dependent regulation of CBP and P/CAF histone acetyltransferase activity, EMBO J. 20 (2001) 1984–1992. [14] N. Miura, K. Iwai, I. Miyamoto, Immunological characterization of hepatocyte nuclear factor 1 protein: appearance of hepatocyte nuclear factor 1 protein in developing mouse embryos, Eur. J. Cell Biol. 60 (1993) 376–382. [15] V. Carriere, M. Lacasa, M. Rousset, Activity of hepatocyte nuclear factor 1alpha and hepatocyte nuclear factor 1beta isoforms is differently affected by the inhibition of protein phosphatases 1/2A, Biochem. J. 354 (2001) 301–308. [16] S. Lim, K. Jin, E. Friedman, Mirk protein kinase is activated by MKK3 and functions as a transcriptional activator of HNF1alpha, J. Biol. Chem. 277 (2002) 25040–25046. [17] M. Yu, H.X. Guo, C. Hui, X.H. Wang, C.Y. Li, Y.Q. Zhan, C.H. Ge, X.M. Yang, 14-3-3zeta interacts with hepatocyte nuclear factor 1alpha and enhances its DNA binding and transcriptional activation, Biochim. Biophys. Acta 1829 (2013) 970–979. [18] M. Galan, C.M. Garcia-Herrero, S. Azriel, M. Gargallo, M. Duran, J.J. Gorgojo, V.M. Andia, M.A. Navas, Differential effects of HNF-1alpha mutations associated with familial young-onset diabetes on target gene regulation, Mol. Med. 17 (2011) 256–265. [19] A. Khalil, R.N. Morgan, B.R. Adams, S.E. Golding, S.M. Dever, E. Rosenberg, L.F. Povirk, K. Valerie, ATM-dependent ERK signaling via AKT in response to DNA double-strand breaks, Cell Cycle 10 (2011) 481–491. [20] Y. Zhang, A. Dimtchev, A. Dritschilo, M. Jung, Ionizing radiation-induced apoptosis in ataxia-telangiectasia fibroblasts. Roles of caspase-9 and cellular inhibitor of apoptosis protein-1, J. Biol. Chem. 276 (2001) 28842–28848. [21] Y. Li, D.Q. Yang, The ATM inhibitor KU-55933 suppresses cell proliferation and induces apoptosis by blocking Akt in cancer cells with overactivated Akt, Mol. Cancer Ther. 9 (2010) 113–125. [22] S. Matsuoka, B.A. Ballif, A. Smogorzewska, E.R. McDonald, K.E. Hurov III, J. Luo, C.E. Bakalarski, Z. Zhao, N. Solimini, Y. Lerenthal, Y. Shiloh, S.P. Gygi, S.J. Elledge, ATM and ATR substrate analysis reveals extensive protein networks responsive to DNA damage, Science 316 (2007) 1160–1166. [23] Q. Yang, K. Yamagata, K. Fukui, Y. Cao, T. Nammo, H. Iwahashi, H. Wang, I. Matsumura, T. Hanafusa, R. Bucala, C.B. Wollheim, J. Miyagawa, Y. Matsuzawa, Hepatocyte nuclear factor-1alpha modulates pancreatic beta-cell growth by regulating the expression of insulin-like growth factor-1 in INS-1 cells, Diabetes 51 (2002) 1785–1792. [24] J. Borlak, M. Niehof, HNF4alpha and HNF1alpha dysfunction as a molecular rational for cyclosporine induced posttransplantation diabetes mellitus, PLoS One 4 (2009) e4662.

U

651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674 675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728

17

807

Please cite this article as: L. Zhao, et al., Serine 249 phosphorylation by ATM protein kinase regulates hepatocyte nuclear factor-1α transactivation, Biochim. Biophys. Acta (2014), http://dx.doi.org/10.1016/j.bbagrm.2014.05.001

729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744 745 746 747 748 749 750 751 752 753 754 755 756 757 758 759 760 761 762 763 764 765 766 767 768 769 770 771 772 773 774 775 776 777 778 779 780 781 782 783 784 785 786 787 788 789 790 791 792 793 794 795 796 797 798 799 800 801 802 803 804 805 806