Serum amyloid A (SAA) mRNA expression in chicken and quails in response to bacterial stress

Journal Pre-proof Serum amyloid A (SAA) mRNA expression in chicken and quails in response to bacterial stress Prince Pal Singh, Satparkash Singh, B.V. Sunil Kumar, R.S. Sethi, Ramneek Verma

PII:

S0147-9571(20)30009-6

DOI:

https://doi.org/10.1016/j.cimid.2020.101421

Reference:

CIMID 101421

To appear in:

Comparative Immunology, Microbiology and Infectious Diseases

Received Date:

29 July 2019

Revised Date:

11 December 2019

Accepted Date:

3 January 2020

Please cite this article as: Pal Singh P, Singh S, Kumar BVS, Sethi RS, Verma R, Serum amyloid A (SAA) mRNA expression in chicken and quails in response to bacterial stress, Comparative Immunology, Microbiology and Infectious Diseases (2020), doi: https://doi.org/10.1016/j.cimid.2020.101421

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Serum amyloid A (SAA) mRNA expression in chicken and quails in response to bacterial stress Prince Pal Singh1, Satparkash Singh1*, B.V. Sunil Kumar1, R.S. Sethi1 and Ramneek Verma1 Affiliations of authors: 1College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, India-141004

ro of

*Corresponding author affiliation and contact information: Dr Satparkash Singh, Assistant Professor, College of Animal Biotechnology, Guru Angad Dev Veterinary and Animal Sciences University

-p

Ph. No. 8427760769

lP

re

[email protected]

Highlights

Jo

ur

 

SAA gene was significantly over-expressed in case of birds under bacterial stress when compared to un-inoculated control birds SAA gene expression was higher in case of quails than RIR SAA gene from RIR chicken and quails were closely related to each other but distantly related to other species like humans, dogs and ruminants

na



1

ABSTRACT Monitoring of acute phase proteins such as serum amyloid A at gene expression level may provide quick information about immune status of the host and its susceptibility towards

ro of

common infections. Present study was carried out to evaluate and compare the mRNA

expression of SAA gene in Rhode Island Red chicken (RIR) and Japanese quails using real time PCR analysis in response to inactivated Salmonella gallinarum culture. The results

-p

showed that expression of SAA gene was approximately 17-33 folds higher in case of birds

administered with bacterial culture when compared to un-inoculated controls and expression

re

was higher and quicker in case of quails than RIR chicken. The SAA genes from chicken and

lP

quail were cloned and upon sequence analysis it was observed that deduced amino acid sequence of SAA from chicken and quails were having approximately seven percent variation

na

which might have significance in function of this protein in these species.

Jo

ur

Key words: Chicken, Japanese quail, serum amyloid A, expression, real time PCR, cloning

2

1.

Introduction Development in poultry production potential has led to emergence of diseases despite

comprehensive control measures. The degree of resistance to infections in birds varies from

ro of

species to species with the underlying cause still yet not been well established and a simple

and detailed understanding of resistance factors is rare, especially in poultry. Improvement of herd immunity through selection of disease resistant breeds/varieties is seen as environmental

-p

friendly measure to combat various diseases without the use of antimicrobials and reducing

cost to the poultry farmers. The studies which are focussed on characterization and analysis

lP

effective breeding programmes.

re

of components of innate immunity might help in herd immunity or making strategies for

Innate immunity to the infections is the inherent capacity of the host to develop resistance

na

against disease causing agent without any earlier exposure to that pathogen. Recent studies revealed that innate immunity is required for the optimum functionality of acquired immunity

ur

as most of the receptors of antigen are not encoded in the germ line [1].

Jo

The innate immune system is very diverse and includes physical barriers, acute phase responses, phagocytes, complement and toll-like receptors which serve to prevent infection, eliminate potential pathogens, and initiate inflammatory process. The acute phase response (APR) is part of the early-defence or innate immune system, which is triggered by different stimuli including trauma, infection, stress, neoplasia, and inflammation. The APR results in a

3

complex systemic reaction with the goal of re-establishing homeostasis and promoting healing [2]. The acute phase proteins (APPs) such as Ceruloplasmin, Mannose binding lectin, Serum Amyloid A (SAA), haptoglobin etc. are the serum proteins synthesized by hepatocytes as a part of acute phase response. Their plasma concentration becomes higher during the earliest phase of infection and concentration is directly related to magnitude of infection or amount of exposure to pathogen. Serum concentrations of these proteins provide valuable information

ro of

about the prognosis of various diseases, and monitoring the health status of animals [3].

Among these acute phase reactants, SAA is a major vertebrate APP and often considered as the most sensitive protein of the APR in most species. SAA can be induced from resting

-p

levels by more than 1000 fold, implying an important beneficial role in host defence. It

re

opsonizes gram-negative bacteria and induces protective responses from macrophages and neutrophils [4].

lP

Quails possess better disease resistance quality than those of chickens and have been chosen for its economical viability in farming [5]. Japanese quails (Coturnix japonica) are

na

well known for their adaptability and high disease resistance however their genetic potential has not been fully exploited and very scanty information is available regarding evaluation and

ur

characterisation of immune response mediators in quails. Host’s response to certain pathogens is dependent on the genetic regulation of factors responsible for its natural

Jo

resistance toward diseases which determines its susceptibility or resistance to that pathogen. The gene expression of APPs especially SAA can be exploited to study the underlying cause of the difference in innate immune response of avian species. There are currently no studies on the comparative expression or sequence characterization of SAA gene in Rhode Island Red (RIR) chicken (Gallus gallus) and Japanese quails in response to infection. Sequence 4

characterisation of genes or proteins involved in immune response mechanism is important because genetic differences or variations in the sequence of the genes coding for such proteins may be responsible for increased susceptibility or resistance towards diseases. Keeping in view the significance of SAA in innate immunity, we carried out molecular cloning and sequence analysis of SAA gene from these birds in addition to comparative expression studies on SAA gene using Real time PCR in RIR chicken and Japanese quails when subjected to bacterial stress.

2.

ro of

Material and methods

2.1. Bacterial strains and vectors

-p

Experimental birds were administered with inactivated culture of Salmonella

gallinarum obtained from National Centre for Veterinary Type Cultures (NCVTC), Hisar,

re

India. The organisms obtained from NCVTC were subcultured on Hektoen Enteric Agar (HEA), Brain Heart Infusion (BHI) agar or BHI broth (Himedia, Mumbai, India). BHI grown

lP

bacteria were serially diluted ten folds in sterile phosphate buffered saline and plated on BHI agar plate to calculate the colony forming units (CFU) as per standard bacteriological

na

procedure. The desired dilution containing approximately 108 CFU/ml was inactivated by subjecting the culture to 100oC for about 30 min in a water bath. The inactivated suspension

ur

was inoculated on BHI and HEA and incubated for 24 h at 37oC to confirm the non viability of the bacterial culture. The suspension of inactivated culture was stored at 4oC for further

Jo

use. pGEM-T Easy cloning vector (Promega, Durham, USA), and Top10 strain of E. coli (Invitrogen, Massachusetts, USA) were used for the cloning experiments. 2.2.

Birds

All the animal experiments were performed after obtaining permission from Institutional Animal Ethics Committee (IAEC/2018/1153-1188 dated 28.9.2018). Institutional Biosafety 5

Committee permission (GADVASU/IBSC/18/1 dated 29.8.18) was also obtained to carry out recombinant DNA work. One to three days old RIR chicken (n=28) and Japanese quails (n=28) procured from hatchery unit under, Directorate of livestock farms, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab were used. These were fed ad libitum and provided fresh water. Birds of each variety were further subdivided into 2 groups of 14 each i.e. treatment (birds administered with inactivated S. gallinarum culture) and control (un-inoculated birds). For the treatment group, chicken and quails 4-5 days of age

ro of

were orally given 0.1 ml suspension (equivalent to approx. 107 CFU/dose) of inactivated culture of S. gallinarum prepared as above[6].

-p

2.3. Isolation of total RNA and synthesis of complementary DNA (cDNA)

Liver tissues were collected for RNA isolation from six birds each at 12 h and 24 h post

re

inoculation in treatment groups. Similarly in control groups samples were collected from six

lP

birds each at same time as that of treatment group. Tissues were preserved in RNAlater (Sigma-Aldrich, Steinheim, Germany) at -80oC until processed. RNA isolation was carried

na

out using TRI Reagent (Sigma-Aldrich, Steinheim, Germany) following manufacturers protocol. The isolated RNA was finally suspended in appropriate volume (20µl) of nuclease

ur

free water and incubated at 55oC for 10 min to ensure total re-suspension and avoiding formation of secondary structures of RNA. The concentration and purity of the extracted

Jo

RNA was measured in Nanodrop spectrophotometer (Thermo Scientific, Wilmington, USA). The ratio of OD260 and OD280 was observed to check purity of the extracted nucleic acid. Complementary DNA was synthesized from isolated RNA from different samples using AccuScript High Fidelity Reverse Transcriptase cDNA synthesis kit (Agilent Technologies, Santa Clara, USA) following the manufacturer’s instructions. 2.4. Real time PCR 6

Quantitative analysis of SAA gene expression in liver tissue of birds administered with inactivated S. gallinarum culture as compared to un-inoculated birds was done by real timePCR assay to compare the relative levels of mRNA within biological samples under study. cDNA obtained as above was confirmed by using primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene. Primers for real time PCR for GAPDH gene and SAA gene from RIR chicken were as described previously [7]. SAA primers for Japanese quail (Forward:TGCTGACAACCCATTCTCCA and Reverse:TTGTCGGCACCGATGTAGTT)

ro of

were designed on the basis of predicted sequence of SAA protein like sequence (NCBI accession no. XM_015864182.1).

cDNA obtained from liver tissue from quails and chicken were separately used as

-p

template in real time PCR using Power UpTM SYBRR Green master mix (Applied

Biosystems, Beverly, USA). GAPDH gene was used as an internal control in this study.

re

Cycling conditions of real time PCR reaction started at 50oC for 2 min pre run followed by

lP

initial denaturation at 95°C for 10 min and 40 cycles of amplification at 95°C for 10 s, 60°C for 30s, followed by melt curve analysis at 65oC to 95°C. Each qRT-PCR plate contained

amplification.

na

samples run in duplicate and a non template control (NTC) was always kept for any false

ur

After 40 cycles of amplification, threshold cycle (Ct) value was obtained for each sample. The n-fold change expression between treatment & control group of birds was

Jo

calculated by 2-ΔΔct [8]. Statistical analyses were performed to compare expression profiles of SAA gene in control verses inoculated birds by one way Analysis of Variance (Post hoc Duncan’s analysis). 2.5. Cloning and sequence analysis of SAA gene Primers for SAA from RIR chicken (Forward: GGGGCTTCACTTCCACCTGACCTCC and Reverse: CCAAACGCAGCAGTTTCTTTATTGGGC) were designed using available 7

predicted sequence of SAA gene (NCBI reference sequence XM_015286662.2). Similarly the primers for quail (Forward: CCATGAGGCTCTGTATCTG and Reverse: GGAACAGAGAGACTTCAG) were designed on the basis of predicted sequence of the gene in quail (NCBI accession no. XM_015864182.1). PCR reactions were carried out with HotStar Taq master mix (Qiagen, Hilden, Germany) using respective cDNA following manufacturer’s protocol. The reaction contents were thoroughly mixed and placed in a thermocycler (Bio-Rad, Hercules, CA, USA). The cycling

ro of

conditions employed for SAA gene from RIR chicken were initial denaturation at 95oC for 15 min and 35 cycles of denaturation at 94oC for 30 s, annealing at 58oC for 45 s and extension at 72oC for 45 s followed by final extension at 72°C for 5 min. For gene from quails,

-p

annealing temperature was kept 50oC and rest of the conditions was same. PCR products were analysed on 1.5% agarose gel.

re

Each of the gel purified PCR products (SAA gene amplicons from chicken and quails)

lP

was separately ligated with pGEM-T Easy cloning vector (Promega, Durham, USA). Restriction enzyme digestion was done using EcoRI (Thermo Scientific, Wilmington, USA)

na

to release the inserts of desired sizes for confirmation of clones. Clones with the specific insert were selected and their stab cultures were prepared in semisolid agar with ampicillin

ur

(100µg/ml). The overnight grown stab cultures were sent to University of Delhi, South Campus (UDSC) for sequencing and the sequences were submitted to NCBI (BankIt).

Jo

For sequence analysis the nucleotide sequences of the SAA gene from RIR chicken and

Japanese quails deduced in the present study, published SAA gene sequences from other species such as Anser anser domesticus (Goose), Anas platyrhynchos (Duck) and sequence available at NCBI in predicted form viz. Meleagris gallopavo (Turkey), Phasianus colchicus (Common Pheasant), Numida meleagris (Helmeted Guineafowl), predicted sequences of SAA gene from C. japonica (Japanese quail) (XM_015864182.1) and G. gallus (Red jungle 8

fowl) (XM_015286662.2) were subjected to alignment using blastn program of the NCBI. The deduced amino acid sequences from RIR chicken and quail were also compared. Further, these sequences were used to carry out phylogenetic analysis of SAA gene using maximum likelihood model with 100 bootstrap replicates in Molecular Evolutionary Genetic Analysis (MEGA) 6.0 version software [9].

3.

Results

ro of

3.1. Real Time PCR The comparison of SAA gene expression between treatment (inoculated with bacterial culture) and control (un-inoculated) birds was expressed as n-fold change [8]. The assay

revealed approximately 17-33 folds higher and significant (p≤0.05) mRNA expression in

-p

liver tissue from birds post administration of inactivated bacterial culture when compared to

re

control birds (Fig. 1). In RIR chicken of the treatment group, the expression of SAA mRNA at 12 h and 24 h when compared to control birds was respectively 17 and 22 folds higher,

lP

however the difference between these time intervals was not significant. Although Japanese quails also expressed high levels of SAA in treated birds compared to control birds, the

na

expression at 12 h was much higher compared to RIR chickens (Fig.1). 3.2. Cloning and sequence analysis of SAA gene

ur

Upon agarose gel electrophoresis the amplicons of size ~521 bp and ~400 bp were

Jo

observed in case of RIR chicken and quails respectively (Fig. 2). Plasmids isolated from the overnight grown cells of the clones when subjected to restriction enzyme digestion using EcoR1 enzyme released inserts of ~521 bp (Fig. 3) and ~400 bp (Fig. 4) in chicken and quails, respectively. The clones were sequenced and sequences obtained were submitted to BankIt for submission into the GenBank database (Accession nos. MN193049 and MN192427, for RIR chicken and Japanese quail, respectively). Blastn results revealed that 9

SAA gene sequence of RIR chicken was approx 99.7, 95.0, 94.5, 92.4, 92.1, 91.6, 84.0 and 83.0 percent homologous to predicted sequences of G. gallus (XM_015286662.2), P. colchicus, M. gallopavo, C. japonica (this study), C. japonica (predicted sequence; XM_015864182.1), N. meleagris, A. domesticus and A. platyrhynchos, respectively. A similar pattern with high similarity to C. japonica (predicted sequence; XM_015864182.1), M. gallopavo, P. colchicus and RIR (present study) was observed in quail sequence obtained in the present study. Although seems closely related, the percent non-homology of deduced

ro of

amino acid of SAA between RIR chicken and Japanese quail was approximately seven percent. In phylogenetic analysis which depicts evolutionary relationship between different

species, the sequence of chicken was placed close to P. colchicus and M. gallapavo and was

-p

distant from Japanese quails. Further, the A. domesticus and A. platyrhynchos were closely

related to each other but most distantly placed with respect to chicken or Japanese quails in

Discussion

lP

4.

re

the phylogenetic tree (Fig. 5).

Real time PCR assay was carried out to determine the dynamics of SAA mRNA

na

expression in response to inactivated S. gallinarum culture. SAA was found to be significantly up regulated in the treatment groups of both RIR chicken and quails when

ur

compared with the control groups suggesting importance of SAA as APP in response to bacterial infection. This is the first study at the molecular levels to compare the expression of

Jo

acute phase reactants like SAA between chicken and quails and in fact it is first report to study molecular expression of SAA gene in quails. Interestingly, the mRNA expression of SAA gene in quails was significantly higher than that of RIR chicken and it reached maximum particularly at 12 h after infection whereas maximum response in chicken was at 24 h. This suggests a higher and faster APR in quails as compared to chicken which 10

strengthen the hypothesis that quails are more resistant to common poultry diseases [5]. Quails are regarded as hardy and highly adaptive poultry birds with studies showing that they are able to recover from pathogen infection compared to other birds. In a study [10], although the quails given New Castle disease virus strain Kudu 113 showed mild weakness and depression, the typical clinical signs of New Castle disease i.e. severe respiratory distress and diarrhoea were not present. Similarly, Prasath et al. [11] observed that severe symptoms were absent in quails infected with fowl cholera.

ro of

Previously, Yazdani et al. [6] used ELISA to carry out evaluation of APP and

inflammatory changes in 3 days old Iranian native chicken by challenging them with 0.5 ml of S. typhimurium culture containing 108 CFU and showed that the level of SAA in plasma

-p

peaked at 7 days PI in diseased birds compared with healthy birds and then began to decrease

re

to normal value. Similarly, in a study using highly sensitive and specific direct ELISA for quantification of SAA concentration in plasma samples two breeds of Geese (Anser anser

lP

domesticus) viz. Landes Grey and Hungarian White were inoculated with inactivated culture of Pasteurella multocida. Rapid acute phase responses in both breeds were observed in which

na

maximum concentration of SAA was seen at 24 h which returned to normal at 72 h post infection [12]. In another study using a real time PCR analysis to monitor haptoglobin

ur

concentration in response to bacterial stress in the form of Streptococcus suis in pigs (Sus domesticus), a significant variation in mRNA expression between the treated and control

Jo

animals was reported [13].

The SAA gene clones were sequenced and analysis of the gene sequences from the

present study revealed relationships between RIR chicken and quail when compared to other bird species. The phylogram also depicts the similar pattern to sequence analysis using blastn. However, approx. seven percent difference in homology sequence between RIR chicken and 11

quails observed in this study might attribute to variation in protein functions between these species which can be studied further for its impact on acute phase response. This is the first study to clone and sequence the SAA gene in RIR chicken and Japanese quails. Ovelgonne et al. [14] carried out experiment to relate the structural differences between the amyloid precursor protein SAA in susceptibility to amyloid arthropathy in case of Brown and White Layer breed of chicken. However, not much difference was observed between the sequence of SAA mRNAs from both chicken breeds and it was concluded that

ro of

higher susceptibility of brown breed to amyloid arthropathy might be due to some other factors also.

It is important to sequence the genes encoding for factors of innate immunity or APR

-p

such as SAA, because sequence variation or polymorphism in these gene sequences could be

re

determining factor for susceptibility or resistant to certain infections or diseases. Leveque et al. [15] studied whether the allelic variations in the TLR4 region, an important component of

lP

innate immunity, are linked to Salmonella infection in case of chickens through linkage analysis of resistant and susceptible chickens and found it to be associated with traits related

5.

Conclusions

na

to resistance from Salmonella in chicken.

ur

SAA gene was significantly over-expressed in case of birds under bacterial stress when compared to un-inoculated control birds and expression was higher and quicker in case of

Jo

quails than RIR chicken in the present study. Further the sequence analysis of SAA from these poultry birds revealed that a difference of approximately seven percent was observed between sequences of SAA from chicken and quails which might have some importance in structure and function of the SAA protein and its role in acute phase response in these species. 12

Author’s contributions Work is part of MSc research work of PPS, SS designed and supervised the work as major advisor, BVSK helped in analysis of molecular cloning work, RSS helped in real time PCR analysis, RV helped in manuscript editing. All authors approved the final version of the manuscript. Conflict of Interest Statement

ro of

None of the authors have any conflict of interest to declare. Acknowledgements

Authors are grateful to Director, College of Animal Biotechnology, Dean Post Graduate

-p

Studies and Director Research of GADVASU for providing funds and facilities for this

Jo

ur

na

lP

re

research.

13

References: [1] J.B. Owen, R.F.E. Axford, Breeding for disease resistance in farm animals, CAB Int, Wallingford. (1991) pp 499. [2] E.L. O’Reilly, P.D. Eckersall, Acute phase proteins: a review of their function, behaviour and measurement in chicken, Worlds Poult. Sci. J. 70 (2014) 27-44. [3] E.L. O’Reilly, R.J. Burchmore, V. Sandilands, N.H. Sparks, C. Walls, P.D. Eckersall,

abnormalities, Farm Anim. Proteomics (2013) 177-180.

ro of

The plasma proteome and acute phase proteins of broiler chickens with gait

-p

[4] C. Shah, R. Hari-Dass, J.G. Raynes, Serum amyloid A is an innate immune opsonin for gram-negative bacteria, Blood 108 (2006) 1751–1757.

re

[5] National Research Council (NRC), The quail bird. Board for Science and Technology for

lP

International Development, Academic Press, Washington, D. C, (1991) 147-155. [6] A. Yazdani, K. Asasi, S. Nazifi, Evaluation of acute-phase proteins and inflammatory

na

mediators changes in native chickens experimentally infected with Salmonella typhimurium, Comp. Clin. Path. 24 (2015) 733-739.

ur

[7] A.T. Marques, L. Nordio, C. Lecchi, G. Grilli, C. Giudice, F. Ceciliani, Widespread

Jo

extrahepatic expression of acute-phase proteins in healthy chicken (Gallus gallus) tissues, Vet. Immunol. Immunopathol. 190 (2017) 10-17.

[8] A. Berndt, A. Wilhelm, C. Jugert, J. Pieper, K. Sachse, U. Methner, Chicken cecum immune response to Salmonella enterica serovars of different levels of invasiveness, Infect. Immun. 75 (12) (2007) 5993-6007.

14

[9] K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version 6.0, Mol. Biol. Evol. 30 (12) (2013) 2725-2729. [10] S.B. Oladele, I. Enoch, S. Lawal, O.J. Ibu, Clinico-pathological features of Newcastle disease in Japanese quails (Coturnix coturnix japonica) infected with Newcastle disease virus Kudu 113 strain, Int. J. Poult. Sci. 7 (2) (2008) 165-168. [11] N.B. Prasath, J. Selvaraj, P. Ponnusamy, M. Sasikala, An outbreak of Pasteurellosis in

ro of

japanese quail chicks (coturnix coturnix japonica), Indian J. Anim. Health. 57 (2) (2018) 189-194.

[12] B. Kovacs, M. Toussaint, E. Gruys, I. Fabian, L. Szilagyi, J. Janan, P. Rudas, Evaluation

re

assay, Acta Vet. Hung. 55 (3) (2007) 349-357.

-p

of goose serum amyloid A acute phase response by enzyme-linked immunosorbent

[13] S. Knura-Deszczka, C. Lipperheide, B. Petersen, J.L. Jobert, F.B. Herault, M. Kobisch,

lP

F. Madec, Plasma haptoglobin concentration in swine after challenge with Streptococcus

na

suis, J. Vet. Med. B. 49 (2002) 240-244.

[14] J. H. Ovelgonne, W.J.M. Landman, E. Gruys, A. L. J. Gielkens, B. P. H. Peeters,

ur

Identical amyloid precursor proteins in two breeds of chickens which differ in susceptibility to develop amyloid arthropathy, Amyloid 8 (1) (2001) 41-51.

Jo

[15] G. Leveque, V. Forgetta, S. Morroll, A.L. Smith, N. Bumstead, P. Barrow, D. Malo, Allelic variation in TLR4 is linked to susceptibility to Salmonella enterica serovar typhimurium infection in chickens, Infect. Immun. 71 (3) (2003) 1116-1124.

15

ro of

Fig. 1. Graph showing quantification of SAA gene expression in RIR chicken and Japanese quails administered with inactivated S. gallinarum at 12 h and 24 h post inoculation. Values are n-fold changes in mRNA expression levels for treated birds as compared to un-inoculated control birds. Error bars indicate the standard errors of the mean for the relative transcript of SAA mRNA. Asterisk indicates a significant difference between groups (p ≤ 0.05).

lP

re

-p

Fig. 2. PCR amplification of SAA gene in RIR chicken and Japanese quail (Lane M : 1 Kb plus DNA ladder (Invitrogen); Lane 1 : ~ 521 bp amplicon of SAA gene from RIR chicken; Lane 2 & 4 : Non template control; Lane 3: ~ 400 bp amplicon of SAA gene from Japanese quail).

Jo

ur

na

Fig. 3. Restriction enzyme analysis of recombinant clone of SAA gene in RIR chicken (Lane M : 1 Kb plus DNA ladder; Lane 1 : Undigested plasmid; Lane 2 : Recombinant plasmid digested with EcoR1 enzyme; Lane 3 : SAA PCR product from RIR chicken).

Fig. 4. Restriction enzyme analysis of recombinant clone of SAA gene in Japanese quail (Lane M : 1 Kb plus DNA ladder; Lane 1 : Undigested plasmid; Lane 2 : Recombinant plasmid digested with EcoR1 enzyme; Lane 3 : SAA PCR product from Japanese quail).

16

Jo

ur

na

lP

re

-p

ro of

Fig. 5. Phylogenetic tree of SAA gene showing evolutionary relationship among different organisms.

17