- Email: [email protected]
Sesame cake hydrolysates improved spatial learning and memory of mice
Food Bioscience 31 (2019) 100440
Contents lists available at ScienceDirect
Food Bioscience journal homepage: www.elsevier.com/locate/fbio
Sesame cake hydrolysates improved spatial learning and memory of mice a
a,∗
a
b
a
Zaixi Shu , Lingyi Liu , Pengfei Geng , Jiawei Liu , Wangyang Shen , Mengjie Tu a b
T
a
College of Food Science and Engineering, Wuhan Polytechnic University, Wuhan, 430023, Hubei, PR China Shandong Academy of Agricultural Machinery Sciences, Ji'nan, 250100, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Sesame cake hydrolysates Memory mRNA Sesamum indicum L
Age-related decrease in cognition function was shown to be related to oxidative stress, and the study investigated the effect of sesame cake hydrolysates (SCH) on the improvement of learning and memory in mice using the Morris water maze (MWM) test. The mice administered a medium dose (20 mg/kg/d) of SCH did better in learning and memory function compared with the low-dose (10 mg/kg/d), and high-dose (30 mg/kg/d) treated animals with no significant differences in body weight. Biochemical analysis (SOD, GSH-Px, MDA, NO, and AChE) showed SCH improved the antioxidant and AChE activity and reduced the oxidative stress status, although no obvious differences in NO were observed between the control and test groups. qRT-PCR results showed that mRNA expression of CREB, NR2A, and NR2B improved in the test groups, which was consistent with the change of antioxidant capacity. All these results indicated a potential mRNA mechanism for SCH to improve learning and memory ability that was associated with the changes of antioxidant capacity, oxidative stress, and the cholinergic system.
1. Introduction Oxidative stress develops when excess reactive oxygen species (ROS) are generated. The brain is considered to be particularly susceptible to the increased level of oxidative stress due to its low content of antioxidants and glutathione, and the high content of polyunsaturated fatty acids (Abdel-Salam, Youness, Morsy, Mahfouz, & Kenawy, 2015). Deficits of spatial memory would result in N-methyl-Dadpartate (NMDA) receptor signaling dysfunction in the hippocampus (Shi et al., 2006). In addition, the cyclic AMP-responsive element binding protein (CREB) is essential for NMDA receptor signal transduction-mediated spatial learning and memory processes (Zhao et al., 2016a,b). Since ROS are the main mediators of neuronal damage, ROS scavenging moieties may prevent cell injury caused by oxidative stress. Natural antioxidants, such as lignans, and related phenolic compounds, may be potentially useful due to their high ROS scavenging activity (Zhu et al., 2013). Sesame (Sesamum indicum L.) cake is a by-product of the sesame oil industry and contained about 35–50% protein with a well-balanced amino acid composition (Chatterjee, Dey, Ghosh, & Dhar, 2015). Recent studies showed the antioxidant activity and other health-promoting effects of sesame cake based on the presence of hydrophobic amino acids (such as Leu, Ala, and Phe), lignans, flavonoids and phenols (Sarkis, Michel, Tessaro, & Marczak, 2014). Bigoniya, Nishad, and
∗
Singh (2012) observed that sesame cake prevented hyperglycemia and obesity. Peptides from sesame cake have been reported to show benefits for health and longevity, and anti-aging effects in a Caenorhabditis elegans model system (Ma, Cui, Li, Li, & Wang, 2017; Wang, Ma, Li, & Cui, 2016). Attempts have been made by several groups to study the antioxidant capacity of sesame cake as a source of antioxidants using different models, such as a β-carotene bleaching method, a linoleic acid emulsion system using the thiocyanate method, and the DPPH free radical system (Mohdaly, Smetanska, Ramadan, Sarhan, & Mahmoud, 2011; Suja, Abraham, Thamizh, Jayalekshmy, & Arumughan, 2004). Sesame cake is rich in lignan glucosides (Sarkis et al., 2015), which are hydrophilic antioxidants and not extracted with the oil. In some cases, in vivo results may not agree with in vitro results. As the oxidative stress status in vivo is usually associated with learning and memory ability (Patki, Solanki, Atrooz, Allam, & Salim, 2013; Pesce et al., 2017), there might be a benefit to the use of sesame cake. Thus, sesame cake was hydrolyzed and the composition (amino acids, sesamin, and sesamol) measured. Then, the Morris water maze (MWM) test was adopted to study the antioxidant, oxidative stress, cholinergic and mRNA mechanism of sesame cake hydrolysates (SCH)-induced memory enhancement.
Corresponding author. E-mail address: [email protected] (L. Liu).
https://doi.org/10.1016/j.fbio.2019.100440 Received 25 November 2017; Received in revised form 19 July 2019; Accepted 20 July 2019 Available online 25 July 2019 2212-4292/ © 2019 Elsevier Ltd. All rights reserved.
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
a Thermo Hypersil Gold column (150 mm × 2.1 mm i.d., 1.9 μm, Thermo Fisher Corp., Waltham, MA, USA). Flow rate was 0.3 mL/min, with DAD wavelength of 287 nm and detection temperature of 40 °C. The mobile phase consisted of 60% methanol and 40% water.
2. Materials and methods 2.1. Materials Pre-dried sesame cake was provided by Hefei Yanzhuang Oil Co. Ltd. (Hefei, Anhui, China) and stored at −20 °C for a maximum of 6 months. After removing the residual oil in the pre-dried sesame cake using hexane extraction, the compositions of the sesame cake were 5.1 ± 0.2% water, 40 ± 1% protein (dry weight), 1.0 ± 0.2% fat (dry weight) and 10 ± 1% ash (dry weight, Kjeldahl factor = 6.25). Sesame protein (83 ± 2%, dry weight) was obtained using isoelectric point precipitation (pH 4.60) using the method of Das, Dutta, and Bhattacharjee (2012). Moisture, fat, and ash contents were determined according to AOAC method (2005). After single factor tests and response surface optimizations, the optimal conditions to prepare SCH were: 15 g/L of sesame cake protein, 0.3% (v/v) Alcalase (Alcalase® 2.4 L, Sigma Aldrich, Boston, MA, USA) at 50 °C and at pH 8.5 for 120 min. Inactivation of the enzymes was done by adjusting the pH to 2.0 with 1 mol/L HCl. The solution was centrifuged at 7100×g (Sigma 3K15, Sigma Aldrich, Osterode, Germany) for 15 min at 4 °C and then freeze-dried (FD-1D-50, Biocool, Beijing, China). Sesamin, sesamol and bovine serum albumin were purchased from Sigma Aldrich (USA). Superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA), nitric oxide (NO) and acetylcholinesterase (AChE) assay kits were bought from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). RNAiso, Oligo (dT), Ex Taq DNA polymerase, 100 bp DNA ladder marker, and SYBR Premix Ex Taq were from Takara Biotechnology Co., Ltd. (Dalian, Liaoning, China).
2.4. Animal tests Institute of Cancer Research (ICR) male mice (20 ± 1 g, 4–6 wk) were bought from the Zhejiang Academy of Medical Science (Hangzhou, Zhejiang, China) and were cared for according to the US National Institutes of Health (NIH) guidelines (National Research Council, 2011). Mice were divided into 4 groups (n = 10) and housed using standard conditions of controlled temperature at 25 ± 5 °C and a relative humidity of 55 ± 5% (12-h light/dark cycle). The feed for mice was composed of 30% wheat flour, 36% corn starch, 1% cellulose, 1% soybean oil, 16% soybean meal, 7% fish meal, and 1% minerals mixture. The mice were allowed free access to water and food, and acclimated for 1 wk before the experiment. Three tested groups were administrated with SCH at dosages of 10 (SPL), 20 (SPM) and 30 mg/ kg/d (SPH). A control group was treated with the same volume of saline water (CK). The experiment was run for 4 wk. 2.5. Morris water maze test The Morris water maze (MWM) test was done to evaluate the spatial learning and memory ability after SCH administration (Liu et al., 2016). The equipment for the test included a circular water pool, an autotracking apparatus, and behavioral analytic system (Shanghai Jiliang Instruments, Shanghai, China). All mice were tested using a pool 150 cm in diameter and 50 cm in height filled with water at 26 ± 2 °C. An escape platform 15 cm in diameter was placed 1–2 cm below the water surface and invisible. The mice were trained 3 times a day for 4 days. At the beginning of the training, the platform was placed in the fourth quadrant and hidden 5 mm below the water surface. Each trial started at a different position. The mice were placed in the different quadrants with heads against the wall except with the quadrant with the platform. Once the mice found the platform, they were permitted to remain on it for 10 s and then removed from the platform. During the test, the latency period (time spent to find the safe platform hidden in the pool) was determined as a learning score using the auto-tracking system and behavioral analytic system. If a mouse did not find the platform within 60 s, it was placed on the platform for 10 s. The average times for the first 4 days of training were calculated for the test. After the training was over for 24 h, a probe test was done after removing the platform. The number of platform-site crossovers and residence time in the target quadrant were measured for 60 s from initiation of the test.
2.2. Amino acid composition Amino acid compositions of SCH were determined using the method of Qiu et al. (2016). The dried sample was hydrolyzed in a vacuumsealed glass tube at 110 °C for 24 h in the presence of 6 mol/L HCl. The hydrolyzed samples were vacuum-dried, dissolved in 10 mL 20 mmol/L HCl and then filtered through a qualitative filter paper (product no. 92410432S, diameter of 11 cm, Sinopharm Chemical Reagent Co., Ltd., Shanghai, China). An AccQ-Fluro kit (WATO52880, Waters Corp., Milford, CT, USA) was used to produce the 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate derivatives of amino acids. Before injection, the solution was heated to 55 °C in a water bath. The AccQ-Fluro derivatives of amino acids were separated using an ELITE LaChrome HPLC chromatograph (Hitachi, Tokyo, Japan) equipped with a diode array detector (DAD) and reverse phase C18 AccQ-Tag column (3.9 × 150 mm, Waters Corp.). The injection volume was 20 μL. The mobile phase consisted of solvent A (WATO52890, Waters Corp.) and solvent B (60% acetonitrile). DAD wavelength was 254 nm, and the column temperature was 37 °C. The amino acid profiles were identified by comparing their retention times and quantitated using the calibration curves of the respective standards, which underwent the same process of derivatization. An internal standard (DL-2-aminobutyric acid) method based on the areas of the peaks of the derivatives was used. All samples were analyzed in triplicate, and the results were reported as mg amino acid/100 mg protein. The standard Kjeldahl method was used to determine total nitrogen content, and the crude protein content (AOAC, 1990).
2.6. cRNA synthesis and qRT-PCR After the MWM test, mice were sacrificed under anesthesia using sodium pentobarbital, and their brains were immediately removed. The hippocampus was isolated, washed with ice-cold normal saline, frozen in liquid nitrogen and stored at −80 °C until the RNA extraction, a maximum of 7 days. Tissue sections were pulverized using the pre-cold mortar and pestle under liquid nitrogen and then total RNA was extracted from the hippocampus for each group and isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The gene expressions of CREB, NR2A, and NR2B from mice hippocampus were measured using qRTPCR. Two specific primers for each gene were designed for the amplification of the desired product (shown in Table 1) (Liu, Wang, Zhang, & Zhou, 2009). qRT-PCR was done with 25 μL of a reaction system composed of SYBR Premix Ex Taq 2 × buffer solution (12.5 μL), 5′ and 3’ primers (each 1 μL) and template (0.5 μL). The conditions were 94 °C for 3 min for the initial heat activation, followed by the amplification stage which had 40 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s, then using 94 °C for 30 s, 72 °C for 72 s and 95 °C for 30 s for
2.3. Determination of sesamin and sesamol Sesamin and sesamol in the hydrolysate were analyzed using ultraperformance liquid chromatography (UPLC, Waters Corp.). The Acquity™ UPLC system consisted of a binary solvent delivery system, an auto-sampler with 10 μL sample loop, a DAD, a column oven, and a data station running the Empower data software (Waters Corp.). Samples were dissolved in methanol (about 0.5 mg/mL) and passed through a 0.22-μm membrane filter (Waters Corp.). UPLC analysis was done using 2
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
Table 1 The sequences of primes. Gene CREB NR2A NR2B
Table 2 Amino acid content of sesame cake and sesame cake hydrolysates. Primer (5′-3′)
forward reverse forward reverse forward reverse
Amino acid
CATTAACCATGCCCAATGCAG ATGTGCGAATCTGGTATGTTT TCCATTCTTCTGTCATCCTGC AAGACCGTCTCTCACTCTTGC TGCACAATTACTCCTCGACG TCCGATTCTTCTTCTGAGCC
Content (mg/100 mg sample) Sesame cake hydrolysates
Asx Ser Glx Cys Glu Ala Arg Pro a Leu a Phe a His a Met a Ile a Tyr a Lys a Val a Thr Total amino acid Essential amino acid
combined annealing/extension.
2.7. Biochemical assays Antioxidant activities in the hippocampus were determined. Activity of SOD and GSH-Px were assayed following manufacturer's procedures with the commercially available kits. Briefly, SOD and GSHPx activity were determined using colorimetric methods. In the analysis of SOD, water-soluble tetrazolium salt-1 (WST-1) was used to produce a formazan dye upon reduction with superoxide anion. The rate of the reduction with a superoxide anion is linearly related to the xanthine oxidase activity and is inhibited by SOD. GSH-Px activities were determined through a coupled reaction with glutathione reductase. In the assay, GSH-Px reduces cumene hydroperoxide and oxidize glutathione to oxidized glutathione. The oxidized glutathione is reduced to glutathione with consumption of NADPH by glutathione reductase. The decrease of NADPH is proportional to GSH-Px activity in the reactions. The reduction of NADPH can be easily measured using absorbance at 340 nm. Results were expressed as U/mg protein. U was defined as the amount of SOD needed to inhibit the reduction of nitro blue tetrazolium by 50% for SOD activity, and the amount of enzyme that reduces the concentration of GSH in the reaction system at 1 mmol/L/min for GSHPx activity. The concentration of protein in the homogenate was determined using Bradford's dye bind assaying using bovine serum albumin (10–100 μg/mL) as the standard, assuming that the BSA was 100% pure and responses were in the Beer-Lambert law response range (Bradford, 1976). Oxidative stress was determined using the amount of MDA and NO. Cholinergic status was assessed using AChE activity and expressed as U/ mg protein. All of these measurements were done in accordance with the manufacturer's instructions. Briefly, the MDA in the sample is reacted with thiobarbituric acid (TBA) to generate the MDA-TBA adduct, which can be easily quantified colorimetrically at 532 nm. For NO analysis, nitrate was converted into nitrite using nitrate reductase, then Griess Reagents were used to convert nitrite to a deep purple azo compound. The amount of the azochromophore accurately reflects nitric oxide amount in samples, which would be determined at 510 nm. AChE activity was determined using an ELISA method, and color was determined at 510 nm, and was proportional to the amount of AChE in the samples.
a
7.0 ± 0.3 3.9 ± 0.1 4.0 ± 0.2 3.4 ± 0.2 4.0 ± 0.2 9.5 ± 0.1 4.9 ± 0.2 2.5 ± 0.1 4.1 ± 0.2 1.0 ± 0.1 6.1 ± 0.1 2.8 ± 0.1 2.9 ± 0.1 1.8 ± 0.1 3.9 ± 0.2 4.2 ± 0.1 13.6 ± 0.2 79 ± 2 40 ± 1
Essential amino acid, dry weight mg/100 mg sample.
3. Results 3.1. Compositions of SCH The amino acid content of SCH is shown in Table 2. Total amino acid content was 79 ± 2 mg/100 mg after the hydrolysis, which was relatively lower than the protein content of the sesame cake at 83 ± 2% considering that each amino acid adds one water molecule on hydrolysis. The possible reason is due to the sample loss during the enzymatic hydrolysis and amino acid analysis. The total content of 9 essential amino acids (His, Ile, Leu, Lys, Met, Phe, Thr, Try, and Val) in SCH was 40 ± 1 mg/100 mg, which is close to the suggested pattern of the FAO/WHO requirement for children (FAO/WHO, 2007). After hydrolysis, the high content of hydrophobic (Gly, Ala, Val, Leu, Ile, Pro, Phe, and Met) and sulphur-containing amino acids (Cys and Met) were 31 ± 1 and 6.2 ± 0.3 mg/100 mg, which was consistent with the result of Ghribi et al. (2015) that hydrolysis would increase the availability of these two amino acids. Meanwhile, UPLC indicated that SCH contained 1.55% sesamol and 2.23% sesamin (Fig. 1). 3.2. Body weight Body weight of mice with different dosage of SCH changed with time as shown in Fig. 2. Body weight showed no differences among the 4 groups at the end of 4-wk. 3.3. Results of MWM test Cognitive functions following SCH administration were determined for the latency period (time to reach platform), the number of platformsite crossovers and time spent in the target quadrant (probe test) during MWM testing (Table 3). As shown in Table 3, there was a significant difference (p < 0.05) in the latency period among the control group and tested groups during 4 wk. Mice in the control group took a longer time to find the platform. Supplementation with SCH led to a significant decrease in the latency period throughout all the training days (day 1–4). From Table 3, it could also be seen that SCH did not show a dose-depend effect on the average latency change. At the same training day, the effect of the medium dose showed significant improvement in learning ability compared with the low dose (p < 0.05), while no significant difference compared with the high dose.
2.8. Statistical analysis Data were analyzed using the Statistical Package for the Social Sciences (SPSS) 19.0 software package (IBM, Chicago, IL, USA) and expressed as mean ± standard deviation. Statistical significances of differences among treatments were determined using one-way analysis of variance (ANOVA). Following significant ANOVA, multiple post-hoc comparisons were made using Tukey's multiple comparisons test with a p-value < 0.05 considered statistically significant and a p-value < 0.01 considered statistically strongly significant.
3
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
Fig. 1. UPLC detection of sesamol and sesamin content in sesame cake hydrolysates. AU: absorbance at 287 nm.
3.5. Antioxidant activity and oxidative stress in the hippocampus Table 4 shows the effect of SCH on antioxidant activities in hippocampus tissue. No dose-dependent effect of SCH on the antioxidant activities was observed. Administration of SCH enhanced antioxidant levels. SOD activities were significantly increased in all the test groups (p < 0.01) and only SPM and SPH administration could significantly enhance the GSH-Px activity (p < 0.01). In general, treatment with SCH reduced the oxidative level in mice. For MDA, medium and high dose could significantly diminish the MDA content in the hippocampus (p < 0.05). Nevertheless, there was no significant difference between the MDA levels between low dose and control groups. No obvious differences of NO levels were observed between the control group and the test groups. Overall, SCH could increase the antioxidative activity and reduce oxidative stress level in the hippocampus of the mice brain.
Fig. 2. Weekly body weight changes in ICR mice. SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH.
After the training, the swimming time of mice in the target quadrant was longer than that in other quadrants when the platform was removed. Probe trials showed that the number of platform-site crossovers and time spent in the target quadrant were improved with SCH, as compared with the control group (p < 0.01). Meanwhile, the memory of the platform location learned by training was also better after SCH administration (p < 0.01). These results indicated that SCH could improve the spatial learning and memory of ICR mice. In the test groups, the mice in the medium-dose group showed the strongest spatial learning and memory ability (p < 0.05).
3.6. AChE level in hippocampus
3.4. mRNA expression in the hippocampus
Antioxidative hydrolysates from other food protein, including milk (Power, Jakeman, & FitzGerald, 2013), egg (Rao et al., 2012), and corn (Zhou, Sun, & Canning, 2012) have been prepared using enzymatic methods. Alcalase is considered to have a specificity for hydrophobic amino acids as it cleaves peptide bonds next to hydrophobic amino acid (Tang et al., 2018), which could explain that the content of hydrophobic amino acids (Ala, Val, Leu, Ile, Pro, Phe, Trp, and Tyr)
The cholinergic system has an important role in neurodegenerative diseases and AChE in the hippocampus could be impaired with the treatment of neurodegenerative diseases (Bhutada et al., 2011). In this study, medium and high dose led to a significant increase of AChE activity in the hippocampus of mice, while the low dose did not lead to significant change compared with the control group. 4. Discussions
All of the three mRNA expression levels in tested groups were significantly higher than the control group (p < 0.01) (Fig. 3). According to the previous results, there were no dose effects of SCH on the mRNA expression and the highest expression could be observed in the SPM groups with mice in the medium dose group. Table 3 Behavior and memory capacity of ICR mice during MWM test. Group
Control SPL SPM SPH
Latency period (s)
number of platform-site crossovers
Training Day 1
Training Day 2
Training Day 3
Aa
Aa
Aa
50 ± 2 44 ± 2Aa 36 ± 2Bb 32 ± 2BCbc
49 ± 2 36 ± 3Bb 28 ± 2CDcd 22 ± 1DEFef
49 ± 2 33 ± 3BCb 23 ± 1DEFef 18 ± 1Fg
Time spent in the target quadrant (%)
Training Day 4 50 ± 3Aa 35 ± 2Bb 25 ± 2DEde 21 ± 2EFfg
1.8 2.7 3.5 2.9
± ± ± ±
0.2Bc 0.2Ab 0.2Aa 0.1Ab
31 ± 2Bc 38 ± 1Ab 43 ± 2Aa 39 ± 1Ab
(SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH. Different capital letter means p < 0.01; different lower-case letter means p < 0.05.). 4
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
learning and memory ability were enhanced with administration of SCH. Overall, the medium dose had a better result compared with the other two tested groups. Besides the hydrophobic amino acids, sesamederived bioactive compounds, such as sesamol and sesamin, also have antioxidant activity (Zhao et al., 2016a,b). The hippocampus is the most vulnerable site in the brain to oxidize and GSH-Px and SOD are important physiological antioxidants against free radicals and prevent the formation of ROS (Lei et al., 2012). MDA is the last product of lipid peroxidation of bio-membranes, and the content of MDA is usually considered as a marker of lipid peroxidation (Sasaki, Han, Shimozono, Villareal, & Isoda, 2013). NO can be neurotoxic primarily due to its free radical properties and is rapidly produced in inflammatory states and may be a primary mediator of inflammatory damage (Singleton et al., 2001). One of the possible mechanisms involved in the neurotoxic effect of NO in the central nervous system is due to glutamate neurotransmission and the activation of NMDAR, which raises the intracellular calcium, and stimulates neuronal nitric oxide synthase (Reiter, 1998). Both sesamol and sesamin were found in the hippocampus and may be part of the increased antioxidant activity and decreased oxidative stress observed with SCH intake. John et al. (2015) suggested that sesamol was neuroprotective by reversing NO levels in the hippocampus and frontal cortex of mice exposed to AlCl3. However, no significant differences of NO levels were observed (Table 4). NO is involved in neuronal plasticity and memory and is synthesized by a series of nitric oxide synthases (NOS). Cognitive functions are also associated with cholinergic neurotransmission in the brain (Ahmadi, Rajaei, Hadjzadeh, Nemati, & Hosseini, 2017). ACh plays an important role as a cholinergic neurotransmitter in regulating the cognitive functions of brain. Increased AChE activity could result in the termination of synaptic transmission (Zugno et al., 2014). During 4 wk, Rahim, Lim, Mani, Majeed, and Ramasamy (2017) showed AChE activity in the tested mice increased along with the enhancement of antioxidant status, which was in accord with the results in Table 4. Furthermore, the high content of hydrophobic amino acids would be another factor affecting the memory-enhancement using SCH (Table 2). These amino acid residues in the body could stabilize ROS (Chai, Wu, Yang, Li, & Pan, 2016). It was reported that Asp and Ser could modulate the hippocampal N-methyl-D-aspartate (NMDA) receptor (NMDAR)-dependent long-term potentiation and spatial memory capacity (Errico, Napolitano, Nisticò, & Usiello, 2012). Spatial memory impairments are induced by oxidative stress and NMDAR in the hippocampus CA1 region of the brain, which is essential for learning and memory (Zhao et al., 2016a,b). NMDAR could trigger intracellular signaling cascades such as phosphorylation of CREB using the Ca2+ channels, and the CREB signaling system may also be involved in memory formation in mice (Carlezon, Duman, & Nestler, 2005). CREB protein activation would be downregulated following oxidative stress (Lee, Kumar, Rani, & Foster, 2014). The intake of SCH increased the mRNA expression of CREB compared with the control group, which was consistent with the idea that SCH improved spatial learning and memory ability during the MWM test. NR2A, and NR2B containing NMDAR are also required for both long-term potentiation and longterm depression and it has been shown that a supplemental dietary approach is effective in up-regulating NR2B expression and improving
Fig. 3. mRNA expression of CREB (I), NR2A (II) and NR2B (III) in hippocampus tissue SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH. Different capital letter means p < 0.01; different lower-case letter means p < 0.05.
increased. The higher content of hydrophobic amino acids has been shown to be beneficial for the antioxidant activity (Sampath Kumar, Nazeer, & Jaiganesh, 2011). The study investigated the potential use of SCH as a natural antioxidant and memory enhancer in normal ICR mice. Oxidative stress may be one of the first events in the pathogenesis and progression of Alzheimer's disease and is associated with neuronal damage and subsequent impaired spatial learning and memory (Fleshner, Maier, Lyons, & Raskind, 2011). AThe MWM test was done to evaluate the spatial memory function of SCH treated mice. Changes in memory can be measured based on an alteration in animal behavior after learning to use the MWM test (Manikandan et al., 2006). Spatial Table 4 Effect of SCH on the oxidative stress status, NO and AChE level in hippocampus. Group Control SPL SPM SPH
SOD (U/mg protein) Cc
66 ± 2 75 ± 1Bb 85 ± 2Aa 79 ± 0.5ABb
GSH-Px (U/mg protein) Cc
14 ± 1 16 ± 0.3BCc 21 ± 1Aa 19 ± 1ABb
MDA (nmol/mg protein) 2.6 2.5 1.8 2.3
± ± ± ±
Aa
0.1 0.1Aab 0.1Bc 0.1Ab
NO (mmol/g protein)
AChE (U/mg protein)
0.37 0.36 0.36 0.35
2.8 2.9 3.1 3.0
± ± ± ±
0.02 0.01 0.02 0.02
± ± ± ±
0.1Bc 0.04ABbc 0.1Aa 0.1ABab
(SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH. Different capital letter means p < 0.01; different lower-case letter means p < 0.05.). 5
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
memories in preclinical studies (Wang, Jacobs, & Tsien, 2014). NR2A and NR2B mRNA expression in the tested groups clarified that SCH could increase the learning and memory associated with gene expression which was related to oxidative stress status.
Liu, L., Cao, J., Chen, J., Zhang, X., Wu, Z., & Xiang, H. (2016). Effects of peptides from Phascolosoma esculenta on spatial learning and memory via anti-oxidative character in mice. Neuroscience Letters, 631, 30–35. Liu, W. J., Wang, X. M., Zhang, R., & Zhou, Y. K. (2009). Effects of postnatal exposure to methylmercury on spatial learning and memory and brain NMDA receptor mRNA expression in rats. Toxicology Letters, 188(3), 230–235. Ma, X. L., Cui, X. D., Li, J., Li, C., & Wang, Z. H. (2017). Peptides from sesame cake reduce oxidative stress and amyloid-β-induced toxicity by upregulation of SKN-1 in a transgenic Caenorhabditis elegans model of Alzheimer's disease. Journal of Functional Foods, 39, 287–298. Manikandan, S., Padma, M. K., Srikumar, R., Jeya, P. N., Muthuvel, A., & Sheela, D. R. (2006). Effects of chronic noise stress on spatial memory of rats in relation to neuronal dendritic alteration and free radical-imbalance in hippocampus and medial prefrontal cortex. Neuroscience Letters, 399(1), 17–22. Mohdaly, A., Smetanska, I., Ramadan, M. F., Sarhan, M. A., & Mahmoud, A. (2011). Antioxidant potential of sesame (Sesamum indicum) cake extract in stabilization of sunflower and soybean oils. Industrial Crops and Products, 34(1), 952–959. National Research Council (2011). Guide for the care and use of laboratory animals. Washington, DC: The National Academies Press. Patki, G., Solanki, N., Atrooz, F., Allam, F., & Salim, S. (2013). Depression, anxiety-like behavior and memory impairment are associated with increased oxidative stress and inflammation in a rat model of social stress. Brain Research, 1539(48), 73–86. Pesce, M., Tatangelo, R., La, F. I., Rizzuto, A., Campagna, G., Turli, C., et al. (2017). Aging related oxidative stress: Positive effect of memory training. Neuroscience, 370, 246–255. Power, O., Jakeman, P., & FitzGerald, R. J. (2013). Antioxidative peptides: Enzymatic production, in vitro and in vivo antioxidant activity and potential applications of milkderived antioxidative peptides. Amino Acids, 44, 797–820. Qiu, K., Qin, C. F., Luo, M., Zhang, X., Sun, W. J., Jiao, N., et al. (2016). Protein restriction with amino acid-balanced diets shrinks circulating pool size of amino acid by decreasing expression of specific transporters in the small intestine. PLoS One, 11(9), e0162475. Rahim, N. S., Lim, S. M., Mani, V., Majeed, A. B. A., & Ramasamy, K. (2017). Enhanced memory in Wistar rats by virgin coconut oil is associated with increased antioxidative, cholinergic activities and reduced oxidative stress. Pharmaceutical Biology, 55(1), 825–832. Rao, S., Sun, J., Liu, Y., Zeng, H., Su, Y., & Yang, Y. (2012). ACE inhibitory peptides and antioxidant peptides derived from in vitro digestion hydrolysate of hen egg white lysozyme. Food Chemistry, 135, 1245–1252. Reiter, R. J. (1998). Oxidative damage in the central nervous system: Protection by melatonin. Progress in Neurobiology, 56, 359–384. Sampath Kumar, N. S., Nazeer, R. A., & Jaiganesh, R. (2011). Purification and biochemical characterization of antioxidant peptide from horse mackerel (Magalaspis cordyla) viscera protein. Peptides, 32(7), 1496–1501 2011. Sarkis, J. R., Boussetta, N., Blouet, C., Tessaro, I. C., Marczak, L. D. F., & Vorobiev, E. (2015). Effect of pulsed electric fields and high voltage electrical discharges on polyphenol and protein extraction from sesame cake. Innovative Food Science & Emerging Technologies, 29, 170–177. Sarkis, J. R., Michel, I., Tessaro, I. C., & Marczak, L. D. F. (2014). Optimization of phenolics extraction from sesame seed cake. Separation and Purification Technology, 122, 506–514. Sasaki, K., Han, J., Shimozono, H., Villareal, M. O., & Isoda, H. (2013). Caffeoylquinic acid-rich purple sweet potato extract, with or without anthocyanin, imparts neuroprotection and contributes to the improvement of spatial learning and memory of SAMP8 mouse. Journal of Agricultural and Food Chemistry, 61(21), 5037–5045. Shi, L., Adams, M. M., Long, A., Carter, C. C., Bennett, C., Sonntag, W. E., et al. (2006). Spatial learning and memory deficits after whole-brain irradiation are associated with changes in NMDA receptor subunits in the hippocampus. Radiation Research, 166(6), 892–899. Singleton, A. B., Gibson, A. M., Mckeith, I. G., Ballard, C. G., Edwardson, J. A., & Morris, C. M. (2001). Nitric oxide synthase gene polymorphisms in Alzheimer's disease and dementia with Lewy bodies. Neuroscience Letters, 303(1), 33–36. Suja, K. P., Abraham, J. T., Thamizh, S. N., Jayalekshmy, A., & Arumughan, C. (2004). Antioxidant efficacy of sesame cake extract in vegetable oil protection. Food Chemistry, 84(3), 393–400. Tang, Y., Debnath, T., Choi, E. J., Kim, Y. W., Ryu, J. P., Jang, S., et al. (2018). Changes in the amino acid profiles and free radical scavenging activities of Tenebrio molitor larvae following enzymatic hydrolysis. PLoS One, 13(5), e019621. Wang, D., Jacobs, S. A., & Tsien, J. Z. (2014). Targeting the NMDA receptor subunit NR2B for treating or preventing age-related memory decline. Expert Opinion on Therapeutic Targets, 18(10), 1121–1130. Wang, Z. H., Ma, X. L., Li, J., & Cui, X. D. (2016). Peptides from sesame cake extend healthspan of Caenorhabditis elegans via upregulation of skn-1 and inhibition of intracellular ROS levels. Experimental Gerontology, 82, 139–149. Zhao, T. T., Shin, K. S., Kim, K. S., Park, H. J., Kim, H. J., Lee, K. E., et al. (2016a). Effects of (-)-sesamin on motor and memory deficits in an MPTP-lesioned mouse model of Parkinson's disease treated with l-DOPA. Neuroscience, 339, 644–654. Zhao, T. T., Shin, K. S., Park, H. J., Kim, K. S., Lee, K. E., Cho, Y. J., et al. (2016b). Effects of (-)-sesamin on chronic stress-induced memory deficits in mice. Neuroscience Letters, 634, 114–118. Zhou, K., Sun, S., & Canning, C. (2012). Production and functional characterisation of antioxidative hydrolysates from corn protein via enzymatic hydrolysis and ultrafiltration. Food Chemistry, 135, 1192–1197. Zhu, X., Zhang, X., Sun, Y., Su, D., Sun, Y., Hu, B., et al. (2013). Purification and fermentation in vitro of sesaminol triglucoside from sesame cake by human intestinal microbiota. Journal of Agricultural and Food Chemistry, 61(8), 1868–1877. Zugno, A. I., Matos, M. P., Canever, L., Fraga, D. B., De Luca, R. D., Ghedim, F. V., et al. (2014). Evaluation of acetylcholinesterase activity and behavioural alterations induced by ketamine in an animal model of schizophrenia. Acta Neuropsychiatrica, 26(1), 43–50.
5. Conclusions SCH were prepared to determine the spatial learning and memory improvement in mice using the MWM test. Results indicated that SCH at 20 mg/kg/d gave the greatest learning by increasing the antioxidant and AChE activity and reducing the oxidative stress status in mice. In this process, mRNA expression of CREB, NR2A, and NR2B increased along with the change of antioxidant capacity. Conflicts of interest The authors confirm that they have no conflicts of interest with respect to the work described in this manuscript. Acknowledgments This study was supported by the Natural Science Foundation of Hubei Province (2017CFB308), Natural Science of Foundation of China (31601476), and the Foundation of Wuhan Polytechnic University (2016RZ21). References Abdel-Salam, O. M. E., Youness, E. R., Morsy, F. A., Mahfouz, M. M., & Kenawy, S. A. (2015). Study of the effect of antidepressant drugs and donepezil on aluminum-induced memory impairment and biochemical alterations in rats. Comparative Clinical Pathology, 24(4), 847–860. Ahmadi, M., Rajaei, Z., Hadjzadeh, M. A., Nemati, H., & Hosseini, M. (2017). Crocin improves spatial learning and memory deficits in the Morris water maze via attenuating cortical oxidative damage in diabetic rats. Neuroscience Letters, 642, 1–6. AOAC (1990). Official method of analysis. Association of official analytical chemists (15th ed.). Washington, DC: AOAC International Publisher. AOAC (2005). Official method of analysis. Association of official analytical chemists (18th ed.). Washington, DC: AOAC International Publisher. Bhutada, P., Mundhada, Y., Bansod, K., Tawari, S., Patil, S., Dixit, P., et al. (2011). Protection of cholinergic and antioxidant system contributes to the effect of berberine ameliorating memory dysfunction in rat model of streptozotocin-induced diabetes. Behavioural Brain Research, 220(1), 30–41. Bigoniya, P., Nishad, R., & Singh, C. S. (2012). Preventive effect of sesame seed cake on hyperglycemia and obesity against high fructose-diet induced type 2 diabetes in rats. Food Chemistry, 133(4), 1355–1361. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72(1–2), 248–254. Carlezon, W. A., Jr., Duman, R. S., & Nestler, E. J. (2005). The many faces of CREB. Trends in Neurosciences, 28(8), 436–445. Chai, H. J., Wu, C. J., Yang, S. H., Li, T. L., & Pan, B. S. (2016). Peptides from hydrolysate of lantern fish (Benthosema pterotum) proved neuroprotective in vitro and in vivo. Journal of Functional Foods, 24, 438–449. Chatterjee, R., Dey, T. K., Ghosh, M., & Dhar, P. (2015). Enzymatic modification of sesame seed protein, sourced from waste resource for nutraceutical application. Food and Bioproducts Processing, 94, 70–81. Das, R., Dutta, A., & Bhattacharjee, C. (2012). Preparation of sesame peptide and evaluation of antibacterial activity on typical pathogens. Food Chemistry, 131(4), 1504–1509. Errico, F., Napolitano, F., Nisticò, R., & Usiello, A. (2012). New insights on the role of free D-aspartate in the mammalian brain. Amino Acids, 43(5), 1861–1871. FAO/WHO (2007). Protein and amino acid requirements in human nutrition. Report of the Joint FAO/WHO Expert ConsultationRome: Food and Agriculture Organization of the United Nations. Fleshner, M., Maier, S. F., Lyons, D. M., & Raskind, M. A. (2011). The neurobiology of the stress-resistant brain. Stress, 14(5), 498–502. Ghribi, A. M., Gafsi, I. M., Sila, A., Blecker, C., Danthine, S., Attia, H., et al. (2015). Effects of enzymatic hydrolysis on conformational and functional properties of chickpea protein isolate. Food Chemistry, 187(11), 322–330. John, J., Nampoothiri, M., Kumar, N., Mudgal, J., Nampurath, G. K., & Chamallamudi, M. R. (2015). Sesamol, a lipid lowering agent, ameliorates aluminium chloride induced behavioral and biochemical alterations in rats. Pharmacognosy Magazine, 11(42), 327–336. Lee, W. H., Kumar, A., Rani, A., & Foster, T. C. (2014). Role of antioxidant enzymes in redox regulation of N-methyl-D-aspartate receptor function and memory in middleaged rats. Neurobiology of Aging, 35(6), 1459–1468. Lei, Y. F., Chen, J. L., Zhang, W. T., Fu, W., Wu, G. H., Wei, H., et al. (2012). In vivo investigation on the potential of galangin, kaempferol and myricetin for protection of D-galactose-induced cognitive impairment. Food Chemistry, 135(4), 2702–2707.
6
Contents lists available at ScienceDirect
Food Bioscience journal homepage: www.elsevier.com/locate/fbio
Sesame cake hydrolysates improved spatial learning and memory of mice a
a,∗
a
b
a
Zaixi Shu , Lingyi Liu , Pengfei Geng , Jiawei Liu , Wangyang Shen , Mengjie Tu a b
T
a
College of Food Science and Engineering, Wuhan Polytechnic University, Wuhan, 430023, Hubei, PR China Shandong Academy of Agricultural Machinery Sciences, Ji'nan, 250100, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Sesame cake hydrolysates Memory mRNA Sesamum indicum L
Age-related decrease in cognition function was shown to be related to oxidative stress, and the study investigated the effect of sesame cake hydrolysates (SCH) on the improvement of learning and memory in mice using the Morris water maze (MWM) test. The mice administered a medium dose (20 mg/kg/d) of SCH did better in learning and memory function compared with the low-dose (10 mg/kg/d), and high-dose (30 mg/kg/d) treated animals with no significant differences in body weight. Biochemical analysis (SOD, GSH-Px, MDA, NO, and AChE) showed SCH improved the antioxidant and AChE activity and reduced the oxidative stress status, although no obvious differences in NO were observed between the control and test groups. qRT-PCR results showed that mRNA expression of CREB, NR2A, and NR2B improved in the test groups, which was consistent with the change of antioxidant capacity. All these results indicated a potential mRNA mechanism for SCH to improve learning and memory ability that was associated with the changes of antioxidant capacity, oxidative stress, and the cholinergic system.
1. Introduction Oxidative stress develops when excess reactive oxygen species (ROS) are generated. The brain is considered to be particularly susceptible to the increased level of oxidative stress due to its low content of antioxidants and glutathione, and the high content of polyunsaturated fatty acids (Abdel-Salam, Youness, Morsy, Mahfouz, & Kenawy, 2015). Deficits of spatial memory would result in N-methyl-Dadpartate (NMDA) receptor signaling dysfunction in the hippocampus (Shi et al., 2006). In addition, the cyclic AMP-responsive element binding protein (CREB) is essential for NMDA receptor signal transduction-mediated spatial learning and memory processes (Zhao et al., 2016a,b). Since ROS are the main mediators of neuronal damage, ROS scavenging moieties may prevent cell injury caused by oxidative stress. Natural antioxidants, such as lignans, and related phenolic compounds, may be potentially useful due to their high ROS scavenging activity (Zhu et al., 2013). Sesame (Sesamum indicum L.) cake is a by-product of the sesame oil industry and contained about 35–50% protein with a well-balanced amino acid composition (Chatterjee, Dey, Ghosh, & Dhar, 2015). Recent studies showed the antioxidant activity and other health-promoting effects of sesame cake based on the presence of hydrophobic amino acids (such as Leu, Ala, and Phe), lignans, flavonoids and phenols (Sarkis, Michel, Tessaro, & Marczak, 2014). Bigoniya, Nishad, and
∗
Singh (2012) observed that sesame cake prevented hyperglycemia and obesity. Peptides from sesame cake have been reported to show benefits for health and longevity, and anti-aging effects in a Caenorhabditis elegans model system (Ma, Cui, Li, Li, & Wang, 2017; Wang, Ma, Li, & Cui, 2016). Attempts have been made by several groups to study the antioxidant capacity of sesame cake as a source of antioxidants using different models, such as a β-carotene bleaching method, a linoleic acid emulsion system using the thiocyanate method, and the DPPH free radical system (Mohdaly, Smetanska, Ramadan, Sarhan, & Mahmoud, 2011; Suja, Abraham, Thamizh, Jayalekshmy, & Arumughan, 2004). Sesame cake is rich in lignan glucosides (Sarkis et al., 2015), which are hydrophilic antioxidants and not extracted with the oil. In some cases, in vivo results may not agree with in vitro results. As the oxidative stress status in vivo is usually associated with learning and memory ability (Patki, Solanki, Atrooz, Allam, & Salim, 2013; Pesce et al., 2017), there might be a benefit to the use of sesame cake. Thus, sesame cake was hydrolyzed and the composition (amino acids, sesamin, and sesamol) measured. Then, the Morris water maze (MWM) test was adopted to study the antioxidant, oxidative stress, cholinergic and mRNA mechanism of sesame cake hydrolysates (SCH)-induced memory enhancement.
Corresponding author. E-mail address: [email protected] (L. Liu).
https://doi.org/10.1016/j.fbio.2019.100440 Received 25 November 2017; Received in revised form 19 July 2019; Accepted 20 July 2019 Available online 25 July 2019 2212-4292/ © 2019 Elsevier Ltd. All rights reserved.
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
a Thermo Hypersil Gold column (150 mm × 2.1 mm i.d., 1.9 μm, Thermo Fisher Corp., Waltham, MA, USA). Flow rate was 0.3 mL/min, with DAD wavelength of 287 nm and detection temperature of 40 °C. The mobile phase consisted of 60% methanol and 40% water.
2. Materials and methods 2.1. Materials Pre-dried sesame cake was provided by Hefei Yanzhuang Oil Co. Ltd. (Hefei, Anhui, China) and stored at −20 °C for a maximum of 6 months. After removing the residual oil in the pre-dried sesame cake using hexane extraction, the compositions of the sesame cake were 5.1 ± 0.2% water, 40 ± 1% protein (dry weight), 1.0 ± 0.2% fat (dry weight) and 10 ± 1% ash (dry weight, Kjeldahl factor = 6.25). Sesame protein (83 ± 2%, dry weight) was obtained using isoelectric point precipitation (pH 4.60) using the method of Das, Dutta, and Bhattacharjee (2012). Moisture, fat, and ash contents were determined according to AOAC method (2005). After single factor tests and response surface optimizations, the optimal conditions to prepare SCH were: 15 g/L of sesame cake protein, 0.3% (v/v) Alcalase (Alcalase® 2.4 L, Sigma Aldrich, Boston, MA, USA) at 50 °C and at pH 8.5 for 120 min. Inactivation of the enzymes was done by adjusting the pH to 2.0 with 1 mol/L HCl. The solution was centrifuged at 7100×g (Sigma 3K15, Sigma Aldrich, Osterode, Germany) for 15 min at 4 °C and then freeze-dried (FD-1D-50, Biocool, Beijing, China). Sesamin, sesamol and bovine serum albumin were purchased from Sigma Aldrich (USA). Superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), malondialdehyde (MDA), nitric oxide (NO) and acetylcholinesterase (AChE) assay kits were bought from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). RNAiso, Oligo (dT), Ex Taq DNA polymerase, 100 bp DNA ladder marker, and SYBR Premix Ex Taq were from Takara Biotechnology Co., Ltd. (Dalian, Liaoning, China).
2.4. Animal tests Institute of Cancer Research (ICR) male mice (20 ± 1 g, 4–6 wk) were bought from the Zhejiang Academy of Medical Science (Hangzhou, Zhejiang, China) and were cared for according to the US National Institutes of Health (NIH) guidelines (National Research Council, 2011). Mice were divided into 4 groups (n = 10) and housed using standard conditions of controlled temperature at 25 ± 5 °C and a relative humidity of 55 ± 5% (12-h light/dark cycle). The feed for mice was composed of 30% wheat flour, 36% corn starch, 1% cellulose, 1% soybean oil, 16% soybean meal, 7% fish meal, and 1% minerals mixture. The mice were allowed free access to water and food, and acclimated for 1 wk before the experiment. Three tested groups were administrated with SCH at dosages of 10 (SPL), 20 (SPM) and 30 mg/ kg/d (SPH). A control group was treated with the same volume of saline water (CK). The experiment was run for 4 wk. 2.5. Morris water maze test The Morris water maze (MWM) test was done to evaluate the spatial learning and memory ability after SCH administration (Liu et al., 2016). The equipment for the test included a circular water pool, an autotracking apparatus, and behavioral analytic system (Shanghai Jiliang Instruments, Shanghai, China). All mice were tested using a pool 150 cm in diameter and 50 cm in height filled with water at 26 ± 2 °C. An escape platform 15 cm in diameter was placed 1–2 cm below the water surface and invisible. The mice were trained 3 times a day for 4 days. At the beginning of the training, the platform was placed in the fourth quadrant and hidden 5 mm below the water surface. Each trial started at a different position. The mice were placed in the different quadrants with heads against the wall except with the quadrant with the platform. Once the mice found the platform, they were permitted to remain on it for 10 s and then removed from the platform. During the test, the latency period (time spent to find the safe platform hidden in the pool) was determined as a learning score using the auto-tracking system and behavioral analytic system. If a mouse did not find the platform within 60 s, it was placed on the platform for 10 s. The average times for the first 4 days of training were calculated for the test. After the training was over for 24 h, a probe test was done after removing the platform. The number of platform-site crossovers and residence time in the target quadrant were measured for 60 s from initiation of the test.
2.2. Amino acid composition Amino acid compositions of SCH were determined using the method of Qiu et al. (2016). The dried sample was hydrolyzed in a vacuumsealed glass tube at 110 °C for 24 h in the presence of 6 mol/L HCl. The hydrolyzed samples were vacuum-dried, dissolved in 10 mL 20 mmol/L HCl and then filtered through a qualitative filter paper (product no. 92410432S, diameter of 11 cm, Sinopharm Chemical Reagent Co., Ltd., Shanghai, China). An AccQ-Fluro kit (WATO52880, Waters Corp., Milford, CT, USA) was used to produce the 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate derivatives of amino acids. Before injection, the solution was heated to 55 °C in a water bath. The AccQ-Fluro derivatives of amino acids were separated using an ELITE LaChrome HPLC chromatograph (Hitachi, Tokyo, Japan) equipped with a diode array detector (DAD) and reverse phase C18 AccQ-Tag column (3.9 × 150 mm, Waters Corp.). The injection volume was 20 μL. The mobile phase consisted of solvent A (WATO52890, Waters Corp.) and solvent B (60% acetonitrile). DAD wavelength was 254 nm, and the column temperature was 37 °C. The amino acid profiles were identified by comparing their retention times and quantitated using the calibration curves of the respective standards, which underwent the same process of derivatization. An internal standard (DL-2-aminobutyric acid) method based on the areas of the peaks of the derivatives was used. All samples were analyzed in triplicate, and the results were reported as mg amino acid/100 mg protein. The standard Kjeldahl method was used to determine total nitrogen content, and the crude protein content (AOAC, 1990).
2.6. cRNA synthesis and qRT-PCR After the MWM test, mice were sacrificed under anesthesia using sodium pentobarbital, and their brains were immediately removed. The hippocampus was isolated, washed with ice-cold normal saline, frozen in liquid nitrogen and stored at −80 °C until the RNA extraction, a maximum of 7 days. Tissue sections were pulverized using the pre-cold mortar and pestle under liquid nitrogen and then total RNA was extracted from the hippocampus for each group and isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The gene expressions of CREB, NR2A, and NR2B from mice hippocampus were measured using qRTPCR. Two specific primers for each gene were designed for the amplification of the desired product (shown in Table 1) (Liu, Wang, Zhang, & Zhou, 2009). qRT-PCR was done with 25 μL of a reaction system composed of SYBR Premix Ex Taq 2 × buffer solution (12.5 μL), 5′ and 3’ primers (each 1 μL) and template (0.5 μL). The conditions were 94 °C for 3 min for the initial heat activation, followed by the amplification stage which had 40 cycles of 94 °C for 30 s, 58 °C for 30 s and 72 °C for 30 s, then using 94 °C for 30 s, 72 °C for 72 s and 95 °C for 30 s for
2.3. Determination of sesamin and sesamol Sesamin and sesamol in the hydrolysate were analyzed using ultraperformance liquid chromatography (UPLC, Waters Corp.). The Acquity™ UPLC system consisted of a binary solvent delivery system, an auto-sampler with 10 μL sample loop, a DAD, a column oven, and a data station running the Empower data software (Waters Corp.). Samples were dissolved in methanol (about 0.5 mg/mL) and passed through a 0.22-μm membrane filter (Waters Corp.). UPLC analysis was done using 2
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
Table 1 The sequences of primes. Gene CREB NR2A NR2B
Table 2 Amino acid content of sesame cake and sesame cake hydrolysates. Primer (5′-3′)
forward reverse forward reverse forward reverse
Amino acid
CATTAACCATGCCCAATGCAG ATGTGCGAATCTGGTATGTTT TCCATTCTTCTGTCATCCTGC AAGACCGTCTCTCACTCTTGC TGCACAATTACTCCTCGACG TCCGATTCTTCTTCTGAGCC
Content (mg/100 mg sample) Sesame cake hydrolysates
Asx Ser Glx Cys Glu Ala Arg Pro a Leu a Phe a His a Met a Ile a Tyr a Lys a Val a Thr Total amino acid Essential amino acid
combined annealing/extension.
2.7. Biochemical assays Antioxidant activities in the hippocampus were determined. Activity of SOD and GSH-Px were assayed following manufacturer's procedures with the commercially available kits. Briefly, SOD and GSHPx activity were determined using colorimetric methods. In the analysis of SOD, water-soluble tetrazolium salt-1 (WST-1) was used to produce a formazan dye upon reduction with superoxide anion. The rate of the reduction with a superoxide anion is linearly related to the xanthine oxidase activity and is inhibited by SOD. GSH-Px activities were determined through a coupled reaction with glutathione reductase. In the assay, GSH-Px reduces cumene hydroperoxide and oxidize glutathione to oxidized glutathione. The oxidized glutathione is reduced to glutathione with consumption of NADPH by glutathione reductase. The decrease of NADPH is proportional to GSH-Px activity in the reactions. The reduction of NADPH can be easily measured using absorbance at 340 nm. Results were expressed as U/mg protein. U was defined as the amount of SOD needed to inhibit the reduction of nitro blue tetrazolium by 50% for SOD activity, and the amount of enzyme that reduces the concentration of GSH in the reaction system at 1 mmol/L/min for GSHPx activity. The concentration of protein in the homogenate was determined using Bradford's dye bind assaying using bovine serum albumin (10–100 μg/mL) as the standard, assuming that the BSA was 100% pure and responses were in the Beer-Lambert law response range (Bradford, 1976). Oxidative stress was determined using the amount of MDA and NO. Cholinergic status was assessed using AChE activity and expressed as U/ mg protein. All of these measurements were done in accordance with the manufacturer's instructions. Briefly, the MDA in the sample is reacted with thiobarbituric acid (TBA) to generate the MDA-TBA adduct, which can be easily quantified colorimetrically at 532 nm. For NO analysis, nitrate was converted into nitrite using nitrate reductase, then Griess Reagents were used to convert nitrite to a deep purple azo compound. The amount of the azochromophore accurately reflects nitric oxide amount in samples, which would be determined at 510 nm. AChE activity was determined using an ELISA method, and color was determined at 510 nm, and was proportional to the amount of AChE in the samples.
a
7.0 ± 0.3 3.9 ± 0.1 4.0 ± 0.2 3.4 ± 0.2 4.0 ± 0.2 9.5 ± 0.1 4.9 ± 0.2 2.5 ± 0.1 4.1 ± 0.2 1.0 ± 0.1 6.1 ± 0.1 2.8 ± 0.1 2.9 ± 0.1 1.8 ± 0.1 3.9 ± 0.2 4.2 ± 0.1 13.6 ± 0.2 79 ± 2 40 ± 1
Essential amino acid, dry weight mg/100 mg sample.
3. Results 3.1. Compositions of SCH The amino acid content of SCH is shown in Table 2. Total amino acid content was 79 ± 2 mg/100 mg after the hydrolysis, which was relatively lower than the protein content of the sesame cake at 83 ± 2% considering that each amino acid adds one water molecule on hydrolysis. The possible reason is due to the sample loss during the enzymatic hydrolysis and amino acid analysis. The total content of 9 essential amino acids (His, Ile, Leu, Lys, Met, Phe, Thr, Try, and Val) in SCH was 40 ± 1 mg/100 mg, which is close to the suggested pattern of the FAO/WHO requirement for children (FAO/WHO, 2007). After hydrolysis, the high content of hydrophobic (Gly, Ala, Val, Leu, Ile, Pro, Phe, and Met) and sulphur-containing amino acids (Cys and Met) were 31 ± 1 and 6.2 ± 0.3 mg/100 mg, which was consistent with the result of Ghribi et al. (2015) that hydrolysis would increase the availability of these two amino acids. Meanwhile, UPLC indicated that SCH contained 1.55% sesamol and 2.23% sesamin (Fig. 1). 3.2. Body weight Body weight of mice with different dosage of SCH changed with time as shown in Fig. 2. Body weight showed no differences among the 4 groups at the end of 4-wk. 3.3. Results of MWM test Cognitive functions following SCH administration were determined for the latency period (time to reach platform), the number of platformsite crossovers and time spent in the target quadrant (probe test) during MWM testing (Table 3). As shown in Table 3, there was a significant difference (p < 0.05) in the latency period among the control group and tested groups during 4 wk. Mice in the control group took a longer time to find the platform. Supplementation with SCH led to a significant decrease in the latency period throughout all the training days (day 1–4). From Table 3, it could also be seen that SCH did not show a dose-depend effect on the average latency change. At the same training day, the effect of the medium dose showed significant improvement in learning ability compared with the low dose (p < 0.05), while no significant difference compared with the high dose.
2.8. Statistical analysis Data were analyzed using the Statistical Package for the Social Sciences (SPSS) 19.0 software package (IBM, Chicago, IL, USA) and expressed as mean ± standard deviation. Statistical significances of differences among treatments were determined using one-way analysis of variance (ANOVA). Following significant ANOVA, multiple post-hoc comparisons were made using Tukey's multiple comparisons test with a p-value < 0.05 considered statistically significant and a p-value < 0.01 considered statistically strongly significant.
3
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
Fig. 1. UPLC detection of sesamol and sesamin content in sesame cake hydrolysates. AU: absorbance at 287 nm.
3.5. Antioxidant activity and oxidative stress in the hippocampus Table 4 shows the effect of SCH on antioxidant activities in hippocampus tissue. No dose-dependent effect of SCH on the antioxidant activities was observed. Administration of SCH enhanced antioxidant levels. SOD activities were significantly increased in all the test groups (p < 0.01) and only SPM and SPH administration could significantly enhance the GSH-Px activity (p < 0.01). In general, treatment with SCH reduced the oxidative level in mice. For MDA, medium and high dose could significantly diminish the MDA content in the hippocampus (p < 0.05). Nevertheless, there was no significant difference between the MDA levels between low dose and control groups. No obvious differences of NO levels were observed between the control group and the test groups. Overall, SCH could increase the antioxidative activity and reduce oxidative stress level in the hippocampus of the mice brain.
Fig. 2. Weekly body weight changes in ICR mice. SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH.
After the training, the swimming time of mice in the target quadrant was longer than that in other quadrants when the platform was removed. Probe trials showed that the number of platform-site crossovers and time spent in the target quadrant were improved with SCH, as compared with the control group (p < 0.01). Meanwhile, the memory of the platform location learned by training was also better after SCH administration (p < 0.01). These results indicated that SCH could improve the spatial learning and memory of ICR mice. In the test groups, the mice in the medium-dose group showed the strongest spatial learning and memory ability (p < 0.05).
3.6. AChE level in hippocampus
3.4. mRNA expression in the hippocampus
Antioxidative hydrolysates from other food protein, including milk (Power, Jakeman, & FitzGerald, 2013), egg (Rao et al., 2012), and corn (Zhou, Sun, & Canning, 2012) have been prepared using enzymatic methods. Alcalase is considered to have a specificity for hydrophobic amino acids as it cleaves peptide bonds next to hydrophobic amino acid (Tang et al., 2018), which could explain that the content of hydrophobic amino acids (Ala, Val, Leu, Ile, Pro, Phe, Trp, and Tyr)
The cholinergic system has an important role in neurodegenerative diseases and AChE in the hippocampus could be impaired with the treatment of neurodegenerative diseases (Bhutada et al., 2011). In this study, medium and high dose led to a significant increase of AChE activity in the hippocampus of mice, while the low dose did not lead to significant change compared with the control group. 4. Discussions
All of the three mRNA expression levels in tested groups were significantly higher than the control group (p < 0.01) (Fig. 3). According to the previous results, there were no dose effects of SCH on the mRNA expression and the highest expression could be observed in the SPM groups with mice in the medium dose group. Table 3 Behavior and memory capacity of ICR mice during MWM test. Group
Control SPL SPM SPH
Latency period (s)
number of platform-site crossovers
Training Day 1
Training Day 2
Training Day 3
Aa
Aa
Aa
50 ± 2 44 ± 2Aa 36 ± 2Bb 32 ± 2BCbc
49 ± 2 36 ± 3Bb 28 ± 2CDcd 22 ± 1DEFef
49 ± 2 33 ± 3BCb 23 ± 1DEFef 18 ± 1Fg
Time spent in the target quadrant (%)
Training Day 4 50 ± 3Aa 35 ± 2Bb 25 ± 2DEde 21 ± 2EFfg
1.8 2.7 3.5 2.9
± ± ± ±
0.2Bc 0.2Ab 0.2Aa 0.1Ab
31 ± 2Bc 38 ± 1Ab 43 ± 2Aa 39 ± 1Ab
(SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH. Different capital letter means p < 0.01; different lower-case letter means p < 0.05.). 4
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
learning and memory ability were enhanced with administration of SCH. Overall, the medium dose had a better result compared with the other two tested groups. Besides the hydrophobic amino acids, sesamederived bioactive compounds, such as sesamol and sesamin, also have antioxidant activity (Zhao et al., 2016a,b). The hippocampus is the most vulnerable site in the brain to oxidize and GSH-Px and SOD are important physiological antioxidants against free radicals and prevent the formation of ROS (Lei et al., 2012). MDA is the last product of lipid peroxidation of bio-membranes, and the content of MDA is usually considered as a marker of lipid peroxidation (Sasaki, Han, Shimozono, Villareal, & Isoda, 2013). NO can be neurotoxic primarily due to its free radical properties and is rapidly produced in inflammatory states and may be a primary mediator of inflammatory damage (Singleton et al., 2001). One of the possible mechanisms involved in the neurotoxic effect of NO in the central nervous system is due to glutamate neurotransmission and the activation of NMDAR, which raises the intracellular calcium, and stimulates neuronal nitric oxide synthase (Reiter, 1998). Both sesamol and sesamin were found in the hippocampus and may be part of the increased antioxidant activity and decreased oxidative stress observed with SCH intake. John et al. (2015) suggested that sesamol was neuroprotective by reversing NO levels in the hippocampus and frontal cortex of mice exposed to AlCl3. However, no significant differences of NO levels were observed (Table 4). NO is involved in neuronal plasticity and memory and is synthesized by a series of nitric oxide synthases (NOS). Cognitive functions are also associated with cholinergic neurotransmission in the brain (Ahmadi, Rajaei, Hadjzadeh, Nemati, & Hosseini, 2017). ACh plays an important role as a cholinergic neurotransmitter in regulating the cognitive functions of brain. Increased AChE activity could result in the termination of synaptic transmission (Zugno et al., 2014). During 4 wk, Rahim, Lim, Mani, Majeed, and Ramasamy (2017) showed AChE activity in the tested mice increased along with the enhancement of antioxidant status, which was in accord with the results in Table 4. Furthermore, the high content of hydrophobic amino acids would be another factor affecting the memory-enhancement using SCH (Table 2). These amino acid residues in the body could stabilize ROS (Chai, Wu, Yang, Li, & Pan, 2016). It was reported that Asp and Ser could modulate the hippocampal N-methyl-D-aspartate (NMDA) receptor (NMDAR)-dependent long-term potentiation and spatial memory capacity (Errico, Napolitano, Nisticò, & Usiello, 2012). Spatial memory impairments are induced by oxidative stress and NMDAR in the hippocampus CA1 region of the brain, which is essential for learning and memory (Zhao et al., 2016a,b). NMDAR could trigger intracellular signaling cascades such as phosphorylation of CREB using the Ca2+ channels, and the CREB signaling system may also be involved in memory formation in mice (Carlezon, Duman, & Nestler, 2005). CREB protein activation would be downregulated following oxidative stress (Lee, Kumar, Rani, & Foster, 2014). The intake of SCH increased the mRNA expression of CREB compared with the control group, which was consistent with the idea that SCH improved spatial learning and memory ability during the MWM test. NR2A, and NR2B containing NMDAR are also required for both long-term potentiation and longterm depression and it has been shown that a supplemental dietary approach is effective in up-regulating NR2B expression and improving
Fig. 3. mRNA expression of CREB (I), NR2A (II) and NR2B (III) in hippocampus tissue SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH. Different capital letter means p < 0.01; different lower-case letter means p < 0.05.
increased. The higher content of hydrophobic amino acids has been shown to be beneficial for the antioxidant activity (Sampath Kumar, Nazeer, & Jaiganesh, 2011). The study investigated the potential use of SCH as a natural antioxidant and memory enhancer in normal ICR mice. Oxidative stress may be one of the first events in the pathogenesis and progression of Alzheimer's disease and is associated with neuronal damage and subsequent impaired spatial learning and memory (Fleshner, Maier, Lyons, & Raskind, 2011). AThe MWM test was done to evaluate the spatial memory function of SCH treated mice. Changes in memory can be measured based on an alteration in animal behavior after learning to use the MWM test (Manikandan et al., 2006). Spatial Table 4 Effect of SCH on the oxidative stress status, NO and AChE level in hippocampus. Group Control SPL SPM SPH
SOD (U/mg protein) Cc
66 ± 2 75 ± 1Bb 85 ± 2Aa 79 ± 0.5ABb
GSH-Px (U/mg protein) Cc
14 ± 1 16 ± 0.3BCc 21 ± 1Aa 19 ± 1ABb
MDA (nmol/mg protein) 2.6 2.5 1.8 2.3
± ± ± ±
Aa
0.1 0.1Aab 0.1Bc 0.1Ab
NO (mmol/g protein)
AChE (U/mg protein)
0.37 0.36 0.36 0.35
2.8 2.9 3.1 3.0
± ± ± ±
0.02 0.01 0.02 0.02
± ± ± ±
0.1Bc 0.04ABbc 0.1Aa 0.1ABab
(SPL: 10 mg/kg/d SCH; SPM: 20 mg/kg/d SCH; SPH: 30 mg/kg/d SCH. Different capital letter means p < 0.01; different lower-case letter means p < 0.05.). 5
Food Bioscience 31 (2019) 100440
Z. Shu, et al.
memories in preclinical studies (Wang, Jacobs, & Tsien, 2014). NR2A and NR2B mRNA expression in the tested groups clarified that SCH could increase the learning and memory associated with gene expression which was related to oxidative stress status.
Liu, L., Cao, J., Chen, J., Zhang, X., Wu, Z., & Xiang, H. (2016). Effects of peptides from Phascolosoma esculenta on spatial learning and memory via anti-oxidative character in mice. Neuroscience Letters, 631, 30–35. Liu, W. J., Wang, X. M., Zhang, R., & Zhou, Y. K. (2009). Effects of postnatal exposure to methylmercury on spatial learning and memory and brain NMDA receptor mRNA expression in rats. Toxicology Letters, 188(3), 230–235. Ma, X. L., Cui, X. D., Li, J., Li, C., & Wang, Z. H. (2017). Peptides from sesame cake reduce oxidative stress and amyloid-β-induced toxicity by upregulation of SKN-1 in a transgenic Caenorhabditis elegans model of Alzheimer's disease. Journal of Functional Foods, 39, 287–298. Manikandan, S., Padma, M. K., Srikumar, R., Jeya, P. N., Muthuvel, A., & Sheela, D. R. (2006). Effects of chronic noise stress on spatial memory of rats in relation to neuronal dendritic alteration and free radical-imbalance in hippocampus and medial prefrontal cortex. Neuroscience Letters, 399(1), 17–22. Mohdaly, A., Smetanska, I., Ramadan, M. F., Sarhan, M. A., & Mahmoud, A. (2011). Antioxidant potential of sesame (Sesamum indicum) cake extract in stabilization of sunflower and soybean oils. Industrial Crops and Products, 34(1), 952–959. National Research Council (2011). Guide for the care and use of laboratory animals. Washington, DC: The National Academies Press. Patki, G., Solanki, N., Atrooz, F., Allam, F., & Salim, S. (2013). Depression, anxiety-like behavior and memory impairment are associated with increased oxidative stress and inflammation in a rat model of social stress. Brain Research, 1539(48), 73–86. Pesce, M., Tatangelo, R., La, F. I., Rizzuto, A., Campagna, G., Turli, C., et al. (2017). Aging related oxidative stress: Positive effect of memory training. Neuroscience, 370, 246–255. Power, O., Jakeman, P., & FitzGerald, R. J. (2013). Antioxidative peptides: Enzymatic production, in vitro and in vivo antioxidant activity and potential applications of milkderived antioxidative peptides. Amino Acids, 44, 797–820. Qiu, K., Qin, C. F., Luo, M., Zhang, X., Sun, W. J., Jiao, N., et al. (2016). Protein restriction with amino acid-balanced diets shrinks circulating pool size of amino acid by decreasing expression of specific transporters in the small intestine. PLoS One, 11(9), e0162475. Rahim, N. S., Lim, S. M., Mani, V., Majeed, A. B. A., & Ramasamy, K. (2017). Enhanced memory in Wistar rats by virgin coconut oil is associated with increased antioxidative, cholinergic activities and reduced oxidative stress. Pharmaceutical Biology, 55(1), 825–832. Rao, S., Sun, J., Liu, Y., Zeng, H., Su, Y., & Yang, Y. (2012). ACE inhibitory peptides and antioxidant peptides derived from in vitro digestion hydrolysate of hen egg white lysozyme. Food Chemistry, 135, 1245–1252. Reiter, R. J. (1998). Oxidative damage in the central nervous system: Protection by melatonin. Progress in Neurobiology, 56, 359–384. Sampath Kumar, N. S., Nazeer, R. A., & Jaiganesh, R. (2011). Purification and biochemical characterization of antioxidant peptide from horse mackerel (Magalaspis cordyla) viscera protein. Peptides, 32(7), 1496–1501 2011. Sarkis, J. R., Boussetta, N., Blouet, C., Tessaro, I. C., Marczak, L. D. F., & Vorobiev, E. (2015). Effect of pulsed electric fields and high voltage electrical discharges on polyphenol and protein extraction from sesame cake. Innovative Food Science & Emerging Technologies, 29, 170–177. Sarkis, J. R., Michel, I., Tessaro, I. C., & Marczak, L. D. F. (2014). Optimization of phenolics extraction from sesame seed cake. Separation and Purification Technology, 122, 506–514. Sasaki, K., Han, J., Shimozono, H., Villareal, M. O., & Isoda, H. (2013). Caffeoylquinic acid-rich purple sweet potato extract, with or without anthocyanin, imparts neuroprotection and contributes to the improvement of spatial learning and memory of SAMP8 mouse. Journal of Agricultural and Food Chemistry, 61(21), 5037–5045. Shi, L., Adams, M. M., Long, A., Carter, C. C., Bennett, C., Sonntag, W. E., et al. (2006). Spatial learning and memory deficits after whole-brain irradiation are associated with changes in NMDA receptor subunits in the hippocampus. Radiation Research, 166(6), 892–899. Singleton, A. B., Gibson, A. M., Mckeith, I. G., Ballard, C. G., Edwardson, J. A., & Morris, C. M. (2001). Nitric oxide synthase gene polymorphisms in Alzheimer's disease and dementia with Lewy bodies. Neuroscience Letters, 303(1), 33–36. Suja, K. P., Abraham, J. T., Thamizh, S. N., Jayalekshmy, A., & Arumughan, C. (2004). Antioxidant efficacy of sesame cake extract in vegetable oil protection. Food Chemistry, 84(3), 393–400. Tang, Y., Debnath, T., Choi, E. J., Kim, Y. W., Ryu, J. P., Jang, S., et al. (2018). Changes in the amino acid profiles and free radical scavenging activities of Tenebrio molitor larvae following enzymatic hydrolysis. PLoS One, 13(5), e019621. Wang, D., Jacobs, S. A., & Tsien, J. Z. (2014). Targeting the NMDA receptor subunit NR2B for treating or preventing age-related memory decline. Expert Opinion on Therapeutic Targets, 18(10), 1121–1130. Wang, Z. H., Ma, X. L., Li, J., & Cui, X. D. (2016). Peptides from sesame cake extend healthspan of Caenorhabditis elegans via upregulation of skn-1 and inhibition of intracellular ROS levels. Experimental Gerontology, 82, 139–149. Zhao, T. T., Shin, K. S., Kim, K. S., Park, H. J., Kim, H. J., Lee, K. E., et al. (2016a). Effects of (-)-sesamin on motor and memory deficits in an MPTP-lesioned mouse model of Parkinson's disease treated with l-DOPA. Neuroscience, 339, 644–654. Zhao, T. T., Shin, K. S., Park, H. J., Kim, K. S., Lee, K. E., Cho, Y. J., et al. (2016b). Effects of (-)-sesamin on chronic stress-induced memory deficits in mice. Neuroscience Letters, 634, 114–118. Zhou, K., Sun, S., & Canning, C. (2012). Production and functional characterisation of antioxidative hydrolysates from corn protein via enzymatic hydrolysis and ultrafiltration. Food Chemistry, 135, 1192–1197. Zhu, X., Zhang, X., Sun, Y., Su, D., Sun, Y., Hu, B., et al. (2013). Purification and fermentation in vitro of sesaminol triglucoside from sesame cake by human intestinal microbiota. Journal of Agricultural and Food Chemistry, 61(8), 1868–1877. Zugno, A. I., Matos, M. P., Canever, L., Fraga, D. B., De Luca, R. D., Ghedim, F. V., et al. (2014). Evaluation of acetylcholinesterase activity and behavioural alterations induced by ketamine in an animal model of schizophrenia. Acta Neuropsychiatrica, 26(1), 43–50.
5. Conclusions SCH were prepared to determine the spatial learning and memory improvement in mice using the MWM test. Results indicated that SCH at 20 mg/kg/d gave the greatest learning by increasing the antioxidant and AChE activity and reducing the oxidative stress status in mice. In this process, mRNA expression of CREB, NR2A, and NR2B increased along with the change of antioxidant capacity. Conflicts of interest The authors confirm that they have no conflicts of interest with respect to the work described in this manuscript. Acknowledgments This study was supported by the Natural Science Foundation of Hubei Province (2017CFB308), Natural Science of Foundation of China (31601476), and the Foundation of Wuhan Polytechnic University (2016RZ21). References Abdel-Salam, O. M. E., Youness, E. R., Morsy, F. A., Mahfouz, M. M., & Kenawy, S. A. (2015). Study of the effect of antidepressant drugs and donepezil on aluminum-induced memory impairment and biochemical alterations in rats. Comparative Clinical Pathology, 24(4), 847–860. Ahmadi, M., Rajaei, Z., Hadjzadeh, M. A., Nemati, H., & Hosseini, M. (2017). Crocin improves spatial learning and memory deficits in the Morris water maze via attenuating cortical oxidative damage in diabetic rats. Neuroscience Letters, 642, 1–6. AOAC (1990). Official method of analysis. Association of official analytical chemists (15th ed.). Washington, DC: AOAC International Publisher. AOAC (2005). Official method of analysis. Association of official analytical chemists (18th ed.). Washington, DC: AOAC International Publisher. Bhutada, P., Mundhada, Y., Bansod, K., Tawari, S., Patil, S., Dixit, P., et al. (2011). Protection of cholinergic and antioxidant system contributes to the effect of berberine ameliorating memory dysfunction in rat model of streptozotocin-induced diabetes. Behavioural Brain Research, 220(1), 30–41. Bigoniya, P., Nishad, R., & Singh, C. S. (2012). Preventive effect of sesame seed cake on hyperglycemia and obesity against high fructose-diet induced type 2 diabetes in rats. Food Chemistry, 133(4), 1355–1361. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry, 72(1–2), 248–254. Carlezon, W. A., Jr., Duman, R. S., & Nestler, E. J. (2005). The many faces of CREB. Trends in Neurosciences, 28(8), 436–445. Chai, H. J., Wu, C. J., Yang, S. H., Li, T. L., & Pan, B. S. (2016). Peptides from hydrolysate of lantern fish (Benthosema pterotum) proved neuroprotective in vitro and in vivo. Journal of Functional Foods, 24, 438–449. Chatterjee, R., Dey, T. K., Ghosh, M., & Dhar, P. (2015). Enzymatic modification of sesame seed protein, sourced from waste resource for nutraceutical application. Food and Bioproducts Processing, 94, 70–81. Das, R., Dutta, A., & Bhattacharjee, C. (2012). Preparation of sesame peptide and evaluation of antibacterial activity on typical pathogens. Food Chemistry, 131(4), 1504–1509. Errico, F., Napolitano, F., Nisticò, R., & Usiello, A. (2012). New insights on the role of free D-aspartate in the mammalian brain. Amino Acids, 43(5), 1861–1871. FAO/WHO (2007). Protein and amino acid requirements in human nutrition. Report of the Joint FAO/WHO Expert ConsultationRome: Food and Agriculture Organization of the United Nations. Fleshner, M., Maier, S. F., Lyons, D. M., & Raskind, M. A. (2011). The neurobiology of the stress-resistant brain. Stress, 14(5), 498–502. Ghribi, A. M., Gafsi, I. M., Sila, A., Blecker, C., Danthine, S., Attia, H., et al. (2015). Effects of enzymatic hydrolysis on conformational and functional properties of chickpea protein isolate. Food Chemistry, 187(11), 322–330. John, J., Nampoothiri, M., Kumar, N., Mudgal, J., Nampurath, G. K., & Chamallamudi, M. R. (2015). Sesamol, a lipid lowering agent, ameliorates aluminium chloride induced behavioral and biochemical alterations in rats. Pharmacognosy Magazine, 11(42), 327–336. Lee, W. H., Kumar, A., Rani, A., & Foster, T. C. (2014). Role of antioxidant enzymes in redox regulation of N-methyl-D-aspartate receptor function and memory in middleaged rats. Neurobiology of Aging, 35(6), 1459–1468. Lei, Y. F., Chen, J. L., Zhang, W. T., Fu, W., Wu, G. H., Wei, H., et al. (2012). In vivo investigation on the potential of galangin, kaempferol and myricetin for protection of D-galactose-induced cognitive impairment. Food Chemistry, 135(4), 2702–2707.
6