Silencing inducible nitric oxide synthase protects rat pancreatic islet

diabetes research and clinical practice 89 (2010) 268–275

Contents lists available at ScienceDirect

Diabetes Research and Clinical Practice jou rna l hom ep ag e: w ww.e lse v ier .com/ loca te /d iab res

Silencing inducible nitric oxide synthase protects rat pancreatic islet Li Bai-Feng, Liu Yong-Feng *, Cheng Ying Department of General Surgery, The First Hospital of China Medical University, North Nanjing Street No. 155, Shenyang 110001, Liaoning Province, China

article info

abstract

Article history:

Objective: To investigate the effect of inducible nitric oxide synthase (iNOS) RNA interfer-

Received 23 March 2010

ence on cytokine-induced injury of pancreatic islet in rats.

Received in revised form

Materials and methods: Islets from Wistar rats were cultured in vitro and then randomly

13 May 2010

divided into five groups: group A, islets were cultured exclusively; group B, islets were

Accepted 17 May 2010

transfected with negative control siRNA; group C, islets were transfected with iNOS siRNA;

Published on line 11 June 2010

group D, islets were transfected with iNOS siRNA and then treated with TNF-a + IL-1b; group

Keywords:

mined by RT-PCR and Western blot. The viability of islet was examined by AO/EB staining

RNA interference

and function was examined by glucose-stimulated insulin secretion (GSIS) assay.

Cell culture

Results: The expression of iNOS and the promoting apoptosis gene Bax and Fas were

E, islets were treated with TNF-a + IL-1b. The expression of iNOS, Bax and Fas was deter-

Islet transplantation

significantly up-regulated by the induction of IL-1b and TNF-a. Thus they led to apoptosis

iNOS

increase and the insulin secretion index decrease (1.87  0.31 vs 3.83  1.40, P < 0.01).

Cytokine

Silencing iNOS by RNAi prevented the up-regulation of Bax and Fas induced by cytokine, thus reduced apoptosis of islets and recovered the insulin secretion index (3.43  0.24 vs 1.87  0.31, P < 0.01). Conclusion: The apoptosis from cytokines to islets mediated by iNOS could be suppressed by RNA interference, which favors the survival and function of islets. # 2010 Elsevier Ireland Ltd. All rights reserved.

1.

Introduction

Diabetes mellitus continues to represent a therapeutic challenge and consequently remains a substantial burden for patients and their families. The principal determinant of the risk of devastating diabetes complications is the total lifetime exposure to elevate blood glucose level. Currently, the only way to restore and sustain normoglycemia without the associated risk of hypoglycemia is to replace the patient’s islet of Langerhans: either by the transplantation of a vascularized pancreas or by the infusion of isolated islets. The islet transplantation is the cellular transplantation, which has the advantages including safer, simpler, more convenient for

the modifying in vitro, lower rate of side-effect and easier repetition than the pancreas transplant, and it has become a prospective method [1]. The transplantation of isolated islets represents a minimal invasive approach for b-cell replacement and recently has developed protocols to enhance the short-term achievement ratio. However, there is still a lack of metabolic capacity in islet transplants in the long run which cannot even be compensated by transplantation of a massive amount of islets. The function of islet allografts may be compromised by many factors, including allograft rejection, drug-induced toxicity, and an unfavorable heterotopic environment. In addition, islet death elicited from recurrence of autoimmunity [2–4], delayed

* Corresponding author. Tel.: +86 024 83283308; fax: +86 024 83282384. E-mail addresses: [email protected] (L. Bai-Feng), [email protected] (L. Yong-Feng). 0168-8227/$ – see front matter # 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.diabres.2010.05.013

diabetes research and clinical practice 89 (2010) 268–275

vascular connection resulting in prolonged hypoxia, and inflammatory conditions against which pancreatic islets possess no significant means of protection [5,6]. Inflammatory cytokines such as tumor necrosis factor-a (TNF-a), interleukin-1b (IL-1b), interferon-g (IFN-g) and nitric oxide (NO) have the potential to damage b-cells [7,8], and these cytokines have been proposed as inducers of b-cell damage in human type 1 diabetes mellitus (IDDM) via the generation of NO [9]. They promote insulitis and b-cell destruction in autoimmune diabetes together with nonspecific toxic molecules, such as reactive oxygen species (ROS) [10–12]. Previous reports showed that in the transplanted islets, inducible NO synthase (iNOS) was up-regulated and toxic amounts of NO were produced as a result of inflammatory cells infiltration and production of proinflammatory cytokines (such as TNF-a and IL1-b), which was deleterious for pancreas b-cells [13–16]. In our experiment, we used RNAi to suppress the expression of iNOS. This may provide a new method for the improving long-term survival and function of islet transplantation.

2.

Materials and methods

2.1.

Islet Isolation and purification

Wistar rats (male, 200–250 g), purchased from the Experimental Animal Department of China Medical University, were anesthetized with 10% chloral hydrate (0.003 ml/g body weight) by intraperitoneal injection. Islets were isolated from the surrounding exocrine tissue by enzymatic digestion with 1.0 mg/ml collagenase V (C-9263, purchased from Sigma, USA) in HANKS, balanced salt solution at 37.5  1 8C for 12–15 min. In the end of digestion, double centrifuge (800 rpm, 4–8 8C, 2 min) and washing followed by screen by 80 [17]. Purifying islet by Ficoll-400 (F8363, from Sigma, USA) purification using a modification of procedures which concentration is 25%, 23%, 20.5% and 11% [18,19]. After isolation and purification, the islet number was determined following dithizone (DTZ) stained and expressed as the number of islet equivalents (IEQ, 1 IEQ = 150-mm diameter islet). And then, the islets were incubated with acridine orange (AO, Sigma, USA) and ethidium bromide (EB, Sigma, USA) for 10 min and examined by fluorescent microscope. The dye mix for the AO/EB staining was 100 mg/ml acridine orange and 100 mg/ml ethidium bromide in PBS. Viable cells were stained green and nonviable cells were seen as orange-stained nuclei.

2.2.

Islets culture

Islets >75 and <250 mm in diameter were counted and suspended in RPMI-1640 medium (purchased from Sigma– Aldrich, USA) containing 100 mg/ml penicillin and 100 mg/ml streptomycin. The islets were cultured at 37 8C in a humidified atmosphere of 5% CO2 and 95% air. According to object, we divided islets into five groups: islets cultured exclusively were taken as blank control group (group A), and islet transfected with negative siRNA or iNOS siRNA as negative transfection control group (group B) or RNAi group (group C). Islets cultured with 50U/ ml IL-1b (purchased from PEPROTECH, USA) and 250 U/ml TNF-a

269

(PEPROTECH, USA) for 24 h were taken as cytokine group (group E), while that transfected with iNOS siRNA before cocultured with IL-1b and TNF-a as RNAi + cytokine group (group D).

2.3.

iNOS siRNA transfection

To decrease iNOS protein, RNA interference technology was used. Two designed pairs of oligoduplexes targeted against iNOS were purchased from Genepharma (China). The target sequences of those oligoduplexes are NOS-S sense strand, 50 ACAACAGGAACCUACCAGCTT-dTdT 30 , and NOS-AS antisense strand, 50 -GCUGGUAGGUUCCUGUUGUTT-dTdT 30 , respectively. A nonspecific oligoduplex (non-silencing control, targeting on AAUUCUCCGAACGUGUCACGU) at the same final concentrations as the iNOS RNA duplexes was used as a negative control. To maximize siRNA silencing potential, the siRNA was heated for 1 min at 90 8C, followed by 60 min at 37 8C before the siRNA transfection. The islets were grown in fresh medium without antibiotics 24 h prior to the transfection. Then, these islets were transferred to each well in 6-well plates (density: 20 IEQ/well). The transient transfection with siRNA duplexes at 100 nM was performed using lipofectamine 2000 reagent (Lipo2000, Sigma, USA) according to the manufacturer’s protocol. The mixture of siRNA–Lipo2000 was added to islets medium and cultured at 37 8C in a humidified atmosphere of 5% CO2 and 95% air for 8 h. After transfection, we continued to culture the islets in medium with serum and antibiotic for 24 and 36 h, then the islets were harvested and the expression of iNOS was measured by RT-PCR and Western blot.

2.4.

Semiquantitative RT-PCR

Expression of iNOS mRNA was evaluated by RT-PCR in isolated rat pancreatic islets to detect the effect of RNAi and expression of apoptosis correlated gene, Bax and Fas were analyzed to indicate the apoptosis of islets, and GAPDH served as an internal control. To compare the relative expression of iNOS, Bax and Fas genes among different groups, we used a RT-PCR semiquantitative method. The values were expressed as percentage of the OD of the interest gene (iNOS, Bax and Fas) relative to the co-amplified internal control gene (GAPDH). Total RNA was extracted from five groups of islets using a RNeasy Mini Kit (Qiagen, Germany), according to the manufacturer’s instructions. Islets immersed in 350 ml guanidine isothiocyanate-containing buffer plus 3.5 ml b-mercaptoethanol. Samples were homogenized and lysed by mechanical disruption with repeated passing through a Pasteur pipette. Total RNA was eluted in diethyl pyrocarbonate-treated water and quantified at 260 nm (DU 640 Spectrophotometer, Beckman, USA). To perform cDNA synthesis, total RNA was treated with RQ1 RNase-free DNase (Promega, USA) at 37 8C for 30 min and predenatured at 60 8C for 10 min with 500 ng random primers (Promega, USA). cDNA synthesis was carried out on total RNA using Superscript reverse transcriptase (400 U, Invitrogen, USA) in a 40 ml reaction at 42 8C for 1 h in a Gene Amp PCR System 9600 (Perkin-Elmer, Norwalk, USA). PCR amplification was performed on 2–10 ml cDNA in a 50 ml reaction, containing 0.2 mM of each primer, 200 mM dNTPs, and 1 U Taq DNA polymerase recombinant (Invitrogen, USA). The sequences of the specific oligonucleotide primer pairs used

270

diabetes research and clinical practice 89 (2010) 268–275

were given as follows. Samples were amplified by cycles of denaturation at 94 8C for 30 s, annealing at different temperatures depending on the gene for 30 s, and elongation at 72 8C for 45 s in a Gene Amp PCR System 9600. PCR cycles were 35. The PCR products were electrophoresed on 2% agarose gels, transferred to nylon membranes, and membranes were opposed to X-ray film.

Gene

Primer design

iNOS

50 -TCACCTATCGCACCCG-30 , 50 -ACATCGCCACAAACATAAA-30 ; amplification production was 472 bp 50 -CCAAGAAGCTGAGCGAGTGTC-30 , 50 -TGAGGACTCCAGCCACAAAGA-30 ; amplification production was 377 bp 50 -GAATGCAAGGGACTGATAGC-30 , 50 -TGGTT GTGTGCAAGGCT C-30 ; amplification production was 414 bp 50 ACCACAGTCCATGCCATCAC-30 , 50 -TCCACCACCCTGTTGCTGTA-30 ; amplification production was 452 bp

Bax

Fas

GAPDH

2.5.

Western blot

Expression of iNOS protein in cultured islets was evaluated by Western blot, and the b-actin served as an internal control protein. Islets from the different groups were lysed in modified RIPA lysis buffer (50 mM Tris–HCl (pH 7.4), 150 mM NaCl, 1% NP-40, and 0.1% SDS), and the protein concentrations in the supernatant were determined by the bicinchoninic acid protein assay reagent (Pierce, Rockford, USA). Then, the islets lysates were resolved on SDS-polyacrylamide slab gels (precast 10% gel, Invitrogen, USA). Protein was blotted onto a nitrocellulose membrane (type NC, 0.45 Fm, Schleicher and Schuell, Germany) using a Novex blotting apparatus according to the manufacturer’s protocol. The nitrocellulose membrane was blocked by incubation for 90 min at room temperature in phosphate-buffered saline (PBS) containing 5% nonfat dried milk. The blot was then incubated for 60 min at room temperature with the selected antibody against b-actin and iNOS (Santa Cruz Biotechnology Inc., USA) at 1 mg/ml in PBS– 5% BSA. The blot was washed 3 times (10 min each) in Tris buffered saline (TBS)–0.1% Tween 20 before incubating for 60 min at room temperature with a 1000 dilution of speciesspecific IgG peroxidase conjugate (Santa Cruz Biotechnology Inc., USA) in PBS–1% gelatin. The blot was washed 6 times (5 min each) in TBS–0.1% Tween 20 before detection of the peroxidase activity using the Enhanced Chemiluminenscence kit (Amersham Life Science Products, UK).

2.6.

Islets function detection

The function of the islets was examined by glucose-stimulated insulin secretion (GSIS) assay. Islets were washed twice with Krebs–Hanks balanced salt solution (containing 10 mmol/L HEPES and 0.25% BSA) and counted 10 IEQ islets. The islets were cultured in the low concentration glucose (2.8 mmol/L) Krebs– Hanks balanced salt solution for 2 h (basal secretion), then cultured in the highly concentrated glucose (16.7 mmol/L)

Krebs–Hanks for 1 h (stimulated secretion), and then collected the 2 and the 3 h nutrient fluid. The buffer was centrifuged to remove any detached cells and debris. Liquid was stored at 20 8C for subsequent insulin measurement performed by radioimmunoassay to calculate the insulin secretion index (SI). SI = 3 h insulin content (high sugar environment)/2 h insulin content (low sugar environment) [20].

2.7.

Apoptosis and viability test

The islets were double-stained by immunoperoxidase for apoptotic nuclei using the TUNEL technique (In situ Cell Death Detection Kit; ApopTag, Intergen, Oxford, UK), and by alkaline phosphatase for the endocrine non-b-cells of the islets. b-Cells and apoptotic nuclei were identified and counted using an Olympus BH-2 microscope connected to a video camera with a color monitor. When assessing apoptotic nuclei, we excluded regions with necrosis. b-Cell apoptosis was expressed as percentage of TUNEL positive b-cells. The viability of the islets was examined by AO/EB staining. After culture, the islets were incubated with AO and EB for 10 min and examined by fluorescent microscope. Viable cells were stained green, and nonviable cells were seen as orangestained nuclei.

2.8.

Statistics analysis

All data were expressed as mean  SD. Differences were analyzed by one-way ANOVA. P < 0.05 was considered statistically significant.

3.

Result

500-600IEQ islets could be extracted from every rat. The DTZ stain showed that the purity of fresh islets was more than 80% and the viability exceeded 75% by AO/EB staining.

3.1.

siRNA iNOS down-regulated iNOS expression

The effect of RNAi was measured by RT-PCR and Western blot. The expression of iNOS in blank control group (group A) and negative transfection control group (group B) was positive, while stimulus with cytokines IL-1b and TNF-a, and the expression of iNOS on cultured islets in cytokine group (group E) enhanced significantly (Fig. 1). The semiquantitative analysis of OD value in electrophoresis product showed that the expression of iNOS mRNA in group E was much higher than other four groups (P < 0.05), and the discrepancy among groups A, B, D had no statistical significance (P > 0.05). Whereas RNA interference could inhibit the stimulus of cytokines, attenuate the expression of iNOS in RNAi group (group C) and RNAi + cytokine group (group D), and restrain the synthesis of iNOS protein (Fig. 2).

3.2. siRNA iNOS protects islets from cytokine-induced apoptosis In islets cocultured with cytokines IL-1b and TNF-a in group E, the expression of promoting apoptosis gene Bax and Fas

diabetes research and clinical practice 89 (2010) 268–275

271

Fig. 1 – Expression of iNOS, Bax and Fas was evaluated by RT-PCR, and GAPDH served as an internal control. Compared the relative expression of iNOS, Bax and Fas genes by RT-PCR semiquantitative analysis method, and the values were expressed as percentage of the OD of the interest gene (iNOS, Bax and Fas) relative to the co-amplified internal control gene (GAPDH) (*P < 0.01).

enhanced strikingly, followed by the up-regulation of iNOS gene (Fig. 1). The semiquantitative analysis of OD value in RT-PCR product showed that the expression of Bax and Fas in group E was much higher than other four groups (P < 0.01) (Fig. 1). Meanwhile, the apoptosis rate of islets detected by TUNEL was 67% in group E, which was much higher than other four groups. In group D, before the addition of TNF-a

and IL-1b, islets were cocultured with iNOS siRNA, the expression of promoting apoptosis gene Bax and Fas was lower then group E (P < 0.01), and the apoptosis rate of islets was 32%. This may indicate the apoptosis of islets due to cytokines mediated by iNOS could be suppressed by RNA interference.

3.3.

Fig. 2 – Expression of iNOS protein was evaluated by Western blot to detect the effect of RNAi.

siRNA iNOS preserves the function of islets

The basal insulin excretion and glucose-stimulated insulin secretion (GSIS) were satisfying in fresh islets, and showed a similar pattern in groups A–C. But in group E, the basal insulin excretion and GSIS declined strikingly when the islets cocultured with cytokines IL-1b and TNF-a for 24 h (P < 0.01), and SI < 2 suggested that the islets encountered so severe harmfulness as to lose the reaction to stimulus of high concentration glucose. After treatment with siRNA iNOS in group D, the islets cocultured with cytokines excreted more insulin and showed higher SI than that of group E (P < 0.01), which indicated that down-regulation of the expression of iNOS could improve the function of islets (Fig. 3 and Table 1).

272

diabetes research and clinical practice 89 (2010) 268–275

Table 1 – The glucose-stimulated insulin secretion (GSIS) assay in five groups. Glucose-stimulated insulin secretion (mIU/ml)

A B C D E

Low glucose

High glucose

51.8  10.0 49.6  9.9 53.7  7.0 44.4  6.7 15.0  5.5a

198.4  46.4 178.2  24.0 218.7  22.5 151.1  16.8 28.3  11.8b

Insulin secretion index (SI)

3.83  1.40 3.64  0.30 4.10  0.37 3.43  0.24 1.87  0.31c

Compared with groups A–D. P = 1  106. b P = 4  109. c P = 9  109. a

Fig. 3 – The insulin secretion index (SI) of islets. SI = 3h insulin content (high sugar environment)/2 h insulin content (low sugar environment) (*P < 0.01).

3.4.

siRNA iNOS improves the viability of islets

Stained by AO/EB, majority of the fresh islets fluoresced green, with integrity and clear boundary, which illustrated favorable viability of islets. And the islets in group A (Fig. 4-1), groups B and C (Fig. 4-2) were similar to the fresh islets. However, most of islets were stained yellow with vague boundary and mass mortality appeared when the islets were cocultured with cytokines IL-1b and TNF-a in group E (Fig. 4-3). While in group

D (Fig. 4-4), lots of islets cocultured with TNF-a + IL-1b followed RNA interference iNOS still fluoresced green and hold integrity and distinctness, which implied the survival of this group surpassed group E.

4.

Discussion

In this study, we used RNA interference technique to silence iNOS gene in cultured islets and found these islets had resistance to the impairment of cytokines IL-1b and TNF-a,

Fig. 4 – (1) Stained by acridine orange/ethidium bromide, majority of the fresh islets and blank control islets (group A) fluoresced green, with integrity and clear boundary, which illustrated favorable viability of islets. (2) Mass of islets in negative transfection control group (group B) and RNAi group (group C) fluoresced green, with integrity and clear boundary, which illustrated satisfying viability of islets. (3) Cocultured with cytokines IL-1b and TNF-a, most of islets in group E stained yellow with vague boundary and mass mortality appeared, which suggested that cytokines IL-1b and TNF-a could damage islets severely and lead to cell death. (4) Lots of islets in group D that transfected with iNOS siRNA before cocultured with cytokines IL-1b and TNF-a, still fluoresced green and hold integrity and distinctness, which implied the survival of islets in this group improved compared with cytokine group. (Acridine orange/ethidium bromide 200T.)

diabetes research and clinical practice 89 (2010) 268–275

which may ameliorate the viability and function of islets and beneficial to islet transplantation. At the present time, islet transplantation is limited by the insufficient supply of islet tissue, a problem that is further aggravated by the high number of islets required for successful transplantation [21]. The nonspecific inflammatory reaction, ischemic/reperfusion injury, oxidative stress, and immuno-attack secondary to transplantation will damage the islets graft seriously [22,23]. Islets are particularly vulnerable in the initial days after transplantation when cell death results in the loss of more than half of the transplanted islet tissue, that is primary nongraft function (PNF) [24,25]. The nonspecific inflammation at the grafted site mediated by the local expression of inflammatory cytokines from macrophage such as IL-1b, TNF-a, and iNOS, NO could play a role on the initial damage to transplanted islets [10–12,26–29]. The expression of IL-1b and iNOS genes was already detectable in freshly isolated islets and increased significantly after transplantation. Macrophages were identified as a main cellular source of both the proteins [30]. In vitro observations indicated that the cytotoxic effect of IL-1b in islet cells involved the iNOS and the production of NO [31]. In our experiment, islets were cocultured with cytokines IL-1b and TNF-a in vitro to imitate the environment of islets graft in recipient. We found that along with the up-regulation of iNOS gene expression the viability and function of islets became weak, which accorded with previous reports. As we know, type 1 diabetes mellitus (IDDM) is a chronic autoimmune disease with an inflammatory process directed against the b-cells in pancreas [32], and monocyte and type 1 T-cell-derived cytokines contribute to the pathogenesis of type 1 diabetes mellitus [33]. Previous reports suggest that both syngeneic and allogeneic pancreatic grafts transplanted into patients with type 1 diabetes have been shown to fail as a result of the selective destruction of b-cells owing to recurrent autoimmunity [3,4]. The proinflammatory cytokines, IL-1b, IL6, and TNF-a, have cytotoxic, cytostatic (inhibits insulin synthesis and secretion), or cytocidal actions to pancreatic islets by inducing NO production, which were concerned with the recurrent autoimmunity [9,34–37]. Moreover, the immunological reaction mediated by TNF/TNFR and B7/CD28 family affected the result of islets transplantation severely [38,39], and certain cytokines were specific for postoperative rejection [40,41]. Some reports indicated that inhibition of cytokines IL1b and TNF-a could alleviate the damage of rejection and improve the survival of islets graft [42–44]. Above all, the proinflammatory cytokines IL-1b and TNF-a which were important for the b-cell lysis might be produced by macrophages in early islet transplantation and play important roles alone or in combination in the pathogenesis of islets impairment [5–8,30,45]. While IL-1 receptor antagonist (IL1ra) was considered protective by blocking the effects of IL-1, and some evolvement have been achieved in therapeutics of diabetes mellitus by means of inhibition to proinflammatory cytokines [12,32,46–48]. Recent reports suggest that IL-1b and TNF-a from islets are major regulators of iNOS expression in b-cells. IL-1b alone or combined with TNF-a is sufficient to stimulate iNOS expression intensively and results in excessive NO production [13,31,49,50]. As our previous results in rat pancreas trans-

273

plantation [51], NO overload has cytotoxic, cytostatic or cytocidal actions to pancreatic islets and plays a fundamental role in cytokine-induced b-cell damage [14–16]. In our study, the expression of iNOS enhanced significantly on islets cocultured with cytokines IL-1b and TNF-a, and then the expression of promoting apoptosis gene Bax and Fas ascended distinctly. Furthermore, mass mortality appeared when the islets were cocultured with cytokines IL-1b and TNF-a, and the basal insulin excretion and glucose-stimulated insulin secretion decreased strikingly in succession. SI < 2 meant the islets lost the reaction to stimulus of high concentration glucose. Whereas, in islets without cytokines, the expression of iNOS and promoting apoptosis gene was low-level, and the viability and function were satisfying. This suggested that cytokines IL1b and TNF-a could promote the expression of iNOS mRNA and the synthesis of iNOS protein and then lead to cell death and dysfunction of islets. iNOS was a key to islets damage and the mechanism of iNOS to islets damage might be concerned with the up-regulation of the promoting apoptosis gene and the apoptosis of numerous islets. Therefore, prevention the impairment of cytokines and iNOS/NO might be of importance to result of islets transplantation. But cytokines are multiplicate, complicated and multifunctional, which are different to regulate. On the contrary, as the common path of various cytokines, iNOS is simple in function and may be convenient to study and control. In order to investigate the mechanism of the damage to islets, siRNA aiming at iNOS was designed in our experiment to inhibit the expression of iNOS gene and reduce the synthesis of iNOS protein by RNA interference technique. RNA interference (RNAi) is widely used for knocking down expression of genes of interest and in systematic screens for desired phenotypes [52]. A variety of organisms utilize the RNAi pathway to silence expression of potentially harmful endogenous mobile elements and to eliminate unnecessary sequences [53,54]. The opportunity to harness the RNAi pathway to silence disease-causing genes holds great promise for the development of therapeutics directed against targets that are otherwise not addressable with current medicines [55]. Additional, recent researches confirmed the specificity and potency of siRNA and suggested that they might be promising as therapeutic agents [56–58]. As reported by other research groups previously, siRNA inhibited rat iNOS gene expression and NO production in b-cell lines (INS-1E) in a dose- and sequence-dependent manner [59]. But the abrogation of NO production did not prevent INS-1E cells from apoptosis, suggesting that this event may not be totally dependent on NO production [60]. In the present study [61], our findings that iNOS gene silencing could protect b-cells from inflammatory cytokine-induced apoptosis and increase their capacity to secrete insulin were consistent to what were reported by other groups [59,60,62]. In this experiment, islets were treated with siRNA iNOS before cocultured with cytokines, and we found iNOS gene silencing could protect b-cells from inflammatory cytokineinduced apoptosis and increase their capacity to secrete insulin, which were similar to that reported previously. Furthermore, we discovered that the inhibition of the expression of iNOS resulted in down-regulation of the expression of Bax and Fas, two proapoptotic genes, and hence leaded to decreased apoptosis rate, reduced cell death and increased insulin secretion. In summary, we considered that iNOS played an

274

diabetes research and clinical practice 89 (2010) 268–275

important role in the damage of cytokines to islets and the mechanism of iNOS to islets apoptosis might be the upregulation of the promoting apoptosis gene, Bax and Fas. In summary, we considered that iNOS played an important role in the damage of cytokines to islets and the mechanism of iNOS to islets apoptosis might be the up-regulation of the promoting apoptosis gene, Bax and Fas. And inhibition of iNOS in islets transplantation could improve the viability and function of islets graft, prevent the recurrence of autoimmune disease, and be beneficial to islets transplantation.

Funding This work was supported by National Natural Science Foundation (30672049), National Science and Technology Support Program (2008BAI60B06), and Health Professions Special Project (200802003).

Conflict of interest There are no conflicts of interest.

references

[1] Shapiro AM, Lakey JR, Ryan EA, Korbutt GS, Toth E, Warnock GL, et al. Islet transplantation in seven patients with type 1 diabetes mellitus using a glucocorticoid-free immunosuppressive regimen. N Engl J Med 2000;343:230–8. [2] Balamurugan AN, Bottino R, Giannoukakis N. Prospective and challenges of islet transplantation for the therapy of autoimmune diabetes. Pancreas 2006;32(April (3)):231–43. [3] Worcester Human Islet Transplantation Group. Autoimmunity after islet-cell allotransplantation. N Engl J Med 2006;355:1397–9. [4] Ryan EA, Paty BW, Senior PA, Bigam D, Alfadhli E, Kneteman NM, et al. Five-year follow-up after clinical islet transplantation. Diabetes 2005;54(7):2060. [5] Mandrup-Poulsen T. Apoptotic signal transduction pathways in diabetes. Biochem Pharmacol 2003;66(8):1433–40. [6] Donath MY, Størling J, Maedler K, Mandrup-Poulsen T. Inflammatory mediators and islet beta-cell failure: a link between type 1 and type 2 diabetes. J Mol Med 2003;81(8):455–70. [7] Southern D, Schuister D, Green IC. Inhibition of insulin secretion by interleukin-1b and tumor necrosis factor-a via an L-arginine-dependent nitric oxide generation mechanism. FEBS Lett 1990;276:42–4. [8] Delaney CA, Eizirik DL, Lave JE. Effects of nitric oxide on DNA damage and ultrastructure in islet of Langerhans—a comparison of human and rodent. Diabetologia 1995;38(Suppl. 1):A17–22. [9] Eizirik DL, Sandler S, Welsh N, Cetkovic-Cvrlje M, Nieman A, Geller DA, et al. Cytokines suppress human islet function irrespective of their effects on nitric oxide generation. J Clin Invest 1994;93(5):1968–74. [10] Cattan P, Berney T, Schena S, Molano RD, Pileggi A, Vizzardelli C, et al. Early assessment of apoptosis in isolated islets of Langerhans. Transplantation 2001;71:857. [11] Szabo C. Roles of poly (ADP-ribose) polymerase activation in the pathogenesis of diabetes mellitus and its complications. Pharmacol Res 2005;52:60–71.

[12] Matsuda T, Omori K, Vuong T, Pascual M, Valiente L, Ferreri K, et al. Inhibition of p38 pathway suppresses human islet production of pro-inflammatory cytokines and improves islet graft function. Am J Transplant 2005;5:484–93. [13] Johan S. Cytokines induce both necrosis and apoptosis via a common bcl-2-inhibitable pathway in fat insulinproducing cells. Endocrinology 2000;141(6):2003–10. [14] McDaniel ML, Kwon G, Hill JR, Marshall CA, Corbett JA. Cytokines and nitric oxide in islet inflammation and diabetes (43950D). Proc Soc Exp Biol Med 1996;211:24–30. [15] Arnush M, Heitmeier MR, Scarim AL, Marino MH, Manning PT, Corbett JA. IL-1 produced and released endogenously within human islets inhibits beta cell function. J Clin Invest 1998;102:516–26. [16] Stickings P, Cunninghan JM. Interleukin-1 beta induced nitric oxide production and inhibition of insulin secretion in rat islets of Langerhans is dependent upon the nitric oxide synthase cofactor tetrahidrobiopterin. Cytokine 2002;18(2):81–5. [17] Gu¨rol AO, Yillar G, Kurs¸un AO, Ku¨c¸u¨k M, Deniz G, Aktas E, et al. A modified automated method for isolation of viable pancreatic islets in laboratory animals. Transplant Proc 2004;36(5):1526–7. [18] Amoli MM, Moosavizadeh R, Larijani B. Optimizing conditions for rat pancreatic islets isolation. Cytotechnology 2005;48(1–3):75–8. [19] Zhang H, Chen H, Zhang Z. Efficacy comparison of rat islet purification between iodixanol and Ficoll density gradient method. World J Gastroenterol 2007;15(15):1759–62. [20] Nagata N, Gu Y, Hori H, Balamurugan AN, Touma M, Kawakami Y, et al. Evaluation of insulin secretion of isolated rat islets cultured in extracellular matrix. Cell Transplant 2001;10(4–5):447–51. [21] Shapiro AM, Ricordi C, Hering BJ, Auchincloss H, Lindblad R, Robertson RP, et al. International trial of the Edmonton protocol for islet transplantation. N Engl J Med 2006;355:1318–30. [22] Ozmen L, Ekdahl KN, Elgue G, Larsson R, Korsgren O, Nilsson B. Inhibition of thrombin abrogates the instant blood-mediated inflammatory reaction triggered by isolated human islets: possible application of the thrombin inhibitor melagatran in clinical islet transplantation. Diabetes 2002;51:1779–84. [23] Fotiadis C, Xekouki P, Papalois AE, Antonakis PT, Sfiniadakis I, Flogeras D, et al. Effect of mycophenolate mofetil vs cyclosporine administration on graft survival and function after islet allotransplantation in diabetic rats. World J Gastroenterol 2005;11:2733–8. [24] Ryan EA, Lakey JR, Paty BW, Imes S, Korbutt GS, Kneteman NM, et al. Successful islet transplantation: continued insulin reserve provides long-term glycemic control. Diabetes 2002;51:2148–52. [25] Fontaine MJ, Fan W. Islet cell transplantation as a cure for insulin dependent diabetes: current improvements in preserving islet cell mass and function. Hepatobiliary Pancreat Dis Int 2003;2(2):170–9. [26] Marquet RL, Bonthuis F, Duval SY, de Bruin RW, van Rooijen N, Scheringa M, et al. Macrophages and nitric oxide are involved in primary nonfunction of islet xenografts. Transplant Proc 1995;27:252. [27] Bennet W, Groth CG, Larsson R, Nilsson B, Korsgren O, et al. Isolated human islets trigger an instant blood mediated inflammatory reaction: implications for intraportal islet transplantation as a treatment for patients with type 1 diabetes. Ups J Med Sci 2000;105(2):125–33. [28] Moberg L. The role of the innate immunity in islet transplantation. Ups J Med Sci 2005;110:17–55. [29] Lewis EC, Shapiro L, Bowers OJ, Dinarello CA. Alphalantitrypsin monotherapy prolongs islet allograft

diabetes research and clinical practice 89 (2010) 268–275

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

survival in mice. Proc Natl Acad Sci USA 2005;102: 12153–8. Montolio M, Biarne´s M, Te´llez N, Escoriza J, Soler J, Montanya E. Interleukin-1b and inducible form of nitric oxide synthase expression in early syngeneic islet transplantation. J Endocrinol 2007;192:169–77. Steer SA, Scarim AL, Chambers KT, Corbett JA. Interleukin1 stimulates b-cell necrosis and release of the immunological adjuvant HMGB1. PLoS Med 2006;3(February (2)):e17 [Epub 2005 December 20]. Karlsson Faresjo MG, Ernerudh J, Ludvigsson J. Cytokine profile in children during the first 3 months after the diagnosis of type 1 diabetes. Scand J Immunol 2004;59(5):517–26. Hussain MJ, Maher J, Warnock T, Vats A, Peakman M, Vergani D. Cytokine overproduction in healthy first degree relatives of patients with IDDM. Diabetologia 1998;41(3):343–9. Erbagci AB, Tarakcioglu M, Coskun Y, Sivasli E, Sibel Namiduru E. Mediators of inflammation in children with type I diabetes mellitus: cytokines in type I diabetic children. Clin Biochem 2001;34(8):645–50. Tchorzewski H, Glowacka E, Banasik M, Lewkowicz P, Szalapska-Zawodniak M. Activated T lymphocytes from patients with high risk of type I diabetes mellitus have different ability to produce interferon-gamma, interleukin6 and interleukin-10 and undergo anti-CD95 induced apoptosis after insulin stimulation. Immunol Lett 2001;75(3):225–34. Rapoport MJ, Mor A, Vardi P, Ramot Y, Winker R, Hindi A, et al. Decreased secretion of Th2 cytokines precedes upregulated and delayed secretion of Th1 cytokines in activated peripheral blood mononuclear cells from patients with insulin-dependent diabetes mellitus. J Autoimmun 1998;11(6):635–42. Yasar D, Saadet A, Bilal U, Erdal Y, Metin KG. SerumIL-1b IL2 and IL-6 in insulin-dependent diabetic children, 2006. Hindawi Publishing Corporation Mediators of Inflammation; 2006. Article ID 59206, pp. 1–6, DOI 101155/ MI/2006/59206. Mai G, Bucher P, Morel P, Mei J, Bosco D, Andres A, et al. Role of CD40-CD154 pathway in the rejection of concordant xenogeneic islets. Transplant Proc 2005;37(1):460. Hirakawa E, Yasunami Y, Nakano M, Shiiba M, Takehara M, Uede T, et al. Amelioration of hyperglycemia in streptozotocin induced diabetic mice with fetal pancreatic allografts: prevention of rejection by donor specific transfusion in conjunction with CTLA-4 Ig E. Pancreas 2004;28(2):146. Mi QS, Ly D, Zucker P, McGarry M, Delovitch TL. Interleukin-4 but not inter-leukin 10 protects against spontaneous and recurrent type 1 diabetes by activated CD ld-restricted invariant natural killer T-cells. Diabetes 2004;53(5):1303. Choi SE, Choi KM, Yoon IH, Shin JY, Kim JS, Park WY, et al. IL-6 protects pancreatic islet beta cells from proinflammatory cytokincs induced cell death and functional impairment in vitro and in vivo. Transplant Immunol 2004;13(1):43. Giannoukakis N, Mi Z, Rudert WA, Gambotto A, Trucco M, Robbins P. Prevention of beta cell dysfunction and apoptosis activation in human islets by adenoviral gene transfer of the insulin like growth factor. Gene Ther 2000;7(23):2015. Sung HH, Juang JH, Lin YC, Kuo CH, Hung JT, Chen A, et al. Transgenie expression of decoy receptor 3 protects islets from spontaneous and chemical-induced autoimmune

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52] [53]

[54]

[55]

[56] [57]

[58]

[59]

[60]

[61]

[62]

275

destruction in nonobeae diabetic mice. Exp Med 2004;199(8):1143. Grey ST, Lock J, Bach FH, Ferran C. Adenovirus-mediated gene of A20 in murine islets inhibits Fas-induced apoptosis. Transplant Proc 2001;33(1–2):577. Ozer G, Teker Z, Cetiner S, Yilmaz M, Topaloglu AK, OnenliMungan N, et al. Serum IL-1, IL-2, TNF-alpha and INFgamma levels of patients with type 1 diabetes mellitus and their siblings. J Pediatr Endocrinol Metabol 2003;16(2):203– 10. Kwon KB, Kim EK, Jeong ES, Lee YH, Lee YR, Park JW, et al. Cortex cinnamomi extract prevents streptozotocin- and cytokine-induced beta-cell damage by inhibiting NFkappaB. World J Gastroenterol 2006;12(27):4331–7. Mose´n H, Salehi A, Henningsson R, Lundquist I. Nitric oxide inhibits, and carbon monoxide activates, islet acid alphaglucoside hydrolase activities in parallel with glucosestimulated insulin secretion. J Endocrinol 2006;190(3): 681–93. Arafat HA, Katakam AK, Chipitsyna G, Gong Q, Vancha AR, Gabbeta J, et al. Osteopontin protects the islets and betacells from interleukin-1 beta-mediated cytotoxicity through negative feedback regulation of nitric oxide. Endocrinology 2007;148(2):575–84. Karlsen AE, Andersen HU, Vissing H, Larsen PM, Fey SJ, Cuartero BG, et al. Cloning and expression of cytokineinducible nitric oxide synthase cDNA from rat islets of Langerhans. Diabetes 1995;44:753–8. Liu D, Pavlovic D, Chen MC, Flodstrom M, Sandler S, Eizirik DL. Cytokines induce apoptosis in beta-cells isolated from mice lacking the inducible isoform of nitric oxide synthase (iNOS/). Diabetes 2000;49:1116–22. Li B-F, Liu Y-F, Ying C. Protective effect of inducible nitric oxide synthase inhibitor on pancreas transplantation in rats. World J Gastroenterol 2007;13(45):6066–71. Couzin J. Breakthrough of the year: small RNAs Make Big Splash. Science 2002;298(5602):2296–7. Rand TA, Petersen S, Du F, Wang X. Argonaute2 cleaves the anti-guide strand of siRNA during RISC activation. Cell 2005;18(123):621–9. Schramke V, Allshire R. Those interfering little RNAs! Silencing and eliminating chromatin. Curr Opin Genet Dev 2004;14(April (2)):174–80. Zimmermann TS, Lee AC, Akinc A, Bramlage B, Bumcrot D, Fedoruk MN, et al. RNAi-mediated gene silencing in nonhuman primates. Nature 2006;441:111–4. McManus MT, Sharp PA. Gene silencing in mammals by small interfering RNAs. Nat Rev Genet 2002;3(10):737–47. Paulson H. RNA interference as potential therapy for neurodegenerative disease: applications to inclusion-body myositis? Neurology 2006;66(2 (Suppl. 1)):S114–117. Gong H, Liu CM, Liu DP, Liang CC. The role of small RNAs in human diseases: potential troublemaker and therapeutic tools. Med Res Rev 2005;25(May (3)):361–81. Li F, Mahato RI. iNOS gene silencing prevents inflammatory cytokine-induced beta-cell apoptosis. Mol Pharm 2008;5(May–June (3)):407–17. De Paula D, Bentley MV, Mahato RI. Effect of iNOS and NFkappaB gene silencing on beta-cell survival and function. J Drug Target 2007;15(June (5)):358–69. Li BF, Liu YF, Cheng Y, Zhang JL, Wang BG. The effect of iNOS gene expression inhibited by RNA inference on the pancreas islet apoptosis and function in rats. Zhonghua Wai Ke Za Zhi 2009;47(September (18)):1406–9. McCabe, O’Brien. Beta cell cytoprotection using lentiviral vector-based iNOS-specific siRNA delivery. Biochem Biophys Res Commun 2007;357(May (1)):75–80.