- Email: [email protected]
Simultaneous degradation of toxic refractory organic pesticide and bioelectricity generation using a soil microbial fuel cell
Bioresource Technology 189 (2015) 87–93
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Simultaneous degradation of toxic refractory organic pesticide and bioelectricity generation using a soil microbial fuel cell Xian Cao, Hai-liang Song, Chun-yan Yu, Xian-ning Li ⇑ School of Energy and Environment, Southeast University, Nanjing 210096, China
h i g h l i g h t s MFC was assembled in a simple method in topsoil. HCB remediation was accelerated by using soil MFC and the HCB degradation pathway was investigated. Use soil microbial fuel cell to recover energy from the polluted topsoil. The existence of the anode in soil MFC promoted growth of electrogenic bacteria.
a r t i c l e
i n f o
Article history: Received 19 January 2015 Received in revised form 30 March 2015 Accepted 31 March 2015 Available online 6 April 2015 Keywords: Microbial fuel cell Topsoil Bioelectricity generation Toxic refractory organic pesticide
a b s t r a c t In this study, the soil microbial fuel cells (MFCs) were constructed in the topsoil contaminated with toxic refractory organic pesticide, hexachlorobenzene (HCB). The performance of electricity generation and HCB degradation in the soil-MFCs were investigated. The HCB degradation pathway was analyzed based on the determination of degradation products and intermediates. Experimental results showed that the HCB removal efficiencies in the three groups (soil MFCs group, open circuit control group and no adding anaerobic sludge blank group) were 71.15%, 52.49% and 38.92%, respectively. The highest detected power density was 77.5 mW/m2 at the external resistance of 1000 X. HCB was degraded via the reductive dechlorination pathway in the soil MFC under anaerobic condition. The existence of the anode promoted electrogenic bacteria to provide more electrons to increase the metabolic reactions rates of anaerobic bacteria was the main way which could promote the removal efficiencies of HCB in soil MFC. Ó 2015 Published by Elsevier Ltd.
1. Introduction As refractory organic pesticide, hexachlorobenzene (HCB) is toxic to human beings and the environment. A range of remedial techniques have been developed to remove toxic refractory organics in soil. These included soil washing, land-farming, soil vapor extraction, ion exchanges, soil flushing, phytoremediation and ecological remediation (Zhou and Song, 2004; Kong et al., 2014). However, the in-situ application of these traditional methods is usually expensive and may cause new problems, such as soil erosion and fertility loss (Khan et al., 2004; Kumpiene et al., 2008). The microbial fuel cells (MFCs) are an advantageous technology that can obtain renewable chemical energy from waste organic sources and convert it into electrical energy. The MFCs can promote significantly the removal of organics, such as glucose (Virdis et al., 2009; Freguia et al., 2008; Puig et al., 2012). Some ⇑ Corresponding author. Tel.: +86 13776650963; fax: +86 025 83795618. E-mail address: [email protected] (X.-n. Li). http://dx.doi.org/10.1016/j.biortech.2015.03.148 0960-8524/Ó 2015 Published by Elsevier Ltd.
new MFCs, such as sediment MFCs and plants MFCs, have been widely studied and used (Liu et al., 2014; Villaseñor et al., 2013). Meanwhile, some studies have reported that MFCs could promote greatly the removal of refractory organics (Galvez et al., 2009; Luo et al., 2009). In the MFC anode, co-substrates provide electrons for both the degradation of biorefractory compounds and electricity production. Therefore, both the electricity production and the degradation of biorefractory compounds are the focus of MFC study (Fang et al., 2015; Yong et al., 2014). Lear et al. (2007), Probstein and Hicks (1993), Acar and Alshawabkeh (1993) reported the traditional electrokinetic remediation in soil, which had a great influence to the soil structure and microbial communities, would consume huge electric power. Few studies have been reported the construction of MFC in topsoil. However, the soil MFCs have several advantages, such as simple configuration, lower energy consumption, less damage to soil structure and less impact to microorganisms. In this study, we used the easily-assembled soil MFCs to accelerate HCB remediation. The performances of soil MFCs were described and
88
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
analyzed. The HCB removal and electricity generation were studied. The bacterial communities in topsoil were analyzed. The HCB degradation pathway, types and transfer processes of intermediate products in soil MFC were explored. The effect of the electrons created by electrogenic bacteria at the anode was investigated. 2. Methods 2.1. Inoculation and system construction Hexachlorobenzene (HCB, purity >98%), was obtained from AccuStandard (USA). The topsoil utilized in this study was sampled from 0 to 20 cm below the surface of a farmland along the shore of Yangtze River. Immediately after the sampling, the soil was dried, sieved (<2 mm) and stored at room temperature. The physicochemical properties of the soil were as the following: the moisture content was 1.79%, the pH was 6.71, the organic matter was 2.06%, the total nitrogen was 0.15%, the available phosphorus was 0.25%, and the available potassium was 1.79%. After adding different milliliters of HCB acetone solution (1000 mg/L) into 1000 g dry soil, the soil were stirred thoroughly to obtain a uniform property. Then, the polluted soil was left in the fume hood for 48 h to evaporate acetone before it was stored finally in a sealed box in the dark at room temperature (Yuan et al., 2007). The soil MFC was constructed in the polluted soil, with schematic diagram listed in Fig. 1. The reactors were made of a glass cylinder with an internal diameter of 35 mm and a length of 150 mm. From the bottom upward, there were four layers: soil layer with a depth of 10 mm, soil MFC anode layer with 15 mm depth of granular activated carbon (GAC, 3–5 mm in diameter with a specific area of 500–900 m2/g), polluted soil layer with a depth of 100 mm, soil MFC air-cathode layer with 15 mm depth of GAC. The
volume of the whole container was 140 mL. Total mass of soil and GAC in soil MFCs system were 130 g (dry weight) and 20 g (dry weight), respectively. In this experiment, 10 different groups of reactors were built, named as Group1 to Group10, in which, the anode and air-cathode embedding with carbon cloth (30 mm 10 mm) were connected by titanium wires (1 mm in diameter). The external circuit was connected by titanium wires with different external resistances, and epoxy was used to prevent the Titanium wire from making a direct electrical contact with the cathode electrode. The HCB initial concentration in the soil of Group1 was 40 mg/ kg. Group2 was used as the control group, with the anode and aircathode not connected. Both of Group1 and Group2 were connected with different external resistance of 10 X. The anaerobic sludge (MLSS: 50 g/L) sampled from the East City Municipal Wastewater Treatment Plant of Nanjing, China, was introduced into Group1 and Group2 group for microbial inoculation. The sludge (12 mL) was mixed with polluted soil in every reactors. Group3 has the same setup with Group2 except that the polluted soil in Group3 was not mixed with anaerobic sludge. Group4, Group5 and Group6 had the same configuration as Group1, with the external circuit connected with an external resistance of 2000 X, 1000 X, 510 X, respectively. Group7 and Group9 were the same as Group1. Only the HCB initial concentration in the soil of Group7 and Group9 were 80 mg/kg and 200 mg/kg, respectively. Group8 and Group10 were the same as Group2, while the HCB initial concentration of soil in Group8 and Group10 were 80 mg/kg and 200 mg/kg, respectively. 2.2. System operation All the 10 groups were added with 45 mL nutrient solution with a composition as the following (per liter): 2 g of CH3COONa, 0.31 g of NH4Cl, 0.2 g of MgSO47H2O, 0.13 g of KCl, 0.015 g of CaCl2, 4.97 g of NaH2PO4, 2.75 g of Na2HPO4, 0.56 g of (NH4)2SO4 and 0.1 mL concentrated trace element solution as reported by Klass (1998). Another 10 mL nutrient solution should be added when the voltage of soil MFC was less than 120 mV. The whole experiments were carried out in the dark at 30 °C. The experiments were conducted in triplicate and every sample was measured three times. In the analysis of HCB concentration, the soil in every reactor was respectively completely mixed before freeze drying. Then 10 mL of hexane was added to every 0.5 g soil sample ahead of ultrasonic extraction (20 kHz) for 30 min and centrifugation for 10 min (5000 rpm). The supernatant was further filtered with 0.45 lm filtration membrane (GenerayBiotech (Shanghai) Co., Ltd.) (Oonnittan et al., 2010). 2.3. Analytics and calculations
Fig. 1. Configuration of the soil microbial fuel cell.
The HCB concentration was measured with a Gas Chromatograph–Mass Spectrometer (GC–MS) (Thermo Fisher Scientific Co., Ltd., USA). The analysis used GC–MS choice ion pattern (SIM). Peak area of 84.00 and 286.00 were used to generate standard curve. The intermediates of HCB degradation were qualitatively determined by the GC–MS. The capillary column is DB5MASS (inner diameter 0.25 mm, length 30 m). High purity Helium was employed as the carrier gas at a flow rate of 1 mL/ min. The temperature of the gasification compartment was firstly set to 60 °C for 0.5 min, and then raised linearly to 235 °C at a rate of 25 °C/min. After maintaining at 235 °C for 2 min, it was further raised linearly to 250 °C at a rate of 2 °C/min and then maintained at 250 °C for 5 min. Finally, the temperature of gasification component was increased linearly to 280 °C at a rate of 15 °C/min and maintained at 280 °C for 5 min. The retention time and sampling
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
89
volume was 3 min and 1 lL, respectively. The sample was injected with no diversion. The ionization way of mass spectroscopy was electron impact (EI) with the voltage of electron multiplier at 1605 V. The temperatures of the ion source and the interface were 230 °C and 280 °C, respectively. The molecular weight of HCB in the soil was scanned in the range of 45–600 m/z. Separated ingredients were analyzed with a reference to the NIST MS Search 2.0mass spectral library database (Fang et al., 2013). The results of every groups were subjected to T-test analysis for the comparison of HCB removal efficiencies between different groups. If P value <0.01, there is significant difference between the data sets. If 0.01 < P value <0.05, the difference between groups is not very obvious. If P value >0.05, there is no significant difference between the groups. The generated cell voltages (V) were recorded every 8 h by a data acquisition module (DAM-3057 and DAM-3210, Art Technology Co., Ltd., China). HCB removal efficiency was calculated using Eq. (1):
HCB removal efficiency ð%Þ ¼ ðA BÞ=A 100%
ð1Þ
A is the initial HCB concentrations; B is the residual HCB concentrations. The power density (W/m2) was calculated according to Eq. (2):
P ¼ IU=V
ð2Þ
where I is the current, U is the voltage, and V is the working volume of the anode. The internal resistance was calculated by the linear region of polarization curve (Puig et al., 2012; Logan, 2008). In order to examine the influence of anode on electrogenic bacteria, the anodic materials packed in the anodic area of the reactors were sampled at the end of the experiment. In this study, Geobacter sulfurreducens and Beta Proteobacteria were chosen as the typical electrogenic bacteria in the anode (Logan, 2008; Kiely et al., 2011). The relative abundances of G. sulfurreducens and Beta Proteobacteria on the surface of the anodic materials were detected via the fluorescence in situ hybridization (FISH) technique. Samples were pretreated and fixed on the glass slides. The probes for Beta Proteobacteria (BET42a) were labeled with HEX. The sequence is GCTGCCTCCCGTAGGAGT. The probe for G. sulfurreducens (GEO2) was labeled with CY3, used in combination with unlabeled auxiliary probes HGEO2-1(the sequence is GTCCCCCCCTTTTCCCGCAAGA) and HGEO2-2 (the sequence is CTAATGGTACGCGGACTCATCC). All the samples were hybridized with DAPI (40, 60-diamidino-2-phenylindole dihydrochloride) (Kiely et al., 2011) at the same time. The slides were examined under a fluorescence microscope (OLYMPUS-BX42, Japan) and imaged by a Nikon Coolpix P7000 camera. The observation fields were randomly selected, and the fluorescence intensity was detected by Image-Pro Plus. The microbial population were determined by direct counting, and the group specific population were obtained via the normalization of each direct counts to DAPI stained ones in the same field. 3. Results and discussion 3.1. HCB degradation in soil MFC As represented in Fig. 2A, from day 1 to day 7, the average HCB concentrations in Group1, Group2, and Group3 decreased from 35.53 mg/kg, 35.53 mg/kg, and 35.40 mg/kg to 25.07 mg/kg, 23.77 mg/kg, and 24.73 mg/kg, respectively. From day 8 to day 21, the average HCB concentrations in Group1, Group2, and Group3 decreased to 21.71 mg/kg, 22.28 mg/kg, and 22.84 mg/kg, respectively. During day 1 to day 21, the average HCB
Fig. 2. The degradation of HCB in soil MFC: (A) the average HCB concentrations; (B) the average removal efficiencies of HCB; (C) the average degradation rates from day 29 to day 56.
concentrations exhibited insignificant difference in the three groups. Results in Fig. 2B revealed that the average HCB removal efficiencies in Group1, Group2 and Group3 were 37.12%, 35.49%, and 33.61%, respectively. From day 22 to day 56, the average HCB concentrations in Group1, Group2, and Group3 decreased from 21.71 mg/kg, 22.28 mg/kg, and 22.84 mg/kg to 9.96 mg/kg,
90
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
16.41 mg/kg, and 21.01 mg/kg, respectively. This indicated that the average HCB removal efficiencies in Group1, Group2, and Group3 were 34.02%, 17.00%, and 5.31%, respectively. Fig. 2C was the average degradation rates of HCB of last 4 weeks in 3 groups from day 29 to day 56. The average HCB concentrations in Groups 1–3 decreased rapidly from day 1 to day 7. Previous researchers have reported that the half-life period of HCB in soil was 2.622.9 years (Beck and Hansen, 1974; Beall, 1976; Kengara et al., 2013). Therefore, the average degradation rate of HCB in soil was extremely low at natural conditions, and the rapid decrease of HCB concentration in this study probably due to volatilization and the activated carbon adsorption. The HCB concentrations had slight change from day 8 to day 21 (Groups 1–3). From day 22 to day 56, the average HCB concentration in Group3 still changed a little (from 22.84 mg/ kg to 21.01 mg/kg), indicating that without exterior microorganisms addition, it was different to remove HCB only through biodegradation with indigenous microorganisms in the soil. The average HCB concentration in Group2 decreased by 5.87 mg/kg from 22.28 mg/kg to 16.41 mg/kg, which was larger than that in Group3 (P < 0.01). The HCB removal efficiency in Group2 was 3.21 times higher than that in Group3 which indicated that the addition of anaerobic sludge benefited HCB removal performance. What’s more, the average HCB concentration in Group1 decreased by 11.75 mg/kg from 21.71 mg/kg to 9.96 mg/kg. It was obvious that the HCB concentration in Group1 showed a significant decreasing trend compared to those in Group2 and Group3 (T test, PGroup1Group3 < 0.01, PGroup1Group2 < 0.01). The HCB removal efficiency in Group1 was 2 times and 6.32 times higher than that in Group2 and Group3, respectively. Compared with Group2 and Group3, Group1 had significant improvement in HCB removal. Therefore, the soil MFCs dramatically promoted the removal of toxic and refractory organics, such as HCB. 3.2. Electricity generation in soil MFC The electricity generation in soil MFC Run4 along with the running time was represented in Fig. 3A. Our experiments are sequencing batch reactors, the electricity generation in soil MFC would decline as the consumption of organics. Four cycles of electricity generation were observed during the experiment. In each electricity generation cycle, the voltage increased first to a peak, and then decreased. The maximum voltage outputs in each generate electricity cycle were 241 mV, 284 mV, 309 mV, and 326 mV, respectively. Polarization curve was obtained from the stationary phase of the last electricity generation cycle. As shown in Fig. 3B, the highest power density was observed to be 77.5 mW/m2 at the external resistance of 1000 X, while the internal resistance was 972.73 X. During the four electricity cycle period, the peak voltages from the first cycle to the third cycle increased. There was little difference in the maximal voltage between the third and fourth electricity generation cycle. The maximum voltage outputs in each electricity cycle were 241 mV, 284 mV, 309 mV, and 326 mV, respectively. Due to the characteristics of soil, the electricity production performance of MFCs which were consisted of soil was different from that of traditional MFC reactors with liquid phase. Song et al. (2010) constructed a sediment microbial fuel cell (SMFC). In the SMFC reactor, the average current, highest power density and the internal resistance were 0.22 mA, 3.15 mW/m2 and 214 X, respectively. Zhou et al. (2014) also constructed the SMFCs, in which, the voltage outputs were stable at 310 mV, the power density were 9.73–101.52 mW/m2, and the internal resistance were 546–781 X. Sajana et al. (2014) constructed another SMFCs with the voltage outputs of 167–365 mV, the power density of 107.3– 242.1 lW/m2, and the internal resistance of 616–814 X. It can be
Fig. 3. Electricity generation of soil MFC: (A) the electricity generation curves; (B) power density curve and the polarization curve.
concluded that the soil MFC constructed in this study achieved the similar level of voltage outputs and power density as SMFC. Meanwhile, the soil MFC was demonstrated to exhibit good ability of electricity generation.
3.3. Microbial population variation The number of bacteria in Group1, Group2, and Group3 are as follows. The number of G. sulfurreducens in Group1, Group2, Group3 were 35.7 106/g, 8.9 106/g, 0.3 106/g, respectively. The number of Beta Proteobacteria in Group1, Group2, Group3 were 24.6 106/g, 4.7 106/g, 0.2 106/g, respectively. According to the FISH results, the densities of two electrogenic bacteria showed similar variation tendencies. The density of G. sulfurreducens in Group1 was the highest, which was 4 times and 119 times higher than that in Group2 and Group3, respectively. Similarly, the density of Beta Proteobacteria in Group1 was 5 times and 123 times higher than that in Group2 and Group3, respectively. The results indicated that the soil MFC promoted the multiplication and growth of electrogenic bacteria, which subsequently benefit the electricity generation.
3.4. Degradation of HCB The samples were analyzed by GC–MS every 7 days. Trichlorobenzene, tetrachlorobenzene and pentachlorobenzene
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
91
were detected at a retention time of 4.49 min, 6.00 min and 6.74 min, respectively. The potential HCB degradation pathway was proposed by Fathepure et al. (1988) in 1988. They also found that reductive dechlorination was the primary step in the degradation procedure under the anaerobic condition. Pentachlorobenzene and tetrachlorobenzene were the intermediates in the whole degradation process. In Group1 system, pentachlorobenzene was detected in day 21. Meanwhile, pentachlorobenzene, tetrachlorobenzene and trichlorobenzene were detected from day 22 to day 56. However, no degradation productions were obtained in Group3 during the experiments. Therefore, the HCB degradation pathway in soil MFC might be hexachlorobenzene–pentachlorobenzene–tetrachlorobenzene–trichlorobenzene in reduction sequences, which was consistent with what Fathepure proposed. Meanwhile, it have been reported that glucose, methanoic acid or acetic acid were needed as co-substrates during the HCB reduction under anaerobic condition. HCB, as the terminal electron acceptor, was reduced to easily degradable organics by obtaining electrons from the cosubstrates (Chang et al., 1998; Brahushi et al., 2004). 3.5. The influence of different soil pollution concentrations on HCB removal efficiencies In this section, three different soil pollution concentrations (40 mg/kg, 80 mg/kg, and 200 mg/kg) were studied to find the influence of different soil pollution concentrations on HCB removal efficiencies. As presented in Fig. 4A, from day 1 to day 7, the average HCB removal efficiencies in Group1, Group2, Group7, Group8, Group9 and Group10 were 37.12%, 35.49%, 34.35%, 31.51%, 26.29%, 22.70%, respectively. From day 22 to day 56, the average HCB removal efficiencies in Group1, Group2, Group7, Group8, Group9 and Group10 were 34.02%, 17.00%, 27.80%, 12.18%, 23.77%, 8.19%, respectively. It was found from the results listed in Fig. 4B that the average degradation rates of HCB in 6 groups were 0.336 mg/(kg d), 0.167 mg/(kg d), 0.543 mg/(kg d), 0.238 mg/(kg d), 1.184 mg/(kg d), 0.408 mg/(kg d), respectively. Fig. 4C was the average degradation rates of HCB of last 4 weeks in 6 groups from day 29 to day 56. With the increase of HCB concentrations in polluted soil, the degradation rate increased although the removal efficiency declined in soil MFCs when comparing Group1, and Group2 with Group7, Group8, Group9 and Group10. The average HCB concentrations in 6 groups were declined by time, results in Fig. 4C revealed that the average degradation rates of HCB declined by week, which could verify that he average degradation rates of HCB increase with the HCB concentration. It indicated that the soil MFCs impacted the HCB removal with different concentrations, which was in agreement with other documented findings that MFCs promote greatly the removal of refractory organics (Galvez et al., 2009; Luo et al., 2009). In the soil containing HCB or other toxic refractory organic pesticides, the soil MFCs with the settings of both the cathode and anode activated carbons, inoculated sludge and added co-substrate can significantly improve the HCB removal efficiencies. 3.6. Effects of current on HCB removal efficiencies In this part, the currents in soil MFCs changed with the variation of external resistances connected in external circuits. The comparison of HCB removal efficiencies in soil MFCs along with external resistance was represented in Fig. 5A. It can be seen that HCB removal efficiencies were 39.33%, 38.80%, 36.1% and 37.13% during the time internal of day 1 to day 21, meanwhile, 18.17%, 22.38%, 26.8% and 34.02% from day 22 to day 56 when the external resistances were 2000 X, 1000 X, 510 X and 10 X,
Fig. 4. The degradation of HCB in soil MFC: (A) the average degradation efficiencies of HCB; (B) the average degradation rates with different soil pollution concentrations; (C) the average degradation rates from day 29 to day 56.
respectively. Fig. 5B revealed the relationship between the average degradation rates of HCB from day 22 to day 56 and the average maximum currents in the four cycles of the 3 groups. As indicated in Fig 5B, a high positive relationship (R2 = 0.9949) between the HCB degradation efficiency and the average maximal currents was found. The lower external resistance would induce larger current in soil MFC, which was probably due to the increased substrate conversion rate at the lower resistance during the MFCs operation (Gil et al., 2003). The lower external resistance could reduce the extracellular electron transfer resistance and subsequently increase the
92
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
(3) The electric field affected certain enzymes in electrogenic bacteria to promote organic removal reactions (Pitts et al., 2003). The three principal pathways mentioned above may all exist in soil MFCs. The HCB degradation pathway in the soil MFC was reductive dechlorination under the anaerobic condition. The reduction of HCB needs to gain electrons in the reaction. Meanwhile, the average removal/degradation rate of HCB increased along with the increase of current in soil MFCs. The electrogenic bacteria created large numbers of electrons when the co-substrates (sodium acetate) were available. Some of the generated electrons were transferred from the anode to the cathode to generate an electric current, and the others were directly used for reductive dechlorination of HCB. The densities of electrons and currents in soil MFCs increased with the decrease of external resistance, indicating that more electrons could be utilized to HCB reduction. In summary, as the first way mentioned above, the existence of the anode promoted the multiplication and growth of electrogenic bacteria to provide electrons to increase the metabolic reactions rates of anaerobic bacteria in the MFCs, which provided the most important channel for the improvement of refractory organic pollutants removal efficiency. 4. Conclusions The soil MFCs can significantly improve toxic refractory organic pesticide removal efficiencies. The HCB removal efficiency in experimental group was 6.32 times higher than that in blank control group. Meanwhile, the highest power density in soil MFC was 77.5 mW/m2 and the internal resistance was 972.73 X. The FISH results showed that the soil MFC promoted the multiplication and growth of electrogenic bacteria. The HCB degradation pathway in soil MFC was clear in reduction sequences. The electrons created by electrogenic bacteria were significant for the improvement of HCB removal efficiency. Further studies on electron motion is needed. Fig. 5. Current generation and effects on HCB removal in different soil MFCs: (A) HCB removal efficiencies with different external resistances; (B) the relationship between the average degradation efficiencies of HCB and the average maximum currents in four electricity generation cycles.
electron transfer rate. The average HCB degradation rates accelerated with the increase of current in soil MFCs. As shown in Fig. 5B, a positive correlation (R2 = 0.9949) between the HCB degradation efficiency and the average maximal currents. With the increase of current in soil MFCs, the number of electrons passing a random cross section in circuit per unit time increased, and subsequently, improved the degradation rate of refractory organics. This result demonstrated that the increased number of electrons benefited the removal of refractory organics with the presence of co-substrates. These findings were consistent with those reported by Sun et al. (2009). Previous studies have shown that there were three principal ways to explain why MFCs could promote the removal efficiencies of refractory organic pollutants: (1) The electrons created by electrogenic bacteria at the anode increased the metabolic reaction rates of anaerobic bacteria (Luo et al., 2009; Li et al., 2010). (2) The electric field could change the permeability of cell membrane, leading to the excessive absorbance of extracellular substances and further change the microbial metabolism (Rittmann and McCarty, 2001).
Acknowledgements We thank the National Natural Science Foundation of China (21277024), the Provincial Natural Science Foundation of Jiangsu, China (BK20141330 and BK20141117), and the National Key Technology R&D Program (2013BAJ10B12-02) for financial support. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2015.03. 148. References Acar, Y.B., Alshawabkeh, A.N., 1993. Principles of electrokinetic remediation. Environ. Sci. Technol. 27, 2638–2647. Beall, M.L., 1976. Persistence of aerially applied hexachlorobenzene on grass and soil. J. Environ. Qual. 5, 367–369. Beck, J., Hansen, K.E., 1974. The degradation of quintozene, pentachlorobenzene, hexachlorobenzene and pentachloroaniline in soil. Pestic. Sci. 5, 41–48. Brahushi, F., Doerfler, U., Schroll, R., Munch, J.C., 2004. Stimulation of reductive dechlorination of hexachlorobenzene in soil by inducing the native microbial activity. Chemosphere 55, 1477–1484. Chang, B., Su, C., Yuan, S., 1998. Microbial hexachlorobenzene dechlorination under three reducing conditions. Chemosphere 36, 2721–2730. Fang, Z., Song, H.L., Cang, N., Li, X.N., 2013. Performance of microbial fuel cell coupled constructed wetland system for decolorization of azo dye and bioelectricity generation. Bioresour. Technol. 144, 165–171.
X. Cao et al. / Bioresource Technology 189 (2015) 87–93 Fang, Z., Song, H.L., Cang, N., Li, X.N., 2015. Electricity production from Azo dye wastewater using a microbial fuel cell coupled constructed wetland operating under different operating conditions. Biosens. Bioelectron. 69, 135–141. Fathepure, B.Z., Tiedje, J.M., Boyd, S.A., 1988. Reductive dechlorination of hexachlorobenzene to tri- and dichlorobenzenes in anaerobic sewage sludge. Appl. Environ. Microbiol. 54, 327–330. Freguia, S., Rabaey, K., Yuan, Z., Keller, J., 2008. Syntrophic processes drive the conversion of glucose in microbial fuel cell anodes. Environ. Sci. Technol. 42, 7937–7943. Galvez, A., Greenman, J., Ieropoulos, I., 2009. Landfill leachate treatment with microbial fuel cells; scale-up through plurality. Bioresour. Technol. 100, 5085–5091. Gil, G.C., Chang, I.S., Kim, B.H., Kim, M., Jang, J.K., Park, H.S., Kim, H.J., 2003. Operational parameters affecting the performance of a mediator-less microbial fuel cell. Biosens. Bioelectron. 18, 327–334. Kengara, F.O., Doerflera, U., Welzlc, G., Rutha, B., Muncha, J.C., Schroll, R., 2013. Enhanced degradation of 14C-HCB in two tropical clay soils using multiple anaerobiceaerobic cycles. Environ. Pollut. 173, 168–175. Khan, F.I., Husain, T., Hejazi, R., 2004. An overview and analysis of site remediation technologies. J. Environ. Manage. 71, 95–122. Kiely, P.D., Rader, G., Regan, J.M., Logan, B.E., 2011. Long-term cathode performance and the microbial communities that develop in microbial fuel cells fed different fermentation end products. Bioresour. Technol. 102, 361–366. Klass, D.L., 1998. Biomass for Renewable Energy, Fuels, and Chemicals. Academic Press, San Diego. Kong, L.L., Liu, W.T., Zhou, Q.X., 2014. An effective amendment for remediating contaminated soil. Rev. Environ. Contam. Toxicol. 228, 83–99. Kumpiene, J., Lagerkvist, A., Maurice, C., 2008. Stabilization of As, Cr, Cu, Pb and Zn in soil using amendments-a review. Waste Manage. 28, 215–225. Lear, G., Harbottle, M.J., Sills, G., Knowles, C.J., Semple, K.T., Thompson, I.P., 2007. Impact of electrokinetic remediation on microbial communities within PCP contaminated soil. Environ. Pollut. 146, 139–146. Li, J., Liu, G.L., Zhang, R.D., Luo, Y., Zhang, C.P., Li, M.C., 2010. Electricity generation by two types of microbial fuel cells using nitrobenzene as the anodic or cathodic reactants. Bioresour. Technol. 101, 4013–4020. Liu, S.T., Song, H.L., Wei, S.Z., Yang, F., Li, X.N., 2014. Bio-cathode materials evaluation and configuration optimization for power output of vertical subsurface flow constructed wetland—microbial fuel cell systems. Bioresour. Technol. 166, 575–583. Logan, B.E., 2008. Microbial Fuel Cell. John Wiley & Sons, New York. Luo, H., Liu, G., Zhang, R., Jin, S., 2009. Phenol degradation in microbial fuel cells. Chem. Eng. J. 147, 259–264. Oonnittan, A., Isosaari, P., Sillanpaeae, M., 2010. Oxidant availability in soil and its effect on HCB removal during electrokinetic Fenton process. Sep. Purif. Technol. 76, 146–150.
93
Pitts, K.E., Dobbin, P.S., Reyes-Ramirez, F., Thomson, A.J., Richardson, D.J., Seward, H.E., 2003. Characterization of the Shewanella oneidensis MR-1 decaheme cytochrome MtrA: expression in Escherichia coli confers the ability to reduce soluble Fe (III) chelates. J. Biol. Chem. 278, 27758–27765. Probstein, R.F., Hicks, R.E., 1993. Removal of contaminants from soils by electric fields. Science 260, 498–503. Puig, S., Coma, M., Desloover, J., Boon, N., Balaguer, M.D., 2012. Autotrophic denitrification in microbial fuel cells treating low ionic strength waters. Environ. Sci. Technol. 46, 2309–2315. Rittmann, B.E., McCarty, P.L. (Eds.), 2001. Environmental Biotechnology: principles and applications. McGraw-Hill, New York. Sajana, T.K., Ghangrekar, M.M., Mitra, A., 2014. Effect of presence of cellulose in the freshwater sediment on the performance of sediment microbial fuel cell. Bioresour. Technol. 155, 84–90. Song, T.S., Yan, Z.S., Zhao, Z.W., Jiang, H.L., 2010. Removal of organic matter in freshwater sediment by microbial fuel cells at various external resistances. J. Chem. Technol. Biotechnol. 85, 1489–1493. Sun, J., Hu, Y.Y., Bi, Z., Cao, Y.Q., 2009. Simultaneous decolorization of azo dye and bioelectricity generation using a microfiltration membrane air-cathode singlechamber microbial fuel cell. Bioresour. Technol. 100, 3185–3192. Villaseñor, J., Capilla, P., Rodrigo, M.A., Cañizares, P., Fernández, F.J., 2013. Operation of a horizontal subsurface flow constructed wetland—microbial fuel cell treating wastewater under different organic loading rates. Water Res. 47, 6731–6738. Virdis, B., Rabaey, K., Yuan, Z., Rozendal, R.A., Keller, J., 2009. Electron fluxes in a microbial fuel cell performing carbon and nitrogen removal. Environ. Sci. Technol. 43, 5144–5149. Yong, X.Y., Feng, J., Chen, Y.L., Shi, D.Y., Xu, Y.S., Zhou, J., Shu, Y.W., Xu, L., Yong, C.Y., Sun, Y.M., Shi, C.L., 2014. Enhancement of bioelectricity generation by cofactor manipulation in microbial fuel cell. Biosens. Bioelectron. 56, 19–25. Yuan, S.H., Shu, Z., Wan, J.Z., Lu, X.H., 2007. Enhanced desorption of hexachlorobenzene from kaolin by single and mixed surfactants. J. Colloid Interface Sci. 314, 167–175. Zhou, Q., Song, Y. (Eds.), 2004. Contaminated soil remediation: principles and methods. Science Press, Beijing. Zhou, Y.L., Yang, Y., Chen, M., Zhao, Z.W., Jiang, H.L., 2014. To improve the performance of sediment microbial fuel cell through amending colloidal iron oxyhydroxide into freshwater sediments. Bioresour. Technol. 159, 232–239.
Contents lists available at ScienceDirect
Bioresource Technology journal homepage: www.elsevier.com/locate/biortech
Simultaneous degradation of toxic refractory organic pesticide and bioelectricity generation using a soil microbial fuel cell Xian Cao, Hai-liang Song, Chun-yan Yu, Xian-ning Li ⇑ School of Energy and Environment, Southeast University, Nanjing 210096, China
h i g h l i g h t s MFC was assembled in a simple method in topsoil. HCB remediation was accelerated by using soil MFC and the HCB degradation pathway was investigated. Use soil microbial fuel cell to recover energy from the polluted topsoil. The existence of the anode in soil MFC promoted growth of electrogenic bacteria.
a r t i c l e
i n f o
Article history: Received 19 January 2015 Received in revised form 30 March 2015 Accepted 31 March 2015 Available online 6 April 2015 Keywords: Microbial fuel cell Topsoil Bioelectricity generation Toxic refractory organic pesticide
a b s t r a c t In this study, the soil microbial fuel cells (MFCs) were constructed in the topsoil contaminated with toxic refractory organic pesticide, hexachlorobenzene (HCB). The performance of electricity generation and HCB degradation in the soil-MFCs were investigated. The HCB degradation pathway was analyzed based on the determination of degradation products and intermediates. Experimental results showed that the HCB removal efficiencies in the three groups (soil MFCs group, open circuit control group and no adding anaerobic sludge blank group) were 71.15%, 52.49% and 38.92%, respectively. The highest detected power density was 77.5 mW/m2 at the external resistance of 1000 X. HCB was degraded via the reductive dechlorination pathway in the soil MFC under anaerobic condition. The existence of the anode promoted electrogenic bacteria to provide more electrons to increase the metabolic reactions rates of anaerobic bacteria was the main way which could promote the removal efficiencies of HCB in soil MFC. Ó 2015 Published by Elsevier Ltd.
1. Introduction As refractory organic pesticide, hexachlorobenzene (HCB) is toxic to human beings and the environment. A range of remedial techniques have been developed to remove toxic refractory organics in soil. These included soil washing, land-farming, soil vapor extraction, ion exchanges, soil flushing, phytoremediation and ecological remediation (Zhou and Song, 2004; Kong et al., 2014). However, the in-situ application of these traditional methods is usually expensive and may cause new problems, such as soil erosion and fertility loss (Khan et al., 2004; Kumpiene et al., 2008). The microbial fuel cells (MFCs) are an advantageous technology that can obtain renewable chemical energy from waste organic sources and convert it into electrical energy. The MFCs can promote significantly the removal of organics, such as glucose (Virdis et al., 2009; Freguia et al., 2008; Puig et al., 2012). Some ⇑ Corresponding author. Tel.: +86 13776650963; fax: +86 025 83795618. E-mail address: [email protected] (X.-n. Li). http://dx.doi.org/10.1016/j.biortech.2015.03.148 0960-8524/Ó 2015 Published by Elsevier Ltd.
new MFCs, such as sediment MFCs and plants MFCs, have been widely studied and used (Liu et al., 2014; Villaseñor et al., 2013). Meanwhile, some studies have reported that MFCs could promote greatly the removal of refractory organics (Galvez et al., 2009; Luo et al., 2009). In the MFC anode, co-substrates provide electrons for both the degradation of biorefractory compounds and electricity production. Therefore, both the electricity production and the degradation of biorefractory compounds are the focus of MFC study (Fang et al., 2015; Yong et al., 2014). Lear et al. (2007), Probstein and Hicks (1993), Acar and Alshawabkeh (1993) reported the traditional electrokinetic remediation in soil, which had a great influence to the soil structure and microbial communities, would consume huge electric power. Few studies have been reported the construction of MFC in topsoil. However, the soil MFCs have several advantages, such as simple configuration, lower energy consumption, less damage to soil structure and less impact to microorganisms. In this study, we used the easily-assembled soil MFCs to accelerate HCB remediation. The performances of soil MFCs were described and
88
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
analyzed. The HCB removal and electricity generation were studied. The bacterial communities in topsoil were analyzed. The HCB degradation pathway, types and transfer processes of intermediate products in soil MFC were explored. The effect of the electrons created by electrogenic bacteria at the anode was investigated. 2. Methods 2.1. Inoculation and system construction Hexachlorobenzene (HCB, purity >98%), was obtained from AccuStandard (USA). The topsoil utilized in this study was sampled from 0 to 20 cm below the surface of a farmland along the shore of Yangtze River. Immediately after the sampling, the soil was dried, sieved (<2 mm) and stored at room temperature. The physicochemical properties of the soil were as the following: the moisture content was 1.79%, the pH was 6.71, the organic matter was 2.06%, the total nitrogen was 0.15%, the available phosphorus was 0.25%, and the available potassium was 1.79%. After adding different milliliters of HCB acetone solution (1000 mg/L) into 1000 g dry soil, the soil were stirred thoroughly to obtain a uniform property. Then, the polluted soil was left in the fume hood for 48 h to evaporate acetone before it was stored finally in a sealed box in the dark at room temperature (Yuan et al., 2007). The soil MFC was constructed in the polluted soil, with schematic diagram listed in Fig. 1. The reactors were made of a glass cylinder with an internal diameter of 35 mm and a length of 150 mm. From the bottom upward, there were four layers: soil layer with a depth of 10 mm, soil MFC anode layer with 15 mm depth of granular activated carbon (GAC, 3–5 mm in diameter with a specific area of 500–900 m2/g), polluted soil layer with a depth of 100 mm, soil MFC air-cathode layer with 15 mm depth of GAC. The
volume of the whole container was 140 mL. Total mass of soil and GAC in soil MFCs system were 130 g (dry weight) and 20 g (dry weight), respectively. In this experiment, 10 different groups of reactors were built, named as Group1 to Group10, in which, the anode and air-cathode embedding with carbon cloth (30 mm 10 mm) were connected by titanium wires (1 mm in diameter). The external circuit was connected by titanium wires with different external resistances, and epoxy was used to prevent the Titanium wire from making a direct electrical contact with the cathode electrode. The HCB initial concentration in the soil of Group1 was 40 mg/ kg. Group2 was used as the control group, with the anode and aircathode not connected. Both of Group1 and Group2 were connected with different external resistance of 10 X. The anaerobic sludge (MLSS: 50 g/L) sampled from the East City Municipal Wastewater Treatment Plant of Nanjing, China, was introduced into Group1 and Group2 group for microbial inoculation. The sludge (12 mL) was mixed with polluted soil in every reactors. Group3 has the same setup with Group2 except that the polluted soil in Group3 was not mixed with anaerobic sludge. Group4, Group5 and Group6 had the same configuration as Group1, with the external circuit connected with an external resistance of 2000 X, 1000 X, 510 X, respectively. Group7 and Group9 were the same as Group1. Only the HCB initial concentration in the soil of Group7 and Group9 were 80 mg/kg and 200 mg/kg, respectively. Group8 and Group10 were the same as Group2, while the HCB initial concentration of soil in Group8 and Group10 were 80 mg/kg and 200 mg/kg, respectively. 2.2. System operation All the 10 groups were added with 45 mL nutrient solution with a composition as the following (per liter): 2 g of CH3COONa, 0.31 g of NH4Cl, 0.2 g of MgSO47H2O, 0.13 g of KCl, 0.015 g of CaCl2, 4.97 g of NaH2PO4, 2.75 g of Na2HPO4, 0.56 g of (NH4)2SO4 and 0.1 mL concentrated trace element solution as reported by Klass (1998). Another 10 mL nutrient solution should be added when the voltage of soil MFC was less than 120 mV. The whole experiments were carried out in the dark at 30 °C. The experiments were conducted in triplicate and every sample was measured three times. In the analysis of HCB concentration, the soil in every reactor was respectively completely mixed before freeze drying. Then 10 mL of hexane was added to every 0.5 g soil sample ahead of ultrasonic extraction (20 kHz) for 30 min and centrifugation for 10 min (5000 rpm). The supernatant was further filtered with 0.45 lm filtration membrane (GenerayBiotech (Shanghai) Co., Ltd.) (Oonnittan et al., 2010). 2.3. Analytics and calculations
Fig. 1. Configuration of the soil microbial fuel cell.
The HCB concentration was measured with a Gas Chromatograph–Mass Spectrometer (GC–MS) (Thermo Fisher Scientific Co., Ltd., USA). The analysis used GC–MS choice ion pattern (SIM). Peak area of 84.00 and 286.00 were used to generate standard curve. The intermediates of HCB degradation were qualitatively determined by the GC–MS. The capillary column is DB5MASS (inner diameter 0.25 mm, length 30 m). High purity Helium was employed as the carrier gas at a flow rate of 1 mL/ min. The temperature of the gasification compartment was firstly set to 60 °C for 0.5 min, and then raised linearly to 235 °C at a rate of 25 °C/min. After maintaining at 235 °C for 2 min, it was further raised linearly to 250 °C at a rate of 2 °C/min and then maintained at 250 °C for 5 min. Finally, the temperature of gasification component was increased linearly to 280 °C at a rate of 15 °C/min and maintained at 280 °C for 5 min. The retention time and sampling
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
89
volume was 3 min and 1 lL, respectively. The sample was injected with no diversion. The ionization way of mass spectroscopy was electron impact (EI) with the voltage of electron multiplier at 1605 V. The temperatures of the ion source and the interface were 230 °C and 280 °C, respectively. The molecular weight of HCB in the soil was scanned in the range of 45–600 m/z. Separated ingredients were analyzed with a reference to the NIST MS Search 2.0mass spectral library database (Fang et al., 2013). The results of every groups were subjected to T-test analysis for the comparison of HCB removal efficiencies between different groups. If P value <0.01, there is significant difference between the data sets. If 0.01 < P value <0.05, the difference between groups is not very obvious. If P value >0.05, there is no significant difference between the groups. The generated cell voltages (V) were recorded every 8 h by a data acquisition module (DAM-3057 and DAM-3210, Art Technology Co., Ltd., China). HCB removal efficiency was calculated using Eq. (1):
HCB removal efficiency ð%Þ ¼ ðA BÞ=A 100%
ð1Þ
A is the initial HCB concentrations; B is the residual HCB concentrations. The power density (W/m2) was calculated according to Eq. (2):
P ¼ IU=V
ð2Þ
where I is the current, U is the voltage, and V is the working volume of the anode. The internal resistance was calculated by the linear region of polarization curve (Puig et al., 2012; Logan, 2008). In order to examine the influence of anode on electrogenic bacteria, the anodic materials packed in the anodic area of the reactors were sampled at the end of the experiment. In this study, Geobacter sulfurreducens and Beta Proteobacteria were chosen as the typical electrogenic bacteria in the anode (Logan, 2008; Kiely et al., 2011). The relative abundances of G. sulfurreducens and Beta Proteobacteria on the surface of the anodic materials were detected via the fluorescence in situ hybridization (FISH) technique. Samples were pretreated and fixed on the glass slides. The probes for Beta Proteobacteria (BET42a) were labeled with HEX. The sequence is GCTGCCTCCCGTAGGAGT. The probe for G. sulfurreducens (GEO2) was labeled with CY3, used in combination with unlabeled auxiliary probes HGEO2-1(the sequence is GTCCCCCCCTTTTCCCGCAAGA) and HGEO2-2 (the sequence is CTAATGGTACGCGGACTCATCC). All the samples were hybridized with DAPI (40, 60-diamidino-2-phenylindole dihydrochloride) (Kiely et al., 2011) at the same time. The slides were examined under a fluorescence microscope (OLYMPUS-BX42, Japan) and imaged by a Nikon Coolpix P7000 camera. The observation fields were randomly selected, and the fluorescence intensity was detected by Image-Pro Plus. The microbial population were determined by direct counting, and the group specific population were obtained via the normalization of each direct counts to DAPI stained ones in the same field. 3. Results and discussion 3.1. HCB degradation in soil MFC As represented in Fig. 2A, from day 1 to day 7, the average HCB concentrations in Group1, Group2, and Group3 decreased from 35.53 mg/kg, 35.53 mg/kg, and 35.40 mg/kg to 25.07 mg/kg, 23.77 mg/kg, and 24.73 mg/kg, respectively. From day 8 to day 21, the average HCB concentrations in Group1, Group2, and Group3 decreased to 21.71 mg/kg, 22.28 mg/kg, and 22.84 mg/kg, respectively. During day 1 to day 21, the average HCB
Fig. 2. The degradation of HCB in soil MFC: (A) the average HCB concentrations; (B) the average removal efficiencies of HCB; (C) the average degradation rates from day 29 to day 56.
concentrations exhibited insignificant difference in the three groups. Results in Fig. 2B revealed that the average HCB removal efficiencies in Group1, Group2 and Group3 were 37.12%, 35.49%, and 33.61%, respectively. From day 22 to day 56, the average HCB concentrations in Group1, Group2, and Group3 decreased from 21.71 mg/kg, 22.28 mg/kg, and 22.84 mg/kg to 9.96 mg/kg,
90
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
16.41 mg/kg, and 21.01 mg/kg, respectively. This indicated that the average HCB removal efficiencies in Group1, Group2, and Group3 were 34.02%, 17.00%, and 5.31%, respectively. Fig. 2C was the average degradation rates of HCB of last 4 weeks in 3 groups from day 29 to day 56. The average HCB concentrations in Groups 1–3 decreased rapidly from day 1 to day 7. Previous researchers have reported that the half-life period of HCB in soil was 2.622.9 years (Beck and Hansen, 1974; Beall, 1976; Kengara et al., 2013). Therefore, the average degradation rate of HCB in soil was extremely low at natural conditions, and the rapid decrease of HCB concentration in this study probably due to volatilization and the activated carbon adsorption. The HCB concentrations had slight change from day 8 to day 21 (Groups 1–3). From day 22 to day 56, the average HCB concentration in Group3 still changed a little (from 22.84 mg/ kg to 21.01 mg/kg), indicating that without exterior microorganisms addition, it was different to remove HCB only through biodegradation with indigenous microorganisms in the soil. The average HCB concentration in Group2 decreased by 5.87 mg/kg from 22.28 mg/kg to 16.41 mg/kg, which was larger than that in Group3 (P < 0.01). The HCB removal efficiency in Group2 was 3.21 times higher than that in Group3 which indicated that the addition of anaerobic sludge benefited HCB removal performance. What’s more, the average HCB concentration in Group1 decreased by 11.75 mg/kg from 21.71 mg/kg to 9.96 mg/kg. It was obvious that the HCB concentration in Group1 showed a significant decreasing trend compared to those in Group2 and Group3 (T test, PGroup1Group3 < 0.01, PGroup1Group2 < 0.01). The HCB removal efficiency in Group1 was 2 times and 6.32 times higher than that in Group2 and Group3, respectively. Compared with Group2 and Group3, Group1 had significant improvement in HCB removal. Therefore, the soil MFCs dramatically promoted the removal of toxic and refractory organics, such as HCB. 3.2. Electricity generation in soil MFC The electricity generation in soil MFC Run4 along with the running time was represented in Fig. 3A. Our experiments are sequencing batch reactors, the electricity generation in soil MFC would decline as the consumption of organics. Four cycles of electricity generation were observed during the experiment. In each electricity generation cycle, the voltage increased first to a peak, and then decreased. The maximum voltage outputs in each generate electricity cycle were 241 mV, 284 mV, 309 mV, and 326 mV, respectively. Polarization curve was obtained from the stationary phase of the last electricity generation cycle. As shown in Fig. 3B, the highest power density was observed to be 77.5 mW/m2 at the external resistance of 1000 X, while the internal resistance was 972.73 X. During the four electricity cycle period, the peak voltages from the first cycle to the third cycle increased. There was little difference in the maximal voltage between the third and fourth electricity generation cycle. The maximum voltage outputs in each electricity cycle were 241 mV, 284 mV, 309 mV, and 326 mV, respectively. Due to the characteristics of soil, the electricity production performance of MFCs which were consisted of soil was different from that of traditional MFC reactors with liquid phase. Song et al. (2010) constructed a sediment microbial fuel cell (SMFC). In the SMFC reactor, the average current, highest power density and the internal resistance were 0.22 mA, 3.15 mW/m2 and 214 X, respectively. Zhou et al. (2014) also constructed the SMFCs, in which, the voltage outputs were stable at 310 mV, the power density were 9.73–101.52 mW/m2, and the internal resistance were 546–781 X. Sajana et al. (2014) constructed another SMFCs with the voltage outputs of 167–365 mV, the power density of 107.3– 242.1 lW/m2, and the internal resistance of 616–814 X. It can be
Fig. 3. Electricity generation of soil MFC: (A) the electricity generation curves; (B) power density curve and the polarization curve.
concluded that the soil MFC constructed in this study achieved the similar level of voltage outputs and power density as SMFC. Meanwhile, the soil MFC was demonstrated to exhibit good ability of electricity generation.
3.3. Microbial population variation The number of bacteria in Group1, Group2, and Group3 are as follows. The number of G. sulfurreducens in Group1, Group2, Group3 were 35.7 106/g, 8.9 106/g, 0.3 106/g, respectively. The number of Beta Proteobacteria in Group1, Group2, Group3 were 24.6 106/g, 4.7 106/g, 0.2 106/g, respectively. According to the FISH results, the densities of two electrogenic bacteria showed similar variation tendencies. The density of G. sulfurreducens in Group1 was the highest, which was 4 times and 119 times higher than that in Group2 and Group3, respectively. Similarly, the density of Beta Proteobacteria in Group1 was 5 times and 123 times higher than that in Group2 and Group3, respectively. The results indicated that the soil MFC promoted the multiplication and growth of electrogenic bacteria, which subsequently benefit the electricity generation.
3.4. Degradation of HCB The samples were analyzed by GC–MS every 7 days. Trichlorobenzene, tetrachlorobenzene and pentachlorobenzene
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
91
were detected at a retention time of 4.49 min, 6.00 min and 6.74 min, respectively. The potential HCB degradation pathway was proposed by Fathepure et al. (1988) in 1988. They also found that reductive dechlorination was the primary step in the degradation procedure under the anaerobic condition. Pentachlorobenzene and tetrachlorobenzene were the intermediates in the whole degradation process. In Group1 system, pentachlorobenzene was detected in day 21. Meanwhile, pentachlorobenzene, tetrachlorobenzene and trichlorobenzene were detected from day 22 to day 56. However, no degradation productions were obtained in Group3 during the experiments. Therefore, the HCB degradation pathway in soil MFC might be hexachlorobenzene–pentachlorobenzene–tetrachlorobenzene–trichlorobenzene in reduction sequences, which was consistent with what Fathepure proposed. Meanwhile, it have been reported that glucose, methanoic acid or acetic acid were needed as co-substrates during the HCB reduction under anaerobic condition. HCB, as the terminal electron acceptor, was reduced to easily degradable organics by obtaining electrons from the cosubstrates (Chang et al., 1998; Brahushi et al., 2004). 3.5. The influence of different soil pollution concentrations on HCB removal efficiencies In this section, three different soil pollution concentrations (40 mg/kg, 80 mg/kg, and 200 mg/kg) were studied to find the influence of different soil pollution concentrations on HCB removal efficiencies. As presented in Fig. 4A, from day 1 to day 7, the average HCB removal efficiencies in Group1, Group2, Group7, Group8, Group9 and Group10 were 37.12%, 35.49%, 34.35%, 31.51%, 26.29%, 22.70%, respectively. From day 22 to day 56, the average HCB removal efficiencies in Group1, Group2, Group7, Group8, Group9 and Group10 were 34.02%, 17.00%, 27.80%, 12.18%, 23.77%, 8.19%, respectively. It was found from the results listed in Fig. 4B that the average degradation rates of HCB in 6 groups were 0.336 mg/(kg d), 0.167 mg/(kg d), 0.543 mg/(kg d), 0.238 mg/(kg d), 1.184 mg/(kg d), 0.408 mg/(kg d), respectively. Fig. 4C was the average degradation rates of HCB of last 4 weeks in 6 groups from day 29 to day 56. With the increase of HCB concentrations in polluted soil, the degradation rate increased although the removal efficiency declined in soil MFCs when comparing Group1, and Group2 with Group7, Group8, Group9 and Group10. The average HCB concentrations in 6 groups were declined by time, results in Fig. 4C revealed that the average degradation rates of HCB declined by week, which could verify that he average degradation rates of HCB increase with the HCB concentration. It indicated that the soil MFCs impacted the HCB removal with different concentrations, which was in agreement with other documented findings that MFCs promote greatly the removal of refractory organics (Galvez et al., 2009; Luo et al., 2009). In the soil containing HCB or other toxic refractory organic pesticides, the soil MFCs with the settings of both the cathode and anode activated carbons, inoculated sludge and added co-substrate can significantly improve the HCB removal efficiencies. 3.6. Effects of current on HCB removal efficiencies In this part, the currents in soil MFCs changed with the variation of external resistances connected in external circuits. The comparison of HCB removal efficiencies in soil MFCs along with external resistance was represented in Fig. 5A. It can be seen that HCB removal efficiencies were 39.33%, 38.80%, 36.1% and 37.13% during the time internal of day 1 to day 21, meanwhile, 18.17%, 22.38%, 26.8% and 34.02% from day 22 to day 56 when the external resistances were 2000 X, 1000 X, 510 X and 10 X,
Fig. 4. The degradation of HCB in soil MFC: (A) the average degradation efficiencies of HCB; (B) the average degradation rates with different soil pollution concentrations; (C) the average degradation rates from day 29 to day 56.
respectively. Fig. 5B revealed the relationship between the average degradation rates of HCB from day 22 to day 56 and the average maximum currents in the four cycles of the 3 groups. As indicated in Fig 5B, a high positive relationship (R2 = 0.9949) between the HCB degradation efficiency and the average maximal currents was found. The lower external resistance would induce larger current in soil MFC, which was probably due to the increased substrate conversion rate at the lower resistance during the MFCs operation (Gil et al., 2003). The lower external resistance could reduce the extracellular electron transfer resistance and subsequently increase the
92
X. Cao et al. / Bioresource Technology 189 (2015) 87–93
(3) The electric field affected certain enzymes in electrogenic bacteria to promote organic removal reactions (Pitts et al., 2003). The three principal pathways mentioned above may all exist in soil MFCs. The HCB degradation pathway in the soil MFC was reductive dechlorination under the anaerobic condition. The reduction of HCB needs to gain electrons in the reaction. Meanwhile, the average removal/degradation rate of HCB increased along with the increase of current in soil MFCs. The electrogenic bacteria created large numbers of electrons when the co-substrates (sodium acetate) were available. Some of the generated electrons were transferred from the anode to the cathode to generate an electric current, and the others were directly used for reductive dechlorination of HCB. The densities of electrons and currents in soil MFCs increased with the decrease of external resistance, indicating that more electrons could be utilized to HCB reduction. In summary, as the first way mentioned above, the existence of the anode promoted the multiplication and growth of electrogenic bacteria to provide electrons to increase the metabolic reactions rates of anaerobic bacteria in the MFCs, which provided the most important channel for the improvement of refractory organic pollutants removal efficiency. 4. Conclusions The soil MFCs can significantly improve toxic refractory organic pesticide removal efficiencies. The HCB removal efficiency in experimental group was 6.32 times higher than that in blank control group. Meanwhile, the highest power density in soil MFC was 77.5 mW/m2 and the internal resistance was 972.73 X. The FISH results showed that the soil MFC promoted the multiplication and growth of electrogenic bacteria. The HCB degradation pathway in soil MFC was clear in reduction sequences. The electrons created by electrogenic bacteria were significant for the improvement of HCB removal efficiency. Further studies on electron motion is needed. Fig. 5. Current generation and effects on HCB removal in different soil MFCs: (A) HCB removal efficiencies with different external resistances; (B) the relationship between the average degradation efficiencies of HCB and the average maximum currents in four electricity generation cycles.
electron transfer rate. The average HCB degradation rates accelerated with the increase of current in soil MFCs. As shown in Fig. 5B, a positive correlation (R2 = 0.9949) between the HCB degradation efficiency and the average maximal currents. With the increase of current in soil MFCs, the number of electrons passing a random cross section in circuit per unit time increased, and subsequently, improved the degradation rate of refractory organics. This result demonstrated that the increased number of electrons benefited the removal of refractory organics with the presence of co-substrates. These findings were consistent with those reported by Sun et al. (2009). Previous studies have shown that there were three principal ways to explain why MFCs could promote the removal efficiencies of refractory organic pollutants: (1) The electrons created by electrogenic bacteria at the anode increased the metabolic reaction rates of anaerobic bacteria (Luo et al., 2009; Li et al., 2010). (2) The electric field could change the permeability of cell membrane, leading to the excessive absorbance of extracellular substances and further change the microbial metabolism (Rittmann and McCarty, 2001).
Acknowledgements We thank the National Natural Science Foundation of China (21277024), the Provincial Natural Science Foundation of Jiangsu, China (BK20141330 and BK20141117), and the National Key Technology R&D Program (2013BAJ10B12-02) for financial support. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.biortech.2015.03. 148. References Acar, Y.B., Alshawabkeh, A.N., 1993. Principles of electrokinetic remediation. Environ. Sci. Technol. 27, 2638–2647. Beall, M.L., 1976. Persistence of aerially applied hexachlorobenzene on grass and soil. J. Environ. Qual. 5, 367–369. Beck, J., Hansen, K.E., 1974. The degradation of quintozene, pentachlorobenzene, hexachlorobenzene and pentachloroaniline in soil. Pestic. Sci. 5, 41–48. Brahushi, F., Doerfler, U., Schroll, R., Munch, J.C., 2004. Stimulation of reductive dechlorination of hexachlorobenzene in soil by inducing the native microbial activity. Chemosphere 55, 1477–1484. Chang, B., Su, C., Yuan, S., 1998. Microbial hexachlorobenzene dechlorination under three reducing conditions. Chemosphere 36, 2721–2730. Fang, Z., Song, H.L., Cang, N., Li, X.N., 2013. Performance of microbial fuel cell coupled constructed wetland system for decolorization of azo dye and bioelectricity generation. Bioresour. Technol. 144, 165–171.
X. Cao et al. / Bioresource Technology 189 (2015) 87–93 Fang, Z., Song, H.L., Cang, N., Li, X.N., 2015. Electricity production from Azo dye wastewater using a microbial fuel cell coupled constructed wetland operating under different operating conditions. Biosens. Bioelectron. 69, 135–141. Fathepure, B.Z., Tiedje, J.M., Boyd, S.A., 1988. Reductive dechlorination of hexachlorobenzene to tri- and dichlorobenzenes in anaerobic sewage sludge. Appl. Environ. Microbiol. 54, 327–330. Freguia, S., Rabaey, K., Yuan, Z., Keller, J., 2008. Syntrophic processes drive the conversion of glucose in microbial fuel cell anodes. Environ. Sci. Technol. 42, 7937–7943. Galvez, A., Greenman, J., Ieropoulos, I., 2009. Landfill leachate treatment with microbial fuel cells; scale-up through plurality. Bioresour. Technol. 100, 5085–5091. Gil, G.C., Chang, I.S., Kim, B.H., Kim, M., Jang, J.K., Park, H.S., Kim, H.J., 2003. Operational parameters affecting the performance of a mediator-less microbial fuel cell. Biosens. Bioelectron. 18, 327–334. Kengara, F.O., Doerflera, U., Welzlc, G., Rutha, B., Muncha, J.C., Schroll, R., 2013. Enhanced degradation of 14C-HCB in two tropical clay soils using multiple anaerobiceaerobic cycles. Environ. Pollut. 173, 168–175. Khan, F.I., Husain, T., Hejazi, R., 2004. An overview and analysis of site remediation technologies. J. Environ. Manage. 71, 95–122. Kiely, P.D., Rader, G., Regan, J.M., Logan, B.E., 2011. Long-term cathode performance and the microbial communities that develop in microbial fuel cells fed different fermentation end products. Bioresour. Technol. 102, 361–366. Klass, D.L., 1998. Biomass for Renewable Energy, Fuels, and Chemicals. Academic Press, San Diego. Kong, L.L., Liu, W.T., Zhou, Q.X., 2014. An effective amendment for remediating contaminated soil. Rev. Environ. Contam. Toxicol. 228, 83–99. Kumpiene, J., Lagerkvist, A., Maurice, C., 2008. Stabilization of As, Cr, Cu, Pb and Zn in soil using amendments-a review. Waste Manage. 28, 215–225. Lear, G., Harbottle, M.J., Sills, G., Knowles, C.J., Semple, K.T., Thompson, I.P., 2007. Impact of electrokinetic remediation on microbial communities within PCP contaminated soil. Environ. Pollut. 146, 139–146. Li, J., Liu, G.L., Zhang, R.D., Luo, Y., Zhang, C.P., Li, M.C., 2010. Electricity generation by two types of microbial fuel cells using nitrobenzene as the anodic or cathodic reactants. Bioresour. Technol. 101, 4013–4020. Liu, S.T., Song, H.L., Wei, S.Z., Yang, F., Li, X.N., 2014. Bio-cathode materials evaluation and configuration optimization for power output of vertical subsurface flow constructed wetland—microbial fuel cell systems. Bioresour. Technol. 166, 575–583. Logan, B.E., 2008. Microbial Fuel Cell. John Wiley & Sons, New York. Luo, H., Liu, G., Zhang, R., Jin, S., 2009. Phenol degradation in microbial fuel cells. Chem. Eng. J. 147, 259–264. Oonnittan, A., Isosaari, P., Sillanpaeae, M., 2010. Oxidant availability in soil and its effect on HCB removal during electrokinetic Fenton process. Sep. Purif. Technol. 76, 146–150.
93
Pitts, K.E., Dobbin, P.S., Reyes-Ramirez, F., Thomson, A.J., Richardson, D.J., Seward, H.E., 2003. Characterization of the Shewanella oneidensis MR-1 decaheme cytochrome MtrA: expression in Escherichia coli confers the ability to reduce soluble Fe (III) chelates. J. Biol. Chem. 278, 27758–27765. Probstein, R.F., Hicks, R.E., 1993. Removal of contaminants from soils by electric fields. Science 260, 498–503. Puig, S., Coma, M., Desloover, J., Boon, N., Balaguer, M.D., 2012. Autotrophic denitrification in microbial fuel cells treating low ionic strength waters. Environ. Sci. Technol. 46, 2309–2315. Rittmann, B.E., McCarty, P.L. (Eds.), 2001. Environmental Biotechnology: principles and applications. McGraw-Hill, New York. Sajana, T.K., Ghangrekar, M.M., Mitra, A., 2014. Effect of presence of cellulose in the freshwater sediment on the performance of sediment microbial fuel cell. Bioresour. Technol. 155, 84–90. Song, T.S., Yan, Z.S., Zhao, Z.W., Jiang, H.L., 2010. Removal of organic matter in freshwater sediment by microbial fuel cells at various external resistances. J. Chem. Technol. Biotechnol. 85, 1489–1493. Sun, J., Hu, Y.Y., Bi, Z., Cao, Y.Q., 2009. Simultaneous decolorization of azo dye and bioelectricity generation using a microfiltration membrane air-cathode singlechamber microbial fuel cell. Bioresour. Technol. 100, 3185–3192. Villaseñor, J., Capilla, P., Rodrigo, M.A., Cañizares, P., Fernández, F.J., 2013. Operation of a horizontal subsurface flow constructed wetland—microbial fuel cell treating wastewater under different organic loading rates. Water Res. 47, 6731–6738. Virdis, B., Rabaey, K., Yuan, Z., Rozendal, R.A., Keller, J., 2009. Electron fluxes in a microbial fuel cell performing carbon and nitrogen removal. Environ. Sci. Technol. 43, 5144–5149. Yong, X.Y., Feng, J., Chen, Y.L., Shi, D.Y., Xu, Y.S., Zhou, J., Shu, Y.W., Xu, L., Yong, C.Y., Sun, Y.M., Shi, C.L., 2014. Enhancement of bioelectricity generation by cofactor manipulation in microbial fuel cell. Biosens. Bioelectron. 56, 19–25. Yuan, S.H., Shu, Z., Wan, J.Z., Lu, X.H., 2007. Enhanced desorption of hexachlorobenzene from kaolin by single and mixed surfactants. J. Colloid Interface Sci. 314, 167–175. Zhou, Q., Song, Y. (Eds.), 2004. Contaminated soil remediation: principles and methods. Science Press, Beijing. Zhou, Y.L., Yang, Y., Chen, M., Zhao, Z.W., Jiang, H.L., 2014. To improve the performance of sediment microbial fuel cell through amending colloidal iron oxyhydroxide into freshwater sediments. Bioresour. Technol. 159, 232–239.