- Email: [email protected]
Simultaneous detection of norovirus and rotavirus in oysters by multiplex RT–PCR
Available online at www.sciencedirect.com
Food Control 19 (2008) 722–726 www.elsevier.com/locate/foodcont
Short communication
Simultaneous detection of norovirus and rotavirus in oysters by multiplex RT–PCR Xiaoxia Kou a
a,b
, Qingping Wu
a,*
, Dapeng Wang
a,b,c
, Jumei Zhang
a
Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Institute of Microbiology, Guangzhou 510070, China b Wuhan Institute of Virology, Chinese Academy of Science, Wuhan 430071, China c Graduate University of Chinese Academy of Sciences, Beijing 100049, China Received 21 November 2006; received in revised form 23 June 2007; accepted 2 July 2007
Abstract Multiplex reverse transcription–polymerase chain reaction (RT–PCR) was used to detect noroviruses (NVs) and rotaviruses (RVs) in artificially and naturally contaminated oysters. Clearly expected amplicons of 327 bp from NVs and 392 bp from RVs were obtained, respectively. The sensitivity was 200 pg RNA/g oyster tissue. In a total of 150 naturally contaminated oysters that were highly polluted by feces, 5 (3.33%) were rotavirus, 21 (14%) were norovirus GII and 6 (4%) were norovirus GI. The results clearly demonstrate that the multiplex RT–PCR method is a specific, sensitive and time-saving method and can be used to detect NVs and RVs in marine products before their entering the markets. 2007 Elsevier Ltd. All rights reserved. Keywords: Norovirus; Rotavirus; Multiplex RT–PCR; Oyster
1. Introduction Noroviruses (NVs) and rotaviruses (RVs) are well known to be the most common causes of acute viral gastroenteritis throughout the world (Koopmans et al., 2002). NVs and RVs are environmentally stable viruses that are readily transmitted via the fecal-oral route. Oysters, being aquatic filter feeders, are notorious as a source of foodborne viral infectious because they actively concentrate viruses from contaminated water (Lees, 2000). The linkage between viral gastroenteritis and consumption of oysters has been reported internationally for many years. The reports indicated that infectious viruses still can be detected after six weeks without any loss in quality of shellfish (Lee & Younger, 2002). Furthermore, the common processing procedures of seafood by icing and freezing are likely to enhance survival of the viruses. As a result, consumption of virus-contaminated oysters represents a significant *
Corresponding author. Tel./fax: +86 20 8768 8132. E-mail address: [email protected] (Q. Wu).
0956-7135/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2007.07.001
health threat to shellfish consumers, as well as an economic threat to the seafood industry. Currently, the sanitary quality control of marketable oyster is based on analysis of the level of fecal-pollution bacterial indicators in oysters or in growing-waters. However, the reliability of these microorganisms as an indicator of viral pollution has been widely questioned (Muniain-Mujika, Calvo, Lucena, & Girones, 2003), which is emphasized by occurrence of viral outbreaks associated with consumption of oysters which have been proved meeting the legal bacteriological standards (Shieh et al., 2000). Therefore, to develop rapid and sensitive methods allowing the direct detection of viral contaminants in oyster is particularly important to prevent spread of diseases and limit economic losses. To date, NVs cannot be cultured in vitro. RVs can be cultured, which is, however, very difficult. Laboratory detection methods depend primarily on electron microscopy (EM), enzyme-linked immunosorbent assay (ELISA) and reverse transcription–polymerase chain reaction (RT– PCR) (Rohayem et al., 2004). Because of its high specificity
X. Kou et al. / Food Control 19 (2008) 722–726
and sensitivity, RT–PCR is the only published method that offers the possibility of direct detection of these viruses in environmental samples (Lees, 2000). But the conventional RT–PCR detects only one template per reaction and difficult to detect multiple specimens in a short time. In contrast to monoplex assay, the multiplex RT–PCR assay incorporates different sets of specific primers for two or more targets in one reaction tube and enables simultaneous amplification of different target nucleic acids in a single test. Because of the reduction in labor and reagent costs and time, multiplex RT–PCR studies have attracted much attention and been largely applied in clinical services (Yan, Yagyu, Okitsu, Nishio, & Ushijima, 2003). However, little attempt has been focused on the detection of oysters specimens in these studies. The major aim of our research was to (i) develop multiplex RT–PCR method for simultaneous detection of NVs and RVs, (ii) test the artificially contaminated oysters with NVs and RVs to determine the utility of the multiplex RT–PCR and (iii) detect NVs and RVs from the naturally contaminated oysters using the new developed method.
723
1996) and can detect GGI and GGII simultaneously. Primers of RVs designed according to the VP7 gene (Flores et al., 1990; Gouvea et al., 1990; Le Guyader, Dubois, Menard, & Pommepuy, 1994). The sequences of the oligonucleotide primers were listed in Table 1. 2.4. Multiplex RT–PCR
2. Materials and methods
The optimum assay was performed in 25 ll of a mixture containing 2 ll target RNA, 2.5 ll 10 · PCR buffer, 100 U of reverse-transcriptase M-MLV (Invitrogen), 20 U of RNase inhibitor (Promega), 2 mM MgCl2, 250 lM each dNTP (Promega), 0.6 lM JV12/JV13 and 0.6 lM P1/P2, 1.5 U of Taq DNA polymerase (Invitrogen), and added DEPC water to 25 ll. Reverse transcription reaction was carried out at 42 C for 40 min followed by 5 min at 94 C, and then amplified by touchdown PCR cycling parameter as follows: denaturation at 94 C for 45 s, annealing at 55 C for 1 min at the initial 10 cycles, then reducing the annealing temperature by 1 C increment every two cycles to 50 C, which was used for the final 15 cycles, extension at 72 C for 1 min, for total of 35 cycles, followed by final extension for 7 min at 72 C.
2.1. Virus specimens
2.5. Evaluation of multiplex RT–PCR
Two fecal specimens derived from patients with gastroenteritis, which were previously tested to be positive for NVs and RVs by RT–PCR respectively were used as positive control to develop and evaluate multiplex RT–PCR. The sequences of amplicons were 100% homology to that of accession no. DQ369797 of NVs and no. D50116 of RVs.
To determine the specificity of primer pairs and reaction conditions in the multiplex RT–PCR, the amplification reactions in various combinations as follows: the PCR mixtures containing the mixed templates (NVs and RVs) with only one set of primer of NVs or RVs, the mixed primer pairs (NVs and RVs) with single template of RVs or NVs and the mixed templates (NVs and RVs) with the mixed primer pairs (NVs and RVs), were tested. In addition, 10fold serial dilutions (101–106) of extracted RNA were simultaneously detected by multiplex RT–PCR to determine the sensitivity. The final concentrations of each kind of premixes were the same as the procedures mentioned above.
2.2. RNA extraction RNA were extracted from 200 ll fecal samples (positive control) by Trizol-LS reagent (Gibco BRL, Gaithersburg, Maryland, CA, USA) according to the manufacturer’s protocols. The RNA pellets were all dissolved in 50 ll of DEPC-treated water. Quantification of RNA yields was undertaken by measuring the absorbance at 260 nm of a 1:100 dilution of each sample, against an appropriate blank. The RNA solution was stored at 80 C. 2.3. Primers Primers of NVs target the RNA-dependent RNA polymerase gene (Koopmans et al., 2002; Vinje and Koopmans,
2.6. Artificially contaminated oysters Ninety-six oysters obtained from the local marine market, which were negative for noroviruses and rotaviruses, were subsequently used to evaluate the utility of multiplex RT–PCR method. The oysters were shucked. The stomach and digestive diverticuli were removed by dissection, and cut into small portions, mixed, divided into 1 g portions and frozen. Frozen aliquots of pancreatic tissues dissected
Table 1 Primers of NVs and RVs Virus
Primer
Sequence (5 0 -3 0 )
Location
Product size (bp)
NVs
JV12 JV13 P1 P2
ATACCACTATGATGCAGATTA TCATCATCACCATAGAAAGAG GGCTTTAAAAGAGAGAATTTCCGTCTGG GATCCTGTTGGCCATCC
4552–4572 4858–4878 1–28 376–392
327
RVs
392
724
X. Kou et al. / Food Control 19 (2008) 722–726
from shellfish were used for artificial contamination with 200 ll dilutions of fecal suspension. The samples were homogenized for 1 min by vortexing before virus concentration and nucleic acid extraction. Virus concentration and recovery were performed by a previously described method (Atmar et al., 1995; Le Guyader, Haugarreau, Miossec, Dubois, & Pommepuy, 2000). A total of 200 ll elution were collected and subjected to RNA extraction as described above. 2.7. Naturally contaminated oysters A total of 150 oysters, which were highly contaminated by feces, were collected randomly from six oyster culture ponds in Guangzhou city of China between December 2004 and January 2005. All samples were shipped directly to the laboratory in cold storage and processed within a 24 h period. Oysters were washed, scrubbed under clean running water and opened with a sterile shucking knife. The virus recovery was treated as described above. The viral concentrate was stored at 80 C prior to nucleic acid extraction. 2.8. Electrophoresis Amplified products of multiplex RT–PCR were analysed on 1.4% agarose gel in TBE buffer containing 2.5 ll Goldview dye (Sbs, Guangzhou, China) for 45 min at 5v/ cm, and then the amplified fragments were visualized under ultraviolet light. 2.9. Sequence analysis Positive amplicons of NVs and RVs from naturally contaminated shellfish were extracted and purified using the High pure PCR Product Purification Kit (Roche Diagnostics, Baesl, Switzerland) and sequenced on an automated sequencer (ABI 373 A, Applied Biosystems). Sequences were compared with available sequences in GenBank using the BlAST program of the National Center for Biotechnology Information (NCBI). 2.10. Controls and interpretation
Fig. 1. The specificity of multiplex RT–PCR assay with different reaction modes. M.100 bp ladder DNA marker (Promega); N. negative control; Lane 1: a mixture of primer pairs of P1/P2 and JV12/JV13 with single template of NVs; Lane 2: a mixture of templates of NVs and RVs with single primer pair of JV12/JV13; Lane 3: a mixture of primer pairs of P1/ P2 and JV12/JV13 with single template of RVs; Lane 4: a mixture of templates of NVs and RVs with single primer pair of P1/P2; Lane 5: the mixture of templates of NVs and RVs with the mixture of primer pairs for P1/P2 and JV12/JV13.
in a very sharp band corresponding to the expected size of 327 bp for NVs and 392 bp for RVs, respectively. The specificity of the multiplex RT–PCR reaction system was further confirmed by carrying out amplification reactions in different combinations described as 2.5. Clearly anticipative band was acquired in every reaction mode. No crossreaction happened between primers and templates. Each test repeated three or more times gave reproducible results. No band was obtained in negative controls. The results confirmed that the multiplex RT–PCR employing primer pairs and reaction conditions effectively detected the target viruses. 3.2. Sensitivity of multiplex RT–PCR in fecal samples In order to determine the sensitivity level of multiplex RT–PCR, 10-fold serial dilutions, corresponding to the template was 0.5 lg, 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, resectively, were made and examined by the multiplex RT–PCR. The highest detection limit was 50 pg RNA per 200 ll fecal specimens for two viruses (Fig. 2) except that the bands of NVs were slightly weak when 50 pg RNA of NVs was amplified.
All precautions were done to prevent false positive or negative results. Amplifications were performed in different rooms and filter-equipped pipette tips were used throughout the assay. All experiments were repeated at least twice, and a negative control sample (i.e., containing no nucleic acid) was run with each test. 3. Results 3.1. Specificity of multiplex RT–PCR The main products of multiplex RT–PCR were shown in Fig. 1. All products in agarose gel electrophoresis resulted
Fig. 2. The sensitivity of multiplex RT–PCR in fecal samples. M: 100 bp ladder DNA marker (Promega); N: negative control; Lane (1–6): 10-fold dilutions of RNA corresponding to 0.5 lg, 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, resectively.
X. Kou et al. / Food Control 19 (2008) 722–726
Fig. 3. The detection limit of multiplex RT–PCR in artificially contaminated oysters. M: 100 bp ladder DNA marker (Promega); N: negative control; P: positive control; Lane (1–5): 200 pg of RNA from 1.0 g artificially contaminated oyster tissues were amplified.
3.3. Sensitivity of multiplex RT–PCR in artificially contaminated oysters Artificially contaminated oysters were used to determine whether the multiplex RT–PCR method could be carried out in live contaminated shellfish. Ten-fold serial dilutions of RNA from the oyster extracts were tested. A repeated positive signal was exhibited when the RNA preparations were adjusted to 200 pg RNA/g contaminated oysters tissues. A total of 96 experimentally contaminated oysters were tested and similar results obtained. The results were shown in Fig. 3. 3.4. Detection of NVs and RVs in naturally contaminated oysters In total, 32 (21.33%) out of 150 naturally oysters were positive for the target viruses, of which, 5 (3.33%) were rotavirus, 21 (14%) were norovirus GII and 6 (4%) were norovirus GI. The sequences of amplicons showed 95–100% homology to human rotavirus serotype G1, G3 and G9 [Wa (K02033), WD33 (Y18786), jpn-421 (D16326), JA2 (D86266, Japan), DL73 (AJ491165, United States) and R136 (AF438228, United States), respectively], 91–98% homology to those of the putative RNA-dependent RNA polymerase domain of norovirus genotype GGII.1, GGII.2, GGII.4 (prototype strains Hawaii/1971/ US, Melksham/1994/K, Bristol/1993/UK, Camberwell/ 1994/AU and Lordsdale/1993/UK, respectively) and 93– 99% identity to those of putative RNA-dependent RNA polymerase domain of norovirus genotype GGI.1, GGI.2 or GGI.4 (prototype strains Norwalk/1968/US, Southampton/1991/UK and Chiba407/1987/JP, respectively). 4. Discussion Shellfish, especially oysters, contaminated by microorganisms that are pathogenic to humans is a worldwide public health concern. Although many diagnostic methods have been developed for the detection of virus or viral
725
RNA in food and water, they have not found their way to routine laboratories in most parts of the world. Currently, there are international collaborative efforts to produce PCR-based methods for foodborne pathogens that are suitable for standardization and adoption as routine diagnostic procedures (Malorny et al., 2003). The framework of these efforts is based on three principal steps: demonstration of primer specificity; evaluation of the method through collaborative trial; and finally, proposal to an international standardization body such as CEN (European Committee for Standardization). To date, RT–PCR assays have been shown to be useful diagnostic procedures for RNA virus detection. It is reported that sensitivity of the conventional PCR with specific primer was higher than that of EM (Vipond et al., 2000) and ELISA (Saito et al., 1995). Multiplex PCR is the first step towards PCR automation for routine simultaneous laboratory testing of diverse viral parameters in environmental samples and food. In this study, a multiplex reverse transcription–polymerase chain reaction was designed for the simultaneous detection of NVs and RVs in oysters, and represented a reduction of the time and cost of the assay. There were some aspects of this study to be addressed. When the multiplex RT–PCR assay was used as routine microbiological diagnostic tools, great attention must be paid to the specificity. A possible interaction should be prevented not only between primers and primers, but also between primers and non-target templates. In this study, each primer set was challenged with target template or non-target template. The high specificity of the primers JV12/JV13 for NVs and P1/P2 for RVs were demonstrated as shown in Fig. 1. These results showed that the primers and the optimum reaction conditions used in this study were highly specific. The detection limit decreased from 50 pg RNA in fecal specimens to 200 pg RNA in oysters tissues when 200 ll fecal samples mixed into 1.0 g oysters tissues. Although there is decrease in sensitivity, the overall efficiency of multiplex RT–PCR method could be used to successfully detect NVs and RVs in oysters. The application of multiplex RT–PCR was validated by testing 150 naturally contaminated oysters and further confirmed by sequencing of amplicons from all the positive samples. The reduction of sensitivity was probably a consequence of too many inhibitors existing in shellfish. Therefore, further studies will be concentrated on a more efficient method for virus recovery and PCR pretreatment to eliminate inhibitors of shellfish in our next work. In addition, Primer design and selection was a key factor when a multiplex amplification system was designed. Many primer sets had been used for detection of NV due to its genetic diversity (Green, Gallimore, Norcott, Lewis, & Brown, 1995; Jiang et al., 1999), but they differed in sensitivity and accuracy. The primer sets of JV12/JV13 of NVs gave the excellent results in the assay of specificity and sensitivity after many repeated trials in this study.
726
X. Kou et al. / Food Control 19 (2008) 722–726
Generally, the multiplex RT–PCR has effectively incorporated two-tube two-step reaction into single-round reaction, and successfully simultaneously detected two important foodborne viruses in shellfish with high sensitivity and specificity. Although there exist some limitations, RT–PCR, as a diagnostic tool for food and environmental samples, is surely worthy of committed developmental effort, could be used to detect the NVs and RVs for routine monitoring and risk assessment for a large scale screening in diseases outbreak and marine products. Acknowledgement This work was supported by nature science Grant from Guangdong province. References Atmar, R. L., Neill, F. H., Romalde, J. L., Le Guyader, F., Woodley, C. M., Metcalf, T. G., et al. (1995). Detection of Norwalk virus and Hepatitis A virus in shellfish tissues with the PCR. Applied and Environmental Microbiology, 61, 3014–3018. Flores, J., Sears, J., Schael, P. I., White, L., Garcia, D., Lanata, C., et al. (1990). Identification of human RV serotype by hybridization to polymerse chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capisid protein VP7. Journal of Virology, 64, 4021–4024. Gouvea, V., Allen, J. R., Glass, R. I., Woods, P., Taniguich, K. C., Lark, H. F., et al. (1990). Polymerase chain reaction amplification and typing of RV nucleic acid from stool specimens. Journal of Clinical Microbiology, 28, 276–282. Green, J., Gallimore, C. I., Norcott, J. P., Lewis, D., & Brown, D. W. (1995). Broadly reactive reverse transcriptase polymerse chain reaction for the diagnosis of SRSV-associated gastroenteritis. Journal of Medical Virology, 47, 392–398. Jiang, X., Huang, P. W., Zhong, W. M., Farkas, T., Cubitt, D. W., & Matson, D. O. (1999). Design and evaluation of a primer pair that detects both Norwalk- and Sappo-like Calicivirus by RRT–PCR. Journal of Virological Methods, 83, 145–154. Koopmans, M., De Bruin, E., & Vennema, H. (2002a). Rational optimisation of generic primers used for Norwalk-like virus detection by reverse transcription polymerse chain reaction. Journal of Clinical Methods, 25, 233–236.
Koopmans, M., von Bonsdorff, C. H., Vinje, J., de Medici, D., & Monroe, S. (2002b). Foodborne viruses. FEMS Microbiological Review, 26, 187–205. Le Guyader, F., Dubois, E., Menard, D., & Pommepuy, M. (1994). Detection of hepatitis A virus, RV, and enterovirus in naturally contaminated shellfish and sediment by reverse transcription-seminested PCR. Applied and Environmental Microbiology, 60, 3665–3671. Le Guyader, F., Haugarreau, L., Miossec, L., Dubois, E., & Pommepuy, M. (2000). Three-year study to assess human enteric viruses in shellfish. Applied and Environmental Microbiology, 66, 3241–3248. Lee, R. J., & Younger, A. D. (2002). Developing microbiological risk assessment for shellfish purification. International Biodeterioration and Biodegradation, 50, 177–183. Lees, D. (2000). Viruses and bivalve shellfish. International Journal of Food Microbiology, 59, 81–116. Malorny, B., Tassios, P. T., Radstrom, P., Cook, N., Wagner, M., & Hoorfar, J. (2003). Standardization of diagnostic PCR for the detection of foodborne pathogens. International Journal of Food Microbiology, 83, 39–48. Muniain-Mujika, I., Calvo, M., Lucena, F., & Girones, R. (2003). Comparative analysis of viral pathogens and potential indicators in shellish. International Journal of Food Microbiology, 83, 75–85. Rohayem, J., Berger, S., Juretzek, T., Herchenroder, O., Mogel, M., Poppe, M., et al. (2004). A simple and rapid single-step multiplex RT– PCR to detect NV, astrovirus and adenovirus in clinical stool specimens. Journal of Virological Methods, 118, 49–59. Saito, K., Ushijima, H., Nishio, O., Oseto, M., Motohiro, H., Ueda, Y., et al. (1995). Detection of astroviruses from stool specimens in Japan using reverse transcription and polymerase chain reaction amplification. Microbiological Immunology, 39, 825–828. Shieh, C. Y. S., Monroe, S. S., Fankhauser, R. L., Langlois, G. W., Burkhardt, W., & Baric, R. S. (2000). Detection of Norwalk-like virus in shellfish implicated in illness. Journal of Infective Disease, 181, 360–366. Vinje, J., & Koopmans, M. (1996). Molecular detection and epidemiology of small round structured viruses in outbreaks of gastroenteritis in the Netherlands. Journal of Infective Disease, 174, 610–615. Vipond, I. B., Pelosi, E., Williams, J., Ashley, C. R., Lambden, P. R., Clarke, I. N., et al. (2000). A diagnostic EIA for detection of the prevalent SRSV strain in United Kingdom outbreaks of gastroenteritis. Journal of Medical Virology, 61, 132–137. Yan, H., Yagyu, F., Okitsu, S., Nishio, O., & Ushijima, H. (2003). Detection of NV (GI,GII), sapovirus and astrovirus in fecal specimens using reverse transcription single-round multiplex PCR. Journal of Virological Methods, 114, 37–44.
Food Control 19 (2008) 722–726 www.elsevier.com/locate/foodcont
Short communication
Simultaneous detection of norovirus and rotavirus in oysters by multiplex RT–PCR Xiaoxia Kou a
a,b
, Qingping Wu
a,*
, Dapeng Wang
a,b,c
, Jumei Zhang
a
Guangdong Provincial Key Laboratory of Microbial Culture Collection and Application, Guangdong Institute of Microbiology, Guangzhou 510070, China b Wuhan Institute of Virology, Chinese Academy of Science, Wuhan 430071, China c Graduate University of Chinese Academy of Sciences, Beijing 100049, China Received 21 November 2006; received in revised form 23 June 2007; accepted 2 July 2007
Abstract Multiplex reverse transcription–polymerase chain reaction (RT–PCR) was used to detect noroviruses (NVs) and rotaviruses (RVs) in artificially and naturally contaminated oysters. Clearly expected amplicons of 327 bp from NVs and 392 bp from RVs were obtained, respectively. The sensitivity was 200 pg RNA/g oyster tissue. In a total of 150 naturally contaminated oysters that were highly polluted by feces, 5 (3.33%) were rotavirus, 21 (14%) were norovirus GII and 6 (4%) were norovirus GI. The results clearly demonstrate that the multiplex RT–PCR method is a specific, sensitive and time-saving method and can be used to detect NVs and RVs in marine products before their entering the markets. 2007 Elsevier Ltd. All rights reserved. Keywords: Norovirus; Rotavirus; Multiplex RT–PCR; Oyster
1. Introduction Noroviruses (NVs) and rotaviruses (RVs) are well known to be the most common causes of acute viral gastroenteritis throughout the world (Koopmans et al., 2002). NVs and RVs are environmentally stable viruses that are readily transmitted via the fecal-oral route. Oysters, being aquatic filter feeders, are notorious as a source of foodborne viral infectious because they actively concentrate viruses from contaminated water (Lees, 2000). The linkage between viral gastroenteritis and consumption of oysters has been reported internationally for many years. The reports indicated that infectious viruses still can be detected after six weeks without any loss in quality of shellfish (Lee & Younger, 2002). Furthermore, the common processing procedures of seafood by icing and freezing are likely to enhance survival of the viruses. As a result, consumption of virus-contaminated oysters represents a significant *
Corresponding author. Tel./fax: +86 20 8768 8132. E-mail address: [email protected] (Q. Wu).
0956-7135/$ - see front matter 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodcont.2007.07.001
health threat to shellfish consumers, as well as an economic threat to the seafood industry. Currently, the sanitary quality control of marketable oyster is based on analysis of the level of fecal-pollution bacterial indicators in oysters or in growing-waters. However, the reliability of these microorganisms as an indicator of viral pollution has been widely questioned (Muniain-Mujika, Calvo, Lucena, & Girones, 2003), which is emphasized by occurrence of viral outbreaks associated with consumption of oysters which have been proved meeting the legal bacteriological standards (Shieh et al., 2000). Therefore, to develop rapid and sensitive methods allowing the direct detection of viral contaminants in oyster is particularly important to prevent spread of diseases and limit economic losses. To date, NVs cannot be cultured in vitro. RVs can be cultured, which is, however, very difficult. Laboratory detection methods depend primarily on electron microscopy (EM), enzyme-linked immunosorbent assay (ELISA) and reverse transcription–polymerase chain reaction (RT– PCR) (Rohayem et al., 2004). Because of its high specificity
X. Kou et al. / Food Control 19 (2008) 722–726
and sensitivity, RT–PCR is the only published method that offers the possibility of direct detection of these viruses in environmental samples (Lees, 2000). But the conventional RT–PCR detects only one template per reaction and difficult to detect multiple specimens in a short time. In contrast to monoplex assay, the multiplex RT–PCR assay incorporates different sets of specific primers for two or more targets in one reaction tube and enables simultaneous amplification of different target nucleic acids in a single test. Because of the reduction in labor and reagent costs and time, multiplex RT–PCR studies have attracted much attention and been largely applied in clinical services (Yan, Yagyu, Okitsu, Nishio, & Ushijima, 2003). However, little attempt has been focused on the detection of oysters specimens in these studies. The major aim of our research was to (i) develop multiplex RT–PCR method for simultaneous detection of NVs and RVs, (ii) test the artificially contaminated oysters with NVs and RVs to determine the utility of the multiplex RT–PCR and (iii) detect NVs and RVs from the naturally contaminated oysters using the new developed method.
723
1996) and can detect GGI and GGII simultaneously. Primers of RVs designed according to the VP7 gene (Flores et al., 1990; Gouvea et al., 1990; Le Guyader, Dubois, Menard, & Pommepuy, 1994). The sequences of the oligonucleotide primers were listed in Table 1. 2.4. Multiplex RT–PCR
2. Materials and methods
The optimum assay was performed in 25 ll of a mixture containing 2 ll target RNA, 2.5 ll 10 · PCR buffer, 100 U of reverse-transcriptase M-MLV (Invitrogen), 20 U of RNase inhibitor (Promega), 2 mM MgCl2, 250 lM each dNTP (Promega), 0.6 lM JV12/JV13 and 0.6 lM P1/P2, 1.5 U of Taq DNA polymerase (Invitrogen), and added DEPC water to 25 ll. Reverse transcription reaction was carried out at 42 C for 40 min followed by 5 min at 94 C, and then amplified by touchdown PCR cycling parameter as follows: denaturation at 94 C for 45 s, annealing at 55 C for 1 min at the initial 10 cycles, then reducing the annealing temperature by 1 C increment every two cycles to 50 C, which was used for the final 15 cycles, extension at 72 C for 1 min, for total of 35 cycles, followed by final extension for 7 min at 72 C.
2.1. Virus specimens
2.5. Evaluation of multiplex RT–PCR
Two fecal specimens derived from patients with gastroenteritis, which were previously tested to be positive for NVs and RVs by RT–PCR respectively were used as positive control to develop and evaluate multiplex RT–PCR. The sequences of amplicons were 100% homology to that of accession no. DQ369797 of NVs and no. D50116 of RVs.
To determine the specificity of primer pairs and reaction conditions in the multiplex RT–PCR, the amplification reactions in various combinations as follows: the PCR mixtures containing the mixed templates (NVs and RVs) with only one set of primer of NVs or RVs, the mixed primer pairs (NVs and RVs) with single template of RVs or NVs and the mixed templates (NVs and RVs) with the mixed primer pairs (NVs and RVs), were tested. In addition, 10fold serial dilutions (101–106) of extracted RNA were simultaneously detected by multiplex RT–PCR to determine the sensitivity. The final concentrations of each kind of premixes were the same as the procedures mentioned above.
2.2. RNA extraction RNA were extracted from 200 ll fecal samples (positive control) by Trizol-LS reagent (Gibco BRL, Gaithersburg, Maryland, CA, USA) according to the manufacturer’s protocols. The RNA pellets were all dissolved in 50 ll of DEPC-treated water. Quantification of RNA yields was undertaken by measuring the absorbance at 260 nm of a 1:100 dilution of each sample, against an appropriate blank. The RNA solution was stored at 80 C. 2.3. Primers Primers of NVs target the RNA-dependent RNA polymerase gene (Koopmans et al., 2002; Vinje and Koopmans,
2.6. Artificially contaminated oysters Ninety-six oysters obtained from the local marine market, which were negative for noroviruses and rotaviruses, were subsequently used to evaluate the utility of multiplex RT–PCR method. The oysters were shucked. The stomach and digestive diverticuli were removed by dissection, and cut into small portions, mixed, divided into 1 g portions and frozen. Frozen aliquots of pancreatic tissues dissected
Table 1 Primers of NVs and RVs Virus
Primer
Sequence (5 0 -3 0 )
Location
Product size (bp)
NVs
JV12 JV13 P1 P2
ATACCACTATGATGCAGATTA TCATCATCACCATAGAAAGAG GGCTTTAAAAGAGAGAATTTCCGTCTGG GATCCTGTTGGCCATCC
4552–4572 4858–4878 1–28 376–392
327
RVs
392
724
X. Kou et al. / Food Control 19 (2008) 722–726
from shellfish were used for artificial contamination with 200 ll dilutions of fecal suspension. The samples were homogenized for 1 min by vortexing before virus concentration and nucleic acid extraction. Virus concentration and recovery were performed by a previously described method (Atmar et al., 1995; Le Guyader, Haugarreau, Miossec, Dubois, & Pommepuy, 2000). A total of 200 ll elution were collected and subjected to RNA extraction as described above. 2.7. Naturally contaminated oysters A total of 150 oysters, which were highly contaminated by feces, were collected randomly from six oyster culture ponds in Guangzhou city of China between December 2004 and January 2005. All samples were shipped directly to the laboratory in cold storage and processed within a 24 h period. Oysters were washed, scrubbed under clean running water and opened with a sterile shucking knife. The virus recovery was treated as described above. The viral concentrate was stored at 80 C prior to nucleic acid extraction. 2.8. Electrophoresis Amplified products of multiplex RT–PCR were analysed on 1.4% agarose gel in TBE buffer containing 2.5 ll Goldview dye (Sbs, Guangzhou, China) for 45 min at 5v/ cm, and then the amplified fragments were visualized under ultraviolet light. 2.9. Sequence analysis Positive amplicons of NVs and RVs from naturally contaminated shellfish were extracted and purified using the High pure PCR Product Purification Kit (Roche Diagnostics, Baesl, Switzerland) and sequenced on an automated sequencer (ABI 373 A, Applied Biosystems). Sequences were compared with available sequences in GenBank using the BlAST program of the National Center for Biotechnology Information (NCBI). 2.10. Controls and interpretation
Fig. 1. The specificity of multiplex RT–PCR assay with different reaction modes. M.100 bp ladder DNA marker (Promega); N. negative control; Lane 1: a mixture of primer pairs of P1/P2 and JV12/JV13 with single template of NVs; Lane 2: a mixture of templates of NVs and RVs with single primer pair of JV12/JV13; Lane 3: a mixture of primer pairs of P1/ P2 and JV12/JV13 with single template of RVs; Lane 4: a mixture of templates of NVs and RVs with single primer pair of P1/P2; Lane 5: the mixture of templates of NVs and RVs with the mixture of primer pairs for P1/P2 and JV12/JV13.
in a very sharp band corresponding to the expected size of 327 bp for NVs and 392 bp for RVs, respectively. The specificity of the multiplex RT–PCR reaction system was further confirmed by carrying out amplification reactions in different combinations described as 2.5. Clearly anticipative band was acquired in every reaction mode. No crossreaction happened between primers and templates. Each test repeated three or more times gave reproducible results. No band was obtained in negative controls. The results confirmed that the multiplex RT–PCR employing primer pairs and reaction conditions effectively detected the target viruses. 3.2. Sensitivity of multiplex RT–PCR in fecal samples In order to determine the sensitivity level of multiplex RT–PCR, 10-fold serial dilutions, corresponding to the template was 0.5 lg, 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, resectively, were made and examined by the multiplex RT–PCR. The highest detection limit was 50 pg RNA per 200 ll fecal specimens for two viruses (Fig. 2) except that the bands of NVs were slightly weak when 50 pg RNA of NVs was amplified.
All precautions were done to prevent false positive or negative results. Amplifications were performed in different rooms and filter-equipped pipette tips were used throughout the assay. All experiments were repeated at least twice, and a negative control sample (i.e., containing no nucleic acid) was run with each test. 3. Results 3.1. Specificity of multiplex RT–PCR The main products of multiplex RT–PCR were shown in Fig. 1. All products in agarose gel electrophoresis resulted
Fig. 2. The sensitivity of multiplex RT–PCR in fecal samples. M: 100 bp ladder DNA marker (Promega); N: negative control; Lane (1–6): 10-fold dilutions of RNA corresponding to 0.5 lg, 50 ng, 5 ng, 0.5 ng, 50 pg, 5 pg, resectively.
X. Kou et al. / Food Control 19 (2008) 722–726
Fig. 3. The detection limit of multiplex RT–PCR in artificially contaminated oysters. M: 100 bp ladder DNA marker (Promega); N: negative control; P: positive control; Lane (1–5): 200 pg of RNA from 1.0 g artificially contaminated oyster tissues were amplified.
3.3. Sensitivity of multiplex RT–PCR in artificially contaminated oysters Artificially contaminated oysters were used to determine whether the multiplex RT–PCR method could be carried out in live contaminated shellfish. Ten-fold serial dilutions of RNA from the oyster extracts were tested. A repeated positive signal was exhibited when the RNA preparations were adjusted to 200 pg RNA/g contaminated oysters tissues. A total of 96 experimentally contaminated oysters were tested and similar results obtained. The results were shown in Fig. 3. 3.4. Detection of NVs and RVs in naturally contaminated oysters In total, 32 (21.33%) out of 150 naturally oysters were positive for the target viruses, of which, 5 (3.33%) were rotavirus, 21 (14%) were norovirus GII and 6 (4%) were norovirus GI. The sequences of amplicons showed 95–100% homology to human rotavirus serotype G1, G3 and G9 [Wa (K02033), WD33 (Y18786), jpn-421 (D16326), JA2 (D86266, Japan), DL73 (AJ491165, United States) and R136 (AF438228, United States), respectively], 91–98% homology to those of the putative RNA-dependent RNA polymerase domain of norovirus genotype GGII.1, GGII.2, GGII.4 (prototype strains Hawaii/1971/ US, Melksham/1994/K, Bristol/1993/UK, Camberwell/ 1994/AU and Lordsdale/1993/UK, respectively) and 93– 99% identity to those of putative RNA-dependent RNA polymerase domain of norovirus genotype GGI.1, GGI.2 or GGI.4 (prototype strains Norwalk/1968/US, Southampton/1991/UK and Chiba407/1987/JP, respectively). 4. Discussion Shellfish, especially oysters, contaminated by microorganisms that are pathogenic to humans is a worldwide public health concern. Although many diagnostic methods have been developed for the detection of virus or viral
725
RNA in food and water, they have not found their way to routine laboratories in most parts of the world. Currently, there are international collaborative efforts to produce PCR-based methods for foodborne pathogens that are suitable for standardization and adoption as routine diagnostic procedures (Malorny et al., 2003). The framework of these efforts is based on three principal steps: demonstration of primer specificity; evaluation of the method through collaborative trial; and finally, proposal to an international standardization body such as CEN (European Committee for Standardization). To date, RT–PCR assays have been shown to be useful diagnostic procedures for RNA virus detection. It is reported that sensitivity of the conventional PCR with specific primer was higher than that of EM (Vipond et al., 2000) and ELISA (Saito et al., 1995). Multiplex PCR is the first step towards PCR automation for routine simultaneous laboratory testing of diverse viral parameters in environmental samples and food. In this study, a multiplex reverse transcription–polymerase chain reaction was designed for the simultaneous detection of NVs and RVs in oysters, and represented a reduction of the time and cost of the assay. There were some aspects of this study to be addressed. When the multiplex RT–PCR assay was used as routine microbiological diagnostic tools, great attention must be paid to the specificity. A possible interaction should be prevented not only between primers and primers, but also between primers and non-target templates. In this study, each primer set was challenged with target template or non-target template. The high specificity of the primers JV12/JV13 for NVs and P1/P2 for RVs were demonstrated as shown in Fig. 1. These results showed that the primers and the optimum reaction conditions used in this study were highly specific. The detection limit decreased from 50 pg RNA in fecal specimens to 200 pg RNA in oysters tissues when 200 ll fecal samples mixed into 1.0 g oysters tissues. Although there is decrease in sensitivity, the overall efficiency of multiplex RT–PCR method could be used to successfully detect NVs and RVs in oysters. The application of multiplex RT–PCR was validated by testing 150 naturally contaminated oysters and further confirmed by sequencing of amplicons from all the positive samples. The reduction of sensitivity was probably a consequence of too many inhibitors existing in shellfish. Therefore, further studies will be concentrated on a more efficient method for virus recovery and PCR pretreatment to eliminate inhibitors of shellfish in our next work. In addition, Primer design and selection was a key factor when a multiplex amplification system was designed. Many primer sets had been used for detection of NV due to its genetic diversity (Green, Gallimore, Norcott, Lewis, & Brown, 1995; Jiang et al., 1999), but they differed in sensitivity and accuracy. The primer sets of JV12/JV13 of NVs gave the excellent results in the assay of specificity and sensitivity after many repeated trials in this study.
726
X. Kou et al. / Food Control 19 (2008) 722–726
Generally, the multiplex RT–PCR has effectively incorporated two-tube two-step reaction into single-round reaction, and successfully simultaneously detected two important foodborne viruses in shellfish with high sensitivity and specificity. Although there exist some limitations, RT–PCR, as a diagnostic tool for food and environmental samples, is surely worthy of committed developmental effort, could be used to detect the NVs and RVs for routine monitoring and risk assessment for a large scale screening in diseases outbreak and marine products. Acknowledgement This work was supported by nature science Grant from Guangdong province. References Atmar, R. L., Neill, F. H., Romalde, J. L., Le Guyader, F., Woodley, C. M., Metcalf, T. G., et al. (1995). Detection of Norwalk virus and Hepatitis A virus in shellfish tissues with the PCR. Applied and Environmental Microbiology, 61, 3014–3018. Flores, J., Sears, J., Schael, P. I., White, L., Garcia, D., Lanata, C., et al. (1990). Identification of human RV serotype by hybridization to polymerse chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capisid protein VP7. Journal of Virology, 64, 4021–4024. Gouvea, V., Allen, J. R., Glass, R. I., Woods, P., Taniguich, K. C., Lark, H. F., et al. (1990). Polymerase chain reaction amplification and typing of RV nucleic acid from stool specimens. Journal of Clinical Microbiology, 28, 276–282. Green, J., Gallimore, C. I., Norcott, J. P., Lewis, D., & Brown, D. W. (1995). Broadly reactive reverse transcriptase polymerse chain reaction for the diagnosis of SRSV-associated gastroenteritis. Journal of Medical Virology, 47, 392–398. Jiang, X., Huang, P. W., Zhong, W. M., Farkas, T., Cubitt, D. W., & Matson, D. O. (1999). Design and evaluation of a primer pair that detects both Norwalk- and Sappo-like Calicivirus by RRT–PCR. Journal of Virological Methods, 83, 145–154. Koopmans, M., De Bruin, E., & Vennema, H. (2002a). Rational optimisation of generic primers used for Norwalk-like virus detection by reverse transcription polymerse chain reaction. Journal of Clinical Methods, 25, 233–236.
Koopmans, M., von Bonsdorff, C. H., Vinje, J., de Medici, D., & Monroe, S. (2002b). Foodborne viruses. FEMS Microbiological Review, 26, 187–205. Le Guyader, F., Dubois, E., Menard, D., & Pommepuy, M. (1994). Detection of hepatitis A virus, RV, and enterovirus in naturally contaminated shellfish and sediment by reverse transcription-seminested PCR. Applied and Environmental Microbiology, 60, 3665–3671. Le Guyader, F., Haugarreau, L., Miossec, L., Dubois, E., & Pommepuy, M. (2000). Three-year study to assess human enteric viruses in shellfish. Applied and Environmental Microbiology, 66, 3241–3248. Lee, R. J., & Younger, A. D. (2002). Developing microbiological risk assessment for shellfish purification. International Biodeterioration and Biodegradation, 50, 177–183. Lees, D. (2000). Viruses and bivalve shellfish. International Journal of Food Microbiology, 59, 81–116. Malorny, B., Tassios, P. T., Radstrom, P., Cook, N., Wagner, M., & Hoorfar, J. (2003). Standardization of diagnostic PCR for the detection of foodborne pathogens. International Journal of Food Microbiology, 83, 39–48. Muniain-Mujika, I., Calvo, M., Lucena, F., & Girones, R. (2003). Comparative analysis of viral pathogens and potential indicators in shellish. International Journal of Food Microbiology, 83, 75–85. Rohayem, J., Berger, S., Juretzek, T., Herchenroder, O., Mogel, M., Poppe, M., et al. (2004). A simple and rapid single-step multiplex RT– PCR to detect NV, astrovirus and adenovirus in clinical stool specimens. Journal of Virological Methods, 118, 49–59. Saito, K., Ushijima, H., Nishio, O., Oseto, M., Motohiro, H., Ueda, Y., et al. (1995). Detection of astroviruses from stool specimens in Japan using reverse transcription and polymerase chain reaction amplification. Microbiological Immunology, 39, 825–828. Shieh, C. Y. S., Monroe, S. S., Fankhauser, R. L., Langlois, G. W., Burkhardt, W., & Baric, R. S. (2000). Detection of Norwalk-like virus in shellfish implicated in illness. Journal of Infective Disease, 181, 360–366. Vinje, J., & Koopmans, M. (1996). Molecular detection and epidemiology of small round structured viruses in outbreaks of gastroenteritis in the Netherlands. Journal of Infective Disease, 174, 610–615. Vipond, I. B., Pelosi, E., Williams, J., Ashley, C. R., Lambden, P. R., Clarke, I. N., et al. (2000). A diagnostic EIA for detection of the prevalent SRSV strain in United Kingdom outbreaks of gastroenteritis. Journal of Medical Virology, 61, 132–137. Yan, H., Yagyu, F., Okitsu, S., Nishio, O., & Ushijima, H. (2003). Detection of NV (GI,GII), sapovirus and astrovirus in fecal specimens using reverse transcription single-round multiplex PCR. Journal of Virological Methods, 114, 37–44.