- Email: [email protected]
Single cell RT-PCR analysis of tyrosine kinase receptor expression in adult rat retinal ganglion cells isolated by retinal sandwiching
Brain Research Protocols 10 (2002) 75–83 www.elsevier.com / locate / brainresprot
Protocol
Single cell RT-PCR analysis of tyrosine kinase receptor expression in adult rat retinal ganglion cells isolated by retinal sandwiching ¨ ¨ a ,* Niclas Lindqvist a , Manuel Vidal-Sanz b , Finn Hallbook a
Department of Neuroscience, Biomedical Center, Uppsala University, Box 587, SE-751 23 Uppsala, Sweden b Laboratory of Experimental Ophthalmology, Faculty of Medicine, Murcia University, Murcia, Spain Accepted 7 August 2002
Abstract We describe a protocol for analysis of gene expression in single, acutely dissociated adult rat retinal ganglion cells using RT-PCR. Retrograde tracing of retinal ganglion cells from the superior colliculi was conducted using Fluorogold. Retinas were dissected and ganglion cells isolated using retinal layer separation (sandwiching). Single, fluorescently labelled retinal ganglion cells were aspirated using a micropipette and used for PCR. Two PCR protocols are described where single cell cDNA was analysed for TrkB and GAPDH or TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin by multiplex-PCR. All five tyrosine kinase receptors were amplified from single retinal ganglion cells. The method will prove useful for the molecular characterization of adult retinal ganglion cells. 2002 Elsevier Science B.V. All rights reserved. Theme: Sensory systems Topic: Retina and photoreceptors Keywords: Polymerase chain reaction (PCR); Reverse transcription (RT); Retinal ganglion cell (rgc); Fluorogold (FG)
1. Type of research The current protocol was developed to analyse the expression of tyrosine kinase receptors in single adult rat retinal ganglion cells. The PCR protocols can be used to analyse the expression of multiple genes in a single cell or in the retinal ganglion cell layer (ganglion cells and displaced amacrine cells).
2. Time required • Surgery with tracer deposition on to the superior colliculi: 40–60 min. • Retrograde tracing of retinal ganglion cells using Fluorogold: 4–7 days. • Enucleation of the eyes after anesthesia, dissection of retinas, mounting on to nitrocellulose filter and removal of vitreous body: 10 min. • Enzymatic incubations and layer-separation: 20 min. *Corresponding author. Tel.: 146-18-471-4944; fax: 146-18-559-017. ¨¨ E-mail address: [email protected] (F. Hallbook).
• • • • •
Aspiration of cells: 2–4 h. DNase treatment and cDNA synthesis: 2 h. Multiplex PCR: 5–6 h. Agarose gel analysis: 2 h. Sequencing: 1 day.
3. Materials
3.1. Animals We used adult female Sprague–Dawley rats (each weighing 225–250 g) obtained from B&K Universal (Sollentuna, Sweden). Rats were housed in standard cages and maintained in temperature-controlled rooms with a 12-h light, 12-h dark cycle with light intensity ranging from 8 to 24 lx. The rats were fed ad libitum.
3.2. Equipment • Millipore filter (type HA 0.45 mm) (Millipore) • Nitrocellulose filter (Hybond-C 0.45 mm) (Amersham)
1385-299X / 02 / $ – see front matter 2002 Elsevier Science B.V. All rights reserved. PII: S1385-299X( 02 )00184-8
76
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
• Uncoated coverslips (24360 mm) and (24332 mm) ¨ (Menzel-Glaser) [1.0 • Micropipettes (GD-1), micropipette polisher (EG-40), micropipette forger (MF-90) and microinjector (IM55) (Narishige) • Micropipette puller (Model P-97) (Sutter Instruments) • Micromanipulator and inverted microscope (DM IRB) (Leica) • Temperature-controlled incubator (Salvis Biocenter) • Computer-program OLIGO 6.0 • Programmable thermal cycler (Hybaid) • Gel documentation system (ChemiDoc) (BioRad) • Sequencer (Applied Biosystems 373)
3.3. Chemicals and reagents • Xylazine (Rompun), 20 mg / ml (Bayer) and ketamine (Ketalar), 50 mg / ml (Parke–Davis) • Fluorogold (Fluorochrome, Englewood, CO, USA) • Pentobarbital, 100 mg / ml (Apoteket, Sweden) • Dimethyl sulfoxide (Merck) • Trypsin (from bovine pancreas) (Biochrom KG) • DNase I, 1st strand cDNA synthesis kit and RNase inhibitor (Boehringer–Mannheim) • Gel Extraction Kit (Qiagen) • Hydroxypropylmethylcellulose H-7509 (Sigma) • RNase-free DNase (Promega) • Amplitaq Gold DNA Polymerase and Terminator Ready Reaction Mix (Perkin-Elmer) • Agarose (Shelton Scientific)
an intraperitoneal injection of 3–4 ml pentobarbital. The temporal–nasal border of the eyes was marked with a suture and the eyes were enucleated and immediately put on ice for dissection.
4.2. Isolation of retinal ganglion cells by mechanical layer separation Eyes were dissected in sterile phosphate-buffered saline (PBS) and the retina was carefully separated from the sclera and cut into quadrants. Using a forceps, a retinal quadrant was placed on to a nitrocellulose (NC) filter (535 mm) with the photoreceptors facing the filter (Fig. 1). Care was taken not to damage the inner retinal layers. The vitreous body was removed and the NC-filter and retina were incubated in PBS with 0.5% trypsin and 0.04 mg / ml DNaseI at 37 8C for 15 min. The NC filter was blotted on a Millipore (MP) filter (15315 mm) for 5 s to remove excess fluid and placed on an uncoated coverslip (24360 mm) with the inner retinal side down. A smaller coverslip (24332 mm; 0.27 g) was placed over the MPfilter to promote adhesion to the glass surface. This ‘sandwich’ was incubated at 37 8C for 5 min. The small coverslip was removed and layer-separation was carried out by carefully lifting the filters and retina with a forceps. Isolated cells were immediately covered with 200 ml of ice-cold PBS with 0.16% hydroxypropylmethylcellulose (HPMC) which stabilizes cells by increasing viscosity [4,12].
4.3. Collection of single retinal ganglion cells 4. Detailed procedure
4.1. Retrograde tracing of retinal ganglion cells Experiments were carried out in accordance with European Community guidelines and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Procedures were scrutinized by the local ethics committee for experimental animals. Two animals were used for the single-cell PCR data in this study. For surgery, the animals were anesthetized with an intraperitoneal injection mixture of Rompun and Ketalar: 10–15 and 30–100 mg / kg body weight, respectively. The ganglion cells in the retina were retrogradely labelled from the superior colliculi with the fluorescent tracer Fluorogold, using previously described techniques [16,17]. In brief, after exposing the surface of the superior colliculi, a piece of gelfoam soaked in 0.9% NaCl solution containing 3% Fluorogold and 10% dimethyl sulfoxide (DMSO) was applied on to these structures. Cell terminals were thus exposed to Fluorogold, which was retrogradely transported to ganglion cell bodies in the retina. Optimal labelling is achieved 7 days after Fluorogold application [16]. Animals were sacrificed via
Cells were kept on the original coverslip and cell picking was carried out in an inverted fluorescence microscope. Single retinal ganglion cells were identified by the light emitted by Fluorogold and were aspirated using a micropipette attached to a hand-controlled microinjector. The micropipette was navigated in three dimensions via an electronic micromanipulator. One cell was picked at a time by applying negative pressure with the microinjector. Care was taken not to aspirate any other cellular material or debris along with the cell. The cell was transferred to a 3–7 ml droplet of PBS on another coverslip (Fig. 1) where the few picoliters of HPMC–PBS containing the cell were expelled under visual control by carefully applying positive pressure. The PBS droplet with the cell was transferred to a 0.2-ml reaction tube kept at 4 8C until cDNA synthesis the same day. To control for extracellular mRNA contaminants, a few picoliters of HPMC–PBS from each cell preparation were sampled for RT-PCR analysis. The collection of single retinal ganglion cells continued for up to 4 h and the same micropipette could be used repeatedly to pick 3–4 cells. Cells were supplemented with ice-cold HPMC–PBS to prevent desiccation.
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
77
Fig. 1. Overview of the layer-separation procedure. For further details see text under detailed procedure. RT, reverse transcription; PBS, phosphatebuffered saline; HPMC, hydroxypropylmethylcellulose; onl, outer nuclear layer; opl, outer plexiform layer; inl, inner nuclear layer; ipl, inner plexiform layer; gcl, ganglion cell layer; nfl, nerve fiber layer.
4.4. Isolation of RNA from retina cDNA from total retina RNA was used as a positive control. Total RNA from adult rat retina was isolated using the acid–phenol method [8]. Retinas from adult rats were dissected and homogenized in 500 ml GITC-buffer (4 M guanidinium isothiocyanate, 0.5% sodium lauroyl sarcosine and 0.2 M b-mercaptoethanol) using a homogenizer (Polytrone). The samples were extracted with 0.5 ml acid phenol supplemented with 0.3 M sodium acetate (pH 4.8); 150 ml chloroform was added and samples were mixed and incubated on ice for 15 min before centrifuging at 15 5003g for 15 min. The water / RNA phase was precipi-
tated in ethanol and subsequently dissolved in water. RNA concentration was determined using a spectrophotometer.
4.5. cDNA synthesis Due to limiting amounts of starting material in single cell preparations, first strand cDNA synthesis was conducted in 20-ml reaction volumes. Buffer was added (10 mM Tris, 50 mM KCl, 5 mM MgCl 2 and 1 mM dNTP mix) to the cell samples and negative controls. Samples were heated to 95 8C for 1 min to release cell contents (Table 1). Then 1 U RNase-free DNase was added to digest genomic DNA [3] and 25 U RNase-inhibitor to
78
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
Table 1 Degradation of chromosomal DNA and reverse transcription of single retinal ganglion cell mRNA Process
Temp (8C)
Time (min)
Release of cell contents and denaturation of proteins Add RNase-free DNase and RNase inhibitors Digestion of chromosomal DNA Denaturation of DNase Add AMV reverse transcriptase, RNase inhibitors and random hexamer primers Annealing of primers Synthesis of cDNA Denaturation of AMV reverse transcriptase Storage
95 37 37 75 25
1 Pause 30 5 Pause
25 42 95 4
10 60 5 ,120
block RNase activity and samples were incubated at 37 8C for 30 min. DNase was inactivated by incubation at 75 8C for 5 min and 20 U of AMV reverse transcriptase, 4 mg random hexamer primers and 25 U RNase-inhibitor were added followed by incubation at 25 8C for 10 min and 42 8C for 1 h. Finally, AMV reverse transcriptase was inactivated by incubation at 95 8C for 5 min. A 1-mg aliquot of total retina RNA was used for cDNA synthesis following the same procedure.
4.6. Polymerase chain reaction ( PCR) Two PCR strategies were used for analysis of gene expression in single retinal ganglion cells (Fig. 2). In the first strategy cDNA reactions were split into two 50 ml PCR reactions for amplification of TrkB or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (positive control). The reactions contained 50 pmol of GAPDH primers or 50 pmol of TrkB primers (Table 2), 10 ml of single cell cDNA reaction, buffer (10 mM Tris–HCl, 50 mM KCl), 0.25 mM of each of the dNTPs, 2.5 mM MgCl 2 and 2.5 U Amplitaq Gold DNA polymerase. A
negative control was done for each cell containing water instead of cDNA and analysed using GAPDH primers. Ten minutes at 95 8C activated the enzyme and 50 cycles (95 8C for 1 min, 57 8C for 2 min, 72 8C for 2 min) were used to amplify single cell cDNA. The HPMC–PBS medium cDNA reactions were analysed using GAPDH primers under the same conditions. In the second PCR strategy, TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin (positive control) were analysed using two consecutive PCR reactions. The first 50-ml multiplex PCR reaction [2,9] contained 25 pmol of each of the 12 primers (Table 2), 10 ml cDNA reaction, buffer (15 mM Tris–HCl, 50 mM KCl), 0.25 mM of each of the dNTPs, 2.5 mM MgCl 2 and 2.5 U Amplitaq Gold DNA polymerase. A negative control was performed for each cell containing water instead of cDNA and analysed using Beta-actin primers. Ten minutes at 95 8C activated the enzyme, and two-step PCR (94 8C for 30 s, 68 8C for 1 min) was used to amplify single cell cDNA (25 cycles) and retina cDNA (20 cycles). The first PCR reaction was split into six PCR reactions with the same final concentrations of buffer, MgCl 2 and dNTPs as the first reaction, but 50
Fig. 2. Overview of the two PCR strategies used to analyse tyrosine kinase receptor expression in single adult rat retinal ganglion cells. Single cell mRNA was reverse transcribed to cDNA and analysed for TrkB and GAPDH by PCR or TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin by multiplex PCR. All PCR reactions were analysed by analytical agarose gel electrophoresis and sequencing.
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
79
Table 2 Primers used for PCR amplification Target cDNA GAPDH
a
TrkB a TrkB b TrkC b Ret b Met b ErbB2 b b-Actin b a b
Primers (59-39) forward / reverse
Amplicon position
Amplicon size (bp)
CCTTCATTGACCTCAACTAC TTCACACCCATCACAAAC CACCAACCATCACATTTCTC ATCTGTCTCTCGTCCTTCCC GCTTACAAGGCGTTTCTGA GGGGCTGGATTTCGT AAATTCTATGGGGTCTGTG TCTGACTGGCGATGTG TATGTCCATGCCCTACGG GCCATTTCGGATGCTGA TGTACGGTCCCCAGTGAC AGGAAGAGCCCGGATACT GGAAGAATGGGGTTGTCA GGGGTCCCTTCAAAGTTACT GCCCCTCTGAACCCTAAG CATCACAATGCCAGTGGTA
nt 101–401
301
nt 857–1121
265
nt 319–508
189
nt 1804–1987
184
nt 154–343
189
nt 2683–2864
182
nt 3558–3753
196
nt 322–459
cDNA—138 Genomic DNA—603
Primers used for single cell PCR. Primers used for single cell multiplex PCR.
pmol of primers, 5 U Amplitaq Gold DNA Polymerase and 8 ml of the first PCR reaction. A two-step PCR (94 8C for 30 s, 68 8C for 1 min) amplified single cell cDNA (50 cycles) and retina cDNA (30 cycles). Contaminating chromosomal DNA was monitored by amplification of a 603-bp Beta-actin fragment since the amplicon was positioned over an intron.
the ganglion cells too firmly which resulted in broken cells during the cell picking. For successful single cell PCR, use a separate area and dedicated equipment for PCR set-up. Use filtertips and aliquot reagents, especially primers, which should be thrown away if contamination is suspected. Use sterile solutions and sterilize the coverslips used for layer-separation.
4.7. Analysis of PCR products by agarose gel electrophoresis and sequencing 5. Results Ten microliters of each PCR reaction were analysed by electrophoresis on a 3% agarose gel stained with ethidium bromide. To confirm the identity of the PCR fragments they were sequenced directly using the forward primers (Table 2). The fragments were purified by agarose gel electrophoresis, excised under UV-light and extracted using silica-based chemistry (Qiagen). Fragments were quantified by comparison to DNA standards on an agarose gel and sequenced using an ABI dye terminator cycle sequencing ready reaction kit (Perkin-Elmer).
4.8. Trouble-shooting mechanical layer-separation and single-cell PCR Poor retinal attachment to filters can be avoided by depressing the edges of the retina with the tip of a forceps. Poor ganglion cell layer adherence to the glass surface can be a result of: (a) remaining vitreous body (all vitreous body must be peeled off from the retina), or (b) the filters impeding proper contact of the sandwich (the filters should be cut only slightly larger than the retina). To prevent desiccation, medium should be added immediately after layer-separation and 200 ml of medium gave a suitable density of cells. Uncoated glass-surface should be used for the separation. Poly-L-lysine coated glass surfaces bound
5.1. Isolation of cells by layer-separation and picking of single retinal ganglion cells The protocol for layer separation provided enough retinal ganglion cells for single cell picking. In the preparation there were single, UV-fluorescent and intact ganglion cells that were easily retrieved by micromanipulation (Fig. 3C–F). There were also larger continuous retinal sheets with scattered, fluorescent ganglion cells (Fig. 3A,B) and smaller aggregates of cells and debris. The retinal ganglion cells were easily distinguished from other cell types using UV-light microscopy and fluorescence was emitted from the ganglion cells several hours after layerseparation. The soma sizes of the dissociated and pickable retinal ganglion cells ranged from 8 to 25 mm, although the majority had smaller soma sizes.
5.2. Expression analysis of tyrosine kinase receptors in single acutely dissociated retinal ganglion cells by RTPCR Eighteen retinal ganglion cells were analysed by RTPCR. Nine ganglion cells were analysed for TrkB and GAPDH. Eight were positive for GAPDH and four were
80
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
Fig. 3. Micrographs showing single cell picking and cell configurations after mechanical layer-separation. The retinal ganglion cell layer of one quadrant of an adult rat retina was isolated using layer-separation and single retinal ganglion cells were identified under UV-light and picked using a micropipette. (A) Larger continuous sheet of retinal ganglion cell layer, arrow denotes a retinal ganglion cell. Scale bar 100 mm. (B) UV-light detection of Fluorogold-labelled ganglion cells in (A). (C) Single, pickable retinal ganglion cells. Scale bar 50 mm. (D) UV-detection of the cells in (C). (E) Picking of a retinal ganglion cell (12 mm soma diameter) for transfer to a droplet of PBS. Scale bar 20 mm. (F) UV-light detection of the ganglion cell in (E).
also positive for TrkB (Fig. 4A). cDNA from nine ganglion cells and total retina cDNA were analysed for TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin by multiplex PCR. Eight cells were positive for Beta-actin with only one band at 138 bp, indicating absence of chromosomal DNA. Two of 18 cells yielded no specific PCR product. All five receptors were amplified from retinal ganglion cells (Table 3), but all receptors were not amplified together from the same cell. In one ganglion cell none of the receptors were detected. Ret was amplified most frequently (seven cells) followed by Met (four cells) and Ret was amplified together with Met in two cells (Table 3). All five receptors were amplified from retina cDNA (representative gel in Fig. 4C). Control HPMC–PBS medium PCR reactions were negative (Fig. 4A) as were the water control PCR reactions (Fig. 4A–C). Sequencing of PCR fragments yielded the expected sequences.
6. Discussion
6.1. Comparison with other methods to isolate retinal ganglion cells Our protocol for layer-separation is based on the protocol described by Simon and Thanos for adult rat retinas [12]. By comparison our protocol is faster, easier to perform and adapted for isolating single retinal ganglion cells for RT-PCR. Originally, separation of retinal sublayers was developed for neonatal rat retinas [11], but without identifying retinal ganglion cells. Another protocol for isolating adult rat retinal ganglion cells [5] included enzymatic treatment of the retina followed by trituration with a Pasteur pipette. The yield of ganglion cells using this method was very low. Our own experience is that trituration of the retina yields very few, intact Fluorogold-
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
81
Fig. 4. Agarose gel analysis of PCR reactions. (A) Agarose gel analysis of single cell PCR reactions. cDNA from a retinal ganglion cell was split for analysis of TrkB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH); PCR products were obtained for both TrkB (265 bp) and GAPDH (301 bp). No product was obtained in the water negative control reaction (lane neg ctrl) nor in the HPMC–PBS medium negative control (lane neg med ctrl). (B) Agarose gel analysis of multiplex single cell PCR. PCR products were obtained for Ret (189 bp), Met (182 bp) and Beta-actin (138 bp). (C) Agarose gel analysis of multiplex PCR on retina cDNA. PCR products were obtained for all five tyrosine kinase receptors and Beta-actin. M, molecular weight marker.
labelled adult retinal ganglion cells. This, we believe, is because the adult retinal ganglion cells are very fragile. Another study [19] used flow-cytometry to quantitate paraformaldehyde-fixed retinal ganglion cells using anti-
bodies to Fluorogold. Whether this method of collecting ganglion cells can be used for analyzing gene expression in the cells remains to be shown.
6.2. Overall assessment of PCR protocols
Table 3 Result of multiplex PCR amplification of single retinal ganglion cell (rgc) cDNA rgc
TrkB
TrkC
Ret
Met
ErbB2
b-Actin a
b-Actin b
1 2 3 4 5 6 7 8
– 1 – 1 – – – –
– – – 1 – – – –
1 1 – 1 1 1 1 1
– 1 – – – 1 1 1
– 1 – – – – – 1
1 1 1 1 1 1 1 1
– – – – – – – –
(1) amplification of PCR-fragment of correct size; (–) no amplification. a 138-bp fragment (cDNA). b 603-bp fragment (chromosomal DNA).
We used two different PCR protocols to study the expression of tyrosine kinase receptors in retinal ganglion cells. Multiplex PCR was useful since it amplified several genes in the limiting amounts of cDNA, although it was time-consuming due to pipetting. The multiplex analysis had six targets but can be expanded to 20 targets [20]. The amplicons were of the same size to achieve equally efficient amplification, although amplicons of incremental sizes can be used which could be analysed after one round of PCR [20]. In total, 89% (16 of 18) of the single-cell PCR reactions were successful amplifying a specific PCR product. Reasons for unsuccessful single cell PCR are that the cell did not follow into the reaction tube or that the cDNA or PCR reactions did not work due to pipetting error. To study the expression of a family of tyrosine
82
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
kinase receptors, degenerate PCR could be used with primers directed towards a conserved sequence in the tyrosine kinase domain.
6.3. Expression analysis of tyrosine kinase receptors by single cell RT-PCR We amplified TrkB, TrkC, Ret, Met and ErbB2 from single retinal ganglion cells and from retina. In only one out of eight cells tested, none of the tyrosine kinase cDNAs were detected. PCR primers for TrkB were located in the extracellular region and could potentially detect both full-length receptor and receptor lacking the tyrosine kinase domain (truncated TrkB receptor). Using in situ hybridisation [14], 60% of the cells in the ganglion cell layer were positive for full-length TrkB mRNA, while 80% were positive for truncated TrkB mRNA. 38% (six of 16) of the retinal ganglion cells in our study were positive for TrkB, although to obtain a good estimation of TrkB expression using our method, more cells should be sampled. Full-length TrkC transcript was amplified from one of eight retinal ganglion cells. As shown by Northern blot [15] both full-length and truncated TrkC mRNA are expressed in the adult rat retina. Ret cDNA was amplified from retinal ganglion cells. Earlier studies have shown that axotomized retinal ganglion cells are responsive to treatment by GDNF in vivo [6,7,18]. GDNF acts via the cell-surface receptor Ret [10]. We detected ErbB2 transcript in retinal ganglion cells, but the expression of ErbB2 may be very low. In an earlier study [1], ErbB2 showed immunoreactivity in the inner plexiform layer in the embryonic and postnatal rat retina but not in adult retina. We also detected expression of the receptor for HGF (Met) in ganglion cells. Met shows weak immunoreactivity in the ganglion cell layer in the adult rat retina [13]. Our single-cell PCR method shows that it is possible to detect expression of tyrosine kinase receptors in single retinal ganglion cells and the PCR result indicates that a majority of ganglion cells in the adult rat retina express tyrosine kinase receptors.
7. Quick procedure • Perform surgery for retrograde tracing of retinal ganglion cells from the superior colliculi in the adult rat. • Sacrifice the animal after 1 week, enucleate the eyes and dissect the retinas. • Perform retinal ganglion cell layer separation. • Aspirate a single, Fluorogold-labelled retinal ganglion cell with a micropipette under UV-light and transfer it to a reaction tube. • Degrade chromosomal DNA, synthesize cDNA by reverse transcription and run multiplex PCR.
• Analyse the PCR fragments by agarose gel electrophoresis and by sequencing.
8. Essential literature references References [9,12,16]
Acknowledgements The authors wish to thank Dr Earl T. Larson for English corrections. This work was supported by the Foundation for Strategic Research, National Neuroscience Network (34-1-98), Swedish Research Council (12187), Stiftelsen KMA and Mattsons Research Foundation.
References [1] O. Bermingham-McDonogh, K.L. McCabe, T.A. Reh, Effects of GGF / neuregulins on neuronal survival and neurite outgrowth correlate with erbB2 / neu expression in developing rat retina, Development 122 (1996) 1427–1438. [2] B. Cauli, E. Audinat, B. Lambolez, M. Angulo, N. Ropert, K. Tsuzuki, S. Hestrin, J. Rossier, Molecular and physiological diversity of cortical nonpyramidal cells, J. Neurosci. 17 (1997) 3894–3906. [3] E. Grigorenko, H. Yeh, Expression profiling of GABAA receptor beta-subunits in the rat retina, Vis. Neurosci. 11 (1994) 379–387. [4] J. Henry, K. Olander, Comparison of the effect of four viscoelastic agents on early postoperative intraocular pressure, J. Cataract Refract. Surg. 22 (1996) 960–966. [5] Y. Hong, S. Thanos, A quantitative approach to identify and isolate pure populations of fluorescently labeled adult retinal ganglion cells using a pressure-driven microaspiration technique, Neurosci. Lett. 214 (1996) 111–114. ¨ ¨ ¨ [6] N. Klocker, F. Braunling, S. Isenmann, M. Bahr, In vivo neurotrophic effects of GDNF on axotomized retinal ganglion cells, Neuroreport 8 (1997) 3439–3442. [7] P.D. Koeberle, A.K. Ball, Effects of GDNF on retinal ganglion cell survival following axotomy, Vis. Res. 38 (1998) 1505–1515. [8] T. Maniatis, E. Fritsch, J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Publications, New York, 1982. [9] D. Ruano, B. Lambolez, J. Rossier, A. Paternain, J. Lerma, Kainate receptor subunits expressed in single cultured hippocampal neurons: molecular and functional variants by RNA editing, Neuron 14 (1995) 1009–1017. [10] M. Saarma, GDNF—a stranger in the TGF-beta superfamily?, Eur. J. Biochem. 267 (2000) 6968–6971. [11] S. Shiosaka, H. Kiyama, M. Tohyama, A simple method for the separation of retinal sublayers from the entire retina with special reference to application for cell culture, J. Neurosci. Methods 10 (1984) 229–235. [12] P. Simon, S. Thanos, Combined methods of retrograde staining, layer-separation and viscoelastic cell stabilization to isolate retinal ganglion cells in adult rats, J. Neurosci. Methods 83 (1998) 113– 124. [13] W. Sun, H. Funakoshi, T. Nakamura, Differential expression of hepatocyte growth factor and its receptor, c-Met in the rat retina during development, Brain Res. 851 (1999) 46–53. [14] A. Suzuki, S. Nomura, E. Morii, Y. Fukuda, J. Kosaka, Localization of mRNAs for trkB isoforms and p75 in rat retinal ganglion cells, J. Neurosci. Res. 54 (1998) 27–37.
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83 [15] D.M. Valenzuela, P.C. Maisonpierre, D.J. Glass, E. Rojas, L. Nunez, Y. Kong, D.R. Gies, T.N. Stitt, N.Y. Ip, G.D. Yancopoulos, Alternative forms of rat TrkC with different functional capabilities, Neuron 10 (1993) 963–974. [16] M. Vidal-Sanz, M. Villegas-Perez, G. Bray, A. Aguayo, Persistent retrograde labeling of adult rat retinal ganglion cells with the carbocyanine dye diI, Exp. Neurol. 102 (1988) 92–101. [17] M. Villegas-Perez, M. Vidal-Sanz, M. Rasminsky, G. Bray, A. Aguayo, Rapid and protracted phases of retinal ganglion cell loss follow axotomy in the optic nerve of adult rats, J. Neurobiol. 24 (1993) 23–36. [18] Q. Yan, J. Wang, C. Matheson, J. Urich, Glial cell line-derived
83
neurotrophic factor (GDNF) promotes the survival of axotomized retinal ganglion cells in adult rats comparison to and combination with brain-derived neurotrophic factor (BDNF), J. Neurobiol. 38 (1999) 382–390. [19] J. Yang, G. Tezel, R.V. Patil, M.B. Wax, Flow cytometry for quantification of retrogradely labeled retinal ganglion cells by Fluoro-Gold, Curr. Eye Res. 21 (2000) 981–985. [20] G. Zangenberg, R. Saiki, R. Reynolds, Multiplex PCR: optimisation guidelines, in: M. Innis, D. Gelfand, J. Sninsky (Eds.), PCR Applications; Protocols for Functional Genomics, Academic Press, San Diego, CA, 1999, pp. 73–94.
Protocol
Single cell RT-PCR analysis of tyrosine kinase receptor expression in adult rat retinal ganglion cells isolated by retinal sandwiching ¨ ¨ a ,* Niclas Lindqvist a , Manuel Vidal-Sanz b , Finn Hallbook a
Department of Neuroscience, Biomedical Center, Uppsala University, Box 587, SE-751 23 Uppsala, Sweden b Laboratory of Experimental Ophthalmology, Faculty of Medicine, Murcia University, Murcia, Spain Accepted 7 August 2002
Abstract We describe a protocol for analysis of gene expression in single, acutely dissociated adult rat retinal ganglion cells using RT-PCR. Retrograde tracing of retinal ganglion cells from the superior colliculi was conducted using Fluorogold. Retinas were dissected and ganglion cells isolated using retinal layer separation (sandwiching). Single, fluorescently labelled retinal ganglion cells were aspirated using a micropipette and used for PCR. Two PCR protocols are described where single cell cDNA was analysed for TrkB and GAPDH or TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin by multiplex-PCR. All five tyrosine kinase receptors were amplified from single retinal ganglion cells. The method will prove useful for the molecular characterization of adult retinal ganglion cells. 2002 Elsevier Science B.V. All rights reserved. Theme: Sensory systems Topic: Retina and photoreceptors Keywords: Polymerase chain reaction (PCR); Reverse transcription (RT); Retinal ganglion cell (rgc); Fluorogold (FG)
1. Type of research The current protocol was developed to analyse the expression of tyrosine kinase receptors in single adult rat retinal ganglion cells. The PCR protocols can be used to analyse the expression of multiple genes in a single cell or in the retinal ganglion cell layer (ganglion cells and displaced amacrine cells).
2. Time required • Surgery with tracer deposition on to the superior colliculi: 40–60 min. • Retrograde tracing of retinal ganglion cells using Fluorogold: 4–7 days. • Enucleation of the eyes after anesthesia, dissection of retinas, mounting on to nitrocellulose filter and removal of vitreous body: 10 min. • Enzymatic incubations and layer-separation: 20 min. *Corresponding author. Tel.: 146-18-471-4944; fax: 146-18-559-017. ¨¨ E-mail address: [email protected] (F. Hallbook).
• • • • •
Aspiration of cells: 2–4 h. DNase treatment and cDNA synthesis: 2 h. Multiplex PCR: 5–6 h. Agarose gel analysis: 2 h. Sequencing: 1 day.
3. Materials
3.1. Animals We used adult female Sprague–Dawley rats (each weighing 225–250 g) obtained from B&K Universal (Sollentuna, Sweden). Rats were housed in standard cages and maintained in temperature-controlled rooms with a 12-h light, 12-h dark cycle with light intensity ranging from 8 to 24 lx. The rats were fed ad libitum.
3.2. Equipment • Millipore filter (type HA 0.45 mm) (Millipore) • Nitrocellulose filter (Hybond-C 0.45 mm) (Amersham)
1385-299X / 02 / $ – see front matter 2002 Elsevier Science B.V. All rights reserved. PII: S1385-299X( 02 )00184-8
76
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
• Uncoated coverslips (24360 mm) and (24332 mm) ¨ (Menzel-Glaser) [1.0 • Micropipettes (GD-1), micropipette polisher (EG-40), micropipette forger (MF-90) and microinjector (IM55) (Narishige) • Micropipette puller (Model P-97) (Sutter Instruments) • Micromanipulator and inverted microscope (DM IRB) (Leica) • Temperature-controlled incubator (Salvis Biocenter) • Computer-program OLIGO 6.0 • Programmable thermal cycler (Hybaid) • Gel documentation system (ChemiDoc) (BioRad) • Sequencer (Applied Biosystems 373)
3.3. Chemicals and reagents • Xylazine (Rompun), 20 mg / ml (Bayer) and ketamine (Ketalar), 50 mg / ml (Parke–Davis) • Fluorogold (Fluorochrome, Englewood, CO, USA) • Pentobarbital, 100 mg / ml (Apoteket, Sweden) • Dimethyl sulfoxide (Merck) • Trypsin (from bovine pancreas) (Biochrom KG) • DNase I, 1st strand cDNA synthesis kit and RNase inhibitor (Boehringer–Mannheim) • Gel Extraction Kit (Qiagen) • Hydroxypropylmethylcellulose H-7509 (Sigma) • RNase-free DNase (Promega) • Amplitaq Gold DNA Polymerase and Terminator Ready Reaction Mix (Perkin-Elmer) • Agarose (Shelton Scientific)
an intraperitoneal injection of 3–4 ml pentobarbital. The temporal–nasal border of the eyes was marked with a suture and the eyes were enucleated and immediately put on ice for dissection.
4.2. Isolation of retinal ganglion cells by mechanical layer separation Eyes were dissected in sterile phosphate-buffered saline (PBS) and the retina was carefully separated from the sclera and cut into quadrants. Using a forceps, a retinal quadrant was placed on to a nitrocellulose (NC) filter (535 mm) with the photoreceptors facing the filter (Fig. 1). Care was taken not to damage the inner retinal layers. The vitreous body was removed and the NC-filter and retina were incubated in PBS with 0.5% trypsin and 0.04 mg / ml DNaseI at 37 8C for 15 min. The NC filter was blotted on a Millipore (MP) filter (15315 mm) for 5 s to remove excess fluid and placed on an uncoated coverslip (24360 mm) with the inner retinal side down. A smaller coverslip (24332 mm; 0.27 g) was placed over the MPfilter to promote adhesion to the glass surface. This ‘sandwich’ was incubated at 37 8C for 5 min. The small coverslip was removed and layer-separation was carried out by carefully lifting the filters and retina with a forceps. Isolated cells were immediately covered with 200 ml of ice-cold PBS with 0.16% hydroxypropylmethylcellulose (HPMC) which stabilizes cells by increasing viscosity [4,12].
4.3. Collection of single retinal ganglion cells 4. Detailed procedure
4.1. Retrograde tracing of retinal ganglion cells Experiments were carried out in accordance with European Community guidelines and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Procedures were scrutinized by the local ethics committee for experimental animals. Two animals were used for the single-cell PCR data in this study. For surgery, the animals were anesthetized with an intraperitoneal injection mixture of Rompun and Ketalar: 10–15 and 30–100 mg / kg body weight, respectively. The ganglion cells in the retina were retrogradely labelled from the superior colliculi with the fluorescent tracer Fluorogold, using previously described techniques [16,17]. In brief, after exposing the surface of the superior colliculi, a piece of gelfoam soaked in 0.9% NaCl solution containing 3% Fluorogold and 10% dimethyl sulfoxide (DMSO) was applied on to these structures. Cell terminals were thus exposed to Fluorogold, which was retrogradely transported to ganglion cell bodies in the retina. Optimal labelling is achieved 7 days after Fluorogold application [16]. Animals were sacrificed via
Cells were kept on the original coverslip and cell picking was carried out in an inverted fluorescence microscope. Single retinal ganglion cells were identified by the light emitted by Fluorogold and were aspirated using a micropipette attached to a hand-controlled microinjector. The micropipette was navigated in three dimensions via an electronic micromanipulator. One cell was picked at a time by applying negative pressure with the microinjector. Care was taken not to aspirate any other cellular material or debris along with the cell. The cell was transferred to a 3–7 ml droplet of PBS on another coverslip (Fig. 1) where the few picoliters of HPMC–PBS containing the cell were expelled under visual control by carefully applying positive pressure. The PBS droplet with the cell was transferred to a 0.2-ml reaction tube kept at 4 8C until cDNA synthesis the same day. To control for extracellular mRNA contaminants, a few picoliters of HPMC–PBS from each cell preparation were sampled for RT-PCR analysis. The collection of single retinal ganglion cells continued for up to 4 h and the same micropipette could be used repeatedly to pick 3–4 cells. Cells were supplemented with ice-cold HPMC–PBS to prevent desiccation.
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
77
Fig. 1. Overview of the layer-separation procedure. For further details see text under detailed procedure. RT, reverse transcription; PBS, phosphatebuffered saline; HPMC, hydroxypropylmethylcellulose; onl, outer nuclear layer; opl, outer plexiform layer; inl, inner nuclear layer; ipl, inner plexiform layer; gcl, ganglion cell layer; nfl, nerve fiber layer.
4.4. Isolation of RNA from retina cDNA from total retina RNA was used as a positive control. Total RNA from adult rat retina was isolated using the acid–phenol method [8]. Retinas from adult rats were dissected and homogenized in 500 ml GITC-buffer (4 M guanidinium isothiocyanate, 0.5% sodium lauroyl sarcosine and 0.2 M b-mercaptoethanol) using a homogenizer (Polytrone). The samples were extracted with 0.5 ml acid phenol supplemented with 0.3 M sodium acetate (pH 4.8); 150 ml chloroform was added and samples were mixed and incubated on ice for 15 min before centrifuging at 15 5003g for 15 min. The water / RNA phase was precipi-
tated in ethanol and subsequently dissolved in water. RNA concentration was determined using a spectrophotometer.
4.5. cDNA synthesis Due to limiting amounts of starting material in single cell preparations, first strand cDNA synthesis was conducted in 20-ml reaction volumes. Buffer was added (10 mM Tris, 50 mM KCl, 5 mM MgCl 2 and 1 mM dNTP mix) to the cell samples and negative controls. Samples were heated to 95 8C for 1 min to release cell contents (Table 1). Then 1 U RNase-free DNase was added to digest genomic DNA [3] and 25 U RNase-inhibitor to
78
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
Table 1 Degradation of chromosomal DNA and reverse transcription of single retinal ganglion cell mRNA Process
Temp (8C)
Time (min)
Release of cell contents and denaturation of proteins Add RNase-free DNase and RNase inhibitors Digestion of chromosomal DNA Denaturation of DNase Add AMV reverse transcriptase, RNase inhibitors and random hexamer primers Annealing of primers Synthesis of cDNA Denaturation of AMV reverse transcriptase Storage
95 37 37 75 25
1 Pause 30 5 Pause
25 42 95 4
10 60 5 ,120
block RNase activity and samples were incubated at 37 8C for 30 min. DNase was inactivated by incubation at 75 8C for 5 min and 20 U of AMV reverse transcriptase, 4 mg random hexamer primers and 25 U RNase-inhibitor were added followed by incubation at 25 8C for 10 min and 42 8C for 1 h. Finally, AMV reverse transcriptase was inactivated by incubation at 95 8C for 5 min. A 1-mg aliquot of total retina RNA was used for cDNA synthesis following the same procedure.
4.6. Polymerase chain reaction ( PCR) Two PCR strategies were used for analysis of gene expression in single retinal ganglion cells (Fig. 2). In the first strategy cDNA reactions were split into two 50 ml PCR reactions for amplification of TrkB or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (positive control). The reactions contained 50 pmol of GAPDH primers or 50 pmol of TrkB primers (Table 2), 10 ml of single cell cDNA reaction, buffer (10 mM Tris–HCl, 50 mM KCl), 0.25 mM of each of the dNTPs, 2.5 mM MgCl 2 and 2.5 U Amplitaq Gold DNA polymerase. A
negative control was done for each cell containing water instead of cDNA and analysed using GAPDH primers. Ten minutes at 95 8C activated the enzyme and 50 cycles (95 8C for 1 min, 57 8C for 2 min, 72 8C for 2 min) were used to amplify single cell cDNA. The HPMC–PBS medium cDNA reactions were analysed using GAPDH primers under the same conditions. In the second PCR strategy, TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin (positive control) were analysed using two consecutive PCR reactions. The first 50-ml multiplex PCR reaction [2,9] contained 25 pmol of each of the 12 primers (Table 2), 10 ml cDNA reaction, buffer (15 mM Tris–HCl, 50 mM KCl), 0.25 mM of each of the dNTPs, 2.5 mM MgCl 2 and 2.5 U Amplitaq Gold DNA polymerase. A negative control was performed for each cell containing water instead of cDNA and analysed using Beta-actin primers. Ten minutes at 95 8C activated the enzyme, and two-step PCR (94 8C for 30 s, 68 8C for 1 min) was used to amplify single cell cDNA (25 cycles) and retina cDNA (20 cycles). The first PCR reaction was split into six PCR reactions with the same final concentrations of buffer, MgCl 2 and dNTPs as the first reaction, but 50
Fig. 2. Overview of the two PCR strategies used to analyse tyrosine kinase receptor expression in single adult rat retinal ganglion cells. Single cell mRNA was reverse transcribed to cDNA and analysed for TrkB and GAPDH by PCR or TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin by multiplex PCR. All PCR reactions were analysed by analytical agarose gel electrophoresis and sequencing.
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
79
Table 2 Primers used for PCR amplification Target cDNA GAPDH
a
TrkB a TrkB b TrkC b Ret b Met b ErbB2 b b-Actin b a b
Primers (59-39) forward / reverse
Amplicon position
Amplicon size (bp)
CCTTCATTGACCTCAACTAC TTCACACCCATCACAAAC CACCAACCATCACATTTCTC ATCTGTCTCTCGTCCTTCCC GCTTACAAGGCGTTTCTGA GGGGCTGGATTTCGT AAATTCTATGGGGTCTGTG TCTGACTGGCGATGTG TATGTCCATGCCCTACGG GCCATTTCGGATGCTGA TGTACGGTCCCCAGTGAC AGGAAGAGCCCGGATACT GGAAGAATGGGGTTGTCA GGGGTCCCTTCAAAGTTACT GCCCCTCTGAACCCTAAG CATCACAATGCCAGTGGTA
nt 101–401
301
nt 857–1121
265
nt 319–508
189
nt 1804–1987
184
nt 154–343
189
nt 2683–2864
182
nt 3558–3753
196
nt 322–459
cDNA—138 Genomic DNA—603
Primers used for single cell PCR. Primers used for single cell multiplex PCR.
pmol of primers, 5 U Amplitaq Gold DNA Polymerase and 8 ml of the first PCR reaction. A two-step PCR (94 8C for 30 s, 68 8C for 1 min) amplified single cell cDNA (50 cycles) and retina cDNA (30 cycles). Contaminating chromosomal DNA was monitored by amplification of a 603-bp Beta-actin fragment since the amplicon was positioned over an intron.
the ganglion cells too firmly which resulted in broken cells during the cell picking. For successful single cell PCR, use a separate area and dedicated equipment for PCR set-up. Use filtertips and aliquot reagents, especially primers, which should be thrown away if contamination is suspected. Use sterile solutions and sterilize the coverslips used for layer-separation.
4.7. Analysis of PCR products by agarose gel electrophoresis and sequencing 5. Results Ten microliters of each PCR reaction were analysed by electrophoresis on a 3% agarose gel stained with ethidium bromide. To confirm the identity of the PCR fragments they were sequenced directly using the forward primers (Table 2). The fragments were purified by agarose gel electrophoresis, excised under UV-light and extracted using silica-based chemistry (Qiagen). Fragments were quantified by comparison to DNA standards on an agarose gel and sequenced using an ABI dye terminator cycle sequencing ready reaction kit (Perkin-Elmer).
4.8. Trouble-shooting mechanical layer-separation and single-cell PCR Poor retinal attachment to filters can be avoided by depressing the edges of the retina with the tip of a forceps. Poor ganglion cell layer adherence to the glass surface can be a result of: (a) remaining vitreous body (all vitreous body must be peeled off from the retina), or (b) the filters impeding proper contact of the sandwich (the filters should be cut only slightly larger than the retina). To prevent desiccation, medium should be added immediately after layer-separation and 200 ml of medium gave a suitable density of cells. Uncoated glass-surface should be used for the separation. Poly-L-lysine coated glass surfaces bound
5.1. Isolation of cells by layer-separation and picking of single retinal ganglion cells The protocol for layer separation provided enough retinal ganglion cells for single cell picking. In the preparation there were single, UV-fluorescent and intact ganglion cells that were easily retrieved by micromanipulation (Fig. 3C–F). There were also larger continuous retinal sheets with scattered, fluorescent ganglion cells (Fig. 3A,B) and smaller aggregates of cells and debris. The retinal ganglion cells were easily distinguished from other cell types using UV-light microscopy and fluorescence was emitted from the ganglion cells several hours after layerseparation. The soma sizes of the dissociated and pickable retinal ganglion cells ranged from 8 to 25 mm, although the majority had smaller soma sizes.
5.2. Expression analysis of tyrosine kinase receptors in single acutely dissociated retinal ganglion cells by RTPCR Eighteen retinal ganglion cells were analysed by RTPCR. Nine ganglion cells were analysed for TrkB and GAPDH. Eight were positive for GAPDH and four were
80
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
Fig. 3. Micrographs showing single cell picking and cell configurations after mechanical layer-separation. The retinal ganglion cell layer of one quadrant of an adult rat retina was isolated using layer-separation and single retinal ganglion cells were identified under UV-light and picked using a micropipette. (A) Larger continuous sheet of retinal ganglion cell layer, arrow denotes a retinal ganglion cell. Scale bar 100 mm. (B) UV-light detection of Fluorogold-labelled ganglion cells in (A). (C) Single, pickable retinal ganglion cells. Scale bar 50 mm. (D) UV-detection of the cells in (C). (E) Picking of a retinal ganglion cell (12 mm soma diameter) for transfer to a droplet of PBS. Scale bar 20 mm. (F) UV-light detection of the ganglion cell in (E).
also positive for TrkB (Fig. 4A). cDNA from nine ganglion cells and total retina cDNA were analysed for TrkB, TrkC, Ret, Met, ErbB2 and Beta-actin by multiplex PCR. Eight cells were positive for Beta-actin with only one band at 138 bp, indicating absence of chromosomal DNA. Two of 18 cells yielded no specific PCR product. All five receptors were amplified from retinal ganglion cells (Table 3), but all receptors were not amplified together from the same cell. In one ganglion cell none of the receptors were detected. Ret was amplified most frequently (seven cells) followed by Met (four cells) and Ret was amplified together with Met in two cells (Table 3). All five receptors were amplified from retina cDNA (representative gel in Fig. 4C). Control HPMC–PBS medium PCR reactions were negative (Fig. 4A) as were the water control PCR reactions (Fig. 4A–C). Sequencing of PCR fragments yielded the expected sequences.
6. Discussion
6.1. Comparison with other methods to isolate retinal ganglion cells Our protocol for layer-separation is based on the protocol described by Simon and Thanos for adult rat retinas [12]. By comparison our protocol is faster, easier to perform and adapted for isolating single retinal ganglion cells for RT-PCR. Originally, separation of retinal sublayers was developed for neonatal rat retinas [11], but without identifying retinal ganglion cells. Another protocol for isolating adult rat retinal ganglion cells [5] included enzymatic treatment of the retina followed by trituration with a Pasteur pipette. The yield of ganglion cells using this method was very low. Our own experience is that trituration of the retina yields very few, intact Fluorogold-
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
81
Fig. 4. Agarose gel analysis of PCR reactions. (A) Agarose gel analysis of single cell PCR reactions. cDNA from a retinal ganglion cell was split for analysis of TrkB and glyceraldehyde-3-phosphate dehydrogenase (GAPDH); PCR products were obtained for both TrkB (265 bp) and GAPDH (301 bp). No product was obtained in the water negative control reaction (lane neg ctrl) nor in the HPMC–PBS medium negative control (lane neg med ctrl). (B) Agarose gel analysis of multiplex single cell PCR. PCR products were obtained for Ret (189 bp), Met (182 bp) and Beta-actin (138 bp). (C) Agarose gel analysis of multiplex PCR on retina cDNA. PCR products were obtained for all five tyrosine kinase receptors and Beta-actin. M, molecular weight marker.
labelled adult retinal ganglion cells. This, we believe, is because the adult retinal ganglion cells are very fragile. Another study [19] used flow-cytometry to quantitate paraformaldehyde-fixed retinal ganglion cells using anti-
bodies to Fluorogold. Whether this method of collecting ganglion cells can be used for analyzing gene expression in the cells remains to be shown.
6.2. Overall assessment of PCR protocols
Table 3 Result of multiplex PCR amplification of single retinal ganglion cell (rgc) cDNA rgc
TrkB
TrkC
Ret
Met
ErbB2
b-Actin a
b-Actin b
1 2 3 4 5 6 7 8
– 1 – 1 – – – –
– – – 1 – – – –
1 1 – 1 1 1 1 1
– 1 – – – 1 1 1
– 1 – – – – – 1
1 1 1 1 1 1 1 1
– – – – – – – –
(1) amplification of PCR-fragment of correct size; (–) no amplification. a 138-bp fragment (cDNA). b 603-bp fragment (chromosomal DNA).
We used two different PCR protocols to study the expression of tyrosine kinase receptors in retinal ganglion cells. Multiplex PCR was useful since it amplified several genes in the limiting amounts of cDNA, although it was time-consuming due to pipetting. The multiplex analysis had six targets but can be expanded to 20 targets [20]. The amplicons were of the same size to achieve equally efficient amplification, although amplicons of incremental sizes can be used which could be analysed after one round of PCR [20]. In total, 89% (16 of 18) of the single-cell PCR reactions were successful amplifying a specific PCR product. Reasons for unsuccessful single cell PCR are that the cell did not follow into the reaction tube or that the cDNA or PCR reactions did not work due to pipetting error. To study the expression of a family of tyrosine
82
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83
kinase receptors, degenerate PCR could be used with primers directed towards a conserved sequence in the tyrosine kinase domain.
6.3. Expression analysis of tyrosine kinase receptors by single cell RT-PCR We amplified TrkB, TrkC, Ret, Met and ErbB2 from single retinal ganglion cells and from retina. In only one out of eight cells tested, none of the tyrosine kinase cDNAs were detected. PCR primers for TrkB were located in the extracellular region and could potentially detect both full-length receptor and receptor lacking the tyrosine kinase domain (truncated TrkB receptor). Using in situ hybridisation [14], 60% of the cells in the ganglion cell layer were positive for full-length TrkB mRNA, while 80% were positive for truncated TrkB mRNA. 38% (six of 16) of the retinal ganglion cells in our study were positive for TrkB, although to obtain a good estimation of TrkB expression using our method, more cells should be sampled. Full-length TrkC transcript was amplified from one of eight retinal ganglion cells. As shown by Northern blot [15] both full-length and truncated TrkC mRNA are expressed in the adult rat retina. Ret cDNA was amplified from retinal ganglion cells. Earlier studies have shown that axotomized retinal ganglion cells are responsive to treatment by GDNF in vivo [6,7,18]. GDNF acts via the cell-surface receptor Ret [10]. We detected ErbB2 transcript in retinal ganglion cells, but the expression of ErbB2 may be very low. In an earlier study [1], ErbB2 showed immunoreactivity in the inner plexiform layer in the embryonic and postnatal rat retina but not in adult retina. We also detected expression of the receptor for HGF (Met) in ganglion cells. Met shows weak immunoreactivity in the ganglion cell layer in the adult rat retina [13]. Our single-cell PCR method shows that it is possible to detect expression of tyrosine kinase receptors in single retinal ganglion cells and the PCR result indicates that a majority of ganglion cells in the adult rat retina express tyrosine kinase receptors.
7. Quick procedure • Perform surgery for retrograde tracing of retinal ganglion cells from the superior colliculi in the adult rat. • Sacrifice the animal after 1 week, enucleate the eyes and dissect the retinas. • Perform retinal ganglion cell layer separation. • Aspirate a single, Fluorogold-labelled retinal ganglion cell with a micropipette under UV-light and transfer it to a reaction tube. • Degrade chromosomal DNA, synthesize cDNA by reverse transcription and run multiplex PCR.
• Analyse the PCR fragments by agarose gel electrophoresis and by sequencing.
8. Essential literature references References [9,12,16]
Acknowledgements The authors wish to thank Dr Earl T. Larson for English corrections. This work was supported by the Foundation for Strategic Research, National Neuroscience Network (34-1-98), Swedish Research Council (12187), Stiftelsen KMA and Mattsons Research Foundation.
References [1] O. Bermingham-McDonogh, K.L. McCabe, T.A. Reh, Effects of GGF / neuregulins on neuronal survival and neurite outgrowth correlate with erbB2 / neu expression in developing rat retina, Development 122 (1996) 1427–1438. [2] B. Cauli, E. Audinat, B. Lambolez, M. Angulo, N. Ropert, K. Tsuzuki, S. Hestrin, J. Rossier, Molecular and physiological diversity of cortical nonpyramidal cells, J. Neurosci. 17 (1997) 3894–3906. [3] E. Grigorenko, H. Yeh, Expression profiling of GABAA receptor beta-subunits in the rat retina, Vis. Neurosci. 11 (1994) 379–387. [4] J. Henry, K. Olander, Comparison of the effect of four viscoelastic agents on early postoperative intraocular pressure, J. Cataract Refract. Surg. 22 (1996) 960–966. [5] Y. Hong, S. Thanos, A quantitative approach to identify and isolate pure populations of fluorescently labeled adult retinal ganglion cells using a pressure-driven microaspiration technique, Neurosci. Lett. 214 (1996) 111–114. ¨ ¨ ¨ [6] N. Klocker, F. Braunling, S. Isenmann, M. Bahr, In vivo neurotrophic effects of GDNF on axotomized retinal ganglion cells, Neuroreport 8 (1997) 3439–3442. [7] P.D. Koeberle, A.K. Ball, Effects of GDNF on retinal ganglion cell survival following axotomy, Vis. Res. 38 (1998) 1505–1515. [8] T. Maniatis, E. Fritsch, J. Sambrook, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Publications, New York, 1982. [9] D. Ruano, B. Lambolez, J. Rossier, A. Paternain, J. Lerma, Kainate receptor subunits expressed in single cultured hippocampal neurons: molecular and functional variants by RNA editing, Neuron 14 (1995) 1009–1017. [10] M. Saarma, GDNF—a stranger in the TGF-beta superfamily?, Eur. J. Biochem. 267 (2000) 6968–6971. [11] S. Shiosaka, H. Kiyama, M. Tohyama, A simple method for the separation of retinal sublayers from the entire retina with special reference to application for cell culture, J. Neurosci. Methods 10 (1984) 229–235. [12] P. Simon, S. Thanos, Combined methods of retrograde staining, layer-separation and viscoelastic cell stabilization to isolate retinal ganglion cells in adult rats, J. Neurosci. Methods 83 (1998) 113– 124. [13] W. Sun, H. Funakoshi, T. Nakamura, Differential expression of hepatocyte growth factor and its receptor, c-Met in the rat retina during development, Brain Res. 851 (1999) 46–53. [14] A. Suzuki, S. Nomura, E. Morii, Y. Fukuda, J. Kosaka, Localization of mRNAs for trkB isoforms and p75 in rat retinal ganglion cells, J. Neurosci. Res. 54 (1998) 27–37.
N. Lindqvist et al. / Brain Research Protocols 10 (2002) 75–83 [15] D.M. Valenzuela, P.C. Maisonpierre, D.J. Glass, E. Rojas, L. Nunez, Y. Kong, D.R. Gies, T.N. Stitt, N.Y. Ip, G.D. Yancopoulos, Alternative forms of rat TrkC with different functional capabilities, Neuron 10 (1993) 963–974. [16] M. Vidal-Sanz, M. Villegas-Perez, G. Bray, A. Aguayo, Persistent retrograde labeling of adult rat retinal ganglion cells with the carbocyanine dye diI, Exp. Neurol. 102 (1988) 92–101. [17] M. Villegas-Perez, M. Vidal-Sanz, M. Rasminsky, G. Bray, A. Aguayo, Rapid and protracted phases of retinal ganglion cell loss follow axotomy in the optic nerve of adult rats, J. Neurobiol. 24 (1993) 23–36. [18] Q. Yan, J. Wang, C. Matheson, J. Urich, Glial cell line-derived
83
neurotrophic factor (GDNF) promotes the survival of axotomized retinal ganglion cells in adult rats comparison to and combination with brain-derived neurotrophic factor (BDNF), J. Neurobiol. 38 (1999) 382–390. [19] J. Yang, G. Tezel, R.V. Patil, M.B. Wax, Flow cytometry for quantification of retrogradely labeled retinal ganglion cells by Fluoro-Gold, Curr. Eye Res. 21 (2000) 981–985. [20] G. Zangenberg, R. Saiki, R. Reynolds, Multiplex PCR: optimisation guidelines, in: M. Innis, D. Gelfand, J. Sninsky (Eds.), PCR Applications; Protocols for Functional Genomics, Academic Press, San Diego, CA, 1999, pp. 73–94.