- Email: [email protected]
Single-Site Polymerase Chain Reaction through Single Oligonucleotide Ligation
NOTES & TIPS 4. Abraham, G. E. (1974) Clin. Biochem. 7, 193–201. 5. Fenske, M., and Scho¨nheiter, H. (1991) J. Chromatogr. 563, 178– 183.
Single-Site Polymerase Chain Reaction through Single Oligonucleotide Ligation Zhenwu Lin, Yunsong Zhu,1 Xiangfeng Cui, and Honghua Li2 Coriell Institute for Medical Research, 401 Haddon Avenue, Camden, New Jersey 08103 Received May 3, 1995
In a regular PCR3 procedure, DNA sequence information at two sites flanking the region to be amplified is needed for designing PCR primers. However, such information is often available only at one site. To amplify the DNA regions of interest, many single-site PCR strategies have been developed (1–21). All these procedures are based on the attachment of a short generic oligonucleotide to all termini of a population of DNA fragments, including the fragment with the target and known specific sequence. Amplification of the target sequence is achieved by using a specific primer designed according to the known sequence and a generic primer using the attached oligomer as anchor sequence. In several studies, the anchor sequences were either a homopolynucleotide tract generated by the terminal deoxynucleotidyl transferase (2,7) or a singlestranded oligonucleotide ligated with the T4 RNA ligase (17). In most procedures, however, the anchor sequences are generated by digesting DNA samples with restriction enzymes and ligating double-stranded DNA (such as vector DNA) or oligonucleotides to the restriction termini. MacGregor and Overbeek (15) showed that it is possible to create the primer anchor sequence by ligating a single-stranded oligonucleotide to a restriction fragment with 3*-overhanging termini. In this way synthesis of complementary oligonucleotides and phosphorylation of the 5*-end of one of the complementary oligonucleotides required by double-stranded DNA ligation are eliminated. However, the procedure de1
Current address: Department of Biochemistry, Shanghai Medical University, Shanghai 200032, PRC. 2 To whom correspondence should be addressed at Coriell Institute for Medical Research, 401 Haddon Avenue, Camden, NJ 08103. Fax: 609-964-0254. Email: [email protected]. 3 Abbreviations used: PCR, polymerase chain reaction; dNTP, deoxynucleotidetriphosphate; RSP, regular specific primer; NSP, nested specific primer; PBGD, porphobilinogen deaminase; OTF3, octamer-binding transcription factor 3; ERBB2, erythroblastic leukemia viral oncogene; DTE, dithioerythritol. ANALYTICAL BIOCHEMISTRY
scribed is quite complicated. With this procedure, the size of the fragment containing the target sequence in the genomic DNA digested with a restriction enzyme is determined by Southern analysis. The sample used for PCR is prepared by fractionating the digested genomic DNA with gel electrophoresis and excising the gel slices containing DNA fragments in the desirable size range. Although such an enrichment of target DNA was shown to enhance the amplification specificity, a large amount of genomic DNA is required as starting material. In this paper, we show that these complicated steps can be avoided by including a second round of amplification with hemi-nested primers. We also show that 20 ng of genomic DNA is sufficient for obtaining highly specific PCR product. With this improved protocol we successfully amplified five DNA regions at the porphobilinogen deaminase (PBGD, sequence with accession No. M18799 in GenBank deposited by Romeo), octamer-binding transcription factor 3 (OTF3, Ref. 22), erythroblastic leukemia viral oncogene (ERBB2, Ref. 23) gene loci, and two regions flanking the human VH genes 3-1 and 8-2, respectively (Li and Hood, unpublished data). Material and Methods Ligation. After phenol extraction and ethanol precipitation 400 ng PstI-digested human genomic DNA was dissolved in 10 ml of ddH2O. Six microliters (240 ng) of the digest was ligated to an oligonucleotide, PstL (5*AGCGTTGACAGCCAGGTGCA3*) containing a 3* four-base sequence complementary to the 3*-overhanging sequence of the PstI terminus (Fig. 1). Ligation was performed at 167C overnight in a 15-ml solution containing 11 ligation buffer (66 mM Tris–HCl, pH 7.5, 5 mM MgCl2 , 1 mM DTE, and 1 mM ATP, supplied with T4 ligase, Boehringer Mannheim), 0.2 mM PstL, and 1 unit T4 DNA ligase. Specific primers. For each locus, one regular specific primer (RSP) and one nested specific primer (NSP) were used. These primers were ERB2O (RSP, 5*TCAGCTCCGTCTCTTTCAGG3*) and ERB2P (NSP, 5* acgagtcacgttgtcgcaggGGGGGTGGTGGGTCAGTG3*) for amplifying a region at the ERBB2 locus on chromosome 17; OTF3O (RSP, 5*GTAGTCCTTTGTTACATGCA3*) and OTF3P (NSP, 5*ggtcgtggacactctacaggGTGGGCAGCTTGGAAGGCACA3*) for a region at the OTF3 locus on chromosome 6; PBGDO (RSP, 5*GTCCAGAAGCCCAAAGTGTG3*) and PBGDP (NSP, 5*tgactctgatggtacagtggCCCCCGGCCCCGGGAAGtCG3*) for a region at the PBGD locus on chromosome 11; S4M8 (RSP, 5*GTGCCGTGCACCCACCACACTC3*) and S4M11 (NSP, 5*ATAGTGACTCCCACAATTCTGTATCC3*) for a region at the VH 3-1 gene locus; and S5M1 (RSP, 5*ATTGGCAGAGACACACTGGGAC3*) and S5M4 (NSP, 5*GCAGAAATTCAGGTATTAGTGAAA-
231, 449–452 (1995)
0003-2697/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4314$$nat
10-13-95 16:04:50
abnt
449
AP-Anal Bio
450
NOTES & TIPS
ACC3*) at the VH 8-2 gene locus. Since primers for the ERBB2, OTF3, and PBGD loci were originally designed for another study (Lin, Cui, and Li, unpublished work), the sequences in lower case were not genomic sequences and were not necessary for this study. The third nucleotide ‘‘t’’ from the 3*-end of PBGDP mismatches the template and was designed for another purpose in the original study. Normally, it should be a ‘‘C.’’ PCR. Each PCR sample contained 11 PCR buffer (100 mM Tris–HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2 , and 0.1 mg/ml gelatin), 1 unit of Taq DNA polymerase, 0.2 mM of each primer, and 20 ng DNA in a final volume of 50 ml. Amplification was performed on a DNA Thermal Cycler 480 (Perkin–Elmer). In the first round, the samples were incubated at 947C for 2 min to denature DNA template before adding the Taq DNA polymerase. In the second round, 2 ml of the first-round PCR product was reamplified with corresponding primers. The thermal profile was 947C, 1 min; 607C, 1 min; and 727C, 1 min for each cycle and 35 cycles for each round. The PCR products were analyzed by 7% PAGE and visualized under uv light after ethidium bromide staining. Results and Discussion The scheme of single-site PCR through ligation between a single oligonucleotide (PstL) and the PstI site is illustrated in Fig. 1. According to this procedure, PstL was ligated to the 5*-recessed ends of both strands of every PstI restriction fragment generated by digesting human genomic DNA. The ligation was facilitated by (i) the complementarity between the four bases at the 3*-end of PstL and the 3*-overhanging sequence of the PstI termini; (ii) the 5* phosphate group on each DNA strand generated by PstI digestion which eliminated the need of phosphorylation when ligated with PstL containing a 3* hydroxide group; and (iii) a high concentration (0.2 mM) of PstL so that each PstI terminus was surrounded by 106 PstL molecules and therefore circularization and/or self-ligation of the PstI fragments was minimized. The ligation was so efficient that 20 ng of genomic DNA could be used as starting materials for PCR. Ligation of PstL to the PstI termini converted these 3*-protrudent termini into 5*-protrudent with PstL as the overhanging sequence. In the regular procedure, PCR samples are prepared at room temperature and brought to a high temperature to denature the DNA template in the beginning of the first PCR cycle. During such a process the sequence complementary to PstL can be synthesized at all termini of the fragments with the 5*-overhanging PstL if all PCR reagents are present. If this occurs, PstL cannot be used as a PCR primer for specific amplification because the newly synthesized complementary sequence can be used as an anchor sequence by PstL
/ m4314$$nat
10-13-95 16:04:50
abnt
FIG. 1. Schematic illustration of single-site PCR through single oligonucleotide ligation. Known sequence is shown as grey boxes. (1) Ligation; (2) DNA template denaturation, adding the Taq polymerase, and RSP annealing; (3) PCR cycles of the first round; (4) denaturation and NSP annealing steps during the second round of PCR; and (5) PCR cycles of the second round.
and a large amount of nonspecific sequences will be amplified. To solve this problem, the Taq polymerase was not included until the samples with all other reagents were denatured at 947C. Denaturation before formation of the PstL anchor sequence was a key step for specific amplification with PstL because only 20 ng genomic DNA was used in each reaction and, once denatured, reannealing of the genomic sequence will be a very slow process and virtually impossible for most sequences during the 1-min annealing step in each cycle. Without reannealing, the PstL anchor sequence cannot be synthesized on these sequences. On the other hand, the RSP was included in the reaction at a high concentration (0.2 mM); its quick annealing to the specific template and extension resulted in synthesis of the target sequence flanked by RSP and the PstL anchor sequence, which in turn is used as template for further specific amplification with both RSP and PstL. Because only one of the two PCR primers is specific, reduced specificity has been a major problem associated with many single-site PCR protocols compared to the amplification with two specific primers. Heavy backgrounds were also associated with a significant portion of the PCR products generated with the procedure described above (data not shown). However, we showed that the backgrounds can be reduced to very
AP-Anal Bio
NOTES & TIPS
FIG. 2. Amplification of DNA fragments at five gene loci by singlesite PCR through single oligonucleotide ligation. Five microliters of each PCR product from the second-round PCR was subjected to PAGE with a 7% gel. The gel was stained with ethidium bromide and photographed under uv illumination. The size (in base pairs) of the final PCR product for each locus is indicated on the right. S, specific primers only; PS, specific primers / PstL; P, PstL only; and M, 1-kb DNA ladder as molecular size markers.
low levels by reamplifying the PCR products with PstL and corresponding NSPs (Fig. 2). The results in Fig. 2 indicate that the nonspecific background sequences were mainly generated from the amplification of nonspecific annealing between the genomic sequences and the primers used in the first round, rather than from the amplification of the fragments with PstL anchor sequence at both termini. If the latter were the case, the backgrounds would not be reduced significantly by using NSRs. With this improved procedure we successfully amplified the DNA regions at five gene loci: PBGD, OTF3, ERBB2, and two VH gene loci, 3-1 and 8-2. According to the known sequences, the final PCR products from these loci should be 513, 713, 401, 199, and 121 bp, respectively. As shown in Fig. 2, fragments with the expected length were observed clearly after gel electrophoresis and ethidium bromide staining. The high degree of amplification specificity was also proved by the fact that no amplifications were detected with either RSP/NSP or PstL alone (Fig. 2, lanes P and S) used as primer. Because of the high degree of specificity, we showed that the PCR products amplified by this procedure could be used directly for sequence analysis without molecular cloning (data not shown). The single-site PCR strategy described above is limited to using enzymes generating termini with 3*-overhanging sequences. However, this may not limit the application of this method because the possible limitations associated with restriction enzymes in single-site PCR are the length of the recognition sequences and the number of commercially available enzymes but not the types of termini they generate. Statistically, under the assumptions that the digested sequence consists of equal numbers of the four bases and the four bases are distributed randomly, the average length of the fragments generated by a four-base cutter is 44 Å 256 bp and 1024, 4096, 16,384, and 65,536 bp for five-, six-, seven, and eight-base cutters, respectively. Al-
/ m4314$$nat
10-13-95 16:04:50
abnt
451
though these numbers may vary in practice, they help in predicting the length range of the resulting fragments. When the fragment containing the known sequence is too long or too short, more restriction enzymes need to be tested for generating the fragment in desirable length. Based on the average length (4096 bp) of the resulting fragments, an enzyme could be identified among about 4 six-base cutters for generating a fragment of Ç1000 bp that could be used for PCR. Because more than 10 six-base cutters and 3 four-base cutters generating fragments with 3*-overhanging sequences are commercially available, the limitation of only using the enzymes generating termini with 3*overhanging sequences may not limit the application of the method described in this paper. Acknowledgments. The authors thank Drs. David P. Beck and Lorraine H. Toji for their comments on the manuscript. This work was supported in part by an institutional grant from the Coriell Institute and the Emlen Stokes Chair in Genetics for HL.
REFERENCES 1. Triglia, T., Peterson, M. G., and Kemp, D. J. (1988) Nucleic Acids Res. 16, 8186. 2. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. USA 85, 8998–9002. 3. Ochman, H., Gerber, A. S., and Hartl, D. L. (1988) Genetics 120, 621–623. 4. Pfeifer, G. P., Steigerwald, S. D., Mueller, P. R., Wold, B., and Riggs, A. D. (1989) Science 246, 810–813. 5. Shyamala, V., and Ames, G. F.-L. (1989) Gene 84, 1–8. 6. Silver, J., and Keerikatte, V. (1989) J. Virol. 63, 1924–1928. 7. Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L., and Davis, M. M. (1989) Science 243, 217–220. 8. Mueller, P. R., and Wold, B. (1989) Science 246, 780–786. 9. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990) Nucleic Acids Res. 18, 2887–2890. 10. Fors, L., Saavedra, R. A., and Hood, L. (1990) Nucleic Acids Res. 18, 2793–2799. 11. Roux, K. H., and Dhanarajan, P. (1990) Biotechniques 8, 48–57. 12. Steigerwald, S. D., Pfeifer, G. P., and Riggs, A. D. (1990) Nucleic Acids Res. 18, 1435–1439. 13. Rosenthal, A., and Jones, D. S. (1990) Nucleic Acids Res. 18, 3095–3096. 14. Collasius, M., Puchta, H., Schlenker, S., and Valet, G. (1991) J. Virol. Methods 32, 115–119. 15. MacGregor, G. R., and Overbeek, P. A. (1991) PCR Methods Appl. 1, 129–135. 16. Raineri, I., Moroni, C., and Senn, H. P. (1991) Nucleic Acids Res. 19, 4010. 17. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., and Nossal, G. J. (1992) Proc. Natl. Acad. Sci. USA 89, 9823–9825. 18. Jones, D. H., and Winistorfer, S. C. (1992) Nucleic Acids Res. 20, 595–600. 19. Gibson, R. A., Buchwald, M., Roberts, R. G., and Mathew, C. G. (1993) Hum. Mol. Genet. 2, 35–38. 20. Pfeifer, G. P., Drouin, R., and Holmquist, G. P. (1993) Mut. Res. 288, 39–46.
AP-Anal Bio
452
NOTES & TIPS
21. Luo, M., and Cella, R. (1994) Gene 140, 59–62. 22. Takeda, J., Seino, S., and Bell, G. I. (1992) Nucleic Acids Res. 20, 4613–4620. 23. Coussens, L., Yang-Feng, T. L., Liao, Y.-C., Chen, E., Gray, A., McGrath, J., Seeburg, P. H., Libermann, T. A., Schlessinger, J., Francke, U., Levinson, A., and Ullrich, A. (1985) Science 230, 1132–1139.
Spectroscopic Aqueous-Phase Assay for Alkylating Activity Suitable for Automation or Multiwell Plate Application P. G. Penketh, K. Shyam, and A. C. Sartorelli1 Department of Pharmacology and Developmental Therapeutics Program, Cancer Center, Yale University School of Medicine, New Haven, Connecticut 06520
Received June 20, 1995
Determination of the alkylating activity of existing antineoplastic agents under various conditions, or of newly developed biologically or chemically activated prodrugs, constitutes a frequent experimental requirement. Moreover, it is often desirable to detect the presence of an alkylating species in largely aqueous media in the presence of living cells or biological components. Experimental protocols employing highly aqueous media should allow decomposition mechanisms and nucleophile selectivity to more accurately reflect the in vivo situation than systems utilizing organic solvents, since solvent polarity can strongly influence both the reaction mechanism and the nucleophile preference of many alkylating agents (1). The relatively low concentration of water found in some assay systems may produce a deceptively high signal due to the diminished concentration of this competing nucleophile. The most commonly used colorimetric assays for alkylating activity are those that utilize 4-(4-nitrobenzyl)pyridine (NBP)2 as a nucleophile. Koenigs et al. in 1925 first reported the production of a blue dye when the product of the reaction of NBP with methyl iodide was treated with potassium hydroxide (2). The product (A) was assigned the following structure: 1 To whom correspondence should be addressed. Fax: (203) 7372045. 2 Abbreviations used: NBP, 4-(4-nitrobenzyl)pyridine; BCH, 1,2bis(methylsulfonyl)-1-(2-chloroethyl)hydrazine; HPbCD, hydroxypropyl b-cyclodextrin; BCNU, 1,3-bis(2-chloroethyl)-1-nitrosourea; aTG, a-thioglycerol.
ANALYTICAL BIOCHEMISTRY
Compound A is presumably generated as a result of the following reaction sequence:
Compound A is relatively unstable, has low aqueous solubility, and produces a strong purple/blue solution when dissolved in most organic solvents. This chromophoric reaction has been employed to evaluate a variety of alkylating agents, including mustard gas and ethylenimines (3). Wheeler and Chumley (4) used a slight modification of the method described by Epstein et al. (3) to study the alkylating activity of various clinically relevant antineoplastic haloethyl and methylnitrosoureas and related compounds. Since this time the Wheeler and Chumley protocol has become the standard assay procedure for the determination of the alkylating activity of antineoplastic agents. The Wheeler and Chumley protocol utilizes a mixture of 2 ml of water, 1 ml of acetate buffer (0.025 M, pH 6.0), 1 ml of acetone containing the suspected alkylating agent, and 0.4 ml of a 5% (w/v) solution of NBP in acetone. When the reaction is complete 2 ml of acetone, 5 ml of ethyl acetate, and 1.5 ml of 0.25 M NaOH are added. The addition of the NaOH raises the pH to approximately 12.5. This mixture is then processed very rapidly in subdued light owing to the instability of the colored product. The mixture is shaken, then centrifuged (both for defined brief periods) and a portion of the upper phase removed and the absorbancy at 540 nm is determined versus a reagent blank. The absorbancy is taken at a defined time interval after the initiation of the work-up procedure to ensure reproducible results. A number of variations on this protocol have been described. In some cases, decreased concentrations of NBP have been used in largely aqueous media (necessitated by the low solubility of NBP in water); these protocols still require a rapid work-up procedure involving organic solvents and phase separation (5). The major disadvantages of these protocols are (a) the use of nonaqueous solvents during the reaction of the alkylating agent and nucleophile (some procedures only); (b) the necessity for centrifugation and phase separation steps (all current procedures); and (c) the lack of chromophore stability (most methods). The stability of the chromophore is highly dependent upon its environment. In the standard Wheeler/Chum-
231, 452–455 (1995)
0003-2697/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4314$$nat
10-13-95 16:04:50
abnt
AP-Anal Bio
Single-Site Polymerase Chain Reaction through Single Oligonucleotide Ligation Zhenwu Lin, Yunsong Zhu,1 Xiangfeng Cui, and Honghua Li2 Coriell Institute for Medical Research, 401 Haddon Avenue, Camden, New Jersey 08103 Received May 3, 1995
In a regular PCR3 procedure, DNA sequence information at two sites flanking the region to be amplified is needed for designing PCR primers. However, such information is often available only at one site. To amplify the DNA regions of interest, many single-site PCR strategies have been developed (1–21). All these procedures are based on the attachment of a short generic oligonucleotide to all termini of a population of DNA fragments, including the fragment with the target and known specific sequence. Amplification of the target sequence is achieved by using a specific primer designed according to the known sequence and a generic primer using the attached oligomer as anchor sequence. In several studies, the anchor sequences were either a homopolynucleotide tract generated by the terminal deoxynucleotidyl transferase (2,7) or a singlestranded oligonucleotide ligated with the T4 RNA ligase (17). In most procedures, however, the anchor sequences are generated by digesting DNA samples with restriction enzymes and ligating double-stranded DNA (such as vector DNA) or oligonucleotides to the restriction termini. MacGregor and Overbeek (15) showed that it is possible to create the primer anchor sequence by ligating a single-stranded oligonucleotide to a restriction fragment with 3*-overhanging termini. In this way synthesis of complementary oligonucleotides and phosphorylation of the 5*-end of one of the complementary oligonucleotides required by double-stranded DNA ligation are eliminated. However, the procedure de1
Current address: Department of Biochemistry, Shanghai Medical University, Shanghai 200032, PRC. 2 To whom correspondence should be addressed at Coriell Institute for Medical Research, 401 Haddon Avenue, Camden, NJ 08103. Fax: 609-964-0254. Email: [email protected]. 3 Abbreviations used: PCR, polymerase chain reaction; dNTP, deoxynucleotidetriphosphate; RSP, regular specific primer; NSP, nested specific primer; PBGD, porphobilinogen deaminase; OTF3, octamer-binding transcription factor 3; ERBB2, erythroblastic leukemia viral oncogene; DTE, dithioerythritol. ANALYTICAL BIOCHEMISTRY
scribed is quite complicated. With this procedure, the size of the fragment containing the target sequence in the genomic DNA digested with a restriction enzyme is determined by Southern analysis. The sample used for PCR is prepared by fractionating the digested genomic DNA with gel electrophoresis and excising the gel slices containing DNA fragments in the desirable size range. Although such an enrichment of target DNA was shown to enhance the amplification specificity, a large amount of genomic DNA is required as starting material. In this paper, we show that these complicated steps can be avoided by including a second round of amplification with hemi-nested primers. We also show that 20 ng of genomic DNA is sufficient for obtaining highly specific PCR product. With this improved protocol we successfully amplified five DNA regions at the porphobilinogen deaminase (PBGD, sequence with accession No. M18799 in GenBank deposited by Romeo), octamer-binding transcription factor 3 (OTF3, Ref. 22), erythroblastic leukemia viral oncogene (ERBB2, Ref. 23) gene loci, and two regions flanking the human VH genes 3-1 and 8-2, respectively (Li and Hood, unpublished data). Material and Methods Ligation. After phenol extraction and ethanol precipitation 400 ng PstI-digested human genomic DNA was dissolved in 10 ml of ddH2O. Six microliters (240 ng) of the digest was ligated to an oligonucleotide, PstL (5*AGCGTTGACAGCCAGGTGCA3*) containing a 3* four-base sequence complementary to the 3*-overhanging sequence of the PstI terminus (Fig. 1). Ligation was performed at 167C overnight in a 15-ml solution containing 11 ligation buffer (66 mM Tris–HCl, pH 7.5, 5 mM MgCl2 , 1 mM DTE, and 1 mM ATP, supplied with T4 ligase, Boehringer Mannheim), 0.2 mM PstL, and 1 unit T4 DNA ligase. Specific primers. For each locus, one regular specific primer (RSP) and one nested specific primer (NSP) were used. These primers were ERB2O (RSP, 5*TCAGCTCCGTCTCTTTCAGG3*) and ERB2P (NSP, 5* acgagtcacgttgtcgcaggGGGGGTGGTGGGTCAGTG3*) for amplifying a region at the ERBB2 locus on chromosome 17; OTF3O (RSP, 5*GTAGTCCTTTGTTACATGCA3*) and OTF3P (NSP, 5*ggtcgtggacactctacaggGTGGGCAGCTTGGAAGGCACA3*) for a region at the OTF3 locus on chromosome 6; PBGDO (RSP, 5*GTCCAGAAGCCCAAAGTGTG3*) and PBGDP (NSP, 5*tgactctgatggtacagtggCCCCCGGCCCCGGGAAGtCG3*) for a region at the PBGD locus on chromosome 11; S4M8 (RSP, 5*GTGCCGTGCACCCACCACACTC3*) and S4M11 (NSP, 5*ATAGTGACTCCCACAATTCTGTATCC3*) for a region at the VH 3-1 gene locus; and S5M1 (RSP, 5*ATTGGCAGAGACACACTGGGAC3*) and S5M4 (NSP, 5*GCAGAAATTCAGGTATTAGTGAAA-
231, 449–452 (1995)
0003-2697/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4314$$nat
10-13-95 16:04:50
abnt
449
AP-Anal Bio
450
NOTES & TIPS
ACC3*) at the VH 8-2 gene locus. Since primers for the ERBB2, OTF3, and PBGD loci were originally designed for another study (Lin, Cui, and Li, unpublished work), the sequences in lower case were not genomic sequences and were not necessary for this study. The third nucleotide ‘‘t’’ from the 3*-end of PBGDP mismatches the template and was designed for another purpose in the original study. Normally, it should be a ‘‘C.’’ PCR. Each PCR sample contained 11 PCR buffer (100 mM Tris–HCl, pH 8.3, 50 mM KCl, 2.5 mM MgCl2 , and 0.1 mg/ml gelatin), 1 unit of Taq DNA polymerase, 0.2 mM of each primer, and 20 ng DNA in a final volume of 50 ml. Amplification was performed on a DNA Thermal Cycler 480 (Perkin–Elmer). In the first round, the samples were incubated at 947C for 2 min to denature DNA template before adding the Taq DNA polymerase. In the second round, 2 ml of the first-round PCR product was reamplified with corresponding primers. The thermal profile was 947C, 1 min; 607C, 1 min; and 727C, 1 min for each cycle and 35 cycles for each round. The PCR products were analyzed by 7% PAGE and visualized under uv light after ethidium bromide staining. Results and Discussion The scheme of single-site PCR through ligation between a single oligonucleotide (PstL) and the PstI site is illustrated in Fig. 1. According to this procedure, PstL was ligated to the 5*-recessed ends of both strands of every PstI restriction fragment generated by digesting human genomic DNA. The ligation was facilitated by (i) the complementarity between the four bases at the 3*-end of PstL and the 3*-overhanging sequence of the PstI termini; (ii) the 5* phosphate group on each DNA strand generated by PstI digestion which eliminated the need of phosphorylation when ligated with PstL containing a 3* hydroxide group; and (iii) a high concentration (0.2 mM) of PstL so that each PstI terminus was surrounded by 106 PstL molecules and therefore circularization and/or self-ligation of the PstI fragments was minimized. The ligation was so efficient that 20 ng of genomic DNA could be used as starting materials for PCR. Ligation of PstL to the PstI termini converted these 3*-protrudent termini into 5*-protrudent with PstL as the overhanging sequence. In the regular procedure, PCR samples are prepared at room temperature and brought to a high temperature to denature the DNA template in the beginning of the first PCR cycle. During such a process the sequence complementary to PstL can be synthesized at all termini of the fragments with the 5*-overhanging PstL if all PCR reagents are present. If this occurs, PstL cannot be used as a PCR primer for specific amplification because the newly synthesized complementary sequence can be used as an anchor sequence by PstL
/ m4314$$nat
10-13-95 16:04:50
abnt
FIG. 1. Schematic illustration of single-site PCR through single oligonucleotide ligation. Known sequence is shown as grey boxes. (1) Ligation; (2) DNA template denaturation, adding the Taq polymerase, and RSP annealing; (3) PCR cycles of the first round; (4) denaturation and NSP annealing steps during the second round of PCR; and (5) PCR cycles of the second round.
and a large amount of nonspecific sequences will be amplified. To solve this problem, the Taq polymerase was not included until the samples with all other reagents were denatured at 947C. Denaturation before formation of the PstL anchor sequence was a key step for specific amplification with PstL because only 20 ng genomic DNA was used in each reaction and, once denatured, reannealing of the genomic sequence will be a very slow process and virtually impossible for most sequences during the 1-min annealing step in each cycle. Without reannealing, the PstL anchor sequence cannot be synthesized on these sequences. On the other hand, the RSP was included in the reaction at a high concentration (0.2 mM); its quick annealing to the specific template and extension resulted in synthesis of the target sequence flanked by RSP and the PstL anchor sequence, which in turn is used as template for further specific amplification with both RSP and PstL. Because only one of the two PCR primers is specific, reduced specificity has been a major problem associated with many single-site PCR protocols compared to the amplification with two specific primers. Heavy backgrounds were also associated with a significant portion of the PCR products generated with the procedure described above (data not shown). However, we showed that the backgrounds can be reduced to very
AP-Anal Bio
NOTES & TIPS
FIG. 2. Amplification of DNA fragments at five gene loci by singlesite PCR through single oligonucleotide ligation. Five microliters of each PCR product from the second-round PCR was subjected to PAGE with a 7% gel. The gel was stained with ethidium bromide and photographed under uv illumination. The size (in base pairs) of the final PCR product for each locus is indicated on the right. S, specific primers only; PS, specific primers / PstL; P, PstL only; and M, 1-kb DNA ladder as molecular size markers.
low levels by reamplifying the PCR products with PstL and corresponding NSPs (Fig. 2). The results in Fig. 2 indicate that the nonspecific background sequences were mainly generated from the amplification of nonspecific annealing between the genomic sequences and the primers used in the first round, rather than from the amplification of the fragments with PstL anchor sequence at both termini. If the latter were the case, the backgrounds would not be reduced significantly by using NSRs. With this improved procedure we successfully amplified the DNA regions at five gene loci: PBGD, OTF3, ERBB2, and two VH gene loci, 3-1 and 8-2. According to the known sequences, the final PCR products from these loci should be 513, 713, 401, 199, and 121 bp, respectively. As shown in Fig. 2, fragments with the expected length were observed clearly after gel electrophoresis and ethidium bromide staining. The high degree of amplification specificity was also proved by the fact that no amplifications were detected with either RSP/NSP or PstL alone (Fig. 2, lanes P and S) used as primer. Because of the high degree of specificity, we showed that the PCR products amplified by this procedure could be used directly for sequence analysis without molecular cloning (data not shown). The single-site PCR strategy described above is limited to using enzymes generating termini with 3*-overhanging sequences. However, this may not limit the application of this method because the possible limitations associated with restriction enzymes in single-site PCR are the length of the recognition sequences and the number of commercially available enzymes but not the types of termini they generate. Statistically, under the assumptions that the digested sequence consists of equal numbers of the four bases and the four bases are distributed randomly, the average length of the fragments generated by a four-base cutter is 44 Å 256 bp and 1024, 4096, 16,384, and 65,536 bp for five-, six-, seven, and eight-base cutters, respectively. Al-
/ m4314$$nat
10-13-95 16:04:50
abnt
451
though these numbers may vary in practice, they help in predicting the length range of the resulting fragments. When the fragment containing the known sequence is too long or too short, more restriction enzymes need to be tested for generating the fragment in desirable length. Based on the average length (4096 bp) of the resulting fragments, an enzyme could be identified among about 4 six-base cutters for generating a fragment of Ç1000 bp that could be used for PCR. Because more than 10 six-base cutters and 3 four-base cutters generating fragments with 3*-overhanging sequences are commercially available, the limitation of only using the enzymes generating termini with 3*overhanging sequences may not limit the application of the method described in this paper. Acknowledgments. The authors thank Drs. David P. Beck and Lorraine H. Toji for their comments on the manuscript. This work was supported in part by an institutional grant from the Coriell Institute and the Emlen Stokes Chair in Genetics for HL.
REFERENCES 1. Triglia, T., Peterson, M. G., and Kemp, D. J. (1988) Nucleic Acids Res. 16, 8186. 2. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. USA 85, 8998–9002. 3. Ochman, H., Gerber, A. S., and Hartl, D. L. (1988) Genetics 120, 621–623. 4. Pfeifer, G. P., Steigerwald, S. D., Mueller, P. R., Wold, B., and Riggs, A. D. (1989) Science 246, 810–813. 5. Shyamala, V., and Ames, G. F.-L. (1989) Gene 84, 1–8. 6. Silver, J., and Keerikatte, V. (1989) J. Virol. 63, 1924–1928. 7. Loh, E. Y., Elliott, J. F., Cwirla, S., Lanier, L. L., and Davis, M. M. (1989) Science 243, 217–220. 8. Mueller, P. R., and Wold, B. (1989) Science 246, 780–786. 9. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990) Nucleic Acids Res. 18, 2887–2890. 10. Fors, L., Saavedra, R. A., and Hood, L. (1990) Nucleic Acids Res. 18, 2793–2799. 11. Roux, K. H., and Dhanarajan, P. (1990) Biotechniques 8, 48–57. 12. Steigerwald, S. D., Pfeifer, G. P., and Riggs, A. D. (1990) Nucleic Acids Res. 18, 1435–1439. 13. Rosenthal, A., and Jones, D. S. (1990) Nucleic Acids Res. 18, 3095–3096. 14. Collasius, M., Puchta, H., Schlenker, S., and Valet, G. (1991) J. Virol. Methods 32, 115–119. 15. MacGregor, G. R., and Overbeek, P. A. (1991) PCR Methods Appl. 1, 129–135. 16. Raineri, I., Moroni, C., and Senn, H. P. (1991) Nucleic Acids Res. 19, 4010. 17. Troutt, A. B., McHeyzer-Williams, M. G., Pulendran, B., and Nossal, G. J. (1992) Proc. Natl. Acad. Sci. USA 89, 9823–9825. 18. Jones, D. H., and Winistorfer, S. C. (1992) Nucleic Acids Res. 20, 595–600. 19. Gibson, R. A., Buchwald, M., Roberts, R. G., and Mathew, C. G. (1993) Hum. Mol. Genet. 2, 35–38. 20. Pfeifer, G. P., Drouin, R., and Holmquist, G. P. (1993) Mut. Res. 288, 39–46.
AP-Anal Bio
452
NOTES & TIPS
21. Luo, M., and Cella, R. (1994) Gene 140, 59–62. 22. Takeda, J., Seino, S., and Bell, G. I. (1992) Nucleic Acids Res. 20, 4613–4620. 23. Coussens, L., Yang-Feng, T. L., Liao, Y.-C., Chen, E., Gray, A., McGrath, J., Seeburg, P. H., Libermann, T. A., Schlessinger, J., Francke, U., Levinson, A., and Ullrich, A. (1985) Science 230, 1132–1139.
Spectroscopic Aqueous-Phase Assay for Alkylating Activity Suitable for Automation or Multiwell Plate Application P. G. Penketh, K. Shyam, and A. C. Sartorelli1 Department of Pharmacology and Developmental Therapeutics Program, Cancer Center, Yale University School of Medicine, New Haven, Connecticut 06520
Received June 20, 1995
Determination of the alkylating activity of existing antineoplastic agents under various conditions, or of newly developed biologically or chemically activated prodrugs, constitutes a frequent experimental requirement. Moreover, it is often desirable to detect the presence of an alkylating species in largely aqueous media in the presence of living cells or biological components. Experimental protocols employing highly aqueous media should allow decomposition mechanisms and nucleophile selectivity to more accurately reflect the in vivo situation than systems utilizing organic solvents, since solvent polarity can strongly influence both the reaction mechanism and the nucleophile preference of many alkylating agents (1). The relatively low concentration of water found in some assay systems may produce a deceptively high signal due to the diminished concentration of this competing nucleophile. The most commonly used colorimetric assays for alkylating activity are those that utilize 4-(4-nitrobenzyl)pyridine (NBP)2 as a nucleophile. Koenigs et al. in 1925 first reported the production of a blue dye when the product of the reaction of NBP with methyl iodide was treated with potassium hydroxide (2). The product (A) was assigned the following structure: 1 To whom correspondence should be addressed. Fax: (203) 7372045. 2 Abbreviations used: NBP, 4-(4-nitrobenzyl)pyridine; BCH, 1,2bis(methylsulfonyl)-1-(2-chloroethyl)hydrazine; HPbCD, hydroxypropyl b-cyclodextrin; BCNU, 1,3-bis(2-chloroethyl)-1-nitrosourea; aTG, a-thioglycerol.
ANALYTICAL BIOCHEMISTRY
Compound A is presumably generated as a result of the following reaction sequence:
Compound A is relatively unstable, has low aqueous solubility, and produces a strong purple/blue solution when dissolved in most organic solvents. This chromophoric reaction has been employed to evaluate a variety of alkylating agents, including mustard gas and ethylenimines (3). Wheeler and Chumley (4) used a slight modification of the method described by Epstein et al. (3) to study the alkylating activity of various clinically relevant antineoplastic haloethyl and methylnitrosoureas and related compounds. Since this time the Wheeler and Chumley protocol has become the standard assay procedure for the determination of the alkylating activity of antineoplastic agents. The Wheeler and Chumley protocol utilizes a mixture of 2 ml of water, 1 ml of acetate buffer (0.025 M, pH 6.0), 1 ml of acetone containing the suspected alkylating agent, and 0.4 ml of a 5% (w/v) solution of NBP in acetone. When the reaction is complete 2 ml of acetone, 5 ml of ethyl acetate, and 1.5 ml of 0.25 M NaOH are added. The addition of the NaOH raises the pH to approximately 12.5. This mixture is then processed very rapidly in subdued light owing to the instability of the colored product. The mixture is shaken, then centrifuged (both for defined brief periods) and a portion of the upper phase removed and the absorbancy at 540 nm is determined versus a reagent blank. The absorbancy is taken at a defined time interval after the initiation of the work-up procedure to ensure reproducible results. A number of variations on this protocol have been described. In some cases, decreased concentrations of NBP have been used in largely aqueous media (necessitated by the low solubility of NBP in water); these protocols still require a rapid work-up procedure involving organic solvents and phase separation (5). The major disadvantages of these protocols are (a) the use of nonaqueous solvents during the reaction of the alkylating agent and nucleophile (some procedures only); (b) the necessity for centrifugation and phase separation steps (all current procedures); and (c) the lack of chromophore stability (most methods). The stability of the chromophore is highly dependent upon its environment. In the standard Wheeler/Chum-
231, 452–455 (1995)
0003-2697/95 $12.00 Copyright q 1995 by Academic Press, Inc. All rights of reproduction in any form reserved.
/ m4314$$nat
10-13-95 16:04:50
abnt
AP-Anal Bio