SIRT1 and TOR signaling pathway of Megalobrama amblycephala

Aquaculture 510 (2019) 225–233

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Replacing fish meal with cottonseed meal protein hydrolysate affects amino acid metabolism via AMPK/SIRT1 and TOR signaling pathway of Megalobrama amblycephala

T

Xiang-Yang Yuana, Ming-Yang Liub, Hui-Hui Chenga, Yang-Yang Huanga, Yong-Jun Daia, ⁎ Wen-Bin Liua, Guang-Zhen Jianga, a

Key Laboratory of Aquatic Nutrition and Feed Science of Jiangsu Province, College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095, PR China Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China

b

A R T I C LE I N FO

A B S T R A C T

Keywords: Cottonseed meal protein hydrolysate Amino acids metabolism TOR signaling pathway AMPK/SIRT1 pathway Megalobrama amblycephala

This study was conducted to evaluate effects of replacing fish meal with cottonseed meal protein hydrolysate (CPH) on amino acid metabolism of Megalobrama amblycephala. Fish (38.66 ± 0.08 g) were randomly divided into five groups and fed five isonitrogenous (320 g kg−1 crude protein) and isocaloric (17.8 MJ kg−1 gross energy) diets replacing fish meal by CPH 0% (CPH 0), 1% (CPH 1), 3% (CPH 3), 5% (CPH 5) and 7% (CPH 7). Dietary 3% CPH had no effect on plasma aspartate aminotransferase (AST), alanine aminotransferase (ALT), succinate dehydrogenase (SDH) and xanthine oxidase (XOD) contents and liver SDH and XOD (P > 0.05), but significantly increased hepatic AST and ALT contents (P < 0.05). The plasma threonine (Thr), valine (Val), lysine (Lys), histidine (His), total essential amino acids and total amino acids contents of fish fed CPH5 and CPH7 diets significantly decreased (P < 0.05) compared with the control diet. Meanwhile, threonine (Thr), valine (Val), isoleucine (Ile) and leucine (Leu) contents in muscle significantly decreased (P < 0.05) when fish fed CPH7 diet. Diets with 5% and 7% CPH significantly decreased target of rapamycin (TOR) and S6 kinase-polypeptide 1 (S6K1) mRNA expressions levels in liver and gut, but increased eukaryotic translation initiation factor 4E-binding protein 2 (4E-BP2) mRNA expression levels (P < 0.05), as well as increased hepatic AMP-activated protein kinase α1 (AMPKa-1), AMP-activated protein kinase α2 (AMPKa-2) and sirtuin-1 (SIRT-1) mRNA expressions levels. Furthermore, the AMP-activated protein kinase α (t-AMPKα) and phospho-AMPKα (p-AMPKα) protein contents were increased significantly in fish fed with 5% and 7% CPH over the control group (P < 0.05). Overall, replacing fish meal with CPH at high level (5 and 7%) decreased the amino acid metabolism and growth performance, as well as inhibited ATP consumption via inhibiting TOR signaling pathway and activating AMPK/ SIRT1 pathway.

1. Introduction In aquaculture, fish meal (FM) is a kind of major dietary protein source (Hussein and Jordan, 1991; Lu et al., 2015). However, increasing demand, escalating price and unpredictable supply of fish meal (Khajepour and Hossein, 2012) has made it difficult to meet the growing production demand in the aquafeed industry. Besides, excessive use of fish meal could result in a series of environmental problems. In this context, replacing fish meal with plant-based protein source (Regost et al., 1999; Hernandez et al., 2007) has been a hot spot in recent years.

Cottonseed meal is an important plant protein source in traditional oriental diets (Robinson, 2006). The yield of cottonseed estimated at 45.5 million tones around the world in 2013 according to the data reported by Food and Agricultural Organization of the United Nations (FAO) (2014). Many studies have evaluated cottonseed meal as a substitute to fish meal in parrot fish (Oplegnathus fasciatus) (Lim and Lee, 2009), rainbow trout (Oncorhynchus mykiss) (Cheng and Hardy, 2002) and Nile tilapia (Oreochromis niloticus) (Yue and Zhou, 2008). However, the antinutritional factors in the cottonseed meal limited its use in aquaculture feeds. With development of the modern food processing technologies, cottonseed meal protein hydrolysate (CPH) was obtained

⁎ Corresponding author at: Key Laboratory of Aquatic Nutrition and Feed Science of Jiangsu Province, College of Animal Science and Technology, Nanjing Agricultural University, No. 1 Weigang Road, Nanjing 210095, Jiangsu Province, PR China. E-mail address: [email protected] (G.-Z. Jiang).

https://doi.org/10.1016/j.aquaculture.2019.05.056 Received 26 November 2018; Received in revised form 24 April 2019; Accepted 23 May 2019 Available online 24 May 2019 0044-8486/ © 2019 Elsevier B.V. All rights reserved.

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

through enzymatic hydrolysis, which is a mixture of amino acids and peptides (Gui et al., 2010). To date, some studies found that plant protein hydrolysate caused changes of plasma free amino acids and amino acids in muscle, such as soy protein hydrolysate (Song et al., 2014) and whey protein hydrolysate (Kanda et al., 2013). However, information on the mechanism of protein hydrolysates on amino acids metabolism in fish is still barely understood. Therefore, the present study explored the mechanism of CPH on amino acids metabolism in blunt snout bream (Megalobrama amblycephala). Amino acids were produced by the decomposition of food and body protein (Jürss and Bastrop, 1995), and food protein was the main source of amino acids. Therefore, dietary amino acid deficiency or excess could affect growth and metabolism, such as in European seabass (Dicentrarchus labrax) (Tibaldi and Kaushik, 2005), catfish (Parasilurus asotus) (Robinson et al., 1984) and rat (Klavins, 1965). In turn, amino acids are also considered as signaling molecules involved in the regulation of cellular growth and metabolism (Skiba-Cassy et al., 2016). In fish, it is generally considered that amino acids mainly act through two distinct nutrient sensing cascades: the mechanistic target of rapamycin (mTOR) and the amino acid response pathways. Integration of signals triggered by both growth factors (insulin/insulin like growth factors) and amino acids are necessary to activate mTOR complex 1(mTORC1) (Skiba-Cassy et al., 2016). Besides their role in protein synthesis, amino acids also take part in cellular metabolism, cell proliferation, differentiation, migration and metabolism. Recently, more studies on the fish have focused on the amino acid requirement and supplementation, especially on glutamine (Coutinho et al., 2016), methionine (Harding et al., 1977), phenylalanine and tyrosine (Robinson et al., 1980) and so on. However, studies on the effects of dietary protein variation on amino acid metabolism are quite few. Protein synthesis is a process of energy consuming (Lobley, 1990). The AMP-activated protein kinase (AMPK), an evolutionary conserved serine/threonine protein kinase, plays a vital important role in maintaining the cellular energy homeostasis (Foretz and Viollet, 2011). Some previous studies have showed that AMPK could be activated by cellular energy stress (Appuhamy et al., 2014). Once activated, AMPK inhibits ATP consuming processes such as protein synthesis while enhancing ATP producing processes such as fatty acid oxidation and glucose uptake, one of the targets inhibited by activated AMPK is mTOR (Kudchodkar et al., 2007). Indeed, in mammals, it was reported that activation of AMPK repressed global protein synthesis via inhibition of mTOR signals (Burgos et al., 2013). Besides, Safayi and Nielsen (2013) founded that N balance differences could lead to differential glucose. Therefore, examining the impact of the energy sensing and TOR signaling pathway on amino acid metabolism would be more beneficial to understanding N balance. However, the study on metabolic mechanism in amino acid among fish species is not still fully understood. Blunt snout bream, also known as Wuchang bream, is one of the most important economic freshwater fish in China. The culture of this species is highly dependent on artificial diets, while the largescale utilization of the fishmeal-based diets led to water pollution. Therefore, it is quite urgent to find an alternative protein source to replace dietary fish meal. However, few studies were focused on effects of fish meal substitution on amino acid metabolism. The present study aimed to evaluate mechanism of fish meal replacement on amino acid metabolism via AMPK/SIRT1 pathway and TOR signaling pathway.

Table 1 Essential amino acids of fish meal (FM) and cottonseed meal protein hydrolysate (CPH) (g kg−1). Essential amino acids (g kg−1, dry-matter basis)

FM

CPH

Argnine

Arg

39.15

62.77

Histidine Lysine Isoleucine Leucine Methionine Phenylalanine Threonine Valine

His Lys Ile Leu Met Phe Thr Val

17.84 48.72 27.11 52.22 17.58 29.56 30.15 31.50

14.48 20.04 15.02 29.59 8.85 30.09 16.71 21.78

2.2. CPH and diets AS1.398 neutral protease (Yuancheng Group Co., Ltd., Nanjing, China) was applied in this experiment. The enzymatic hydrolysis of cottonseed meal protein was carried out at 40 °C and pH 7.0 for 5 h at an enzyme/substrate ratio of 2500 IU g−1. At the end of hydrolysis, the enzymatic hydrolysis was suspended by heating at 95 °C for 10 min. Then, cottonseed meal protein hydrolysate (CPH) freeze-dried (Song et al., 2014). Essential amino acid profiles of fish meal and CPH were presented in Table 1. In addition, previous study in our laboratory showed that (1) Relative molecular mass distribution of CM: amino acids (74–180 Da): 3.2%, small peptides (180–1983 Da): 1.9%, proteins (1893–21,828 Da): 5.2%. (2) Relative molecular mass distribution of CPH: amino acids (74–180 Da): 5.1%, small peptides (180–1983 Da): 13.4%, proteins (1893–21,828 Da): 4.9% (Gui et al., 2010). The basal diet was composed of 6.0% fish meal, 0.0% CPH, 21.0% soybean meal, 15.0% rapeseed meal, 16.0% cottonseed meal, 33.8% wheat flour, 2.5% fish oil, 2.5% soybean oil, 1.8% Ca(H2PO4)2, 1.0% premix, 0.3% salt and 0.1% choline. Crude protein (%), crude lipid (%), moisture (%) and energy (MJ kg−1) of the basal diet were 32.51, 6.54, 9.01 and 17.82, respectively. Four treatment diets replacing fish meal by 1% (CPH1), 3% (CPH3), 5% (CPH5) and 7% CPH (CPH7), respectively, were formulated. Five experimental diets were isonitrogenous (320 g kg−1 crude protein) and isoenergetic (17.8 MJ kg−1 gross energy). Fish meal, soybean meal, cottonseed meal and rapeseed meal were served as protein sources. Fish oil and soybean oil were used as the lipid source. All the ingredients were ground into powder and thoroughly mixed, then blended with oil (fish oil and soybean oil) and water to form a soft dough which was pelleted using a Pillet Mill (Guangyuan Engineering Co., Ltd., Shandong, China) with a 2 mm diameter. The feed was dried at air temperature at 28 °C overnight and sealed in plastic bags at −4 °C until use.

2.3. Fish and feeding trial Blunt snout bream juveniles were obtained from the fish hatchery of Freshwater Fisheries Research Institute of Jiangsu province (Nanjing, China). Experimental fish were fed with a basal diet for two weeks to acclimate the experimental condition before the beginning of experiments. After the acclimation, 300 healthy fish of similar sizes (average initial weight 38.66 ± 0.08 g) were randomly distributed into 20 floating net cages (Length × Width × Height: 1.0 × 1.0 × 1.7 m) at a rate of 15 fish per cage. Fish were assigned one of five experimental diets. Each diet was tested in four replicates. All fish were hand-fed to apparent satiation three times daily (7:30 am, 12:00 am and 4:30 pm) for 8 weeks. Fish were held under natural photoperiod condition throughout the feeding trial. Water temperature was 26 ± 3 °C, pH was from 6.5 to 7.5, dissolved oxygen was maintained approximately at 5.0 mg L−1 and total ammonia nitrogen < 0.04 mg L−1.

2. Material and method 2.1. Ethics statement In this study, the experiment was conducted according to the ethical requirements and recommendations for animal care of Key Laboratory of Aquatic Nutrition and Feed Science of Jiangsu Province. All experimental procedures involving animals were conducted following the guidelines for the Care and Use of Laboratory Animals in China. 226

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

Table 2 Primer sequences of housekeeping gene and target genes. Gene

Sense

Anti-sense

Reference

EF-1α TOR 4E-BP2 S6K1 AMPKα1 AMPKα2 SIRT1

CTTCTCAGGCTGACTGTGC TTTACACGAGCAAGTCTACGGA ATGTCGTCCAGTCGTCAGTTT GGTGCATGTCACCTTATGGG AGTTGGACGAGAAGGAG ACAGCCCTAAGGCACGATG TCGGTTCATTCAGCAGCACA

CCGCTAGCATTACCCTCC CTTCATCTTGGCTCAGCTCTCT AGGAGTGGTGCAATAGTCGTG AGCTGGCAGCACTTCTAGTC AGGGCATACAAAATCAC TGGGTCGGGTAGTGTTGAG ATGATGATCTGCCACAGCGT

×77,689.1 Q.-L. Zhou et al., 2012 Q.-L. Zhou et al., 2012 Q.-L. Zhou et al., 2012 KX061840.1 KX061841.1 Gao et al., 2012

EF-1α, elongation factor 1 alpha; TOR, target of rapamycin; 4E-BP2, eukaryotic translation initiation factor 4E-binding protein 2; S6K1, S6 kinase-polypeptide 1; AMPKα1, AMP-activated protein kinase α1; AMPKα2, AMP-activated protein kinase α2; SIRT1, sirtuin-1.

5 min, and then centrifuged at 12,000 rpm/min for 15 min. The supernatant was passed through a 0.22 μm filter for amino acid analysis using automated amino acid analyzer (Xu et al., 2016).

2.4. Sample collection and analysis 2.4.1. Sampling At the end of the 8-week feeding trial, experimental fish were fasted for 24 h prior to sampling. Three fish from each cage were anesthetized using MS-222 (tricaine methane sulfonate, Sigma, USA) at a concentration of 150 mg L−1. Blood samples were immediately collected from the caudal vein using a heparinized syringe, and then centrifuged at 3000 rpm/min, 4 °C for 10 min. The samples were stored at −80 °C until analysis. After blood collection, the liver, gut and muscle of the juvenile blunt snout bream were quickly removed (placed on ice) and then stored at −80 °C until further analysis.

2.4.5. Total RNA extraction, reverse transcription and real-time PCR Total RNA was extracted from individual liver and gut using Trizol Reagent (Sigma) and treated by RQ1 RNase-free DNase (Takara Co. Ltd., Japan) to eliminate genomic DNA contamination. The quality of the isolated RNA samples was assessed by electrophoresis in 1.0% formaldehyde denaturing agarose gel. The RNA generally was purified when their OD260/OD280 ratio was between 1.8 and 2.0. After RNA extraction, the first-strand cDNA was synthesised using reverse transcription kit (PrimeScripte RT Master Mix, Takara, Japan). The reaction mixture volume contains 2 μL buffer (5×), 0.5 μL dNTP mixture (10 mM each), 0.25 μL RNase inhibitor (40 U μL−1), 0.5 μL dT-AP primer (50 mM), 0.25 μL ExScript™ RTase (200 U μL−1) and 6.5 μL DEPC water. Primers (Table 2) were designed using the Primer 5.0 program. All the primers for the real-time PCR analysis were synthesised by Shanghai Generay Biotech Co., Ltd., Shanghai, China. The cDNA was synthesised using RT-PCR Kit (Takara, Japan). The PCR reaction condition was as follows: 40 cycles of 95 °C for 5 s, 60 °C for 30 s, followed by a melt curve analysis of 15 s from 95 to 60 °C, 1 m for 60 °C and then up to 95 °C for 15 s. EF-1α gene was chosen as an internal standard. The genes relative expression levels were determined by the 2-ΔΔct method (Livak and Schmittgen, 2001).

2.4.2. Growth performance and proximate compositions analysis Daily growth index (DGI): [(Wf 1/3 - Wo 1/3)/(time in days)] × 100. Average body weight (ABW): (Wo + Wf)/2. Thermal-unit growth coefficient (TGC): (W1/3 f-W1/3 o) × 100/ (∑n i = 1 Ti) (Dumas et al., 2007) where Wf and Wo are final and initial body weight, respectively, of fish in units of g, n (=1.2, …) is the day number recorded from Wo, and Ti (°C) is mean daily water temperature. Moisture, crude protein, crude lipid, gross energy and ash were determined according to the AOAC (AOAC, 1995). Moisture was measured by oven at 105 °C until constant weight; Crude protein was determined by the micro-Kjeldahl method using an Auto Kjeldahl System (2300; FOSS Tector, Hoganas, Sweden); Crude lipid was analyzed by solvent extraction using a Soxtec System (Soxtec System HT6, Sweden); Gross energy was measured using a Bomb Calorimeter (Parr 1281; Parr Instrument Company, USA); Ash was analyzed by combustion at 550 °C for 4 h.

2.4.6. Western blot Total protein of samples was extracted from the liver using RIPA lysis buffer according to the manufacturer's direction. Then, these samples were centrifuged at 12000 rpm/ min, 4 °C for 15 min. The supernatant was collected for protein concentration analysis. The protein concentration was determined using a Bio-Rad protein assay kit (BioRad Laboratories, Munich, Germany). Proteins of samples were separated by sodium dodecyl sulfatepolyacrylamide gel electrophoresis for almost 1 h at 100 V. After that, the proteins were transferred to polyvinylidene fluoride membranes (Millipore, Danvers, MA, United States). The specific primary antibodies used were anti-GAPDH (BM3873, Boster, China, 1:5000 dilution), anti-AMPKα (#2532, Cell Signaling Technology, United States, 1:2000 dilution and anti-phospho-AMPKa (#2535, Cell Signaling Technology, United States, 1:2000 dilution). Then PVDF membranes were washed and incubated with anti-rabbit (#7074, Cell Signaling Technology, United States, 1:2000 dilution) secondary antibody for 2 h at room temperature. Finally, immune complexes were visualized with a luminescent image analyzer (Fujifilm LAS-3000, Japan) were quantified by Image J 1.44p (United States National Institutes of Health, Bethesda, MD, United States).

2.4.3. Enzymes activity assay Activities of aspartate aminotransferase (AST) and alanine aminotransferase (ALT) were measured by enzymatic colorimetric methods according to the method of Rietman and Frankel (1957). Urea nitrogen was measured by the method of Paulson et al. (1971). The activities of succinate dehydrogenase (SDH) and xanthine oxidase (XOD) were determined according to the modified method of Srikantan and Krishnamoorthi (1955). 2.4.4. Amino acids and free amino acids contents analysis For the amino acid contents analysis, samples were hydrolyzed using 6 N HCl at 110 °C for 22 h, then the HCl was removed with nitrogen gas. The samples were redissolved in 0.1 N HCl loading buffer, and filtered through a 0.22 μm polyether sulphone ultrafiltration membrane. Finally, the samples were loaded on a high-performance liquid chromatography (HPLC) system (1100; Agilent Technologies, Inc., Santa Clara, CA, USA). Signals of amino acids were detected. Plasma samples were de-proteinized by thoroughly mixing with 10% sulfosalicylic acid solution, followed by incubation it at 4 °C for

2.5. Statistical analysis All data are presented as means ± S.E.M (standard error of the 227

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

Fig. 1. Replacing fish meal with CPH affected growth performance of blunt snout bream. Each data represents the means ± S.E.M of four replicates. Bars assigned with different letters are significantly different (P < 0.05). DGI, Daily growth index; ABW, Average body weight; TGC, thermal-unit growth coefficient. CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH.

mean). Data was analyzed using the SPSS program version 19.0 (SPSS Inc., Michigan Avenue, Chicago, IL, USA). Normality of the data and homogeneity of the variance were tested to ensure that the assumptions of analysis of variance (ANOVA) were satisfied using Levene's tests. If the variances were normally distributed, Tukey's HSD multiple range test was conducted to rank the means, the level of significant difference was set at P < 0.05.

Table 4 Hepatic amino acid metabolism parameters of blunt snout bream.

3. Results

CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH. AST, aspartate aminotransferase; ALT, alanine aminotransferase; SDH, succinate dehydrogenase; XOD, xanthine oxidase. Values are means ± S.E.M of four replications. Means in the same column with different superscripts are significantly different (P < .05).

Group

AST (U/g)

CPH0 CPH1 CPH3 CPH5 CPH7

3.1. Growth performance As shown in Fig. 1, the ABW, TGC and DGI of fish were fed diets with 1% and 3% CPH was significantly higher than that of fish fed with 5% and 7% CPH (P < 0.05).

27.51 32.24 41.35 21.46 19.75

± ± ± ± ±

ALT (U/g) ab

1.90 1.23b 2.32c 0.72a 2.56a

a

6.47 ± 0.52 11.46 ± 1.19b 15.36 ± 0.74c 11.51 ± 0.47b 9.02 ± 0.17ab

SDH (U/mg)

XOD (U/g)

41.66 39.92 41.56 42.20 42.24

5.69 4.89 5.12 5.22 5.89

± ± ± ± ±

0.81 1.74 0.33 0.89 0.57

± ± ± ± ±

0.64 0.28 0.37 0.20 0.05

Table 3 Plasma amino acid metabolism parameters of blunt snout bream. Group

AST (U/L)

ALT (U/L)

UN (mmol/L)

CPH0 CPH1 CPH3 CPH5 CPH7

14.56 13.43 14.42 15.62 15.94

10.76 ± 0.74 9.56 ± 0.76 9.78 ± 0.89 10.53 ± 0.49 10.10 ± 0.72

21.33 22.20 19.98 15.63 14.11

± ± ± ± ±

1.13 0.46 1.47 1.39 0.93

± ± ± ± ±

0.50a 0.63a 0.57a 0.40b 0.29b

SDH (U/ml)

XOD (U/L)

6.37 5.33 5.67 7.27 6.67

2.60 3.01 2.54 2.13 2.60

± ± ± ± ±

0.75 0.59 0.30 0.37 0.33

± ± ± ± ±

0.33 0.61 0.27 0.14 0.05

CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH. AST, aspartate aminotransferase; ALT, alanine aminotransferase; UN, urea nitrogen; SDH, succinate dehydrogenase; XOD, xanthine oxidase. Values are means ± S.E.M of four replications. Means in the same column with different superscripts are significantly different (P < 0.05). 228

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

Table 5 Effects of replacing fish meal by CPH on plasma free amino acid contents of blunt snout bream (μg μL−1). Amino acids EAA Threonine Valine Methionine Isoleucine Leucine Phenylalanine Lysine Histidine Argnine Σ EAA Σ NEAA ΣAA

Thr Val Met Ile Leu Phe Lys His Arg

CPH0

CPH 1

CPH 3

CPH 5

CPH 7

39.09 ± 0.31a 46.24 ± 1.27a 22.91 ± 0.44 24.21 ± 1.15 56.93 ± 0.65 34.61 ± 0.37 34.31 ± 0.81a 12.94 ± 0.94b 19.26 ± 0.55 288.98 ± 1.02a 186.38 ± 2.48 475.36 ± 2.66a

37.89 ± 0.86a 44.78 ± 1.10a 23.09 ± 0.89 24.02 ± 0.66 57.83 ± 1.00 33.98 ± 0.99 26.70 ± 0.89bc 11.42 ± 0.56ab 19.49 ± 0.61 278.73 ± 2.60a 189.02 ± 0.68 469.75 ± 2.76a

37.34 ± 1.44a 45.61 ± 0.38a 22.26 ± 0.52 24.27 ± 0.69 56.96 ± 0.42 34.09 ± 1.14 28.00 ± 0.12c 11.15 ± 0.33ab 19.67 ± 0.71 278.35 ± 0.38a 188.77 ± 4.03 468.13 ± 3.78a

24.36 ± 2.40b 39.75 ± 0.44b 21.44 ± 0.33 23.72 ± 0.65 56.95 ± 1.28 32.92 ± 0.96 24.18 ± 0.91bd 9.31 ± 0.81a 18.17 ± 0.49 246.79 ± 3.11b 187.89 ± 2.88 438.68 ± 3.62b

23.30 ± 2.85b 39.18 ± 0.43b 21.35 ± 0.72 22.87 ± 0.85 55.25 ± 0.94 32.77 ± 0.14 22.99 ± 0.02d 9.37 ± 0.94a 19.47 ± 0.44 242.55 ± 3.32b 185.22 ± 1.77 431.78 ± 1.61b

Values are means ± S.E.M of four replications. Means in the same line with different superscripts are significantly different (P < .05). CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH. Σ EAA: Total essential amino acids. Σ NEAA: Total non-essential amino acids. ΣAA: Total amino acids.

increased (P < 0.05) the AMPKα-1, AMPKα-2 and SIRT-1 mRNA expressions levels compared with the control diet.

3.2. Biochemical assay in plasma and liver Amino acid metabolism parameters of plasma and liver in blunt snout bream are presented in Tables 3 and 4. Plasma AST and ALT contents were not affected by dietary CPH levels (P > 0.05). Hepatic AST and ALT contents significantly increased as dietary supplementation level of CPH increased up to 3% (P < 0.05), but decreased significantly as further increasing. Plasma UN contents of fish fed CPH5 and CPH7 diets significantly decreased compared to the control diet (P < 0.05). Moreover, dietary CPH supplementation did not affect SDH and XOD contents in plasma and liver (P > 0.05).

3.6. Hepatic protein expressions of AMPKa As can be seen from Fig. 5, fish fed the diets with 5% and 7% CPH obtained significantly (P < 0.05) higher t-AMPKα and p-AMPKα protein contents compared to the control group. 4. Discussions Previous study reported that TGC followed very closely the actual growth curves in different fish species, such as of rainbow trout (Oncorhynchus mykiss), lake trout (Salvelinus namaycush), brown trout (Salmo trutta L.), chinook salmon (Oncorhynchus tshawytscha) and Atlantic salmon (Salmo salar) (Cho, 1992). Thus, TGC could be as an indicator, which reflects growth performance of fish. In this study, the TGC of fish were fed diets with 1% and 3% CPH was significantly higher than that of fish fed with 5% and 7% CPH (P < 0.05). Furthermore, ABW and DGI of fish showed similar results. This indicated that replacing fish meal with CPH at high levels depressed the growth performance of juvenile blunt snout bream. This was reasonable since activation of AMPK inhibited the activation of TOR signaling pathway, depressed protein synthesis, thus resulted in poor growth of fish. This explanation could be further supported by the experiment of TOR signaling pathway and AMPK/ SIRT pathway in this study. Aspartate aminotransferase (ALT) and alanine aminotransferase (AST) are the most important aminotransferases in liver (Fynn-Aikins et al., 1995), which plays a crucial role in indications of tissue damage and amino acids metabolism in fish. In the present study, the plasma AST and ALT activities levels showed no statistical difference among all the treatments, which indicated that replacing fish meal with CPH made no burden on the liver function. A reasonable explanation is that plasma activities of ALT and AST elevated only when the liver was damaged (Li et al., 2014). Interestingly, hepatic AST and ALT contents significantly increased as dietary supplementation level of CPH increased up to 3% (P < 0.05), but decreased significantly as further increasing. This suggested that dietary CPH supplement at proper level enhanced amino acid metabolism of liver. This was due to that exceeding inclusion level of protein hydrolysates could result in saturation of peptide and amino acid in intestine (Zhang et al., 2002). Besides saturation of peptide transporters, previous study also confirmed that the transaminase activity enhanced with the increase of amino acid metabolism (Cheng et al., 2010; Luo et al., 2012). Similar results were

3.3. Amino acid profiles in plasma and muscle As can be seen in Table 5, the contents of Thr, Val, Lys, His, total essential amino acids and total amino acids in plasma of fish fed CPH5 and CPH7 diets significantly decreased (P < 0.05) compared with the control diet. No significant difference in plasma non-essential amino acids was showed (P > 0.05) among all the treatments. However, in the muscle (Table 6), replacing dietary fish meal with 7% CPH significantly decreased (P < 0.05) the contents of Thr, Val, Ile and Leu compared to the control diets. In addition, dietary CPH levels had no significant effects on composition of muscle, total essential amino acids and total non-essential amino acids (P > 0.05). 3.4. Relative expressions of TOR pathway genes in the liver and gut The relative expressions of TOR pathway genes in liver are showed in Fig. 2. The diets with 5% and 7% CPH significantly decreased the TOR and S6K1 mRNA expressions levels and increased the 4E-BP2 mRNA levels (P < 0.05) compared with the control diet. The relative expressions of TOR pathway genes in gut are presented in Fig. 3. Dietary 5% and 7% CPH significantly increased the 4E-BP2 mRNA levels and decreased the S6K1 mRNA expressions levels compared with the control diet. Meanwhile, the TOR mRNA level of fish fed the diet with 7% CPH was significantly lower than that of fish fed the control diet (P < 0.05). 3.5. Relative expressions of AMPK and SIRT-1 in the liver Relative expressions of AMPK and SIRT-1 in the liver are showed in Fig. 4. The diets with 1% and 3% CPH significantly decreased (P < 0.05) AMPKα-1 and SIRT-1 mRNA expressions levels compared with the control diet. However, dietary 5% and 7% CPH significantly 229

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

Table 6 Effects of replacing fish meal by CPH on proximate composition (% wet weight) and amino acid contents (g kg−1 of fresh weight) in muscle of blunt snout bream. Amino acids

CPH0

CPH 1

CPH 3

CPH 5

CPH 7

Proximate composition Moisture Crude Protein Crude lipid Ash

72.08 ± 0.36 17.43 ± 0.08 7.01 ± 0.33 3.48 ± 0.15

71.50 ± 0.28 18.14 ± 0.16 7.22 ± 0.17 3.68 ± 0.13

72.33 ± 0.33 18.29 ± 0.07 7.31 ± 0.09 3.76 ± 0.20

71.80 ± 0.31 18.06 ± 0.32 7.04 ± 0.23 3.35 ± 0.12

72.39 ± 0.18 17.69 ± 0.28 6.61 ± 0.43 3.57 ± 0.10

0.89 ± 0.00ab 0.95 ± 0.01a 0.58 ± 0.01 0.85 ± 0.00a 1.63 ± 0.01a 0.91 ± 0.01 1.71 ± 0.03 0.78 ± 0.02 1.18 ± 0.01 9.46 ± 0.09 9.50 ± 0.07 18.96 ± 0.92

0.89 ± 0.00a 0.95 ± 0.00a 0.58 ± 0.00 0.86 ± 0.00a 1.64 ± 0.00a 0.93 ± 0.01 1.76 ± 0.00 0.77 ± 0.01 1.18 ± 0.01 9.50 ± 0.02 9.41 ± 0.02 18.91 ± 1.02

0.88 ± 0.00abc 0.94 ± 0.01a 0.57 ± 0.00 0.85 ± 0.01a 1.61 ± 0.01ab 0.93 ± 0.01 1.74 ± 0.01 0.84 ± 0.01 1.17 ± 0.00 9.53 ± 0.04 9.42 ± 0.04 18.95 ± 0.84

0.88 ± 0.00bc 0.93 ± 0.01ab 0.57 ± 0.00 0.84 ± 0.00ab 1.60 ± 0.00ab 0.92 ± 0.01 1.73 ± 0.00 0.81 ± 0.02 1.16 ± 0.01 9.43 ± 0.01 9.36 ± 0.01 18.78 ± 0.71

0.87 ± 0.00c 0.91 ± 0.01b 0.56 ± 0.01 0.82 ± 0.01b 1.58 ± 0.02b 0.92 ± 0.01 1.72 ± 0.02 0.77 ± 0.04 1.16 ± 0.01 9.33 ± 0.10 9.43 ± 0.06 18.76 ± 0.67

EAA Threonine Valine Methionine Isoleucine Leucine Phenylalanine Lysine Histidine Argnine Σ EAA Σ NEAA ΣAA

Thr Val Met Ile Leu Phe Lys His Arg

Values are means ± S.E.M of four replications. Means in the same line with different superscripts are significantly different (P < .05). CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH. Σ EAA: Total essential amino acids. Σ NEAA: Total non-essential amino acids. ΣAA: Total amino acids.

Fig. 2. TOR pathway gene relative expression levels in the liver of blunt snout bream fed diets replacing fish meal with CPH. TOR, target of rapamycin; 4EBP2, eukaryotic initiation factor 4E binding protein 2; S6K1, ribosomal protein S6 kinase 1. Each data represents the means ± S.E.M of four replicates. Bars assigned with different letters are significantly different (P < 0.05). CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH.

Fig. 3. TOR pathway gene relative expression levels in the gut of blunt snout bream fed diets replacing fish meal with CPH. Each data represents the means ± S.E.M of four replicates. Bars assigned with different letters are significantly different (P < 0.05). TOR, target of rapamycin; 4E-BP2, eukaryotic initiation factor 4E binding protein 2; S6K1, ribosomal protein S6 kinase 1. CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH.

obtained by Je et al. (2013). Unlikely, the liver ALT and AST activities significantly declined when the juvenile starry flounders were fed the diet with 30% soy protein hydrolysates (Song et al., 2014). Therefore, further research should be carried out to clarify the mechanisms of bioactive peptides respond to amino acid metabolism in fish. Furthermore, it is well known that nitrogen derived from amino acid catabolism is excreted in the urine mainly in the form of urea (Okada and Suzuki, 1974) in mammals. Plasma UN contents significantly decreased when fish was fed with CPH5 and CPH7 diets, suggesting that dietary CPH supplement at high levels decreased amino acid catabolism, inhibited ATP consumption and thus maintained amino acid dynamic balance in fish. This explanation was also supported by following results of TOR signaling pathway and AMPK/ SIRT pathway. In addition, it is worth noting that dietary CPH supplementation had no effects on SDH and XOD contents in plasma and liver. SDH is a key inner mitochondrial membrane enzyme linked with the energy yielding

citric acid cycle in living cells (Atsushi Takeda et al., 2010), which has been used as a biochemical marker in inflammation (Naik et al., 1972). XOD is one of the enzymes involved in the generation of reactive oxygen species (ROS) and cause injury (Cuzzocrea et al., 1999). Therefore, this result was reasonable since an increase in SDH and COD activities were only observed inflammation (Ahmad et al., 2012). Plasma free amino acids have a strong correlation with protein quality in diet (Sunde et al., 2015). In the present study, the contents of Thr, Val, Lys, His, total essential amino acids and total amino acids in plasma of fish fed CPH5 and CPH7 diets significantly decreased (P < 0.05) compared to the control diet, indicating that replacing fish meal with CPH at high level decreased some of free amino acid contents in fish. This was possibly related to lower amino acid contents of CPH compared with fish meal. Therefore, supplementation of essential amino acids to the plant protein diets could increase plasma free amino acid levels (Regost et al., 1999). Similar observations have already been assessed in turbot (Scophthalmus maximus L.) (Xu et al., 2016).

230

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

acid, serine, glycine, and total indispensable amino acids in muscle of juvenile starry flounder (Song et al., 2014). Presently, studies on amino acid compositions of muscle were relatively few. Therefore, in order to find out an explanation to this result, TOR signaling pathway and AMPK/ SIRT-1 were determined in the experiment. In addition, replacing dietary fish meal with CPH had no effects on the proximate composition of fish muscle compared with the control diet (P > 0.05). This could be explained by the fact that, although the diets differed in the containing of fish meal and CPH, they were similar in terms of macronutrient composition, that is, they were isonitrogenous and isoenergetic diets. The finding suggested that CPH could be used as an alternative to replace partial fish meal in diet. A similar finding was reported in juvenile starry flounder (Platichthys stellatus) fed a diet replacing fish meal with soy protein hydrolysates (Song et al., 2014). In mammals and fish, amino acids are known to act as regulators of the TOR signaling pathway (Byfield et al., 2005). In return, the TOR pathway not only plays a crucial role in intracellular sensing of amino acid availability, but also coordinates the balance between protein synthesis and protein degradation in response to nutrient quality and quantity (Laplante and Sabatini, 2012; Chen et al., 2012; Lansard et al., 2010). To assess the role of TOR signaling pathway in amino acids metabolism, the mRNA expression of key genes involved in TOR signaling pathway were determined. The results showed that the TOR mRNA expression levels in the liver and gut of blunt snout bream were not affected by the dietary 1% and 3% CPH, but significantly decreased as the dietary CPH supplement level increased. This indicated that dietary CPH at high levels depressed protein synthesis by inhibiting the activation of TOR signaling pathway. This may be due to the fact that down-regulated TOR mRNA expression depressed protein synthesis

Fig. 4. Relative expressions of AMPK and SIRT-1 in the liver of blunt snout bream fed diets replacing fish meal with CPH. Each data represents the means ± S.E.M of four replicates. Bars assigned with different letters are significantly different (P < 0.05). AMPKα-1, AMP-activated protein kinase α1; AMPKα-2, AMP-activated protein kinase α2; SIRT1, sirtuin-1. CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH.

However, replacing dietary fish meal with 7% CPH significantly decreased (P < 0.05) the contents of Thr, Val, Ile and Leu in muscle of blunt snout bream, but had no effects on total essential amino acids and total amino acids. This result indicated that dietary CPH relieved deficiency of some essential amino acid in muscle induced by replacing fish meal with plant protein at high level. However, the difference with our current findings was that replacing fish meal with soy protein hydrolysate significantly decreased the contents of aspartic acid, glutamic

Fig. 5. Hepatic t-AMPKα and p-AMPKα protein contents of blunt snout bream fed diets replacing fish meal with CPH. Gels were loaded with 20 μg total protein per lane. Protein levels were normalized to liver GAPDH levels. Each data represents the means ± S.E.M of four replicates. Bars assigned with different letters are significantly different (P < 0.05). t-AMPKα, AMP activated protein kinase α. p-AMPKα, phosphorylated AMP activated protein kinase α. CPH, cottonseed meal protein hydrolysate; CPH0, dietary fish meal replacement by 0% CPH; CPH1, dietary fish meal replacement by 1% CPH; CPH3, dietary fish meal replacement by 3% CPH; CPH5, dietary fish meal replacement by 5% CPH; CPH7, dietary fish meal replacement by 7% CPH. 231

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

(Zhou et al., 2017). Similar findings were observed in juvenile turbot (Scophthalmus maximus L.) (Wang et al., 2016) and juvenile blunt snout bream (Zhou et al., 2017). Previous studies found TOR regulates cellular growth, proliferation and metabolism by stimulating protein synthesis through 4EBPs and S6Ks in fish as well as in mammals (Sarbassov et al., 2005). As another downstream of TOR pathway, S6Ks could control the cell growth and apoptosis via regulating translation of ribosomal protein S6 (rpS6) and eukaryotic initiation factor 4B(eIF4B) (Roux and Topisirovic, 2012). In this study, dietary 5% and 7% CPH significantly decreased S6K1 mRNA expressions levels (P < 0.05). This result further confirmed that replacing fish meal with CPH at high levels led to inactivation of TOR signaling pathway again. Interestedly, we found that the 4E-BP2 mRNA expression levels in the gut of fish fed CPH 5 and CPH7 diets were higher than that in the control diet (P < 0.05). That is, high expression of 4E-BP2 subsequently caused the inhibition of mRNA translation and cell proliferation. In fact, the assembly of the eIF4F complex on the 50-mRNA cap structure is the first step of mRNA translation initiation in fish and mammals (Jackson et al., 2010). As small-molecular weight translational repressors, 4E-BP interfere with the assembly of the eIF4F complex by competing with eIF4G for binding to eIF4E (Roux and Topisirovic, 2012). Hence, high expression of 4E-BP2 mRNA could cause the inhibition of mRNA translation and cell proliferation. Previous studies confirmed that AMPK activation leads to an increase in cellular NAD+ levels, which could in turn activate SIRT1, and subsequently activates peroxisome proliferators γ-activated receptor coactivator-1α (PGC-1α), which induces mitochondrial biogenesis (Foretz and Viollet, 2011). In mammals, previous study reported that the expenditure of adenosine triphosphate (ATP) involved synthesis of some amino acids (Reeds et al., 1998). However, information on mechanism of AMPK/ SIRT1 in amino acid metabolism is still barely understood. Therefore, we assessed the role of AMPK/ SIRT1 in amino acid metabolism. In the present study, dietary 5% and 7% CPH significantly increased (P < 0.05) the AMPKα-1, AMPKα-2 and SIRT-1 mRNA expressions levels. This result indicated that dietary fish meal replacement with CPH at high level participated in amino acid metabolism via activating AMPK/ SIRT1. Previous studies reported that AMPK activation inhibits ATP-consuming anabolic pathways such as the mTOR/ S6K1 pathway (Foretz and Viollet, 2011). In addition, the result of hepatic protein expressions of AMPKα further confirmed that dietary CPH supplement at high level could regulate amino acid catabolism via activating AMPK/ SIRT1, thus maintained amino acid dynamic balance in fish. However, this is the first report and the underlying mechanisms still need to be elucidated. In summary, the present study suggested that the replacement of dietary FM by CPH by up to 3% could exert no adverse effects on the growth. Replacing fish meal with CPH at high level decreased amino acid metabolism, as well as resulted in poor growth of fish via activating AMPK/ SIRT1 pathway and then inhibiting TOR signaling pathway. In addition, replacing fish meal with CPH at appropriate level increased amino acid metabolism of juvenile blunt snout bream.

AOAC, 1995. Agricultural chemicals; contaminants, drugs. In: Official Methods of Analysis of AOAC International. AOAC International, Arlington, pp. 1298. Appuhamy, J.A., Nayananjalie, W.A., England, E.M., Gerrard, D.E., Akers, R.M., Hanigan, M.D., 2014. Effects of amp-activated protein kinase (AMPK) signaling and essential amino acids on mammalian target of rapamycin (mTOR) signaling and protein synthesis rates in mammary cells. J. Dairy Sci. 97 (1), 419–429. Atsushi Takeda, M.D., Fujihara, K., Akio Kikuchi, M.D., Teiko Kimpara, M.D., Yasuto Itoyama, M.D., 2010. Antibacterial and anti-inflammatory potential Bergenia ligulata. Am. J. Biomed. Sci. 2 (4), 313–321. Burgos, S.A., Kim, J.J., Dai, M., Cant, J.P., 2013. Energy depletion of bovine mammary epithelial cells activates AMPK and suppresses protein synthesis through inhibition of mtorc1 signaling. Horm. Metab. Res. 45 (03), 183–189. Byfield, M.P., Murray, J.T., Backer, J.M., 2005. Hvps34 is a nutrient-regulated lipid kinase required for activation of p70 S6 kinase. J. Biol. Chem. 280 (38), 33076–33082. Chen, G.F., Feng, L., Kuang, S.Y., Liu, Y., Jiang, J., Hu, K., Jiang, W.D., Li, S.H., Tang, L., Zhou, X.Q., 2012. Effect of dietary arginine on growth, intestinal enzyme activities and gene expression in muscle, hepatopancreas and intestine of juvenile Jian carp (Cyprinus carpio var. Jian). Br. J. Nutr. 108, 195–207. Cheng, Z.J., Hardy, R.W., 2002. Apparent digestibility coefficients and nutritional value of cottonseed meal for rainbow trout (Oncorhynchus mykiss). Aquaculture 212, 361–372. Cheng, Z.Y., Ai, Q.H., Mai, K.S., Xu, W., Ma, H.M., Zhang, J.M., 2010. Effects of dietary canola meal on growth performance, digestion and metabolism of Japanese seabass, Lateolabrax japonicus. Aquaculture 305, 102–108. Cho, C.Y., 1992. Feeding systems for rainbow trout and other salmonids with reference to current estimates of energy and protein requirements. Aquaculture 100 (1–3), 107–123. Coutinho, F., Castro, C., Rufinopalomares, E., Ordóñezgrande, B., Gallardo, M.A., Olivateles, A., et al., 2016. Dietary glutamine supplementation effects on amino acid metabolism, intestinal nutrient absorption capacity and antioxidant response of gilthead sea bream (Sparus aurata) juveniles. Comp. Biochem. Physiol. 191 A 9–17. Cuzzocrea, S., Costantino, G., Mazzon, E., Zingarelli, B., De Sarro, A., Capoti, A.P., 1999. Protective effects of Mn (III)tetrakis (4-benzoic acid) porphyrin (MnTBAP), a superoxide dismutase mimetic, in paw oedema induced by carrageenan in the rat. Biochem. Pharmacol. 58 (1), 171–176. Dumas, A., France, J., Bureau, D.P., 2007. Evidence of three growth stanzas in rainbow trout (Oncorhynchus mykiss) across life stages and adaptation of the thermal-unit growth coefficient. Aquaculture 267, 139–146. Food and Agricultural Organization of the United Nations (FAO), 2014. Fisheries and Aquaculture Department (Rome, Italy). http://www.fao.org/faostat/en/#compare. Foretz, M., Viollet, B., 2011. Regulation of hepatic metabolism by AMPK. J. Hepatol. 54, 827–829. Fynn-Aikins, K., Hughes, S.G., Vandenberg, G.W., 1995. Protein retention and liver aminotransferase activities in Atlantic salmon fed diets containing different energy sources. Comp. Biochem. Physiol. 111A, 163–170. Gao, Z.X., Luo, W., Liu, H., Zeng, C., Liu, X.L., Yi, S.K., et al., 2012. Transcriptome analysis and SSR/SNP markers information of the blunt snout bream (Megalobrama amblycephala). PLoS ONE 7 (8), e42637. Gui, D., Liu, W., Shao, X., Xu, W., 2010. Effects of different dietary levels of cottonseed meal protein hydrolysate on growth, digestibility, body composition and serum biochemical indices in crucian carp (Carassius auratus gibelio). Anim. Feed Sci. Technol. 156, 112–120. Harding, D.E., Jr, A.O., Wilson, R.P., 1977. Sulfur amino acid requirement of channel catfish: l-methionine and l-cystine. J. Nutr. 107 (11), 2031–2045. Hernandez, M.D., Martinez, F.J., Jover, M., Garcia, G.B., 2007. Effects of partial replacement of fish meal by soybean meal in sharp snout seabream (Diplodus puntazzo) diet. Aquaculture 263, 159–167. Hussein, H.S., Jordan, R.M., 1991. Fish meal as a protein supplement in ruminant diets: a review. J. Anim. Sci. 69, 2147–2156. Jackson, R.J., Hellen, C.U., Pestova, T.V., 2010. The mechanism of eukaryotic translation initiation and principles of its regulation. Nat. Rev. Mol. Cell Biol. 11, 113–127. Je, J.Y., Cha, J.Y., Cho, Y.S., Ahn, H.Y., Lee, J.H., Cho, Y.S., Ahn, C.B., 2013. Hepatoprotective effect of peptic hydrolysate from salmon pectoral fin protein byproducts on ethanol-induced oxidative stress in Sprague–Dawley rats. Food Res. Int. 51 (2), 648–653. Jürss, K., Bastrop, R., 1995. Chapter 7 amino acid metabolism in fish. Biochem. Mol. Biol. Fishes 4, 159–189. Kanda, A., Nakayama, K., Fukasawa, T., Koga, J., Kanegae, M., Kawanaka, K., Higuchi, M., 2013. Post-exercise whey protein hydrolysate supplementation induces a greater increase in muscle protein synthesis than its constituent amino acid content. Br. J. Nutr. 110, 981–987. Khajepour, F., Hossein, S.A., 2012. Citric acid improves growth performance and phosphorus digestibility in Beluga (Huso huso) fed diets where soybean meal partly replaced fish meal. Anim. Feed Sci. Technol. 171, 68–73. Klavins, J.V., 1965. Pathology of amino acid excess. v. effects of methionine on free amino acids in serum. BBA - General Subjects 104 (2), 554–565. Kudchodkar, S.B., Del Prete, G.Q., Maguire, T.G., Alwine, J.C., 2007. Ampk-mediated inhibition of mTOR kinase is circumvented during immediate-early times of human cytomegalovirus infection. J. Virol. 81, 3649–3651. Lansard, M., Panserat, S., Plagnes-Juan, E., Seiliez, I., Skiba-Cassy, S., 2010. Integration of insulin and amino acid signals that regulate hepatic metabolism-related gene expression in rainbow trout: role of TOR. Amino Acids 39, 801–810. Laplante, M., Sabatini, D.M., 2012. mTOR signaling in growth control and disease. Cell 149, 274–293. Li, J.Y., Zhang, D.D., Xu, W.N., Jiang, G.Z., Zhang, C.N., Li, X.F., Liu, W.B., 2014. Effects of dietary choline supplementation on growth performance and hepatic lipid

Acknowledgements This study was funded by the earmarked fund for China Agriculture Research System (CARS-45-14). The experiment was designed by W.B. Liu and G.Z. Jiang; contributed feed formulation; X.Y. Yuan wrote the manuscript; X.Y. Yuan, H.H. Cheng, Y.Y. Huang, Y.J. Dai and M.Y. Liu contributed reagents and feed making; All authors took participate in revision of the manuscript. References Ahmad, T., Shinkafi, T.S., Routray, I., Mahmood, A., Ali, S., 2012. Aqueous extract of dried flower buds of Syzygium aromaticum inhibits inflammation and oxidative stress. J. Basic Clin. Pharm. 3 (3), 323–327.

232

Aquaculture 510 (2019) 225–233

X.-Y. Yuan, et al.

Cold Spring Harb. Perspect. Biol. 4 (11), 843–853. Safayi, S., Nielsen, M.O., 2013. Intravenous supplementation of acetate, glucose or essential amino acids to an energy and protein deficient diet in early and late lactating dairy goats: effects on milk production and mammary nutrient extraction. Small Rumin. Res. 112 (1–3), 162–173. Sarbassov, D., Ali, S., Sabatini, D., 2005. Growing roles for the mTOR pathway. Curr. Opin. Cell Biol. 17, 596–603. Skiba-Cassy, S., Geurden, I., Panserat, S., Seiliez, I., 2016. Dietary methionine imbalance alters the transcriptional regulation of genes involved in glucose, lipid and amino acid metabolism in the liver of rainbow trout (Oncorhynchus mykiss). Aquaculture 454 (3), 56–65. Song, Z., Li, H., Wang, J., Li, P., Sun, Y., Zhang, L., 2014. Effects of fishmeal replacement with soy protein hydrolysates on growth performance, blood biochemistry, gastrointestinal digestion and muscle composition of juvenile starry flounder (Platichthys stellatus). Aquaculture 426–427, 96–104. Srikantan, T.N., Krishnamoorthi, C.R., 1955. Tetrazolium test for dehydrogenases. J. Sci. Ind. Res. 14, 206–208. Sunde, J., Kiessling, A., Higgs, D., Opstvedt, J., Venturini, G., Rungruangsak-Torrissen, K., 2015. Evaluation of feed protein quality by measuring plasma free amino acids in Atlantic salmon (Salmosalar L.) after dorsal aorta cannulation. Aquac. Nutr. 9 (6), 351–360. Tibaldi, E., Kaushik, S.J., 2005. Amino acid requirements of Mediterranean fish species. Cahiers Opt. Mediterran. 63, 59–65. Wang, Q., He, G., Mai, K., Xu, W., Zhou, H., 2016. Fishmeal replacement by mixed plant proteins and maggot meal on growth performance, target of rapamycin signalling and metabolism in juvenile turbot (Scophthalmus maximus l.). Aquac. Nutr. 22 (4), 752–758. Xu, D., He, G., Mai, K., Zhou, H., Xu, W., Song, F., 2016. Postprandial nutrient-sensing and metabolic responses after partial dietary fishmeal replacement by soyabean meal in turbot (Scophthalmus maximus L.). Br. J. Nutr. 115 (3), 379–388. Yue, Y.R., Zhou, Q.C., 2008. Effect of replacing soybean meal with cottonseed meal on growth, feed utilization, and hematological indexes for juvenile hybrid tilapia, Oreochromis niloticus × O. aureus. Aquaculture 284, 185–189. Zhang, Y.C., Li, D.F., Fan, S.J., Piao, X.S., Wang, J.T., Han, I.K., 2002. Effects of casein and protein-free diets on endogenous amino acid losses in pigs. Asian-Australas. J. Anim. Sci. 15, 1634–1638. Zhou, Q.L., Habte-Tsio, H.M., Ge, X., Xie, J., Ren, M., Liu, B., Miao, L., Pan, L., 2017. Graded replacing fishmeal with canola meal in diets affects growth and target of rapamycin pathway gene expression of juvenile blunt snout bream, Megalobrama amblycephala. Aquac. Nutr. 24 (1), 300–310.

transport in blunt snout bream (Megalobrama amblycephala) fed high-fat diets. Aquaculture 434, 340–347. Lim, S.J., Lee, K.J., 2009. Partial replacement of fish meal by cottonseed meal and soybean meal with iron and phytase supplementation for parrot fish Oplegnathus fasciatus. Aquaculture 290 (3), 283–289. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods 25 (4), 402–408. Lobley, G.E., 1990. Energy metabolism reactions in ruminant muscle: responses to age, nutrition and hormonal status. Reprod. Nutr. Dev. 30, 13–34. Lu, F., Haga, Y., Satoh, S., 2015. Effects of replacing fish meal with rendered animal protein and plant protein sources on growth response, biological indices, and amino acid availability for rainbow trout Oncorhynchus mykiss. Fish. Sci. 81, 95–105. Luo, Y.W., Ai, Q.H., Mai, K.S., Zhang, W.B., Xu, W., Zhang, Y.J., 2012. Effects of dietary rapeseed meal on growth performance, digestion and protein metabolism in relation to gene expression of juvenile cobia (Rachycentron canadum). Aquaculture 368–369, 109–116. Naik, S.R., Kalyanpur, S.G., Sheth, U.K., 1972. Effects of anti-inflammatory drugs on glutathione levels and liver succinic dehydrogenase activity in carrageenin edema and cotton pellet granuloma in rats. Biochem. Pharmacol. 21 (4), 511–516. Okada, M., Suzuki, K., 1974. Amino acid metabolism in rats fed a high protein diet without pyridoxine. J. Nutr. 104 (3), 287–293. Paulson, G., Ray, R., Sternberg, J., 1971. A rate-sensing approach to urea measurement. Clin. Chem. 17, 644. Reeds, P.J., Burrin, D.G., Davis, T.A., Stoll, B., 1998. Amino acid metabolism and the energetics of growth. Arch. Anim. Nutr. 51 (2–3), 187–197. Regost, C., Arzel, J., Kaushik, S.J., 1999. Partial or total replacement of fish meal by corn gluten meal in diet for turbot (Psetta maxima). Aquaculture 180, 99–117. Rietman, S., Frankel, S.A., 1957. A colorimetric method for the determination of serum glutamic oxalacetic and glutamic pyruvic transaminases. Am. J. Clin. Pathol. 28, 56–63. Robinson, E.H., 2006. Use of cottonseed meal in aquatic animal diets: a review. N. Am. J. Aquac. 68, 14–22. Robinson, E.H., Wilson, R.P., Poe, W.E., 1980. Total aromatic amino acid requirement, phenylalanine requirement and tyrosine replacement value for fingerling channel catfish. J. Nutr. 110 (9), 1805–1812. Robinson, E., Poe, W., Wilson, R., Robinson, E., Poe, W., Wilson, R., 1984. Effects of feeding diets containing an imbalance of branched-chain amino acids on fingerling channel catfish. Aquaculture 37 (1), 51–62. Roux, P.P., Topisirovic, I., 2012. Regulation of mRNA translation by signaling pathways.

233