Skeletal Unloading Induces Biphasic Changes in Insulin-Like Growth Factor-I mRNA Levels and Osteoblast Activity

Experimental Cell Research 251, 275–284 (1999) Article ID excr.1999.4539, available online at http://www.idealibrary.com on

Skeletal Unloading Induces Biphasic Changes in Insulin-Like Growth Factor-I mRNA Levels and Osteoblast Activity 1 H. Drissi,* A. Lomri,* F. Lasmoles,* X. Holy,† E. Zerath,† and P. J. Marie* ,2 *Unit 349 INSERM, Cell and Molecular Biology of Bone and Cartilage, Paris; and †IMASSA-CERMA, Department of Aerospatial Physiology, Bre´tigny sur Orge, France

To determine the local mechanisms involved in the effects of skeletal unloading on bone formation, we studied the temporal pattern of mRNA levels for insulin-like growth factor-I (IGF-I), IGF-I receptor type I (IGF-IR), and transforming growth factor b receptor type II (TGF-bRII) in relation to osteoblast phenotypic markers and osteoblast activity in hindlimb suspended rats. Skeletal unloading decreased bone volume and the mineralizing and osteoblastic surfaces at 4, 7, and 14 days in the tibial metaphysis, whereas the mineral appositional rate returned to normal at 14 days of suspension. RT-PCR analysis showed that skeletal unloading decreased type 1 collagen (Col 1) and osteocalcin (OC) mRNA levels in metaphyseal bone at days 4 and 7, and the levels returned to normal at 14 days of suspension. Unloading also decreased mRNA levels for IGF-I, IGF-IR, and TGF-bRII at 4 –7 days in the metaphyseal bone. However, IGF-I and IGF-IR levels rose above normal at 14 days of suspension. The biphasic changes in IGF-I mRNA levels were strongly correlated with Col 1 and OC mRNA levels. The associated biphasic pattern of IGF-I/IGF-IR expression, osteoblast markers, and osteoblast activity strongly suggests an important role for IGF-I signaling in the local effect of skeletal unloading on metaphyseal bone formation. © 1999 Academic Press Key Words: osteoblasts; IGF-I; IGF-I receptor; TGF-b; bone formation; unloading.

INTRODUCTION

The structural integrity and remodeling of the skeletal tissue are controlled in part by mechanical forces and loading which affect the recruitment and activity of bone forming cells [1, 2]. Hindlimb suspension in the rat, a model of skeletal unloading, was shown to induce 1 This work was supported by grants from the Centre National d’Etudes Spatiales (CNES, Paris, France). 2 To whom correspondence and reprint requests should be addressed. INSERM Unite´ 349, 2 rue Ambroise Pare´, 75475 Paris Cedex 10, France. Fax: 33-1-49 95 84 52. E-mail: pierre.marie@ inserm.lrb.ap-hop-paris.fr.

osteopenia and to inhibit bone formation in long bones [3, 4]. Biochemical and histomorphometric analyses revealed that hindlimb suspension induces a rapid decrease in bone apposition in the metaphyseal area associated with reduced osteoblast number and activity [5– 8]. We showed previously that the impaired endosteal bone formation in unloaded bone results from an impaired recruitment of osteoblast precursor cells in the bone marrow stroma and metaphysis [9]. The reduced osteoblast recruitment is also associated with decreased osteoblast differentiation and expression of bone matrix proteins such as type 1 collagen, osteocalcin, and osteopontin [9 –12]. However, the temporal and local mechanisms involved in the alterations of bone formation induced by unloading remain unknown. The local control of osteogenesis by loading appears to be mediated by prostaglandins, insulin-like growth factor-I (IGF-I) and transforming growth factor-b (TGF-b) [13, 14]. IGF-I and TGF-b are produced by osteoblasts, stimulate osteoblastic cell recruitment, and increase the production of noncollagenous bone matrix proteins by osteoblasts in vitro and in vivo [15, 16]. The cellular activity of IGF-I and TGF-b is known to be mediated by specific receptors [17, 18]. Thus, alterations in the local expression of these growth factors or their receptors may generate disorders of bone formation [19]. In unloaded rats, we previously demonstrated that IGF-I or TGF-b2 administration increases the proliferation of osteoprogenitor cells in the marrow stroma, leading to increased metaphyseal bone formation [20, 21]. Although unloaded metaphyseal long bone was shown to respond to exogenous IGF-I in vivo [20] and in vitro [22], the beneficial effect of IGF-I on marrow stromal cell proliferation, bone formation, and bone mass is lower than the effect induced by exogenous TGF-b2 [21]. Skeletal resistance to IGF-I associated with increased IGF-I and IGF-I receptor (IGF-IR) mRNA levels in the knee or distal femur was reported in tail suspended juvenile rats [10, 23]. In contrast, IGF-I, IGF-II, and TGF-b2 mRNA levels were found to be decreased in long bone stromal cells at the early time points of unloading in the same model [11].

275

0014-4827/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.

276

DRISSI ET AL.

Thus, IGF-I expression in unloaded bone appears to vary with the bone site, the stage of bone cell differentiation, and the duration of unloading. The precise role endogenous IGF-I may play in the effects of skeletal unloading on osteoblasts and bone formation therefore remains unclear. In this study, we determined the temporal changes in mRNA levels for IGF-I, IGF-IR, TGF-b1, and TGF-b receptor II (TGF-bRII) in relation to changes in osteoblast differentiation markers and bone formation in the long bone metaphysis, a site which is greatly affected by unloading. Our temporal analysis of gene expression reveals a biphasic pattern of IGF-I, IGF-IR, and TGF-bIIR mRNA levels in the metaphyseal bone cells during unloading. The biphasic pattern of IGF-I and IGF-IR expression correlates with changes in osteoblast markers and bone formation, indicating that IGF-I/IGF-IR signaling may play an important role in the control of metaphyseal bone formation during skeletal unloading in rats. METHODS Animals. Twenty-five adult 4-week-old Wistar male rats weighing about 130 g (Iffa-Credo, France) were randomly assigned to four groups (3–5 animals per group), designed to evaluate temporal changes at days 0, 4, 7, and 14. In each group, some rats were not suspended (normal loaded) and some were suspended by the tail (unloaded) as previously described [9, 20, 21] after approval of the study by our local Review Board. The base of the tail was attached via a clip to the top of a specially designed Plexiglass cage (CERMABiomeca, France) to have hindlimbs nonweight bearing. In this model, hindlimb elevation causes minimal transient stress, is well tolerated, and allows normal physical activity by the animals which have free movement in the cage by using their forelimbs [9]. The rats were maintained on a 12 h light/12 h dark cycle and body weight was recorded every 2 days. The animals were fed a standard chow containing 1% calcium and 0.8% phosphorus (UAR, France). The rats were pair-fed by adjusting the food intake of the untreated normal loaded group to that of the unloaded rats. All animals were given two doses of calcein (10 mg/kg body wt) at 6 and 2 days prior to sacrifice, to label the sites of mineralization. At the basal time point (day 0) and after 4, 7, and 14 days of suspension, the animals were anesthetized, body weight was recorded, the tibias and femurs were removed and weighed, and their length was measured. The right tibia metaphysis was processed for histomorphometric analysis, the left tibia metaphysis was analyzed for bone mineral content, and the left and right femur metaphyses were used for the extraction of total RNA. Histomorphometric analysis. The right tibia metaphysis was fixed in 10% phosphate-buffered formaldehyde, dehydrated in ethanol, and embedded in methylmethacrylate [9]. Three to five longitudinal sections (5–7 mm thick) were stained with Goldner trichrome, and 10- to 15-mm-thick sections were unstained for visualization of calcein labels under fluorescent microscopy. Histomorphometric indices of bone formation and resorption were measured as previously described [9, 20, 21] using a semiautomatic image analyzer coupled to a digitizing table (VideoPlan, Kontron). The following indices were measured in the metaphyseal area of the tibia in a standardized zone (3.6 mm 2) at a distance (500 mm) from the growth plate: the trabecular bone volume (BV/TV, percentage bone tissue composed of calcified and uncalcified matrix), the trabecular thickness (Tb.Th, average of all trabecular thickness, mm), the osteoblast surface (Ob.S/BS, percentage bone surface covered with osteoblasts). The mineral ap-

position rate (MAR, mean distance between the double fluorescent labels divided by the interval labeling time) and the double labeled surface (MS/BS, percentage of the bone surface with double fluorescent markers) were also measured. The bone formation rate (BFR) at the tissue level was calculated by multiplying the mineral apposition rate by the double-fluorescent-labeled surface [24]. Preparation of metaphyseal bone. The femurs were cleaned of soft tissues and aseptically dissected in sterile phosphate-buffered saline (PBS) with antibiotics (100 IU/ml penicillin and 100 mg/ml streptomycin). After removal of the periosteum and epiphyseal area, the femurs were cut transversally at the middle shaft and then sectioned longitudinally to expose the metaphysis. The metaphyseal area was washed with PBS to remove the marrow, and the metaphyseal bone area was carefully removed and suspended in a monophasic solution of phenol and guanidine isothiocyanate lysis buffer (Extract-All, Eurobio). The metaphyseal extracts from the two femurs in each rat were pooled and frozen at 280°C until RNA isolation. RNA extraction and RT-PCR analysis. In each rat, total RNA from the pooled femur metaphyses was extracted by a modified method of Chomczynsky and Sacchi [25] using Extract-All according to the manufacturer’s protocol. RNA concentration was determined spectrophotometrically and quality was checked on a 1% agarose gel containing ethidium bromide. The expression of transcripts for alkaline phosphatase (ALP), type 1 collagen (Col 1), osteocalcin (OC), IGF-I, IGF-IR, TGF-b1, and TGF-bRII was examined by reverse transcription polymerase chain reaction (RT-PCR) analysis. The synthesis of cDNA from 5 mg of the isolated RNA was carried out for 40 min at 37°C with 200 units of MMLV reverse transcriptase (Gibco BRL, Life Technologies) in the presence of 100 ng oligo(dT)15 primer (Promega), 10 mM DTT,1 mM dNTPs, and 40 units of RNase inhibitor (Promega) in a final volume of 20 ml. Five microliters of this reverse-transcribed cDNA was submitted to polymerase chain reaction in 50 ml of reaction mixture containing 1.25 units of Taq DNA polymerase (ExtrapolEurobio), 2 mM MgCl 2, and 20 pmol of each specific primer for ALP, OC, Col 1, IGF-I, IGF-IR, TGF-b1, TGF-bRII and the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The sequences of the primers are shown in Table 1. PCR was performed after a denaturing step of 5 min at 95°C. Each cycle was composed of a melting step at 94°C for 1 min, annealing at 60°C for 1 min, and elongation at 72°C for 1 min in a Perkin–Elmer/ Celtus Thermal Cycler (Perkin–Elmer). The final step was extended to 10 min at 72°C. For each transcript, an amplification curve was constructed based on ascending cycle number, and an optimal cycle number of 30 cycles, representing the ascending portion of the amplification curve. Negative control reactions for RT-PCR were performed in each assay using all reagents except RNA. The integrity of RNA isolated from the experimental samples was checked by RTPCR with primers for GAPDH. Southern blots were performed by running aliquots of amplified cDNAs on 1.5% agarose gel, visualized by ethidium bromide, and transferred onto nylon membranes (Appligene-oncor, France) by the alkaline transfer method. The membranes were hybridized overnight with an antisense oligonucleotide probe that was 59-end-labeled with [g 32P]ATP (Table 1). Membranes were then washed twice in 23 SSC/0.1% SDS at room temperature for 10 min and then in 0.13 SSC/0.1% SDS at 50°C for 10 min. Filters were exposed to X-ray films with intensifying screen at 280°C. Autoradiographic bands were quantified by densitometric analysis using a scanning densitometer (Transidyne General Co., Ann Arbor, MI). The signal for each gene was related to that for GAPDH. All RT-PCR analyses were carried out using cDNA obtained in each rat and in three rats per group. Each analysis was repeated four times at different occasions to take into account possible variations which may occur from rat to rat or between different assays. In addition, mRNA extracted from ROS 17/2.8 rat osteosarcoma cells was processed under the same conditions and used as positive controls for gene expression.

IGF-I mRNA PATTERN DURING SKELETAL UNLOADING

TABLE 1 Specific Oligonucleotides Used for PCR Amplification and Southern Hybridization

Gene ALP

COL-1

OC TGF-b1 TGF-bRII IGF-I

IGF-IR

GAPDH

Primer sequence Sense Antisense Internal Sense Antisense Internal Sense Antisense Internal Sense Antisense Internal Sense Antisense Internal Sense Antisense Internal Sense Antisense Internal Sense Antisense Internal

CTACTTGTGTGGCGTGAAGG AATGCTGATGAGGTCCAGG GCATCTCATTGTCCGAGTACC CCTACCACTGCAAGAACAGC AACAGACAGGAGTACCACCG AGTACCACCGATGTCCAGAGG CAGACCTAGCAGACACCATGAG CGTCCATACTTTCGAGGCAG GCTAGCTCGTCACAATTGGG AAGACCATCGACATGGAGC GTTCATGTCATGGATGGTGC GACTTGAATCTCTGCAGGCG GCTTCACTCTGGAAGATGCC AAGGAGTGTGGTCACTGTGC TAGAGCTGATGTCAGAGCGG GCTCTTCAGTTCGTGTGTGG GGCTCCTCCTACATTCTGTAGG ACACAGTACATCTCCAGCCTCC CATCACCGAGTACTTGCTGC TGAAGCCTGATGGACACTCC GGTGGTCTTCTCACACATGG TGCTGGTGCTGAGTATGTCG ATTGAGAGCAATGCCAGCC CATGGACTGTGGTCATGAGC

Product size (bp)

277

lowed the same temporal changes, although the difference did not reach statistical significance at 14 days (Fig. 2B). The matrix appositional rate showed a different temporal evolution. This parameter was lower than normal at 7 days, but did not differ from normal loaded rats at 14 days of suspension (Fig. 2C). The bone

418

375

416

663

774

290

698

646

Statistics. All data are expressed as the mean 6 SE. The data were analyzed by two-factor analysis of variance (ANOVA) using the statistical package super-ANOVA (Macintosh, Abacus concepts, Inc., Berkeley, CA). A minimal level of P , 0.05 was considered significant.

RESULTS

Temporal changes in bone mass and bone formation. The temporal changes in the metaphyseal tibial mass are shown in Fig. 1. Skeletal unloading decreased the metaphyseal bone mass at 7–14 days of suspension compared to normal loaded rats (Fig. 1A). Histomorphometric analysis confirmed the decreased metaphyseal bone volume at 7–14 days of suspension compared to normal loaded rats (Fig. 1B). This metaphyseal osteopenia was associated with a marked reduction in trabecular thickness compared to normal loaded rats at 7–14 days of suspension (Fig. 1C). These changes were unrelated to body weight which did not differ significantly at 4 and 7 days in control and unloaded animals (not shown) and was slightly decreased (212%, P , 0.05) in unloaded compared to normal loaded rats at 14 days of suspension. The temporal changes in metaphyseal bone formation are shown in Fig. 2. The extent of trabecular bone surface with osteoblasts was lower than normal at 4 –14 days of suspension compared to normal loaded rats (Fig. 2A). The extent of mineralizing surface fol-

FIG. 1. Temporal changes in bone mass induced by unloading in tibial metaphyses. Skeletal unloading induced a marked decrease in bone mass (A), trabecular bone volume (B), and trabecular bone thickness (C) in the tibial metaphysis compared to normal loaded rats. Data are the means 6 SE (n 5 3–5 per group). a and b indicate a significant difference with base control and age-matched normal loaded rats, respectively (P , 0.05).

278

DRISSI ET AL.

FIG. 2. Temporal changes in bone formation induced by skeletal unloading in the tibial metaphysis. Unloading decreased the osteoblast surface (A), mineralizing surface (B), mineral apposition rate (C), and bone formation rate (D), and the mineral apposition rate came back to control values at 14 days of suspension. Data are the means 6 SE. a and b indicate a significant difference with base control and age-matched normal loaded rats, respectively (P , 0.05).

formation rate followed the same pattern, as it decreased at 4 and 7 days in unloaded rats compared to normal loaded rats and was not different from normal at 14 days of suspension (Fig. 2D). These results indicate that the metaphyseal bone osteopenia induced by unloading was associated with an early decrease in the number of bone forming sites, whereas bone formation activity evaluated by MAR, was initially decreased, and was restored at 14 days of suspension. Expression of osteoblast differentiation markers. We then determined the temporal changes in the expression of characteristic osteoblast differentiation markers during skeletal unloading. To do that, RNA was isolated from femur metaphysis in each rat, and the temporal changes in alkaline phosphatase, type 1 collagen, and osteocalcin, markers of the osteoblast phenotype, were determined by semiquantitative RTPCR analysis. Figure 3A shows the temporal changes in the expression of these markers in normal loaded and unloaded rats in comparison with GAPDH, and Figs. 3B and 3C show the semiquantitative densitometric analysis of mRNA levels after correction for

RNA loading. In normal loaded and unloaded rats, ALP mRNA levels in the metaphyseal area were barely detectable at all time points. In normal loaded bones, Col 1 mRNA levels were high at day 0, decreased at day 4, and remained stable at 4 –14 days. In unloaded rats, Col 1 mRNA levels decreased dramatically at 4 days compared to day 0 expression, and remained low at 7 days. At 4 and 7 days of suspension, Col 1 mRNA levels were 6- to 18-fold lower in unloaded rat than in normal loaded rats. In contrast, Col 1 mRNA levels rose dramatically at 14 days of suspension. At this time point Col-1 mRNA levels were 3-fold higher than in normal loaded rats (Fig. 3C vs 3B). Figure 3 also shows the levels of OC mRNA corrected for RNA loading. In normal loaded rats, OC mRNA levels decreased slowly with time (Fig. 3A). In unloaded bones at 4 days, OC levels were 16-fold lower than in loaded rats. However, OC mRNA levels rose at 7 and 14 days of suspension. At 7 days, the levels were similar to normal loaded rats. At 14 days, the levels were 124-fold higher than in normal loaded rats and reached levels similar to basal ones. These results

IGF-I mRNA PATTERN DURING SKELETAL UNLOADING

279

FIG. 3. Representative autoradiographs of RT-PCR products for the osteoblast differentiation markers type 1 collagen (Col 1) and osteocalcin (OC) (A), and densitometric determination of mRNA levels normalized to GAPDH in normal loaded (B) and unloaded (C) rat femoral metaphyses. Skeletal unloading induces biphasic changes in the expression of osteoblast differentiation markers. Total RNA was reverse transcribed, amplified, and probed with internal primers as described under Methods. Data are the means 6 SE of separate preparations obtained from three individual rats. The star indicates a significant difference with normal loaded rats (P , 0.05).

show that unloading induces a dramatic and rapid decrease in the expression of osteoblast marker genes that was followed by a marked increase after 2 weeks of suspension. Expression of growth factors. The temporal changes in mRNA levels for IGF-I, IGFI-R, TGF-b1, and TGFb2RII in the metaphyseal area are shown in Fig. 4C and the densitometric analysis after correction for GAPDH is shown in Figs. 4C and 4D. In normal loaded rats, IGF-I mRNA levels decreased with time at 7–14 days compared to day 4 (Fig. 4C). In unloaded rats, IGF-I mRNA levels were decreased 23-fold at 4 days and 10-fold at 7 days of suspension, compared to normal loaded rats (Fig. 4D). In contrast, IGF-I expression rose markedly at 14 days of suspension to levels which were 12-fold higher than in normal loaded rats (Figs. 4A and 4D). IGF-IR decreased with time in normal loaded rats and was undetectable at 7–14 days (Fig. 4). In unloaded rats, IGF-IR was undetectable as soon as 4 days after suspension but rose to almost basal values at 14 days after suspension (Fig. 4D).

In contrast to IGF-I, TGF-b1 expression was detectable only at day 0 in normal loaded rats (Fig. 4B). TGF-b1 mRNA was not detectably expressed in unloaded bones. In contrast, TGF-b1 was clearly expressed in ROS 17/2.8 cells used as a positive control for gene expression (Fig. 4B). We found that TGFbRII was expressed in normal loaded rats and the mRNA levels decreased with time at 4 –14 days (Fig. 4B). In unloaded rats, TGFbRII mRNA levels were undetectable at 4 and 7 days of suspension and the levels rose slightly at 14 days of suspension (Fig. 4D). These results show that IGF-I and IGF-IR expression in the metaphysis followed a biphasic pattern, as the levels decreased during early skeletal unloading and returned to, or above, normal after 2 weeks of suspension. Although skeletal unloading also decreased TGFbRII expression, the receptor expression does not recover with time. Correlations between IGF-I expression and osteoblast differentiation markers. Since IGF-I expression in the metaphysis follows a biphasic pattern during skel-

280

DRISSI ET AL.

FIG. 4. Representative autoradiographs of RT-PCR products for IGF-I and IGF-IR (A) and for TGF-b1 and TGF-bRII (B) in femoral metaphysis, and densitometric determination of mRNA levels normalized to GAPDH in normal loaded (C) and unloaded (D) rat femoral metaphyses. IGF-I, IGF-IR, and TGF-bRII expression decreased initially and then increased at 14 days of skeletal unloading. Total RNA was reverse transcribed, amplified, and probed with internal primers, as described under Methods. Data are the means 6 SE of separate preparations obtained from three individual rats. The star indicates a significant difference with normal loaded rats (P , 0.05).

etal unloading, we evaluated whether the temporal pattern of IGF-I mRNA levels correlated with alterations of bone marker expression. When IGF-I and bone marker mRNA levels were compared in normal loaded and suspended rats, we found a strong correlation between IGF-I and Col 1 (Fig. 5A) and between IGF-I and OC mRNA levels (Fig. 5B). In addition, Col 1 and OC mRNA levels were strongly correlated with each other (r 5 0.79, P , 0.04). These results indicate that the temporal alterations of Col-1 and OC expression induced by unloading in the long bone metaphysis correlate with the changes in IGF-I expression in the same metaphyseal area. DISCUSSION

Skeletal unloading in rats induces a marked metaphyseal osteopenia, occurring as the result of de-

creased osteoblast recruitment and bone formation. However, the molecular mechanisms underlying these alterations remain unclear. The present temporal analysis of gene expression shows that the changes in the local expression of IGF-I and IGF-IR in the long bone metaphysis induced by unloading follow a biphasic pattern and correlate with changes in bone formation and the associated alteration of osteoblast marker expression. The temporal changes in metaphyseal bone formation in suspended rats followed a biphasic pattern. Skeletal unloading rapidly decreased the extent of bone surfaces covered with osteoblasts and the mineralizing surface, reflecting a decreased amount of working osteoblasts. Unloading also decreased the mineral apposition rate, reflecting a decreased activity of osteoblasts. However, the latter index went back to normal

IGF-I mRNA PATTERN DURING SKELETAL UNLOADING

281

FIG. 5. Correlations between the expression of IGF-I mRNA and Col 1 (A) or OC levels (B) in the metaphyseal femur, showing that the alterations of osteoblast differentiation markers are associated with changes in IGF-I expression in the metaphysis.

values at 14 days of suspension, suggesting that osteoblast activity was restored with time, in contrast to the number of bone forming cells. Previous studies also reported a partial restoration of bone formation after 2 weeks of suspension, as part of an adaptative response of bone cells to long term unloading [6, 7, 26]. The finding that skeletal unloading affects more rapidly and for a longer period of time the number of osteoblasts recruited than their activity is consistent with our previous cellular and molecular analyses showing that skeletal unloading reduces osteoblastic cell recruitment and the expression of histone H4 and c-fos, markers of cell proliferation, in unloaded metaphyseal bone cells [9, 19]. To determine the molecular alterations induced by skeletal unloading in relation to osteoblast activity in the metaphysis, we investigated the temporal expression of osteoblast differentiation markers using semiquantitative RT-PCR. This method allows a precise evaluation of transcripts for genes that are weakly expressed in bone cells in vivo [27]. In normal loaded rats, we found very low ALP mRNA levels and no relation to bone formation in the metaphysis, which is consistent with previous results in the femora of growing rats [28]. In contrast, we found high levels for Col 1 and OC expression, consistent with the mature phenotype of osteoblastic cells present along the metaphyseal bone surface [9, 29]. The temporal changes in bone marker expression showed that skeletal unloading rapidly decreased Col 1 and OC mRNA levels abruptly at 4 and 7 days of suspension compared to normal loaded rats. This is in line with the rapid decrease in bone formation in the unloaded metaphyseal

bone and with the reduced Col 1 expression previously reported in unloaded long bones [9, 11, 12]. Disuse osteopenia [30] and spaceflight [31] were also found to downregulate Col 1 and OC mRNA levels in rat long bones. Interestingly, we found that Col 1 and OC mRNA levels rose markedly at 14 days of suspension. This finding is consistent with the rise in the mineral apposition rate that we observed at the metaphyseal level and with the changes in osteocalcin concentrations in serum and femur diaphysis reported in hindlimb suspended rats [32]. These data show that the biphasic alteration of bone matrix formation induced by skeletal unloading at the tissue level is associated with parallel changes in the expression of osteoblast differentiation markers by metaphyseal osteoblasts. We then determined whether the observed temporal changes in bone formation and bone marker expression were related to local alterations of growth factor expression. We investigated the changes in TGF-b and IGF-I, factors that are potent activators of osteoblast proliferation and differentiation [15, 16]. We found very low TGF-b1 mRNA levels in metaphyseal bone, consistent with its weak expression in rat bone [33]. Skeletal unloading was found to decrease TGF-b2 mRNA in long bone marrow stromal cells in rats [11]. In contrast, microgravity induced by orbital spaceflight does not appear to affect TGF-b expression in the tibial metaphysis of growing rats [34, 35]. Thus, TGF-b expression appears to be affected differently by unweighting and unloading or to vary with the bone location. Since the levels of signaling TGF-b receptors may affect the osteoblast response to TGF-b, we eval-

282

DRISSI ET AL.

uated the expression of TGF-b type II receptor, the ligand binding receptor that is expressed in osteoblastic cells [36] and is primarily required for TGF-b signal transduction [18]. We found that TGF-bIIR mRNA levels were lower than normal in unloaded metaphysis at 4 days of suspension. Although this decrease in TGFbIIR expression may alter the osteoblastic cell response to TGF-b produced locally, this does not appear to affect the beneficial effect of exogenous TGF-b2 on osteoblast recruitment and bone formation in unloaded rats [21]. In contrast to TGF-b1, we found that metaphyseal bone cells expressed high IGF-I mRNA levels, which is consistent with previous reports in rat osteoblasts in vivo [37, 38]. Skeletal unloading in growing rats was found to decrease the levels of some IGF-I transcripts in bone marrow stromal cells [11], whereas increased IGF-I mRNA levels were found in the distal femur or in the knee of suspended rats [10, 23], suggesting regional or temporal variations in the effects of unloading on IGF-I expression in bone. We therefore determined the temporal pattern of IGF-I expression in metaphyseal bone which is greatly affected by unloading. Our data clearly show that the effects of skeletal unloading on IGF-I levels in metaphyseal bone are dependent on the duration of unloading. IGF-I levels decreased markedly at 4 –7 days and rose abruptly at 14 days of suspension, showing that skeletal unloading induced biphasic changes in IGF-I expression. The high IGF-I expression observed in the metaphyseal bone at 14 days of suspension may account for our previous finding that, in contrast to exogenous TGF-b2 [21], IGF-I administration did not completely correct the defective trabecular bone formation in unloaded metaphyseal bone after 2 weeks [20]. Moreover, we found that the biphasic changes in IGF-I mRNA levels were strongly correlated with changes in Col 1 and OC expression in metaphyseal bone, which indicates that the temporal changes in the osteoblast differentiation markers during skeletal unloading resulted from the associated local changes in IGF-I expression. Changes in transcripts for IGF-I are usually associated with parallel changes in IGF-I protein in rat bone [37, 38]. Thus, the biphasic IGF-I expression in unloaded metaphyseal bone may account for the associated changes in osteoblast activity. These results emphasize the important role of skeletal unloading on IGF-I expression in metaphyseal bone in vivo, which is consistent with the finding that mechanical stimulation increases IGF-I mRNA expression in rat bone cells [39]. The actions of IGFs on bone cells are known to be mediated by IGF receptors and are modulated by IGF binding proteins (IGF-BPs) [16]. Although spaceflight appears to modulate IGF-BP expression in rat marrow stromal cells induced to differentiate into osteoblasts [40], skeletal unloading induced by hindlimb suspen-

sion does not appear to affect IGF-BPs [10, 41]. In contrast, IGF-IR was found to be increased in knees of growing unloaded rats [23]. In unloaded metaphyseal bone, we found a transient and marked decrease in IGF-IR expression which then returned to normal during adaptation to unloading. Thus, IGF-IR followed the same biphasic pattern as for IGF-I during unloading. This suggests that skeletal unloading decreased both IGF-I expression and the cellular response to IGF-I in metaphyseal bone during the early stages of unloading. In contrast, at later stages, recovery of both IGF-I expression and IGF-IR may normalize the local response to IGF-I in metaphyseal bone. Thus, the timerelated biphasic pattern of expression of IGF-I/IGF-IR in unloaded metaphysis provides distinct mechanistic means whereby unloading can affect metaphyseal osteoblast activity in suspended rats. As in unloaded rats, the temporal decrease in osteocalcin mRNA in normal loaded rats was associated with decreases in IGF-I, IGF-IR, and TGF-bRII mRNA levels. Although type I collagen mRNA levels also decreased with time at 4 days, the levels remained relatively high in normal loaded rats, which may reflect regulation at posttranscriptional levels. It seems unlikely that the biphasic change in IGF-I mRNA levels in metaphyseal bone in unloaded rats was related to changes in systemic hormones that are known to modulate IGF-I expression. Although serum levels of 1,25(OH) 2 vitamin D were found to decrease during unloading and to return to control levels at the time bone formation begins to recover, 1,25(OH) 2D infusion does not alter the decrease in bone mass induced by unloading [42]. Thus, 1,25(OH) 2D is unlikely to be responsible for the decrease in bone formation induced by unloading [42]. In addition, serum parathyroid hormone and corticosteroids do not increase in hindlimb suspended rats relative to control rats [6, 43]. Growth hormone also is unlikely to mediate the changes that occur in response to hindlimb unloading [44]. Thus, local factors, such as IGF-I, rather than systemic factors are likely to have the major role in mediating the response of bone to skeletal unloading in this model [45]. The present finding that skeletal unloading induces a biphasic temporal pattern of IGF-I and IGF-IR expression associated with changes in osteoblast differentiation marker expression and osteoblast activity in the unloaded metaphyseal bone area clearly indicates that IGF-I/IGF-IR signaling may play an important role in the temporal control of metaphyseal bone formation during skeletal unloading. The authors thank Mrs. S. Renault and C. Andre´ (IMASSACERMA, Departement de Physiologie Ae´rospatiale, Bre´tigny sur Orge) for their technical assistance. This work was supported in part by grants from the Centre National d’Etudes Spatiales (CNES).

IGF-I mRNA PATTERN DURING SKELETAL UNLOADING

REFERENCES

18.

1.

Lanyon, L. E. (1993). Osteocytes, strain detection, bone modeling and remodeling. Calcif. Tissue Int. 53 (Suppl 1), 102–107.

19.

2.

Dunstan, R. L., and Turner, C. H. (1995). Mechanotransduction and the functional response of bone to mechanical strain. Calcif. Tissue Int. 57(5), 344 –358.

20.

3.

Wronski, T. J., and Morey, E. D. (1982). Skeletal abnormalities in rats induced by simulated weightlessness. Metab. Bone Dis. Rel. Res. 4, 69 –75.

4.

Globus, R. K., Bikle, D. D., and Morey-Holton, E. (1984). Effects of simulated weightlessness on bone mineral metabolism. Endocrinology 114, 2264 –2270.

5.

Globus, R. K., Bikle, D. D., and Morey-Holton, E. (1986). The temporal response of bone to unloading. Endocrinology 118, 733–742.

6.

Halloran, B. P., Bikle, D. D., Cone, C. M., and Morey-Holton, E. (1988). Glucocorticoids and inhibition of bone formation induced by unloading. Am. J. Physiol. 255, E875– 879.

7.

Morey-Holton, E. R., and Globus, R. K. (1998). Hindlimb unloading of growing rats: A model for predicting skeletal changes during space flight. Bone 22(5), 83S– 89S.

8.

Vico, L., Novikov, V. E., Very, J. M., and Alexandre, C. (1991). Bone histomorphometry comparison of rat tibial metaphysis after 7-day tail suspension vs. 7-day spaceflight. Aviat. Space Environ. Med. 62, 26 –31.

9.

Machwate, M., Zerath, E., Holy, X., Hott, M., Modrowski, D., Malouvier, A., and Marie, P. J. (1993). Skeletal unloading in rat decreases proliferation of rat bone and marrow-derived osteoblastic cells. Am. J. Physiol. (Endocrinol. Metabol.) 27(264), E790 –E799.

21.

22.

23.

24.

25.

26.

27.

10.

Bikle, D. D., Harris, J., Halloran, B. P., and Morey-Holton, E. R. (1994). Skeletal unloading induces resistance to insulin-like growth factor I. J. Bone Min. Res. 9(11), 1789 –1796.

11.

Zhang, R., Supowit, S. C., Klein, G. L., Lu, Z., Christiensen, M. D., Lozano, R., and Simmons, D. J. (1995). Rat tail suspension reduces messenger RNA level for growth factors and osteopontin and decreases the osteoblastic differentiation of bone marrow stromal cells. J. Bone Miner. Res. 10, 415– 423.

29.

Kostenuik, P. J., Halloran, B. P., Morey-Holton, E. R., and Bikle, D. D. (1997). Skeletal unloading inhibits the in vitro proliferation and differentiation of rat osteoprogenitor cells. Am. J. Physiol. 273, E1133–E1139.

30.

12.

13.

Rawlinson, S. C. F., El Haj, A. J., Minter, S. L., Tavares, I. A., Bennett, A., and Lanyon, L. E. (1991). Load-related increases of prostaglandin production in cores of adult canine cancellous bone in vitro- a role for prostacyclin in adaptive bone remodeling? J. Bone Miner. Res. 6, 1345–1351.

14.

Klein-Nulend, J., Roelofsen, J., Sterck, J. G., Semeins, C. M. C., and Burger, E. H. (1995). Mechanical loading stimulates the release of transforming growth factor-fl activity by cultured mouse calvariae and periosteal cells. J. Cell Physiol. 163(1), 115–119.

15.

Centrella, M., McCarthy, T. L., and Canalis, E. (1991). Transforming growth factor-beta and remodeling of bone. J. Bone Joint Surg. 73A(9), 1418 –1428.

16.

Conover, C. C. (1996). The role of insulin-like growth factors and binding proteins in bone cell biology. In “Principles of Bone Biology” (J. P. Bilezikian, L. G. Raisz, and G. A. Rodan, Eds.), pp. 607– 618, Academic Press, San Diego.

17.

Centrella, M., McCarthy, T. L., and Canalis, E. (1996). Receptors for insulin-like growth factors-I and -II in osteoblast-enriched cultured from fetal bone. Endocrinology 126, 39 – 44.

28.

31.

32.

33.

34.

35.

283

Massague´, J. (1996). TGF-b signaling: Receptors, transducers and Mad proteins. Cell 85, 947–950. Marie, P. J. (1997). Growth factors and bone formation in osteoporosis: roles for IGF-I and TGF-b. Rev. Rhum. 64(1), 44 –53. Machwate, M., Zerath, E., Holy, X., Hott, M., Pastoureau, P., and Marie, P. J. (1994). Insulin-like growth factor-I increases trabecular bone formation and osteoblastic cell proliferation in unloaded rats. Endocrinology 134(3), 1031–1038. Machwate, M., Zerath, E., Holy, X., Hott, M., Godet, D., Lomri, A., and Marie, P. J. (1995). Systemic administration of transforming growth factor-b2 prevents the impaired bone formation and osteopenia induced by unloading in rats. J. Clin. Invest. 96, 1245–1253. Yamaguchi, M., and Kishi, S. (1994). Differential effects of insulin and insulin-like growth factor-I in the femoral tissues of rats with skeletal unloading. Calcif. Tissue Int. 55, 363–367. Bikle, D. D., Harris, J., Halloran, B. P., Currier, P. A., Tanner, S., and Morey-Holton, E. (1995). The molecular response of bone to growth hormone during skeletal unloading: Regional differences. Endocrinology 136, 2099 –2109. Parfitt, A. M., Drezner, M. K., Glorieux, F. H., Kanis, J. A., Malluche, H., Meunier, P. J., Ott, S., and Recker, R. R. (1987). Bone histomorphometry: Standardization of nomenclature, symbols and units. J. Bone Miner. Res. 2, 595– 610. Chomczynski, P., and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate–phenol– chloroform extraction. Anal. Biochem. 162, 156 –159. Vico, L., and Alexandre, C. (1989). Normalisation of bone cellular responses occurs between 7 and 14 days of simulated weightlessness in rats. Physiologist 32(1), S25–26. Bilbe, G., Roberts, E., Birch, M., and Evans, D. B. (1996). PCR phenotyping of cytokines, growth factors and their receptors and bone matrix proteins in human osteoblast-like cell lines. Bone 19(5), 437– 445. Turner, R. T., and Spelsberg, T. C. (1991). Correlation between mRNA levels for bone cell proteins and bone formation in long bones of maturing rats. Am. J. Physiol. E348 –353. Modrowski, D., and Marie, P. J. (1993). Cells isolated from the endosteal bone surface in adult rats express differentiated osteoblastic characteristics in vitro. Cell. Tissue Res. 271, 499 – 505. Wakley, G. K., Portwood, J. S., and Turner, R. T. (1992). Disuse osteopenia is accompanied by downregulation of gene expression for bone proteins in growing rats. Am. J. Physiol. 263, E1029 –E1034. Backup, P., Westerlind, K., Harris, S., Spelsberg, T., Kline, B., and Turner, R. (1994). Spaceflight results in reduced mRNA levels for tissue-specific proteins in the musculoskeletal system. Am. J. Physiol. 266, E567–E573. Patterson-Buckendahl, P., Globus, R. K., Bikle, D. D., Cann, C. E., Morey-Holton, E. (1989). Effects of simulated weightlessness on rat osteocalcin and bone calcium. Am. J. Physiol. 257, R1103–1109. Horner, A., Kemp, P., Summers, C., Bord, S., Bishop, N. J., Kelsall, A. W., Coleman, N., and Compston, J. E. (1998). Expression and distribution of transforming growth factor-b1 isoforms and their signaling receptors in growing human bone. Bone 23(2), 95–102. Westerlind, K. C., and Turner, R. T. (1995). The skeletal effects of spaceflight in growing rats: Tissue-specific alterations in mRNA levels for TGF-b. J. Bone Miner. Res. 10, 843– 848. Cavolina, J. M., Evans, G. L., Harris, S. A., Zhang, M., Westerlind, K. C., and Turner, R. T. (1997). The effects of orbital spaceflight on bone histomorphometry and messenger ribonu-

284

36.

37.

38.

39.

40.

DRISSI ET AL. cleic acid levels for bone matrix proteins and skeletal signaling peptides in ovariectomized growing rats. Endocrinology 138, 1567–1576. Kabasawa, Y., Ejiri, S., Matsuki, Y., Hara, K., and Ozawa, H. (1998). Immunoreactive localization of transforming growth factor-b type II receptor-positive cells in rat tibiae. Bone 22(2), 93–98. Shinar, D. M., Endo, N., Halperin, D., Rodan, G. A., and Weinreb, M. (1993). Differential expression of insulin-like growth factor-I (IGF-I) and IGF-II messenger ribonucleic acid in growing rat bone. Endocrinology 132, 1158 –1167. Lazowski, D., Fraher, L., Hodsman, A., Steer, B., Modrowski, D., and Han, V. (1994). Regional variation of insulin-like growth factor-I gene expression in mature rat bone and cartilage. Bone 15, 563–576. Lean, J. M., Jagger, C. J., Chambers, T. J., and Chow, J. W. N. (1995). Increased insulin like growth factor I mRNA expression in rat osteocytes in response to mechanical stimulation. Am. J. Physiol. 268, E318 –E327. Kumei, Y., Shimogawa, H., Katano, H., Akiyama, H., Hirano, M., Mukai, C., Nagaoka, S., Whitson, P. A., and Sams, C. F.

Received March 5, 1999 Revised version received April 29, 1999

41.

42.

43.

44.

45.

(1998). Spaceflight modulates insulin-like growth factor binding proteins and glucocorticoid receptor in osteoblasts. J. Appl. Physiol. 85(1), 139 –147. Bikle, D., Harris, J., Halloran, B., and Morey-Holton, E. (1994). Altered skeletal pattern of gene expression in response to spaceflight and hindlimb elevation. Am. J. Physiol. 267, E822–E827. Halloran, B. P., Bikle, D. D., Wronski, D. J., Globus, R. K., Levens, M. J., and Morey-Holton, E. (1986). The role of 1,25dihydroxyvitamin D in the inhibition of bone formation induced by skeletal unloading. Endocrinology 118, 948 –954. Globus, R. K., Bikle, B. P., Halloran, B. P., and Morey-Holton, E. R. (1986). Skeletal response to dietary calcium in a rat model simulating weightlessness. J. Bone Miner. Res. 1, 191–197. Halloran, B. P., Bikle, D. D., Harris, J., Autry, C. P., Currier, P. A., Tanner, S., Patterson-Buckendahl, P., and Morey-Holton, E. (1995). Skeletal unloading induces selective resistance to the anabolic actions of growth hormone on bone. J. Bone Miner. Res. 10, 1168 –1176. Morey-Holton, E. R., and Globus, R. K. (1998). Hindlimb unloading of growing rats: A model for predicting skeletal changes during space flight. Bone 22(5), 83S– 88S.