- Email: [email protected]
SKP1 in the cochlear epithelial gap junction region
Hearing Research 157 (2001) 100^111 www.elsevier.com/locate/heares
OCP1, an F-box protein, co-localizes with OCP2/SKP1 in the cochlear epithelial gap junction region Michael T. Henzl
a;
*, Julie O'Neal a , Richard Killick c , Isolde Thalmann b , Ruediger Thalmann b
a
Department of Biochemistry, University of Missouri-Columbia, Columbia, MO 65211, USA Department of Otolaryngology, Washington University School of Medicine, St. Louis, MO, USA Department of Neuroscience, Institute of Psychiatry, De Crespigny Park, Denmark Hill, London SE5 8AF, UK b
c
Received 11 November 2000; accepted 17 April 2001
Abstract Immunohistochemical data indicate that OCP1 co-localizes exactly with OCP2 in the epithelial gap junction region of the guinea pig organ of Corti (OC). Despite the abundance of OCP1 in the OC, gaining access to its coding sequence ^ and, in particular, the 5P end of the coding sequence ^ proved unexpectedly challenging. The putative full-length OCP1 cDNA ^ 1180 nucleotides in length ^ includes a 67 nucleotide 5P leader sequence, 300 codons (including initiation and termination signals), and a 216 nucleotide 3P untranslated region. The cDNA encodes a protein having a predicted molecular weight of 33 700. The inferred amino acid sequence harbors an F-box motif spanning residues 52^91, consistent with a role for OCP1 and OCP2 in the proteasome-mediated degradation of select OC proteins. Although OCP1 displays extensive homology to an F-box protein recently cloned from rat brain (NFB42), clustered sequence non-identities indicate that the two proteins are transcribed from distinct genes. The presumptive human OCP1 gene was identified in the human genome databank. Located on chromosome 1p35, the inferred translation product exhibits 94% identity with the guinea pig OCP1 coding sequence. ß 2001 Elsevier Science B.V. All rights reserved. Key words: Organ of Corti ; Gap junction; Proteasome; F-box protein; Ubiquitin ; Connexin
1. Introduction In 1980, two-dimensional polyacrylamide gel electrophoresis analyses revealed two abundant proteins in the organ of Corti (OC), with apparent molecular weights of 37 000 and 22 500 (Thalmann et al., 1980). Each
* Corresponding author. Tel.: +1 (573) 882 7485; Fax: +1 (573) 884 4812; E-mail: [email protected] Abbreviations: BSA, bovine serum albumin; Cul1, a gene product from the cullin family, a component of SCF complexes; FITC, £uorescein isothiocyanate; NFB42, a neuronal F-box protein with a high degree of homology to OCP1; OC, organ of Corti; OCP1, an abundant protein (Mr 37 000) in the OC, an F-box protein; OCP2, an abundant protein (Mr 22 500) in the OC, a homolog of SKP1; PBS, phosphate-bu¡ered saline; PCR, polymerase chain reaction; PN, postnatal; Rbx1, a component of SCF complexes; SCF complexes, novel ubiquitin^protein ligases consisting of Skp1, Cul1 (or a homolog), an F-box protein, and Rbx1; Skp1, a component of SCF complexes
comprised roughly 5% of the total protein in the nonsensory cell population. In recognition of their abundance in the OC and apparent absence in other tissues, they were called OCP1 and OCP2, respectively. Two decades later, their physiological roles remain conjectural. The burdensome task of collecting amino acid sequence data for OCP1 and OCP2 (Thalmann et al., 1990 ; 1993) facilitated isolation of the OCP2 cDNA sequence, reported in 1995 (Chen et al., 1995). Cloning of OCP1, however, has proven more di¤cult. It was subsequently learned that OCP2 exhibits extreme sequence homology to Skp1, a eukaryotic regulatory protein (see discussion in Thalmann et al., 1997). Skp1 is a central component in a novel class of ubiquitin^protein ligases commonly called SCF (Skp1, Cullin, F-box protein) complexes (Jackson et al., 2000 ; Callis and Vierstra, 2000 ; Krek, 1998; Peters, 1998). These multi-subunit structures carry out polyubiquitylation reactions
0378-5955 / 01 / $ ^ see front matter ß 2001 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 5 9 5 5 ( 0 1 ) 0 0 2 8 5 - 4
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
that target select proteins for destruction by the 26S proteasome (DeMartino and Slaughter, 1999; Bochtler et al., 1999; Voges et al., 1999). Within the SCF complex, Skp1 contacts at least two other proteins ^ one belonging to the cullin family, the other harboring a sequence motif called the F-box (Bai et al., 1996). The recent emergence of the SCF paradigm promoted speculation that OCP1 would prove to be an F-box protein. And, in fact, the inferred amino acid sequence for an F-box family member recently cloned from rat brain displayed agreement with the available data for OCP1 (Erhardt et al., 1998). Long before the discovery of the Skp1^F-box association, however, the roughly stoichiometric expression levels of OCP1 and OCP2 had suggested a collaborative function. We herein present compelling immunohistochemical and molecular evidence that OCP1 and OCP2 exist as a complex in the OC.
101
ACCAGCCTTTCCAGTAGACAGCGT; ocp1-7s, GACAGCGTCAGGAAGTACTTCGCGTCCTCTTTCGAGTGGTGTCGCAAGGC ; ocp1-8as, ATCCTGGGGGAATCCCACCCCACTGTCTCCGGGTATCTCCTCCACCCTCC; ocp1-9s, ACAAGTTGTTGACCTGCAGGCCGAGGGCTACTGGGAGGAGCTGCTGGACACC ; ocp1-10as, AGCCGTCCCCGCCATGTTCCACGTCACACCAGCCCTCCAAGTCCTCTTCCCG; ocp1-11as, ACGGGTTGCGCAGCAGG; ocp-12as, GCGCCTACGCTTGCTGAGGA; gt11s, ATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATC; m13rext, CAGGAAACAGCTATGACCATGATTACGC ; 2.3. cDNA
Bacteria were cultured on LB agar (Fisher Scienti¢c, Pittsburgh, PA, USA) or LB broth (Bio101, obtained from Midwest Scienti¢c, St. Louis, MO, USA). All cultures were supplemented with 300 Wg/ml ampicillin (Sigma-Aldrich, St. Louis, MO, USA). Small-scale plasmid isolations were performed with the Wizard plasmid puri¢cation kit (Promega, Madison, WI, USA), on bacteria collected from 3^5 ml LB broth cultures. Larger-scale isolations were performed with the Qiagen Maxi Kit (Qiagen, Valencia, CA, USA), on bacteria harvested from 100 ml LB cultures. Prior to automated cycle sequencing, DNA samples were extracted with acid (pH 4.0) phenol/CHCl3 , then precipitated with ethanol using Pellet Paint NF (Novagen, Madison, WI, USA) as a co-precipitant. After rinsing with 70% ethanol, pellets were resuspended in water. Sequencing samples contained approximately 1 Wg of DNA and 20 pmol of the appropriate oligonucleotide primer, in a volume of 25 Wl. All other chemicals were reagent grade and were purchased from Fisher Scienti¢c or Sigma-Aldrich.
Two sources of cDNA were employed as template for the PCR-based cloning procedures described below : the Wilcox^Fex library (Wilcox and Fex, 1992) and an OC cDNA library prepared in this laboratory. For construction of the latter, polyadenylated RNA was isolated from 200 Wg of guinea pig OC, freeze-dried and dissected under rigorously controlled conditions (Thalmann, 1976), employing the MicroPoly(A)Pure mRNA Isolation Kit (Ambion, Austin, TX, USA). Doublestranded cDNA was prepared using the SMART1 cDNA Library Construction Kit (Clontech Laboratories, Palo Alto, CA, USA). After ligating EcoRI-NotISalI adapters to the cDNA and phosphorylating the adapters, the cDNA was size-fractionated by gel ¢ltration, retaining all material greater than 0.5 kb in length. The pooled cDNA was collected by EtOH precipitation, ligated to Vgt11, and packaged with Gigapack III Gold packaging extracts (Stratagene, La Jolla, CA, USA). The resulting library (2.3U106 clones) was ampli¢ed on 35 150 mm agar plates. After clari¢cation, the lysates were stored at 4³C. Several aliquots of the library were stored at 370³C, after addition of dimethyl sulfoxide to a ¢nal concentration of 7%. The Wilcox^Fex cDNA utilized as a template for PCR ampli¢cation was isolated from an aliquot of the Wilcox^Fex library (approx. 2U108 cfu) cultured on LB/amp. cDNA was extracted from our Vgt11-based library using the procedure described in Maniatis et al. (1982).
2.2. Oligonucleotides
2.4. PCR ampli¢cation
The following polymerase chain reaction (PCR) and sequencing primers were synthesized at the University of Missouri DNA Core Facility : ocp1-1s, GGIGARGARGAYCTIGARGG ; ocp1-2as, RTCRTCYTGIGGRAAYTCIACICC ; ocp1-3s, TTGAACATGGCGGGGACGGCTGGA; ocp1-4s, GTGGAGGAGATACCCGGAGACAGT ; ocp1-5as, CTCGGGCTCCGA-
PCR reactions were carried out in thin-walled 0.5 ml tubes in a Thermolyne TempTronic0 thermal cycler. Denaturation steps were performed for 30 s at either 94³C with Taq polymerase (Promega) or 95³C with Pfu Turbo Polymerase (Stratagene). Annealing steps were carried out for 30 s at the temperatures speci¢ed in the ¢gure legends. Extension reactions were carried
2. Materials and methods 2.1. General
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
102
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
out for the speci¢ed times at 72³C. Each cycling protocol included a ¢nal 10 min extension at 72³C. Unless otherwise stated, Taq polymerase was used for ampli¢cation. The Taq polymerase reaction bu¡er contained 50 mM KCl, 10 mM Tris^HCl (pH 9.0 at 25³C), 1.5 mM MgCl2 , 0.1% Triton X-100, and 0.20 mM dNTPs. The Pfu Turbo polymerase reaction bu¡er contained 20 mM Tris^HCl (pH 8.8 at 25³C), 10 mM KCl, 10 mM (NH4 )2 SO4 , 2.0 mM MgSO4 , 0.1 mg/ml nuclease-free bovine serum albumin (BSA), 0.1% Triton X-100, and 0.20 mM dNTPs. Reaction products of interest were puri¢ed by agarose gel electrophoresis, recovered with the QIAEX2 gel extraction kit (Qiagen), and cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA). Prior to cloning, products resulting from ampli¢cation with Pfu Turbo polymerase were treated with 0.2 mM dATP and Taq polymerase (1 U) for 10 min at 72³C, in order to append deoxyadenylate moieties to the 3P termini. 2.5. Antibody production Murine monoclonal antibodies were raised against an internal fragment of guinea pig OCP1, selected on the basis of its high antigenicity index. The peptide, EIPGDSVEFPQDDSV (synthesized by the Protein Chemistry Laboratory at Washington University, St. Louis, MO, USA), was conjugated to keyhole limpet hemocyanin or BSA using the corresponding Imject0 kits from Pierce Chemical Co. (Rockford, IL, USA). The keyhole limpet hemocyanin conjugate was employed for immunization, the BSA conjugate for screening. Both conjugates were puri¢ed before use by dialysis as described in the Pierce protocol. Immunization and hybridoma production were performed as described previously for the avian parvalbumins, ATH and CPV3 (Hapak et al., 1996). Hybridoma supernatants were screened for anti-OCP1 activity by enzyme-linked immunosorbent assay and immunoblotting, using the peptide^BSA conjugate as antigen. Positive clones were puri¢ed by limiting dilution. The anti-OCP2 antibody was raised in rabbit against residues 1^16. Its speci¢city has been described previously (Chen et al., 1995) 2.6. Immunoblot Freeze-dried samples of OC and whole brain were resolved on 15% sodium dodecylsulfate polyacrylamide minigels. Proteins were electrophoretically transferred onto Immobilon-P as described by Towbin et al. (1979). The resulting replicas were blocked with Trisbu¡ered saline containing 0.1% casein and 0.1% Tween 20, incubated with primary antibody (1:20 dilution in blocking solution, 2 h, room temperature), washed with
Fig. 1. Anti-OCP1 antibody speci¢city. The production of a murine monoclonal antibody against guinea pig OCP1 is described in Section 2. The speci¢city of that preparation is shown in the accompanying immunoblot. Broad-range molecular mass standards (in kDa) are shown on the left; lane 1, 5 Wg (dry weight) guinea pig OC; lanes 2 and 3, 6 and 60 Wg (dry weight) of whole guinea pig brain.
blocking solution (3U5 min), and then incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (1:5000 dilution in blocking solution, 2 h, room temperature). After washing (2U5 min with blocking solution, 2U5 min with horseradish peroxidase bu¡er), the antigen^antibody complexes were visualized by chemiluminescence, using the SuperSignal West Pico Chemiluminescent Substrate Kit (Pierce). Apparent molecular weights were deduced by comparison to prestained broad-range standards (Bio-Rad, Hercules, CA, USA). 2.7. Immunohistochemistry Day 1 postnatal (PN) guinea pig cochleae were removed and ¢xed in 3.7% formaldehyde/phosphate-bu¡ered saline (PBS) for 2 h, then decalci¢ed and cryoprotected in 0.5 M ethylenediaminetetraacetic acid, 18% sucrose, PBS for 7 days. The tissue was embedded in low melting point agarose and mounted in Tissuetek o.c.t. compound (Agar, UK), then rapidly frozen with Cryospray (Bright Instruments, UK). 8 Wm thick sections were collected on multi-well gelatin-coated slides (ICN, UK). Tissue sections were permeabilized and pre-blocked with 3% BSA, PBS, 0.1% Tween, for 30 min at room
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
temperature in a humidity chamber. Anti-OCP1 (mouse) and -OCP2 (rabbit) antibodies were applied in PBS, at 1:50 and 1:200 dilutions, respectively, for 2 h at room temperature. Following removal of excess primary antibody with PBS (3U10 min), £uorescein isothiocyanate (FITC) anti-rabbit and Texas red antimouse conjugated secondary antibodies were applied in PBS at a 1:250 dilution. After removal of excess antibody with PBS (3U10 min), the sections were coated with anti-fade mounting medium (Dako, UK) and covered with coverslips. Images were captured using a Kodak DS410 digital camera, mounted on an Axioskope £uorescence microscope. 3. Results 3.1. Speci¢city of the anti-OCP1 antibody Tissue samples from OC and whole brain were solu-
103
bilized, resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis, electrophoretically transferred to nitrocellulose, and probed with a murine antibody raised against an internal fragment of OCP1. As shown in Fig. 1, the antibody yields a single strong signal when used to probe extracts of the OC. The apparent molecular weight (Mr 37 500) of the target protein coincides with that previously determined for OCP1. The weak signal near 32 000 is believed to represent a proteolytic degradation product. The cDNA sequence (see below) suggests that OCP1 should be highly susceptible to proteolysis. The absence of detectable signals from a 12-fold larger quantity of brain tissue testi¢es to the monospeci¢city of the antibody preparation. 3.2. Comparative immunohistochemistry of OCP1 and OCP2 We have previously examined the cochlear distribu-
Fig. 2. Immunohistochemical analysis of OCP1 and OCP2 expression in the guinea pig cochlea. A cross-section of the basal coil from a day 1 PN guinea pig cochlea, simultaneously probed with anti-OCP1 (A) and anti-OCP2 (B) antibodies, demonstrates exact co-localization of the two antigens. The pattern of £uorescence sharply de¢nes the OC and adjacent non-sensory epithelia. The signal is particularly intense in the region of the outer sulcus and the root cells (left), the processes of which appear to extend into the substance of the spiral ligament. The lateral wall tissue itself, however, is unstained. Labeling is likewise intense in the inner sulcus region, with a funnel-like extension towards the lip of the spiral limbus. The interdental cells yield a faint signal; however, staining is absent in the spiral limbus. Although the phalangeal processes of the Deiters cells are intensely labeled, there is no staining of the hair cells proper. This pattern corresponds closely to the regions interconnected by the epithelial gap junction system of the cochlea (Kikuchi et al., 1995; 2000).
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
104
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
Fig. 3. Longitudinal variation in OCP1 and OCP2 expression. Cross-sections were obtained from a day 1 PN guinea pig cochlea at several points along the cochlear axis. The sections were simultaneously treated with mouse anti-OCP1 and rabbit anti-OCP2 antibodies, followed by appropriate £uorophore-tagged secondary antibodies. The red-stained images reveal the distribution of OCP1; the green-stained images reveal the distribution of OCP2. A low-power dark ¢eld image of one-half of the whole cochlea is displayed in the right-hand panel.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
tion of OCP2 in guinea pig (Chen et al., 1995) and gerbil (Yoho et al., 1997). The protein is expressed exclusively, and at very high levels, in the supporting cells of the OC and adjacent non-sensory epithelia, including inner and outer sulcus cells, root cells and their processes and the interdental cells. To determine whether OCP1 displays a similar distribution, OC sections from day 1 PN guinea pig were simultaneously probed with antibodies against OCP1 and OCP2. (The day 1 PN guinea pig cochlea is developmentally comparable to a day 20 PN rat cochlea.) These duallabeling studies unequivocally demonstrate that the two proteins are expressed by the identical cell population. Fig. 2 shows a section simultaneously treated with a mouse anti-OCP1 and rabbit anti-OCP2, followed by Texas red-conjugated goat anti-mouse IgG and FITCconjugated goat anti-rabbit IgG. It is apparent that OCP1 (panel A) exactly co-localizes with OCP2 (panel B), both proteins being expressed solely by the cells in the epithelial gap junction region. Depicting adjacent sections from each of the 4.5 turns of the day 1 PN guinea pig cochlea, Fig. 3 emphasizes the restricted expression pattern of these two cochlear proteins. For orientation, the right-hand panel of Fig. 3 presents a dark ¢eld low-power image of one half of a midmodiolar section of the day 1 PN guinea pig cochlea.
105
3.3. OCP1 cDNA cloning The cDNA sequence for OCP1 (Fig. 4) was accessed by PCR. Degenerate sense and antisense primers (ocp11s and ocp1-2as in Fig. 5A) were designed from existing internal amino acid sequence data that spanned 35 residues (Thalmann et al., 1993). PCR was performed, using this primer pair, on 50 ng of cDNA isolated from an aliquot of our Vgt11-based OC library. The reaction yielded a complex mixture of products, including a faint band (Fig. 5A, fragment 1) that migrated ahead of the 154 bp marker. The sequence of this product includes nucleotides 464^568 in Fig. 4. A modi¢ed RACE-PCR strategy was employed to isolate the remainder of the cDNA sequence from our Vgt11-based library (Fig. 5B). To amplify a fragment corresponding to the 3P half of the coding sequence, we used the sense primer ocp1-3s, based on sequence from fragment 1 (nucleotides 495^518 in Fig. 4), in combination with oligo(dT)30 . A second round of PCR, employing the nested sense primer ocp1-4s (nucleotides 520^543 in Fig. 4) and oligo(dT)30 , yielded a major product (fragment 2, Fig. 5B) that virtually comigrated with a 653 bp marker. The sequence of this fragment spanned nucleotides 521^1181 in Fig. 4; the inferred amino acid sequence included 147 codons, a TGA termination signal, and a 211 nucleotide 3P UTR. An analogous approach was undertaken to isolate
Fig. 4. OCP1 cDNA sequence. The 903 nt coding sequence (299 amino acid residues plus start and stop codons) is £anked by a 67 nt 5P UTR and 210 nt 3P UTR. The putative polyadenylation signal (nt 1161^1166) is underlined. The GenBank accession number is AY029175.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
106
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
Fig. 5. PCR ampli¢cation of guinea pig OCP1 cDNA. (A) Acquisition of a core sequence. Degenerate PCR primers, based on existing amino acid sequence data for OCP1, were used to amplify an aliquot of our Vgt11-based guinea pig OC cDNA library. The translated sequence of the 102 bp product (fragment 1) agreed with the amino acid data at all but one position (indicated by the lowercase `r'). (B) Extension of the cDNA sequence. The 3P half of the OCP1 cDNA (fragment 2) was obtained by nested PCR on an aliquot of the Vgt11-based library, using oligo(dT)30 in combination with ¢rst ocp1-3s, then ocp1-4s. A portion of the 5P half of the coding sequence (fragment 3) was obtained with a sense primer based on £anking Vgt11 vector sequence and the antisense primer, ocp1-5as. (C) Strategy for obtaining the 5P end of the OCP1 cDNA. PCR was performed on an aliquot of the Wilcox^Fex guinea pig OC cDNA library, using ocp1-7s and ocp1-8as. A second round was then performed using the (nested) primers, ocp1-9s and ocp1-10as. These reactions were designed to selectively amplify the pool of cDNA constructs containing OCP1 coding information. This pool was then subjected to two additional rounds of PCR, employing a sense primer (M13r) located in the £anking vector sequence and nested antisense primers ^ ¢rst ocp1-11as, then ocp1-12as. One of the products (fragment 4) in the resulting complex mixture harbored an initiation codon and downstream sequence matching sequence from fragment 3. (D) Ampli¢cation of the putative full-length OCP1 cDNA. An aliquot of cDNA isolated from the Wilcox^Fex library was ampli¢ed, employing sense and antisense primers corresponding to the extreme 5P and 3P ends of the cDNA. The sequence of the larger product (fragment 5) con¢rmed its identity as the OCP1 cDNA.
the 5P end of the OCP1 cDNA. Ampli¢cation with a sense primer based on adjacent vector sequence (gt11s) and an OCP1-speci¢c antisense primer (ocp1-5as, complementary to nucleotides 903^938 in Fig. 4). The resulting fragment (fragment 3, Fig. 5B, including nucleotides 200^938 in Fig. 4) harbored an F-box motif (residues 53^94), but lacked an initiation codon. Repeated attempts failed to yield additional upstream sequence. Analogous experiments were also performed on aliquots of cloned cDNA from the Wilcox^Fex library (Wilcox and Fex, 1992). For these PCR reactions, ocp1-5as was used in combination with a pSport1-based primer, M13r. These attempts likewise failed to yield additional 5P sequence information.
Our inability to amplify the entire 5P end of the cDNA suggested that full-length reverse transcripts of the OCP1 mRNA were rare ^ perhaps due to an intrinsic instability of the OCP1 message or to high secondary structure content. A concerted e¡ort was made, therefore, to enrich for OCP1 sequences. The approach ^ diagrammed in Fig. 5C ^ exploited the circularity of the pSport1 cloning vector used to construct the Wilcox^Fex library. Nested primer pairs were designed for the complete ampli¢cation of any plasmid harboring an OCP1 cDNA insert. An initial round of PCR was performed on an aliquot of the Wilcox^Fex cDNA library, using the ocp1-7s/ocp1-8as pair and Pfu Turbo polymerase, with an annealing/extension temperature of 72³C. An aliquot of the resulting PCR reaction was
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
107
Fig. 6. Comparison of guinea pig OCP1 and rat NFB42 primary structures. Sequence non-identities are shown in boldface type. The hyphens in the NFB42 sequence indicate insertions in the OCP1 sequence.
then used as the template in a second round of PCR, employing the ocp1-9s/ocp1-10as primer pair and the identical thermal cycling protocol. At this point, two additional rounds of nested PCR were performed using the Pfu Turbo polymerase. For both reactions, an OCP1-speci¢c antisense primer (¢rst ocp1-11as, then ocp1-12as) was utilized in conjunction with a sense primer (M13r) based on £anking pSport1 sequence. The M13r/ocp1-12as reaction showed a complex mixture of products (Fig. 5C). The faint band having an approximate length of 525 bp (fragment 4, Fig. 5C) was chosen for further examination. This fragment was puri¢ed by agarose gel electrophoresis, then cloned into the pCR2.1-TOPO vector, after appending overhanging As at the 3P terminus with Taq polymerase. Four transformants, all harboring inserts of the expected length, were submitted for sequence analysis. One of the four harbored a putative start codon, followed by sequence that showed strong homology to the N-terminal sequence of NFB42, an Fbox protein recently cloned from rat brain (Erhardt et al., 1998), and ultimately merged with the existing OCP1 sequence data. This clone, which included nucleotides 1^442 in Fig. 4, also contained a 67 nucleotide
5P untranslated region. In the remaining three transformants, a portion of the putative OCP1 sequence was appended to sequence that neither bore any homology to NFB42 nor harbored an initiation signal. Sense and antisense primers (ocp1-13s and ocp1-14as) ^ corresponding to sequence near the 5P and 3P termini, respectively ^ were designed to permit ampli¢cation of the entire cDNA from the Wilcox^Fex library, employing Pfu Turbo polymerase. The PCR reaction yielded two products, the larger of which was approximately 1150 bp in length (Fig. 5D). This sequence ^ minus the initiation codon ^ encodes a protein having a predicted molecular weight of 33 700. The primary sequences of guinea pig OCP1 and rat NFB42 are compared in Fig. 6. The two proteins are highly homologous, exhibiting 82% identity (246 of 299 residues). Excluding the ¢rst 50 residues ^ which harbor nearly half of the non-identities ^ increases the identity to 89%. The majority of sequence di¡erences occur in clusters: 16 of 17 residues between 20 and 36; nine of 12 residues between 243 and 254, including a three residue insertion (250^252); all ¢ve residues between 104 and 108, including an insertion at position 106; and four of ¢ve between residues 43 and 47. The remaining
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
108
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
non-identities, scattered throughout the cDNA sequence, appear to be the result of single nucleotide substitutions. 4. Discussion Since their discovery two decades ago, there has been speculation that OCP1 and OCP2 are partners in a multi-subunit complex. Our co-localization studies unequivocally demonstrate that the two proteins are produced by a common cell population. As shown previously for OCP2 (Chen et al., 1995; Yoho et al., 1997), the expression of OCP1 is likewise restricted to the supporting cells and adjacent non-sensory cells comprising the epithelial gap junction region of the postnatal cochlea. In fact, the expression patterns are indistinguishable. We have also described the cloning of a novel F-box protein from guinea pig OC. Near perfect agreement with previously reported amino acid sequence data argues persuasively for identity to OCP1. We should emphasize that the core of the cDNA sequence was initially ampli¢ed from a Vgt11-based cDNA library constructed with mRNA from freeze-dried, dissected OC. In this tissue preparation technique ^ thoroughly described by Thalmann (1976) ^ the cochlea is quickfrozen in situ and freeze-dried at low temperature to preserve chemical and structural integrity. Then, under precisely regulated conditions of temperature and humidity, the freeze-dried OC is meticulously dissected away from adjacent tissue. This approach ensures that this cDNA is an OC-derived sequence. 4.1. Comparison of OCP1 and NFB42 sequences An F-box protein called NFB42 was recently isolated from rat neurons (Erhardt et al., 1998). The authors commented on the similarity between the NFB42 sequence and the partial amino acid sequence previously published for guinea pig OCP1 (Thalmann et al., 1993). Indeed, OCP1 and NFB42 are highly homologous, with sequence identity exceeding 80%. However, the proteins display several regions of divergent sequence, indicating that they are distinct gene products. Most notably, the region spanning residues 20^36 di¡ers at 16 of 17 positions, and the corresponding nucleotide sequence displays just 38% identity. Moreover, the OCP1 sequence includes four additional residues ^ a consequence of a three residue insertion at positions 252^254 and a single residue insertion at position 106. As revisions to this article were being ¢nalized, the presumptive OCP1 gene was identi¢ed in the human genome database. It is located on chromosome 1p35, an area that has been implicated in hereditary non-syn-
dromic deafness disorders. The putative human OCP1 translation product displays 94% identity with the guinea pig ortholog ^ including 100% identity in the region between residues 20 and 36 ^ and includes both insertions. 4.2. Are OCP1 and OCP2 components of on OC-speci¢c SCF? Twenty years after their discovery, the physiological role of OCP1 and OCP2 is unknown. Homology to Skp1 suggests a functionally equivalent role for OCP2 in the cochlea. Many cellular processes are regulated by selective proteolysis (King et al., 1996). Proteins destined for destruction are conjugated to polyubiquitin, which provides a recognition signal for the 26S proteasome (DeMartino and Slaughter, 1999; Bochtler et al., 1999 ; Voges et al., 1999). Polyubiquitylation can be targeted through the use of speci¢c E3 ubiquitin ligases. Skp1 is a key component in a speci¢c class of multisubunit ubiquitin^protein ligases known as SCF complexes. Discovered and ¢rst characterized in Saccharomyces cerevisiae (Bai et al., 1996 ; Connelly and Hieter, 1996), SCFs are present in all eukaryotic species (e.g., Jackson et al., 2000). SCF is an acronym for Skp1, cullin, and F-box protein. The cullin component ^ named for the Cul1 gene product (aka Cdc53) in yeast ^ furnishes a sca¡old for complex assembly (e.g., Lyapina et al., 1998 ; Patton et al., 1998; Yu et al., 1998). Skp1 and Cdc34 (the ubiquitin-conjugating enzyme per se) interact directly with cullin, and the F-box protein binds to Skp1 through an F-box motif present in the N-terminal half of the sequence. The F-box protein dictates target protein speci¢city (Skowyra et al., 1997), and the various SCF ubiquitin ligases are denoted by the identity of the associated F-box component. For example, SCFCdc4 denotes the SCF complex containing Cdc4, the original F-box protein discovered in yeast. Interactions with the C-terminal domain of the F-box protein presumably position the target protein for ubiquitylation by Cdc34. Besides the three subunits already mentioned, the complex also contains Rbx1 (Kamura et al., 1999a,b; Tyers and Willems, 1999). The latter interacts with the cullin and F-box components of the SCF and assists in the recruitment of Cdc34 (Skowyra et al., 1999). The Skp1, Cul1, and Cdc4 homologs in higher eukaryotes form multi-gene families. Thus, despite their extreme homology, Skp1 and OCP2 are apparently transcribed from distinct genes (Liang et al., 1997). The F-box family includes several sub-lineages ^ Fbw, Fbl, and Fbx ^ distinguished by their associated protein^protein interaction domains (e.g., Cenciarelli et al., 1999 ; Winston et al., 1999). Fbw proteins contain
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
WD40 repeat domains; Fbl proteins harbor leucine-rich repeat domains ; and Fbx proteins contain other interaction motifs. OCP1 and NFB42 are representatives of the Fbx lineage. Its co-localization with OCP2 and the presence of a consensus F-box motif strongly suggest that OCP1 is associated with OCP2 in an OC-speci¢c SCF complex. Recent immunoblot analyses (R. Thalmann, unpublished data) have con¢rmed the presence of a cullin homolog in OC extracts. Signi¢cantly, OCP1 and OCP2 each constitute roughly 5% of the total protein in the supporting cell population ^ prima facie evidence that the putative SCF complex regulates a comparably abundant target protein. The major gap junction channel proteins in the OC ^ connexins 26 and 30 (Kikuchi et al., 1995; 2000 ; Lautermann et al., 1998) ^ are plausible targets. The similarity of the OCP2 and connexin 26 expression patterns has been noted previously (Chen et al., 1995; Yoho et al., 1997; Thalmann et al., 1997; Henzl et al., 1998). Although the role of the cochlear gap junction system is uncertain, it clearly serves a vital physiological function. Connexin 26 is the gene product most commonly implicated in non-syndromal deafness disorders (Kelsell et al., 1997 ; Kelley et al., 2000). The cochlear gap junction system may facilitate cation homeostasis. Mechanoelectrical transduction in the cochlea is achieved by stimulus-dependent modulation of a large standing K current. This strategy necessitates e¤cient removal of excess K from the hair cell interior and prompt clearance from the exterior basolateral surfaces of sensory and supporting cells alike. The ability of di¡usion to satisfy the demand for K drainage over the entire cochlear partition is questionable, and the suggestion that K clearance is unregulated is teleologically unappealing. Thus, the existence of an active mechanism for K recirculation has been proposed (see Steel, 1999, and references therein). In this scenario, the supporting cell population serves as a conduit for returning K to the stria vascularis, via the spiral ligament. Although morphologically heterogeneous, the sub-classes of the supporting cell population (Spicer and Schulte, 1994) all display a paucity of organelles, a limited protein repertoire, and an extensive gap junction system (Kikuchi et al., 1995) ^ characteristics consistent with a primary role in intercellular transport. Alternatively, the function of the cochlear gap junction system may parallel that of the cardiac gap junction system. Propagation of electrical stimuli in the heart requires gap junction-mediated intercellular ion transfer. By analogy, the cochlear system may facilitate electrical charge equilibration and synchronization in the syncytium-like supporting cell population of the
109
OC. There is evidence is for signi¢cant e¡erent innervation of some of these cells (Fechner et al., 1998). Regardless of the precise role of the cochlear gap junction system, OCP1 and OCP2 may assist in its regulation. Connexins frequently exhibit very short halflives, typically 1^5 h, implying that proteolysis is a primary mechanism for modulating gap junction-dependent intercellular coupling. It is possible that an SCF complex including OCP1 and OCP2 participates in targeted destruction of the OC gap junctions. For example, in cultured cardiac myocytes and perfused rat hearts, both proteasomal and lysosomal pathways contribute to the rapid (t1=2 = 1.3 h) turnover of connexin43, the major gap junction protein in cardiac tissue (Sa¤tz et al., 2000). Moreover, Edwards et al. (2001) have observed the presence of `annular' gap junctions in the cytoplasm of the non-sensory cells of the OC. These structures are believed to represent entire gap junction plaques that have been removed from the cell membrane preparatory to destruction. Like their substrates, F-box proteins are susceptible to proteolysis. In fact, the preponderance of evidence implicates the cognate SCF in the destruction of its F-box subunit (Galan and Peter, 1999; Zhou and Howley, 1998). It may be that F-box proteins are self-ubiquitylated by the SCF following release of the substrate. Like NFB42, the N-terminal sequence of OCP1 displays the earmarks of a protein with a short half-life. Although lacking threonine, it is rich in proline, glutamate, and serine ^ the so-called PEST motif, common in many proteins that are rapidly degraded by the proteasome (Rogers et al., 1986). If the mRNA were likewise short-lived, it would explain the di¤culty we encountered in isolating the OCP1 cDNA. We are currently developing expression systems for OCP1. Previous data from our laboratories have shown that, in vitro, OCP2 exists primarily as a homodimeric protein (Henzl et al., 1998). Several F-box proteins have likewise been shown to form homo- and heterodimeric complexes (Wolf et al., 1999; Suzuki et al., 2000; Kominami et al., 1998). Anticipating that OCP1 and OCP2 will associate, it will be interesting to learn whether the resulting complex is heterodimeric or heterotetrameric and whether it displays a¤nity for connexins 26 and/or 30. Acknowledgements This work was supported by NIDCD/NIH Award 01414. The authors thank Dr. Edward Wilcox, NIDCD/NIH, for providing an aliquot of the organ of Corti cDNA library produced in his laboratory. We thank Ms. Linda M. Schultz for her assistance in
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
110
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
the construction of the Vgt11-based organ of Corti cDNA library. We thank Dr. John D. Larson for technical assistance. References Bai, C., Sen, P., Hofmann, K., Ma, L., Goebl, M., Harper, J.W., Elledge, S.J., 1996. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the Fbox. Cell 86, 263^274. Bochtler, M., Ditzel, L., Groll, M., Hartmann, C., Huber, R., 1999. The proteasome. Annu. Rev. Biophys. Biomol. Struct. 28, 295^ 317. Callis, J., Vierstra, R.D., 2000. Protein degradation in signaling. Curr. Opin. Plant Biol. 3, 381^386. Cenciarelli, C., Chiaur, D.S., Guardavaccaro, D., Parks, W., Vidal, M., Pagano, M.., 1999. Identi¢cation of a family of human F-box proteins. Curr. Biol. 9, 1177^1179. Chen, H., Thalmann, I., Adams, J.C., Avraham, K.B., Copeland, N.G., Jenkins, N.S., Beier, D.R., Corey, D.P., Thalmann, R., Duyk, G.M., 1995. cDNA cloning, tissue distribution, and chromosomal localization of Ocp2, a gene encoding a putative transcription-associated factor predominantly expressed in the auditory organs. Genomics 27, 389^398. Connelly, C., Hieter, P., 1996. Budding yeast SKP1 encodes an evolutionarily conserved kinetochore protein required for cell cycle progression. Cell 86, 275^285. DeMartino, G.N., Slaughter, C.A., 1999. The proteasome, a novel protease regulated by multiple mechanisms. J. Biol. Chem. 274, 22123^22126. Edwards, J., Marziano, N., Becker, D., Casalotti, S., Nevill, G., Forge, A., 2001. Co-localization of connexin b2 (26) and connexin b6 (30) in cochlear gap junctions. Ann. Midwinter Res. Meet. Assoc. Res. Otolaryngol. 24, 150. Erhardt, J.A., Hynicka, W., DiBenedetto, A., Shen, N., Stone, N., Paulson, H., Pittman, R.N., 1998. A novel F box protein, NFB42, is highly enriched in neurons and induces growth arrest. J. Biol. Chem. 273, 35222^35227. Fechner, F.P., Burgess, B.J., Adams, J.C., Liberman, M.C., Nadol, J.B., Jr., 1998. Dense innervation of Deiters' and Hensen's cells persists after chronic dee¡erentation of guinea pig cochleas. J. Comp. Neurol. 400, 299^309. Galan, J.-M., Peter, M., 1999. Ubiquitin-dependent degradation of multiple F-box proteins by an autocatalytic mechanism. Proc. Natl. Acad. Sci. USA 96, 9124^9129. Hapak, R.C., Stanley, C.M., Henzl, M.T., 1996. Intrathymic distribution of the two avian thymic parvalbumins. Exp. Cell Res. 222, 234^245. Henzl, M.T., Thalmann, I., Thalmann, R., 1998. OCP2 exists as a dimer in the organ of Corti. Hear. Res. 126, 37^46. Jackson, P.K., Eldridge, A.G., Freed, E., Furstenthal, L., Hsu, J.Y., Kaiser, B.K., Reimann, J.D.R., 2000. The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases. Trends Cell Biol. 10, 429^439. Kamura, T., Koepp, D.M., Conrad, M.N., Skowyra, D., Moreland, R.J., Iliopoulos, O., Lane, W.S., Kaelin, W.G., Jr., Elledge, S.J., Conaway, R.C., Harper, J.W., Conaway, J.W., 1999a. Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 284, 657^661. Kamura, T., Conrad, M.N., Yan, Q., Conaway, R.C., Conaway, J.W., 1999b. The Rbx1 subunit of SCF and VHL E3 ubiquitin ligase activates Rub1 modi¢cation of cullins Cdc53 and Cul2. Genes Dev. 13, 2928^2933.
Kelley, P.M., Cohn, E., Kimberling, W.J., 2000. Connexin 26: required for normal auditory function. Brain Res. Rev. 32, 184^188. Kelsell, D.P., Dunlop, J., Stevens, H.P., Lench, N.J., Liang, J.N., Parry, G., Mueller, R.F., Leigh, I.M., 1997. Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature 387, 80^83. Kikuchi, T., Ikimura, R.K., Paul, D.P., Adams, J.C., 1995. Gap junctions in the rat cochlea. Anat. Embryol. 191, 101^118. Kikuchi, T., Kimura, R.S., Paul, D.L., Takasaka, T., Adams, J.C., 2000. Gap junction systems in the mammalian cochlea. Brain Res. Rev. 32, 163^166. King, R.W., Deshaies, R.J., Peters, M.M., Kirschner, M.W., 1996. How proteolysis drives the cell cycle. Science 274, 1652^1659. Kominami, K., Ochotorena, I., Toda, T., 1998. Two F-box/WD-repeat proteins Pop1 and Pop2 form hetero- and homo-complexes together with cullin-1 in the ¢ssion yeast SCF (Skp1-Cullin-1-Fbox) ubiquitin ligase. Genes Cells 3, 721^735. Krek, W., 1998. Proteolysis and the G1 /S transition: the SCF connection. Curr. Opin. Genet. Dev. 8, 36^42. Lautermann, J., ten Cate, W.J., Altenho¡, P., Grummer, R., Traub, O., Frank, H., Jahnke, K., Winterhagen, E., 1998. Expression of the gap-junction connexins 26 and 30 in the rat cochlea. Cell Tissue Res. 294, 415^420. Liang, Y., Chen, H., Asher, J.H., Chang, C.-C., Friedman, T.B., 1997. Human inner ear OCP2 cDNA maps to 5q22^5q35.2 with related sequences on chromosomes 4p16.2^4p14, 5p13^5q22, 7pter^q22, 10 and 12p13^12qter. Gene 184, 163^167. Lyapina, S.A., Correll, C.C., Kipreos, E.T., Deshaies, R.J., 1998. Human CUL1 forms an evolutionarily conserved ubiquitin ligase complex (SCF) with SKP1 and an F-box protein. Proc. Natl. Acad. Sci. USA 95, 7451^7456. Maniatis, T., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Patton, E.E., Willems, A.R., Sa, D., Kuras, L., Thomas, D., Craig, K.L., Tyers, M., 1998. Cdc53 is a sca¡old protein for multiple Cdc34/Skp1/F-box protein complexes that regulate cell division and methionine biosynthesis in yeast. Genes Dev. 12, 692^705. Peters, J.-M., 1998. SCF and APC: the Yin and Yang of cell cycle regulated proteolysis. Curr. Opin. Cell Biol. 10, 759^768. Rogers, S., Wells, R., Rechsteiner, M., 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234, 364^368. Sa¤tz, J.E., Laing, J.G., Yamada, K.A., 2000. Connexin expression and turnover: Implications for cardiac excitability. Circ. Res. 86, 723^728. Skowyra, D., Craig, K.L., Tyers, M., Elledge, S.J., Harper, J.W., 1997. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91, 209^219. Skowyra, D., Koepp, D.M., Kamura, T., Conrad, M.N., Conaway, R.C., Conaway, J.W., Elledge, S.J., Harper, J.W., 1999. Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284, 662^665. Spicer, S.S., Schulte, B.A., 1994. Di¡erences along the place-frequency map in the structure of supporting cells in the gerbil cochlea. Hear. Res. 79, 161^177. Steel, K.P., 1999. The bene¢ts of recycling. Science 285, 1363^1364. Suzuki, H., Chiba, T., Suzuki, T., Fujita, T., Ikenoue, T., Omata, M., Furuichi, K., Shikama, H., Tanaka, K., 2000. Homodimer of two F-box proteins LTrCP1 or LTrCP2 binds to IUBK for signal-dependent ubiquitination. J. Biol. Chem. 275, 2877^2884. Thalmann, R., 1976. Quantitative histo- and cytochemistry of the ear. In: C.A. Smith, J.A. Vernon (Eds.), The Handbook of Auditory and Vestibular Research Methods. CC Thomas, Spring¢eld, IL, pp. 359^419.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111 Thalmann, I., Rosenthal, H.L., Moore, B.W., Thalmann, R., 1980. Organ of Corti speci¢c polypeptides: OCP-I and OCP-II. Arch. Otorhinolaryngol. 226, 123^128. Thalmann, I., Takahashi, K., Varghese, J., Comegys, T.H., Thalmann, R., 1990. Biochemical features of major organ of Corti proteins (OCP-I and OCP-II) including partial amino acid sequence. Laryngoscope 100, 99^105. Thalmann, I., Suzuki, H., McCourt, D.W., Comegys, T.H., Thalmann, R., 1993. Partial amino acid sequences of organ of Corti proteins OCP1 and OCP2: A progress report. Hear. Res. 64, 191^ 198. Thalmann, R., Henzl, M.T., Thalmann, I., 1997. Speci¢c proteins of the organ of Corti. Acta Otolaryngol. 117, 265^268. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedures and some applications. Proc. Natl. Acad. Sci. USA 76, 4350^4353. Tyers, M., Willems, A.R., 1999. One ring to rule a superfamily of E3 ubiquitin ligases. Science 284, 601^604. Voges, D., Zwickl, P., Baumeister, W., 1999. The 26S proteasome: a
111
molecular machine designed for controlled proteolysis. Annu. Rev. Biochem. 68, 1015^1068. Wilcox, E.R., Fex, J., 1992. Construction of a cDNA library from microdissected guinea pig organ of Corti. Hear. Res. 62, 124^ 126. Winston, J.T., Koepp, D.M., Zhu, C., Elledge, S.J., Harper, J.W., 1999. A family of mammalian F-box proteins. Curr. Biol. 9, 1180^1182. Wolf, D.A., McKeon, F., Jackson, P.K., 1999. F-box/WD-repeat proteins pop1p and Sud1p/Pop2p form complexes that bind and direct the proteolysis of cdc18p. Curr. Biol. 9, 373^376. Yoho, E.R., Thomopoulos, G.N., Thalmann, I., Thalmann, R., Schulte, B.A., 1997. Localization of organ of Corti protein II in the adult and developing gerbil cochlea. Hear. Res. 104, 47^56. Yu, Z.-K., Gervais, J.L.M., Zhang, H., 1998. Human CUL-1 associates with the SKP1/SKP2 complex and regulates p21CIP1=WAF1 and cyclin D proteins. Proc. Natl. Acad. Sci. USA 95, 11324^11329. Zhou, P., Howley, P.M., 1998. Ubiquitination and degradation of the substrate recognition subunits of SCF ubiquitin-protein ligases. Mol. Cell 2, 571^580.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
OCP1, an F-box protein, co-localizes with OCP2/SKP1 in the cochlear epithelial gap junction region Michael T. Henzl
a;
*, Julie O'Neal a , Richard Killick c , Isolde Thalmann b , Ruediger Thalmann b
a
Department of Biochemistry, University of Missouri-Columbia, Columbia, MO 65211, USA Department of Otolaryngology, Washington University School of Medicine, St. Louis, MO, USA Department of Neuroscience, Institute of Psychiatry, De Crespigny Park, Denmark Hill, London SE5 8AF, UK b
c
Received 11 November 2000; accepted 17 April 2001
Abstract Immunohistochemical data indicate that OCP1 co-localizes exactly with OCP2 in the epithelial gap junction region of the guinea pig organ of Corti (OC). Despite the abundance of OCP1 in the OC, gaining access to its coding sequence ^ and, in particular, the 5P end of the coding sequence ^ proved unexpectedly challenging. The putative full-length OCP1 cDNA ^ 1180 nucleotides in length ^ includes a 67 nucleotide 5P leader sequence, 300 codons (including initiation and termination signals), and a 216 nucleotide 3P untranslated region. The cDNA encodes a protein having a predicted molecular weight of 33 700. The inferred amino acid sequence harbors an F-box motif spanning residues 52^91, consistent with a role for OCP1 and OCP2 in the proteasome-mediated degradation of select OC proteins. Although OCP1 displays extensive homology to an F-box protein recently cloned from rat brain (NFB42), clustered sequence non-identities indicate that the two proteins are transcribed from distinct genes. The presumptive human OCP1 gene was identified in the human genome databank. Located on chromosome 1p35, the inferred translation product exhibits 94% identity with the guinea pig OCP1 coding sequence. ß 2001 Elsevier Science B.V. All rights reserved. Key words: Organ of Corti ; Gap junction; Proteasome; F-box protein; Ubiquitin ; Connexin
1. Introduction In 1980, two-dimensional polyacrylamide gel electrophoresis analyses revealed two abundant proteins in the organ of Corti (OC), with apparent molecular weights of 37 000 and 22 500 (Thalmann et al., 1980). Each
* Corresponding author. Tel.: +1 (573) 882 7485; Fax: +1 (573) 884 4812; E-mail: [email protected] Abbreviations: BSA, bovine serum albumin; Cul1, a gene product from the cullin family, a component of SCF complexes; FITC, £uorescein isothiocyanate; NFB42, a neuronal F-box protein with a high degree of homology to OCP1; OC, organ of Corti; OCP1, an abundant protein (Mr 37 000) in the OC, an F-box protein; OCP2, an abundant protein (Mr 22 500) in the OC, a homolog of SKP1; PBS, phosphate-bu¡ered saline; PCR, polymerase chain reaction; PN, postnatal; Rbx1, a component of SCF complexes; SCF complexes, novel ubiquitin^protein ligases consisting of Skp1, Cul1 (or a homolog), an F-box protein, and Rbx1; Skp1, a component of SCF complexes
comprised roughly 5% of the total protein in the nonsensory cell population. In recognition of their abundance in the OC and apparent absence in other tissues, they were called OCP1 and OCP2, respectively. Two decades later, their physiological roles remain conjectural. The burdensome task of collecting amino acid sequence data for OCP1 and OCP2 (Thalmann et al., 1990 ; 1993) facilitated isolation of the OCP2 cDNA sequence, reported in 1995 (Chen et al., 1995). Cloning of OCP1, however, has proven more di¤cult. It was subsequently learned that OCP2 exhibits extreme sequence homology to Skp1, a eukaryotic regulatory protein (see discussion in Thalmann et al., 1997). Skp1 is a central component in a novel class of ubiquitin^protein ligases commonly called SCF (Skp1, Cullin, F-box protein) complexes (Jackson et al., 2000 ; Callis and Vierstra, 2000 ; Krek, 1998; Peters, 1998). These multi-subunit structures carry out polyubiquitylation reactions
0378-5955 / 01 / $ ^ see front matter ß 2001 Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 5 9 5 5 ( 0 1 ) 0 0 2 8 5 - 4
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
that target select proteins for destruction by the 26S proteasome (DeMartino and Slaughter, 1999; Bochtler et al., 1999; Voges et al., 1999). Within the SCF complex, Skp1 contacts at least two other proteins ^ one belonging to the cullin family, the other harboring a sequence motif called the F-box (Bai et al., 1996). The recent emergence of the SCF paradigm promoted speculation that OCP1 would prove to be an F-box protein. And, in fact, the inferred amino acid sequence for an F-box family member recently cloned from rat brain displayed agreement with the available data for OCP1 (Erhardt et al., 1998). Long before the discovery of the Skp1^F-box association, however, the roughly stoichiometric expression levels of OCP1 and OCP2 had suggested a collaborative function. We herein present compelling immunohistochemical and molecular evidence that OCP1 and OCP2 exist as a complex in the OC.
101
ACCAGCCTTTCCAGTAGACAGCGT; ocp1-7s, GACAGCGTCAGGAAGTACTTCGCGTCCTCTTTCGAGTGGTGTCGCAAGGC ; ocp1-8as, ATCCTGGGGGAATCCCACCCCACTGTCTCCGGGTATCTCCTCCACCCTCC; ocp1-9s, ACAAGTTGTTGACCTGCAGGCCGAGGGCTACTGGGAGGAGCTGCTGGACACC ; ocp1-10as, AGCCGTCCCCGCCATGTTCCACGTCACACCAGCCCTCCAAGTCCTCTTCCCG; ocp1-11as, ACGGGTTGCGCAGCAGG; ocp-12as, GCGCCTACGCTTGCTGAGGA; gt11s, ATTGGTGGCGACGACTCCTGGAGCCCGTCAGTATC; m13rext, CAGGAAACAGCTATGACCATGATTACGC ; 2.3. cDNA
Bacteria were cultured on LB agar (Fisher Scienti¢c, Pittsburgh, PA, USA) or LB broth (Bio101, obtained from Midwest Scienti¢c, St. Louis, MO, USA). All cultures were supplemented with 300 Wg/ml ampicillin (Sigma-Aldrich, St. Louis, MO, USA). Small-scale plasmid isolations were performed with the Wizard plasmid puri¢cation kit (Promega, Madison, WI, USA), on bacteria collected from 3^5 ml LB broth cultures. Larger-scale isolations were performed with the Qiagen Maxi Kit (Qiagen, Valencia, CA, USA), on bacteria harvested from 100 ml LB cultures. Prior to automated cycle sequencing, DNA samples were extracted with acid (pH 4.0) phenol/CHCl3 , then precipitated with ethanol using Pellet Paint NF (Novagen, Madison, WI, USA) as a co-precipitant. After rinsing with 70% ethanol, pellets were resuspended in water. Sequencing samples contained approximately 1 Wg of DNA and 20 pmol of the appropriate oligonucleotide primer, in a volume of 25 Wl. All other chemicals were reagent grade and were purchased from Fisher Scienti¢c or Sigma-Aldrich.
Two sources of cDNA were employed as template for the PCR-based cloning procedures described below : the Wilcox^Fex library (Wilcox and Fex, 1992) and an OC cDNA library prepared in this laboratory. For construction of the latter, polyadenylated RNA was isolated from 200 Wg of guinea pig OC, freeze-dried and dissected under rigorously controlled conditions (Thalmann, 1976), employing the MicroPoly(A)Pure mRNA Isolation Kit (Ambion, Austin, TX, USA). Doublestranded cDNA was prepared using the SMART1 cDNA Library Construction Kit (Clontech Laboratories, Palo Alto, CA, USA). After ligating EcoRI-NotISalI adapters to the cDNA and phosphorylating the adapters, the cDNA was size-fractionated by gel ¢ltration, retaining all material greater than 0.5 kb in length. The pooled cDNA was collected by EtOH precipitation, ligated to Vgt11, and packaged with Gigapack III Gold packaging extracts (Stratagene, La Jolla, CA, USA). The resulting library (2.3U106 clones) was ampli¢ed on 35 150 mm agar plates. After clari¢cation, the lysates were stored at 4³C. Several aliquots of the library were stored at 370³C, after addition of dimethyl sulfoxide to a ¢nal concentration of 7%. The Wilcox^Fex cDNA utilized as a template for PCR ampli¢cation was isolated from an aliquot of the Wilcox^Fex library (approx. 2U108 cfu) cultured on LB/amp. cDNA was extracted from our Vgt11-based library using the procedure described in Maniatis et al. (1982).
2.2. Oligonucleotides
2.4. PCR ampli¢cation
The following polymerase chain reaction (PCR) and sequencing primers were synthesized at the University of Missouri DNA Core Facility : ocp1-1s, GGIGARGARGAYCTIGARGG ; ocp1-2as, RTCRTCYTGIGGRAAYTCIACICC ; ocp1-3s, TTGAACATGGCGGGGACGGCTGGA; ocp1-4s, GTGGAGGAGATACCCGGAGACAGT ; ocp1-5as, CTCGGGCTCCGA-
PCR reactions were carried out in thin-walled 0.5 ml tubes in a Thermolyne TempTronic0 thermal cycler. Denaturation steps were performed for 30 s at either 94³C with Taq polymerase (Promega) or 95³C with Pfu Turbo Polymerase (Stratagene). Annealing steps were carried out for 30 s at the temperatures speci¢ed in the ¢gure legends. Extension reactions were carried
2. Materials and methods 2.1. General
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
102
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
out for the speci¢ed times at 72³C. Each cycling protocol included a ¢nal 10 min extension at 72³C. Unless otherwise stated, Taq polymerase was used for ampli¢cation. The Taq polymerase reaction bu¡er contained 50 mM KCl, 10 mM Tris^HCl (pH 9.0 at 25³C), 1.5 mM MgCl2 , 0.1% Triton X-100, and 0.20 mM dNTPs. The Pfu Turbo polymerase reaction bu¡er contained 20 mM Tris^HCl (pH 8.8 at 25³C), 10 mM KCl, 10 mM (NH4 )2 SO4 , 2.0 mM MgSO4 , 0.1 mg/ml nuclease-free bovine serum albumin (BSA), 0.1% Triton X-100, and 0.20 mM dNTPs. Reaction products of interest were puri¢ed by agarose gel electrophoresis, recovered with the QIAEX2 gel extraction kit (Qiagen), and cloned into pCR2.1-TOPO (Invitrogen, Carlsbad, CA, USA). Prior to cloning, products resulting from ampli¢cation with Pfu Turbo polymerase were treated with 0.2 mM dATP and Taq polymerase (1 U) for 10 min at 72³C, in order to append deoxyadenylate moieties to the 3P termini. 2.5. Antibody production Murine monoclonal antibodies were raised against an internal fragment of guinea pig OCP1, selected on the basis of its high antigenicity index. The peptide, EIPGDSVEFPQDDSV (synthesized by the Protein Chemistry Laboratory at Washington University, St. Louis, MO, USA), was conjugated to keyhole limpet hemocyanin or BSA using the corresponding Imject0 kits from Pierce Chemical Co. (Rockford, IL, USA). The keyhole limpet hemocyanin conjugate was employed for immunization, the BSA conjugate for screening. Both conjugates were puri¢ed before use by dialysis as described in the Pierce protocol. Immunization and hybridoma production were performed as described previously for the avian parvalbumins, ATH and CPV3 (Hapak et al., 1996). Hybridoma supernatants were screened for anti-OCP1 activity by enzyme-linked immunosorbent assay and immunoblotting, using the peptide^BSA conjugate as antigen. Positive clones were puri¢ed by limiting dilution. The anti-OCP2 antibody was raised in rabbit against residues 1^16. Its speci¢city has been described previously (Chen et al., 1995) 2.6. Immunoblot Freeze-dried samples of OC and whole brain were resolved on 15% sodium dodecylsulfate polyacrylamide minigels. Proteins were electrophoretically transferred onto Immobilon-P as described by Towbin et al. (1979). The resulting replicas were blocked with Trisbu¡ered saline containing 0.1% casein and 0.1% Tween 20, incubated with primary antibody (1:20 dilution in blocking solution, 2 h, room temperature), washed with
Fig. 1. Anti-OCP1 antibody speci¢city. The production of a murine monoclonal antibody against guinea pig OCP1 is described in Section 2. The speci¢city of that preparation is shown in the accompanying immunoblot. Broad-range molecular mass standards (in kDa) are shown on the left; lane 1, 5 Wg (dry weight) guinea pig OC; lanes 2 and 3, 6 and 60 Wg (dry weight) of whole guinea pig brain.
blocking solution (3U5 min), and then incubated with horseradish peroxidase-conjugated goat anti-mouse IgG (1:5000 dilution in blocking solution, 2 h, room temperature). After washing (2U5 min with blocking solution, 2U5 min with horseradish peroxidase bu¡er), the antigen^antibody complexes were visualized by chemiluminescence, using the SuperSignal West Pico Chemiluminescent Substrate Kit (Pierce). Apparent molecular weights were deduced by comparison to prestained broad-range standards (Bio-Rad, Hercules, CA, USA). 2.7. Immunohistochemistry Day 1 postnatal (PN) guinea pig cochleae were removed and ¢xed in 3.7% formaldehyde/phosphate-bu¡ered saline (PBS) for 2 h, then decalci¢ed and cryoprotected in 0.5 M ethylenediaminetetraacetic acid, 18% sucrose, PBS for 7 days. The tissue was embedded in low melting point agarose and mounted in Tissuetek o.c.t. compound (Agar, UK), then rapidly frozen with Cryospray (Bright Instruments, UK). 8 Wm thick sections were collected on multi-well gelatin-coated slides (ICN, UK). Tissue sections were permeabilized and pre-blocked with 3% BSA, PBS, 0.1% Tween, for 30 min at room
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
temperature in a humidity chamber. Anti-OCP1 (mouse) and -OCP2 (rabbit) antibodies were applied in PBS, at 1:50 and 1:200 dilutions, respectively, for 2 h at room temperature. Following removal of excess primary antibody with PBS (3U10 min), £uorescein isothiocyanate (FITC) anti-rabbit and Texas red antimouse conjugated secondary antibodies were applied in PBS at a 1:250 dilution. After removal of excess antibody with PBS (3U10 min), the sections were coated with anti-fade mounting medium (Dako, UK) and covered with coverslips. Images were captured using a Kodak DS410 digital camera, mounted on an Axioskope £uorescence microscope. 3. Results 3.1. Speci¢city of the anti-OCP1 antibody Tissue samples from OC and whole brain were solu-
103
bilized, resolved by sodium dodecyl sulfate polyacrylamide gel electrophoresis, electrophoretically transferred to nitrocellulose, and probed with a murine antibody raised against an internal fragment of OCP1. As shown in Fig. 1, the antibody yields a single strong signal when used to probe extracts of the OC. The apparent molecular weight (Mr 37 500) of the target protein coincides with that previously determined for OCP1. The weak signal near 32 000 is believed to represent a proteolytic degradation product. The cDNA sequence (see below) suggests that OCP1 should be highly susceptible to proteolysis. The absence of detectable signals from a 12-fold larger quantity of brain tissue testi¢es to the monospeci¢city of the antibody preparation. 3.2. Comparative immunohistochemistry of OCP1 and OCP2 We have previously examined the cochlear distribu-
Fig. 2. Immunohistochemical analysis of OCP1 and OCP2 expression in the guinea pig cochlea. A cross-section of the basal coil from a day 1 PN guinea pig cochlea, simultaneously probed with anti-OCP1 (A) and anti-OCP2 (B) antibodies, demonstrates exact co-localization of the two antigens. The pattern of £uorescence sharply de¢nes the OC and adjacent non-sensory epithelia. The signal is particularly intense in the region of the outer sulcus and the root cells (left), the processes of which appear to extend into the substance of the spiral ligament. The lateral wall tissue itself, however, is unstained. Labeling is likewise intense in the inner sulcus region, with a funnel-like extension towards the lip of the spiral limbus. The interdental cells yield a faint signal; however, staining is absent in the spiral limbus. Although the phalangeal processes of the Deiters cells are intensely labeled, there is no staining of the hair cells proper. This pattern corresponds closely to the regions interconnected by the epithelial gap junction system of the cochlea (Kikuchi et al., 1995; 2000).
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
104
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
Fig. 3. Longitudinal variation in OCP1 and OCP2 expression. Cross-sections were obtained from a day 1 PN guinea pig cochlea at several points along the cochlear axis. The sections were simultaneously treated with mouse anti-OCP1 and rabbit anti-OCP2 antibodies, followed by appropriate £uorophore-tagged secondary antibodies. The red-stained images reveal the distribution of OCP1; the green-stained images reveal the distribution of OCP2. A low-power dark ¢eld image of one-half of the whole cochlea is displayed in the right-hand panel.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
tion of OCP2 in guinea pig (Chen et al., 1995) and gerbil (Yoho et al., 1997). The protein is expressed exclusively, and at very high levels, in the supporting cells of the OC and adjacent non-sensory epithelia, including inner and outer sulcus cells, root cells and their processes and the interdental cells. To determine whether OCP1 displays a similar distribution, OC sections from day 1 PN guinea pig were simultaneously probed with antibodies against OCP1 and OCP2. (The day 1 PN guinea pig cochlea is developmentally comparable to a day 20 PN rat cochlea.) These duallabeling studies unequivocally demonstrate that the two proteins are expressed by the identical cell population. Fig. 2 shows a section simultaneously treated with a mouse anti-OCP1 and rabbit anti-OCP2, followed by Texas red-conjugated goat anti-mouse IgG and FITCconjugated goat anti-rabbit IgG. It is apparent that OCP1 (panel A) exactly co-localizes with OCP2 (panel B), both proteins being expressed solely by the cells in the epithelial gap junction region. Depicting adjacent sections from each of the 4.5 turns of the day 1 PN guinea pig cochlea, Fig. 3 emphasizes the restricted expression pattern of these two cochlear proteins. For orientation, the right-hand panel of Fig. 3 presents a dark ¢eld low-power image of one half of a midmodiolar section of the day 1 PN guinea pig cochlea.
105
3.3. OCP1 cDNA cloning The cDNA sequence for OCP1 (Fig. 4) was accessed by PCR. Degenerate sense and antisense primers (ocp11s and ocp1-2as in Fig. 5A) were designed from existing internal amino acid sequence data that spanned 35 residues (Thalmann et al., 1993). PCR was performed, using this primer pair, on 50 ng of cDNA isolated from an aliquot of our Vgt11-based OC library. The reaction yielded a complex mixture of products, including a faint band (Fig. 5A, fragment 1) that migrated ahead of the 154 bp marker. The sequence of this product includes nucleotides 464^568 in Fig. 4. A modi¢ed RACE-PCR strategy was employed to isolate the remainder of the cDNA sequence from our Vgt11-based library (Fig. 5B). To amplify a fragment corresponding to the 3P half of the coding sequence, we used the sense primer ocp1-3s, based on sequence from fragment 1 (nucleotides 495^518 in Fig. 4), in combination with oligo(dT)30 . A second round of PCR, employing the nested sense primer ocp1-4s (nucleotides 520^543 in Fig. 4) and oligo(dT)30 , yielded a major product (fragment 2, Fig. 5B) that virtually comigrated with a 653 bp marker. The sequence of this fragment spanned nucleotides 521^1181 in Fig. 4; the inferred amino acid sequence included 147 codons, a TGA termination signal, and a 211 nucleotide 3P UTR. An analogous approach was undertaken to isolate
Fig. 4. OCP1 cDNA sequence. The 903 nt coding sequence (299 amino acid residues plus start and stop codons) is £anked by a 67 nt 5P UTR and 210 nt 3P UTR. The putative polyadenylation signal (nt 1161^1166) is underlined. The GenBank accession number is AY029175.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
106
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
Fig. 5. PCR ampli¢cation of guinea pig OCP1 cDNA. (A) Acquisition of a core sequence. Degenerate PCR primers, based on existing amino acid sequence data for OCP1, were used to amplify an aliquot of our Vgt11-based guinea pig OC cDNA library. The translated sequence of the 102 bp product (fragment 1) agreed with the amino acid data at all but one position (indicated by the lowercase `r'). (B) Extension of the cDNA sequence. The 3P half of the OCP1 cDNA (fragment 2) was obtained by nested PCR on an aliquot of the Vgt11-based library, using oligo(dT)30 in combination with ¢rst ocp1-3s, then ocp1-4s. A portion of the 5P half of the coding sequence (fragment 3) was obtained with a sense primer based on £anking Vgt11 vector sequence and the antisense primer, ocp1-5as. (C) Strategy for obtaining the 5P end of the OCP1 cDNA. PCR was performed on an aliquot of the Wilcox^Fex guinea pig OC cDNA library, using ocp1-7s and ocp1-8as. A second round was then performed using the (nested) primers, ocp1-9s and ocp1-10as. These reactions were designed to selectively amplify the pool of cDNA constructs containing OCP1 coding information. This pool was then subjected to two additional rounds of PCR, employing a sense primer (M13r) located in the £anking vector sequence and nested antisense primers ^ ¢rst ocp1-11as, then ocp1-12as. One of the products (fragment 4) in the resulting complex mixture harbored an initiation codon and downstream sequence matching sequence from fragment 3. (D) Ampli¢cation of the putative full-length OCP1 cDNA. An aliquot of cDNA isolated from the Wilcox^Fex library was ampli¢ed, employing sense and antisense primers corresponding to the extreme 5P and 3P ends of the cDNA. The sequence of the larger product (fragment 5) con¢rmed its identity as the OCP1 cDNA.
the 5P end of the OCP1 cDNA. Ampli¢cation with a sense primer based on adjacent vector sequence (gt11s) and an OCP1-speci¢c antisense primer (ocp1-5as, complementary to nucleotides 903^938 in Fig. 4). The resulting fragment (fragment 3, Fig. 5B, including nucleotides 200^938 in Fig. 4) harbored an F-box motif (residues 53^94), but lacked an initiation codon. Repeated attempts failed to yield additional upstream sequence. Analogous experiments were also performed on aliquots of cloned cDNA from the Wilcox^Fex library (Wilcox and Fex, 1992). For these PCR reactions, ocp1-5as was used in combination with a pSport1-based primer, M13r. These attempts likewise failed to yield additional 5P sequence information.
Our inability to amplify the entire 5P end of the cDNA suggested that full-length reverse transcripts of the OCP1 mRNA were rare ^ perhaps due to an intrinsic instability of the OCP1 message or to high secondary structure content. A concerted e¡ort was made, therefore, to enrich for OCP1 sequences. The approach ^ diagrammed in Fig. 5C ^ exploited the circularity of the pSport1 cloning vector used to construct the Wilcox^Fex library. Nested primer pairs were designed for the complete ampli¢cation of any plasmid harboring an OCP1 cDNA insert. An initial round of PCR was performed on an aliquot of the Wilcox^Fex cDNA library, using the ocp1-7s/ocp1-8as pair and Pfu Turbo polymerase, with an annealing/extension temperature of 72³C. An aliquot of the resulting PCR reaction was
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
107
Fig. 6. Comparison of guinea pig OCP1 and rat NFB42 primary structures. Sequence non-identities are shown in boldface type. The hyphens in the NFB42 sequence indicate insertions in the OCP1 sequence.
then used as the template in a second round of PCR, employing the ocp1-9s/ocp1-10as primer pair and the identical thermal cycling protocol. At this point, two additional rounds of nested PCR were performed using the Pfu Turbo polymerase. For both reactions, an OCP1-speci¢c antisense primer (¢rst ocp1-11as, then ocp1-12as) was utilized in conjunction with a sense primer (M13r) based on £anking pSport1 sequence. The M13r/ocp1-12as reaction showed a complex mixture of products (Fig. 5C). The faint band having an approximate length of 525 bp (fragment 4, Fig. 5C) was chosen for further examination. This fragment was puri¢ed by agarose gel electrophoresis, then cloned into the pCR2.1-TOPO vector, after appending overhanging As at the 3P terminus with Taq polymerase. Four transformants, all harboring inserts of the expected length, were submitted for sequence analysis. One of the four harbored a putative start codon, followed by sequence that showed strong homology to the N-terminal sequence of NFB42, an Fbox protein recently cloned from rat brain (Erhardt et al., 1998), and ultimately merged with the existing OCP1 sequence data. This clone, which included nucleotides 1^442 in Fig. 4, also contained a 67 nucleotide
5P untranslated region. In the remaining three transformants, a portion of the putative OCP1 sequence was appended to sequence that neither bore any homology to NFB42 nor harbored an initiation signal. Sense and antisense primers (ocp1-13s and ocp1-14as) ^ corresponding to sequence near the 5P and 3P termini, respectively ^ were designed to permit ampli¢cation of the entire cDNA from the Wilcox^Fex library, employing Pfu Turbo polymerase. The PCR reaction yielded two products, the larger of which was approximately 1150 bp in length (Fig. 5D). This sequence ^ minus the initiation codon ^ encodes a protein having a predicted molecular weight of 33 700. The primary sequences of guinea pig OCP1 and rat NFB42 are compared in Fig. 6. The two proteins are highly homologous, exhibiting 82% identity (246 of 299 residues). Excluding the ¢rst 50 residues ^ which harbor nearly half of the non-identities ^ increases the identity to 89%. The majority of sequence di¡erences occur in clusters: 16 of 17 residues between 20 and 36; nine of 12 residues between 243 and 254, including a three residue insertion (250^252); all ¢ve residues between 104 and 108, including an insertion at position 106; and four of ¢ve between residues 43 and 47. The remaining
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
108
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
non-identities, scattered throughout the cDNA sequence, appear to be the result of single nucleotide substitutions. 4. Discussion Since their discovery two decades ago, there has been speculation that OCP1 and OCP2 are partners in a multi-subunit complex. Our co-localization studies unequivocally demonstrate that the two proteins are produced by a common cell population. As shown previously for OCP2 (Chen et al., 1995; Yoho et al., 1997), the expression of OCP1 is likewise restricted to the supporting cells and adjacent non-sensory cells comprising the epithelial gap junction region of the postnatal cochlea. In fact, the expression patterns are indistinguishable. We have also described the cloning of a novel F-box protein from guinea pig OC. Near perfect agreement with previously reported amino acid sequence data argues persuasively for identity to OCP1. We should emphasize that the core of the cDNA sequence was initially ampli¢ed from a Vgt11-based cDNA library constructed with mRNA from freeze-dried, dissected OC. In this tissue preparation technique ^ thoroughly described by Thalmann (1976) ^ the cochlea is quickfrozen in situ and freeze-dried at low temperature to preserve chemical and structural integrity. Then, under precisely regulated conditions of temperature and humidity, the freeze-dried OC is meticulously dissected away from adjacent tissue. This approach ensures that this cDNA is an OC-derived sequence. 4.1. Comparison of OCP1 and NFB42 sequences An F-box protein called NFB42 was recently isolated from rat neurons (Erhardt et al., 1998). The authors commented on the similarity between the NFB42 sequence and the partial amino acid sequence previously published for guinea pig OCP1 (Thalmann et al., 1993). Indeed, OCP1 and NFB42 are highly homologous, with sequence identity exceeding 80%. However, the proteins display several regions of divergent sequence, indicating that they are distinct gene products. Most notably, the region spanning residues 20^36 di¡ers at 16 of 17 positions, and the corresponding nucleotide sequence displays just 38% identity. Moreover, the OCP1 sequence includes four additional residues ^ a consequence of a three residue insertion at positions 252^254 and a single residue insertion at position 106. As revisions to this article were being ¢nalized, the presumptive OCP1 gene was identi¢ed in the human genome database. It is located on chromosome 1p35, an area that has been implicated in hereditary non-syn-
dromic deafness disorders. The putative human OCP1 translation product displays 94% identity with the guinea pig ortholog ^ including 100% identity in the region between residues 20 and 36 ^ and includes both insertions. 4.2. Are OCP1 and OCP2 components of on OC-speci¢c SCF? Twenty years after their discovery, the physiological role of OCP1 and OCP2 is unknown. Homology to Skp1 suggests a functionally equivalent role for OCP2 in the cochlea. Many cellular processes are regulated by selective proteolysis (King et al., 1996). Proteins destined for destruction are conjugated to polyubiquitin, which provides a recognition signal for the 26S proteasome (DeMartino and Slaughter, 1999; Bochtler et al., 1999 ; Voges et al., 1999). Polyubiquitylation can be targeted through the use of speci¢c E3 ubiquitin ligases. Skp1 is a key component in a speci¢c class of multisubunit ubiquitin^protein ligases known as SCF complexes. Discovered and ¢rst characterized in Saccharomyces cerevisiae (Bai et al., 1996 ; Connelly and Hieter, 1996), SCFs are present in all eukaryotic species (e.g., Jackson et al., 2000). SCF is an acronym for Skp1, cullin, and F-box protein. The cullin component ^ named for the Cul1 gene product (aka Cdc53) in yeast ^ furnishes a sca¡old for complex assembly (e.g., Lyapina et al., 1998 ; Patton et al., 1998; Yu et al., 1998). Skp1 and Cdc34 (the ubiquitin-conjugating enzyme per se) interact directly with cullin, and the F-box protein binds to Skp1 through an F-box motif present in the N-terminal half of the sequence. The F-box protein dictates target protein speci¢city (Skowyra et al., 1997), and the various SCF ubiquitin ligases are denoted by the identity of the associated F-box component. For example, SCFCdc4 denotes the SCF complex containing Cdc4, the original F-box protein discovered in yeast. Interactions with the C-terminal domain of the F-box protein presumably position the target protein for ubiquitylation by Cdc34. Besides the three subunits already mentioned, the complex also contains Rbx1 (Kamura et al., 1999a,b; Tyers and Willems, 1999). The latter interacts with the cullin and F-box components of the SCF and assists in the recruitment of Cdc34 (Skowyra et al., 1999). The Skp1, Cul1, and Cdc4 homologs in higher eukaryotes form multi-gene families. Thus, despite their extreme homology, Skp1 and OCP2 are apparently transcribed from distinct genes (Liang et al., 1997). The F-box family includes several sub-lineages ^ Fbw, Fbl, and Fbx ^ distinguished by their associated protein^protein interaction domains (e.g., Cenciarelli et al., 1999 ; Winston et al., 1999). Fbw proteins contain
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
WD40 repeat domains; Fbl proteins harbor leucine-rich repeat domains ; and Fbx proteins contain other interaction motifs. OCP1 and NFB42 are representatives of the Fbx lineage. Its co-localization with OCP2 and the presence of a consensus F-box motif strongly suggest that OCP1 is associated with OCP2 in an OC-speci¢c SCF complex. Recent immunoblot analyses (R. Thalmann, unpublished data) have con¢rmed the presence of a cullin homolog in OC extracts. Signi¢cantly, OCP1 and OCP2 each constitute roughly 5% of the total protein in the supporting cell population ^ prima facie evidence that the putative SCF complex regulates a comparably abundant target protein. The major gap junction channel proteins in the OC ^ connexins 26 and 30 (Kikuchi et al., 1995; 2000 ; Lautermann et al., 1998) ^ are plausible targets. The similarity of the OCP2 and connexin 26 expression patterns has been noted previously (Chen et al., 1995; Yoho et al., 1997; Thalmann et al., 1997; Henzl et al., 1998). Although the role of the cochlear gap junction system is uncertain, it clearly serves a vital physiological function. Connexin 26 is the gene product most commonly implicated in non-syndromal deafness disorders (Kelsell et al., 1997 ; Kelley et al., 2000). The cochlear gap junction system may facilitate cation homeostasis. Mechanoelectrical transduction in the cochlea is achieved by stimulus-dependent modulation of a large standing K current. This strategy necessitates e¤cient removal of excess K from the hair cell interior and prompt clearance from the exterior basolateral surfaces of sensory and supporting cells alike. The ability of di¡usion to satisfy the demand for K drainage over the entire cochlear partition is questionable, and the suggestion that K clearance is unregulated is teleologically unappealing. Thus, the existence of an active mechanism for K recirculation has been proposed (see Steel, 1999, and references therein). In this scenario, the supporting cell population serves as a conduit for returning K to the stria vascularis, via the spiral ligament. Although morphologically heterogeneous, the sub-classes of the supporting cell population (Spicer and Schulte, 1994) all display a paucity of organelles, a limited protein repertoire, and an extensive gap junction system (Kikuchi et al., 1995) ^ characteristics consistent with a primary role in intercellular transport. Alternatively, the function of the cochlear gap junction system may parallel that of the cardiac gap junction system. Propagation of electrical stimuli in the heart requires gap junction-mediated intercellular ion transfer. By analogy, the cochlear system may facilitate electrical charge equilibration and synchronization in the syncytium-like supporting cell population of the
109
OC. There is evidence is for signi¢cant e¡erent innervation of some of these cells (Fechner et al., 1998). Regardless of the precise role of the cochlear gap junction system, OCP1 and OCP2 may assist in its regulation. Connexins frequently exhibit very short halflives, typically 1^5 h, implying that proteolysis is a primary mechanism for modulating gap junction-dependent intercellular coupling. It is possible that an SCF complex including OCP1 and OCP2 participates in targeted destruction of the OC gap junctions. For example, in cultured cardiac myocytes and perfused rat hearts, both proteasomal and lysosomal pathways contribute to the rapid (t1=2 = 1.3 h) turnover of connexin43, the major gap junction protein in cardiac tissue (Sa¤tz et al., 2000). Moreover, Edwards et al. (2001) have observed the presence of `annular' gap junctions in the cytoplasm of the non-sensory cells of the OC. These structures are believed to represent entire gap junction plaques that have been removed from the cell membrane preparatory to destruction. Like their substrates, F-box proteins are susceptible to proteolysis. In fact, the preponderance of evidence implicates the cognate SCF in the destruction of its F-box subunit (Galan and Peter, 1999; Zhou and Howley, 1998). It may be that F-box proteins are self-ubiquitylated by the SCF following release of the substrate. Like NFB42, the N-terminal sequence of OCP1 displays the earmarks of a protein with a short half-life. Although lacking threonine, it is rich in proline, glutamate, and serine ^ the so-called PEST motif, common in many proteins that are rapidly degraded by the proteasome (Rogers et al., 1986). If the mRNA were likewise short-lived, it would explain the di¤culty we encountered in isolating the OCP1 cDNA. We are currently developing expression systems for OCP1. Previous data from our laboratories have shown that, in vitro, OCP2 exists primarily as a homodimeric protein (Henzl et al., 1998). Several F-box proteins have likewise been shown to form homo- and heterodimeric complexes (Wolf et al., 1999; Suzuki et al., 2000; Kominami et al., 1998). Anticipating that OCP1 and OCP2 will associate, it will be interesting to learn whether the resulting complex is heterodimeric or heterotetrameric and whether it displays a¤nity for connexins 26 and/or 30. Acknowledgements This work was supported by NIDCD/NIH Award 01414. The authors thank Dr. Edward Wilcox, NIDCD/NIH, for providing an aliquot of the organ of Corti cDNA library produced in his laboratory. We thank Ms. Linda M. Schultz for her assistance in
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
110
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111
the construction of the Vgt11-based organ of Corti cDNA library. We thank Dr. John D. Larson for technical assistance. References Bai, C., Sen, P., Hofmann, K., Ma, L., Goebl, M., Harper, J.W., Elledge, S.J., 1996. SKP1 connects cell cycle regulators to the ubiquitin proteolysis machinery through a novel motif, the Fbox. Cell 86, 263^274. Bochtler, M., Ditzel, L., Groll, M., Hartmann, C., Huber, R., 1999. The proteasome. Annu. Rev. Biophys. Biomol. Struct. 28, 295^ 317. Callis, J., Vierstra, R.D., 2000. Protein degradation in signaling. Curr. Opin. Plant Biol. 3, 381^386. Cenciarelli, C., Chiaur, D.S., Guardavaccaro, D., Parks, W., Vidal, M., Pagano, M.., 1999. Identi¢cation of a family of human F-box proteins. Curr. Biol. 9, 1177^1179. Chen, H., Thalmann, I., Adams, J.C., Avraham, K.B., Copeland, N.G., Jenkins, N.S., Beier, D.R., Corey, D.P., Thalmann, R., Duyk, G.M., 1995. cDNA cloning, tissue distribution, and chromosomal localization of Ocp2, a gene encoding a putative transcription-associated factor predominantly expressed in the auditory organs. Genomics 27, 389^398. Connelly, C., Hieter, P., 1996. Budding yeast SKP1 encodes an evolutionarily conserved kinetochore protein required for cell cycle progression. Cell 86, 275^285. DeMartino, G.N., Slaughter, C.A., 1999. The proteasome, a novel protease regulated by multiple mechanisms. J. Biol. Chem. 274, 22123^22126. Edwards, J., Marziano, N., Becker, D., Casalotti, S., Nevill, G., Forge, A., 2001. Co-localization of connexin b2 (26) and connexin b6 (30) in cochlear gap junctions. Ann. Midwinter Res. Meet. Assoc. Res. Otolaryngol. 24, 150. Erhardt, J.A., Hynicka, W., DiBenedetto, A., Shen, N., Stone, N., Paulson, H., Pittman, R.N., 1998. A novel F box protein, NFB42, is highly enriched in neurons and induces growth arrest. J. Biol. Chem. 273, 35222^35227. Fechner, F.P., Burgess, B.J., Adams, J.C., Liberman, M.C., Nadol, J.B., Jr., 1998. Dense innervation of Deiters' and Hensen's cells persists after chronic dee¡erentation of guinea pig cochleas. J. Comp. Neurol. 400, 299^309. Galan, J.-M., Peter, M., 1999. Ubiquitin-dependent degradation of multiple F-box proteins by an autocatalytic mechanism. Proc. Natl. Acad. Sci. USA 96, 9124^9129. Hapak, R.C., Stanley, C.M., Henzl, M.T., 1996. Intrathymic distribution of the two avian thymic parvalbumins. Exp. Cell Res. 222, 234^245. Henzl, M.T., Thalmann, I., Thalmann, R., 1998. OCP2 exists as a dimer in the organ of Corti. Hear. Res. 126, 37^46. Jackson, P.K., Eldridge, A.G., Freed, E., Furstenthal, L., Hsu, J.Y., Kaiser, B.K., Reimann, J.D.R., 2000. The lore of the RINGs: substrate recognition and catalysis by ubiquitin ligases. Trends Cell Biol. 10, 429^439. Kamura, T., Koepp, D.M., Conrad, M.N., Skowyra, D., Moreland, R.J., Iliopoulos, O., Lane, W.S., Kaelin, W.G., Jr., Elledge, S.J., Conaway, R.C., Harper, J.W., Conaway, J.W., 1999a. Rbx1, a component of the VHL tumor suppressor complex and SCF ubiquitin ligase. Science 284, 657^661. Kamura, T., Conrad, M.N., Yan, Q., Conaway, R.C., Conaway, J.W., 1999b. The Rbx1 subunit of SCF and VHL E3 ubiquitin ligase activates Rub1 modi¢cation of cullins Cdc53 and Cul2. Genes Dev. 13, 2928^2933.
Kelley, P.M., Cohn, E., Kimberling, W.J., 2000. Connexin 26: required for normal auditory function. Brain Res. Rev. 32, 184^188. Kelsell, D.P., Dunlop, J., Stevens, H.P., Lench, N.J., Liang, J.N., Parry, G., Mueller, R.F., Leigh, I.M., 1997. Connexin 26 mutations in hereditary non-syndromic sensorineural deafness. Nature 387, 80^83. Kikuchi, T., Ikimura, R.K., Paul, D.P., Adams, J.C., 1995. Gap junctions in the rat cochlea. Anat. Embryol. 191, 101^118. Kikuchi, T., Kimura, R.S., Paul, D.L., Takasaka, T., Adams, J.C., 2000. Gap junction systems in the mammalian cochlea. Brain Res. Rev. 32, 163^166. King, R.W., Deshaies, R.J., Peters, M.M., Kirschner, M.W., 1996. How proteolysis drives the cell cycle. Science 274, 1652^1659. Kominami, K., Ochotorena, I., Toda, T., 1998. Two F-box/WD-repeat proteins Pop1 and Pop2 form hetero- and homo-complexes together with cullin-1 in the ¢ssion yeast SCF (Skp1-Cullin-1-Fbox) ubiquitin ligase. Genes Cells 3, 721^735. Krek, W., 1998. Proteolysis and the G1 /S transition: the SCF connection. Curr. Opin. Genet. Dev. 8, 36^42. Lautermann, J., ten Cate, W.J., Altenho¡, P., Grummer, R., Traub, O., Frank, H., Jahnke, K., Winterhagen, E., 1998. Expression of the gap-junction connexins 26 and 30 in the rat cochlea. Cell Tissue Res. 294, 415^420. Liang, Y., Chen, H., Asher, J.H., Chang, C.-C., Friedman, T.B., 1997. Human inner ear OCP2 cDNA maps to 5q22^5q35.2 with related sequences on chromosomes 4p16.2^4p14, 5p13^5q22, 7pter^q22, 10 and 12p13^12qter. Gene 184, 163^167. Lyapina, S.A., Correll, C.C., Kipreos, E.T., Deshaies, R.J., 1998. Human CUL1 forms an evolutionarily conserved ubiquitin ligase complex (SCF) with SKP1 and an F-box protein. Proc. Natl. Acad. Sci. USA 95, 7451^7456. Maniatis, T., Fritsch, E.F., Sambrook, J., 1982. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Patton, E.E., Willems, A.R., Sa, D., Kuras, L., Thomas, D., Craig, K.L., Tyers, M., 1998. Cdc53 is a sca¡old protein for multiple Cdc34/Skp1/F-box protein complexes that regulate cell division and methionine biosynthesis in yeast. Genes Dev. 12, 692^705. Peters, J.-M., 1998. SCF and APC: the Yin and Yang of cell cycle regulated proteolysis. Curr. Opin. Cell Biol. 10, 759^768. Rogers, S., Wells, R., Rechsteiner, M., 1986. Amino acid sequences common to rapidly degraded proteins: the PEST hypothesis. Science 234, 364^368. Sa¤tz, J.E., Laing, J.G., Yamada, K.A., 2000. Connexin expression and turnover: Implications for cardiac excitability. Circ. Res. 86, 723^728. Skowyra, D., Craig, K.L., Tyers, M., Elledge, S.J., Harper, J.W., 1997. F-box proteins are receptors that recruit phosphorylated substrates to the SCF ubiquitin-ligase complex. Cell 91, 209^219. Skowyra, D., Koepp, D.M., Kamura, T., Conrad, M.N., Conaway, R.C., Conaway, J.W., Elledge, S.J., Harper, J.W., 1999. Reconstitution of G1 cyclin ubiquitination with complexes containing SCFGrr1 and Rbx1. Science 284, 662^665. Spicer, S.S., Schulte, B.A., 1994. Di¡erences along the place-frequency map in the structure of supporting cells in the gerbil cochlea. Hear. Res. 79, 161^177. Steel, K.P., 1999. The bene¢ts of recycling. Science 285, 1363^1364. Suzuki, H., Chiba, T., Suzuki, T., Fujita, T., Ikenoue, T., Omata, M., Furuichi, K., Shikama, H., Tanaka, K., 2000. Homodimer of two F-box proteins LTrCP1 or LTrCP2 binds to IUBK for signal-dependent ubiquitination. J. Biol. Chem. 275, 2877^2884. Thalmann, R., 1976. Quantitative histo- and cytochemistry of the ear. In: C.A. Smith, J.A. Vernon (Eds.), The Handbook of Auditory and Vestibular Research Methods. CC Thomas, Spring¢eld, IL, pp. 359^419.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart
M.T. Henzl et al. / Hearing Research 157 (2001) 100^111 Thalmann, I., Rosenthal, H.L., Moore, B.W., Thalmann, R., 1980. Organ of Corti speci¢c polypeptides: OCP-I and OCP-II. Arch. Otorhinolaryngol. 226, 123^128. Thalmann, I., Takahashi, K., Varghese, J., Comegys, T.H., Thalmann, R., 1990. Biochemical features of major organ of Corti proteins (OCP-I and OCP-II) including partial amino acid sequence. Laryngoscope 100, 99^105. Thalmann, I., Suzuki, H., McCourt, D.W., Comegys, T.H., Thalmann, R., 1993. Partial amino acid sequences of organ of Corti proteins OCP1 and OCP2: A progress report. Hear. Res. 64, 191^ 198. Thalmann, R., Henzl, M.T., Thalmann, I., 1997. Speci¢c proteins of the organ of Corti. Acta Otolaryngol. 117, 265^268. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets. Procedures and some applications. Proc. Natl. Acad. Sci. USA 76, 4350^4353. Tyers, M., Willems, A.R., 1999. One ring to rule a superfamily of E3 ubiquitin ligases. Science 284, 601^604. Voges, D., Zwickl, P., Baumeister, W., 1999. The 26S proteasome: a
111
molecular machine designed for controlled proteolysis. Annu. Rev. Biochem. 68, 1015^1068. Wilcox, E.R., Fex, J., 1992. Construction of a cDNA library from microdissected guinea pig organ of Corti. Hear. Res. 62, 124^ 126. Winston, J.T., Koepp, D.M., Zhu, C., Elledge, S.J., Harper, J.W., 1999. A family of mammalian F-box proteins. Curr. Biol. 9, 1180^1182. Wolf, D.A., McKeon, F., Jackson, P.K., 1999. F-box/WD-repeat proteins pop1p and Sud1p/Pop2p form complexes that bind and direct the proteolysis of cdc18p. Curr. Biol. 9, 373^376. Yoho, E.R., Thomopoulos, G.N., Thalmann, I., Thalmann, R., Schulte, B.A., 1997. Localization of organ of Corti protein II in the adult and developing gerbil cochlea. Hear. Res. 104, 47^56. Yu, Z.-K., Gervais, J.L.M., Zhang, H., 1998. Human CUL-1 associates with the SKP1/SKP2 complex and regulates p21CIP1=WAF1 and cyclin D proteins. Proc. Natl. Acad. Sci. USA 95, 11324^11329. Zhou, P., Howley, P.M., 1998. Ubiquitination and degradation of the substrate recognition subunits of SCF ubiquitin-protein ligases. Mol. Cell 2, 571^580.
HEARES 3696 12-7-01 Cyaan Magenta Geel Zwart