- Email: [email protected]
SLC34A2 Gene mutation of pulmonary alveolar microlithiasis: Report of four cases and review of literatures
Respiratory Medicine (2013) 107, 217e222
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/rmed
SLC34A2 Gene mutation of pulmonary alveolar microlithiasis: Report of four cases and review of literatures Xinzhen Yin a, Huiying Wang b,*, Dingwen Wu c, Guohua Zhao a, Jingxin Shao b, Yu Dai d a
Department of Neurology, Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310009, PR China b Division of Allergy and Clinical Immunology, Department of Internal Medicine, Second Affiliated Hospital, College of Medicine, Zhejiang University, No. 88 Jiefang Road, Hangzhou, Zhejiang 310009, PR China c Children’s Hospital, Zhejiang University School of Medicine, Zhejiang Key Laboratory for Diagnosis and Therapy of Neonatal Diseases, Hangzhou 310006, PR China d Department of Laboratory, Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310009, PR China Received 31 July 2012; accepted 28 October 2012 Available online 17 November 2012
KEYWORDS Pulmonary alveolar microlithiasis; SLC34A2 gene; Mutation
Summary Pulmonary alveolar microlithiasis (PAM) is a rare autosomal recessive disorder characterized by the deposition of calcium phosphate microliths throughout the lungs. Currently the mutation of SLC34A2 gene was considered responsible for PAM. Here we reported the studies on mutation analysis of the SLC34A2 gene in three familial members and one unrelated subject of PAM by DNA direct sequencing. Meanwhile, we also reviewed and analyzed the published studies of the SLC34A2 gene mutation in PAM patients. The three familial patients were siblings of an inbred family whose parents were cousins. All four patients presented recurrent cough and exertional dyspnea. Diagnosis of PAM was made according to the typical manifestation of radiology. One homozygous mutation of the SLC34A2 gene, c.910A > T (p.K304X) was identified. The review of the SLC34A2 gene mutation showed multiple mutation symbols in PAM patients from China, Turkey, and Japan respectively. The present study supports that the clinical features, pathological and radiological characteristics of Chinese PAM patients are similar to those reported in other countries. Our investigation revealed that the c.910A > T mutation in the SCL34A2 gene was responsible for PAM patients in China. The review of literatures suggests that exon7 and exon8 seemed liable to be affected typical Mongoloid of PAM, and exon8 might be the screen target for Chinese patients. ª 2012 Elsevier Ltd. All rights reserved.
* Corresponding author. Tel.: þ86 571 87783627; fax: þ86 571 87754977. E-mail address: [email protected] (H. Wang). 0954-6111/$ - see front matter ª 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.rmed.2012.10.016
218
Introduction Pulmonary alveolar microlithiasis (PAM [MIM 265099]) is a rare disease characterized by the deposition of calcium phosphate microliths throughout the lungs. It was first described by Puhr in 1933.1 Most patients are either asymptomatic for several years or even decades, or only complaining symptoms such as intermittent mild cough or slowly progressive dyspnea. The onset age of this potentially lethal disease varies from the neonatal period to 80 years.2 Following a chronic progressive course, PAM generally results in a slow deterioration of lung function.3 A sandstorm-like chest roentgenogram is a typical diagnostic finding. A variety of environmental factors have been suggested as the etiology, nevertheless, about onethird of the reported cases are familial.4e6 The most comprehensive report that described more than 500 cases worldwide in 2004 revealed that the prevalence of PAM was predominated in Europe (42.7%) and Asia (40.6%).4 And Japan, Turkey and India are the main source of PAM cases in Asia.7 However, very limited data concerning to Chinese PAM patients were reported.8e15 Recently, mutation in the SLC34A2 gene, which encodes the sodium dependent phosphate transporter, is considered to be responsible for PAM.8,16e19 However, its mutation symbols in different cases are not investigated yet for its limited data. Here we described a novel mutation of the SLC34A2 gene in an inbred family and a sporadic one, and reanalyzed the existing data of different mutations previously reported.
Materials and methods Subjects and ethical considerations A consanguineous family (see Fig. 1A) and one unrelated, sporadic PAM patient (see Fig. 1B) were recruited for this study. Patients were diagnosed based on characteristic chest X-ray and computer tomography (CT) findings. Written informed consent was obtained from either the patient or from an authorized family member. The study was approved by the Committee on Research with Human Participants at Zhejiang University. Patients from the consanguineous family Family member Ⅱ:9, a non-smoking male worker, was diagnosed of PAM at the age of 25 years in a routine checkup.9 Eight years later, he gradually developed chronic cough and exercise-induced dyspnea. Follow-up chest CT scans revealed diffuse fine sand-like high density shadows in bilaterally fields, especially concentrated in the midlower zones. He was followed up once a year for more than thirty years and showed stable status. His parents were first cousins, the mother was healthy with normal chest X-ray manifestations, and the father deceased on his seventy year without case history. His two deceased sisters (Ⅱ:3 and Ⅱ:11) were both patients of PAM, the younger one (Ⅱ:11) was the proband. Both of them were diagnosed in a high school regular checkup asymptomatically, developed respiratory failure 30 years later and finally succumbed to the disease five years ago. Ⅱ:1, the elder brother of Ⅱ:9,
X. Yin et al. and Ⅲ:6, the son of Ⅱ:9, were unaffected with clear lung fields of chest CT scan. The sporadic patient from a non-inbred family This sporadic patient is a 42-year-old, non-smoking female, without any relationship to the foresaid family according to the detail survey of ancestry. She was also identified in a regular checkup at the age of 20. She kept asymptomatic until her 40s when she started experiencing exertional dyspnea. Physical examination revealed normal breath sound. Pulmonary function test demonstrated moderate impairment of ventilation function. A thorough survey of her family excluded the possibility of inbred marriage of her parents who were healthy. The Chest X-rays of all the family including her three brothers and a 20-year-old daughter were normal.
Genetic analysis Genomic DNA was isolated from peripheral blood samples of the three men in the family (individuals Ⅱ:1, Ⅱ:9, Ⅲ:6 in the pedigree shown in Fig. 1A), the sporadic PAM patient (individual Ⅱ:7 in the pedigree shown in Fig. 1B) and 100 healthy volunteers using standard protocols. Applying online software of Primer3, 13 pairs of primers as showed in Table 1 were designed to amplify the coding exons of the SLC34A2 gene and the intronic flanking sequences. The amplifications of all exons were performed in thermocyclers (PerkinElmer, Inc, Foster City, Calif), starting with an initial denaturation of 4 min at 95 C followed by 12 cycles of 35 s denaturation and 35 s annealing at 60 C (0.5 C decrease in each cycle, and 40 s extension at 72 C). After amplification, PCR products were run on 6% PAGE gel to verify the specifities. Then, DNA sequencing was performed in an ABI 3100 Genetic analyzer (Applied Biosystems, Invitrogen Company, Shanghai). All identified disease-associated variants were examined for presence in the 100 controls (200 chromosomes) by direct DNA sequencing.
Literature review We searched the articles in the PubMed (http://www.ncbi. nlm.nih.gov/pubmed) and China National Knowledge Infrastructure (CNKI) databases (http://www.cnki.net) using the keyword “pulmonary alveolar microlithiasis, SLC34A2”. All the papers were reviewed directly by two investigators of our team. The mutation information of the SLC34A2 gene from these articles was collected and reanalyzed together with our result for more comprehensive knowledge about its role in this disease.
Results Genotyping results Member Ⅱ:9 in the consangeous family and the sporadic case (member Ⅱ:7 from the non-inbred family) harbored a same homozygous mutation c.910A > T (p.K304X) in the SLC34A2 exon8 (Fig. 2), which was reported previously.
The SLC34A2 gene mutation in PAM
219
Figure 1 Family 1 and 2 with pulmonary alveolar microlithiasis (PAM) (square symbols, men; circular symbols, women; filled symbols, PAM affected). Cross line indicates deceased. The probands are marked arrows. Family member Ⅰ:1 and Ⅰ:2 are first cousins in family 1.
Family 1 member Ⅲ:6 who was clinically unaffected showed the same variant c.910A > T (p.K304X) in a single chromosome (Fig. 2). Family 1 member Ⅱ:1 and 100 healthy volunteers didn’t have this variant. No other variants in exons 1e7 and 9e13 were detected. Immediate truncation from Lys led by this mutation would result in premature termination, which was predicted to cause loss of function of the protein.
Review of SLC34A2 mutation in PAM Eight articles involving 25 cases studied the SLC34A2 gene mutations in PAM cases.8,10,15e21 One report of 3 cases was eliminated from our analysis for unreliable result.15 Three cases from an inbred Chinese family and one case from Sweden showed negative results.10,21 Other 6 articles with 21 cases demonstrated multiple mutation symbols of the SLC34A2 gene in PAM patients from China, Turkey, and Japan respectively. Among these reports, three point deletions, one deletion plus insertion mutation, five point mutations, one small fragment deletion and one large fragment deletion were identified (Table 2).
Discussion In present study, we described the clinical features and SLC34A2 gene mutations in an inbred PAM family and an unrelated, sporadic patient and reviewed SLC34A2 gene mutations in PAM patients. Our diagnosis of PAM was established based on the characteristic chest X-ray and CT scan findings with the diffuse intra-alveolar lamellar
Table 1 Sequence of primers for amplification of PCR and the length of products of amplification. Sequence of primers
Length of amplified product
SLC34A2-1F:CCGTCGGAGCTTTTCTCTCGG SLC34A2-1R:GTCGATCGTAAGAGTGTAGCAGC SLC34A2-2-3F:GTTGATGCTTTGCAACCAATGG SLC34A2-2-3R:TGATGACACCCACAGTGAACG SLC34A2-4F:GCTCATTGCCAAACTTCTCAGG SLC34A2-4R:GCTGGAGAGGGCTTGCTGA SLC34A2-5F:GGCCTTGGATGGAGACTTCTG SLC34A2-5R:TCCCACCCTCAGATAGACAGG SLC34A2-6F:GGTAACTTTAGCCTGCCTCCAG SLC34A2-6R:GCATGTCATCTTTGGCTGGTT SLC34A2-7F:GAGGGTGGCAGATGATACAGG SLC34A2-7R:TGTCAGCTCAGGTAGGGGATG SLC34A2-8F:CCCTGGGTTTGTGTCCTAAATC SLC34A2-8R:CTTCCTTGAAGGCAAGATTTAGTT SLC34A2-9F:CATTGCCTCCCATTCCCCACT SLC34A2-9R:AATAGGTCACCCCCAGACAAC SLC34A2-10F:TAACAATCTGTAGCCGTGGTGG SLC34A2-10R:GAATCTAAAGGACCCCCACAC SLC34A2-11-12F:TGTACAACCTCACCCCTAAGCC SLC34A2-11-12R:AGAGACCAGTTTGCAAGACCATG SLC34A2-13-1F:TGTGATGCCTGCTAGCTTACCT SLC34A2-13-1R:CAGCAGCGCATCTGGAAGCAG SLC34A2-13-2F:CTGCCGAAGAAACTCCAGAACT SLC34A2-13-2R:CCAAAGGGAATCGAGTTAGGTAG
477bp 500bp 300bp 302bp 270bp 357bp 243bp 241bp 300bp 499bp 492bp 481bp
220
X. Yin et al.
Figure 2 Sequence analysis of the c.910A > T mutation in the available members of family 1 and the sporadic patient of family 2. The affected nucleotide was indicated with an arrowhead. An A to T homozygous mutation at nucleotide 910 (arrow) in the coding region of exon8 of the SCL34A2 gene was observed in family 1 member Ⅱ:9 (B) and the sporadic patient (D). Family 1 member Ⅲ:6(A) was detected a heterozygous mutation at the same site. The point mutation was not seen in family 1 member Ⅱ:1(C) and healthy control (E).
microliths in the lung tissue without obvious clinical manifestation.3,7,22 Identification of a homozygous mutation in the SLC34A2 gene further clinched the diagnosis.8,16,17 The clinical features of our patients were unremarkable compared with previous reported cases.1e8,16e19,23 Both cases showed early onset, slow developing course, no obvious difference could be noted between the familial cases and sporadic case, either. Though extrapulmonary
calcium deposits in testis, kidney, urethra, gallbladder and aortic valve has been reported,5,6,23,24 our patients didn’t present those complications. In spite of its slow development, the prognosis of this disease is not as good as expected. Two (family 1 member Ⅱ:3 and Ⅱ:11) of three familial cases died of respiratory failure. Lung transplantation is suggested the only promising treatment, though long-term result is not proved.
The SLC34A2 gene mutation in PAM Table 2
221
SLC34A2 Sequence variants identified in patients with PAM.
Origin Cases Mutation of patient Turkish
1
c.[-6773_-6588del] þ [-6773_-6588del]
Turkish Turkish Turkish Japanese
3 1 2 2
c.[114delA] þ [114delA] c.[226C > T] þ [226C > T] c.[316G > C] þ [316G > C] c.[857871delinsAAGTTATCGCTTTTTCATC] þ [857-871delinsAAGTTATCGCTTTTTCATC] c.[910A > T] þ [910A > T]* c.[IVS8þ1G > A] þ [IVS8þ1G > A] c.[1328delT] þ [1328delT] c.[1342delG] þ [1342delG] c.[1456C > T] þ [1456C > T] a 5.5 kb long homozygous deletion
Chinese 4 Japanese 4 Turkish 1 Turkish 1 Turkish 1 Japanese 1
Location Effect on translation
Predicted consequence on protein
Reference
Promoter exon1 Exon3 Exon3 Exon4 Exon7
.
Not synthesized Ref. 17
Frameshift p.Q76X p.G106R Frameshift
Truncation Truncation Substitution Truncation
Ref. Ref. Ref. Ref.
17, Ref. 20 17 17, Ref. 20 16
Exon8 Exon8 Exon11 Exon12 Exon13 Exon2e6
p.K304X Aberrant splicing Frameshift p.V448X p.Q486X .
Truncation Truncation Truncation Truncation Truncation .
Ref. Ref. Ref. Ref. Ref. Ref.
8 16 17 17 19 18
* denotes the results of this paper.
Though one third of cases are familial suggested genetic basis might be the etiology of PAM, it is until 2006 the SLC34A2 gene has been identified to be responsible for PAM.16,17 However, currently we only collected 21 cases about SLC34A2 gene mutation in PAM. In those reports, eleven different mutations of SLC34A2 gene were detected without obvious hotspot region among those patients. Exon1, 2, 3, 4, 6, 7, 8, 11, 12 and 13 were involved mainly. The mutation site in Turkish is versatile except exon7 and exon8. Chinese patients only have mutation in exon8. Japanese patients demonstrated a 5.5 kb long homozygous deletion. All of those mutations were homozygous. Most of these mutations happened on the exons, truncation of protein was the predominant result of these mutations. All the patients originated from different regions or countries. Thus, it is more likely that the mutation is recurrent rather than identical by descent. As for the different races, Turkish obviously showed more involved exons, and the mutation in Japanese and Chinese was relatively simple, mainly in exon7 and exon8, which suggests exon7 and exon8 might be liable to be affected in. However, the mutation symbols of their patients are quite different as we noted in Table 2, in spite of the fact that Japanese and Chinese belongs to the same race, Mongoloid, and are close in area. This phenomenon might be explained by the influence of environment and life style on genetics. Our investigation demonstrated a reported mutation of homozygous mutation (c.910A > T) in exon8 of the SLC34A2 gene, which caused premature termination. The truncated protein lacking five functional domains is about half the size of the full-length protein, and has definitely lost its normal function. Although segregation of the mutation could not be confirmed by studying all affected family members due to the death of the two elder sisters, the asymptomatic heterozygous carriers (family 1 member Ⅱ:9) with normal chest X-ray finding provided the strong evidence. In Chinese patients, both the two unrelated affected familial patients and the sporadic patient had the same nonsense mutation in the exon8 of SLC34A2 gene.8 The high consistency of the mutation site releases
a strong signal that exon8 might be a good target for future gene screening in Chinese PAM cases. However, more cases should be collected to confirm it. No disease-causing mutations or single nucleotide polymorphisms in the SLC34A2 gene were identified in an inbred, Chinese PAM family reported by Yang Y et al.10 Recently, the same result has been reported in a PAM patient from Sweden.21 It suggests that PAM may be a genetically heterogeneous entity that arises from mutations in genes other than SLC34A2 although the mutation could be in the 50 and 30 untranslated regions, intron and copy number problems.17 In sum, our investigation revealed a homozygous mutation of the SLC34A2 gene in PAM patients. The review of literatures suggests that exon7 and exon8 seemed liable to be affected typical Mongoloid of PAM, and exon8 might be the screen target for Chinese patients.
Acknowledgments This project was supported partially by the National Natural Science Foundation of China (No. 30600265).
Conflict of interest statement Xinzhen Yin contributed to the design of the study, acquisition of patient, analysis and interpretation of results, and drafting the article. Huiying Wang contributed to the design of the study, patient collection, literature review and revision of the manuscript critically for important intellectual content. Dingwen Wu contributed to the design of the study, genetic analysis and writing the manuscript. Guohua Zhao contributed to the design of the study, literature review, genetic analysis and revision of the manuscript critically for important intellectual content. Jingxin Shao contributed to the design of the study, patient collection, literature review, results interpretation and writing the manuscript. Yu Dai contributed to the design of
222 the study, literature review, data interpretation and writing the manuscript. The authors have no conflict of interest to disclose.
References 1. Puhr L. Mikrolithiasis alveolaris pulmonum. Virchows Arch Pathol Anat Physiol Klin Med 1933;290:156e60. 2. Prakash UB. Pulmonary alveolar microlithiasis. Semin Respir Crit Care Med 2002;23:103e13. 3. Cluzel P, Grenier P, Bernadac P, Laurent F, Picard JD. Pulmonary alveolar microlithiasis: CT findings. J Comput Assist Tomogr 1991;15:938e42. 4. Mariotta S, Ricci A, Papale M, De Clementi F, Sposato B, Guidi L, et al. Pulmonary alveolar microlithiasis: report on 576 cases published in the literature. Sarcoidosis Vasc Diffuse Lung Dis 2004;21:173e81. 5. Ucan ES, Keyf AI, Aydilek R, Yalcin Z, Sebit S, Kudu M, et al. Pulmonary alveolar microlithiasis: review of Turkish reports. Thorax 1993;48:171e3. 6. Castellana G, Gentile M, Castellana R, Fiorente P, Lamorgese V. Pulmonary alveolar microlithiasis: clinical features, evolution of the phenotype, and review of the literature. Am J Med Genet 2002;111:220e4. 7. Tachibana T, Hagiwara K, Johkoh T. Pulmonary alveolar microlithiasis: review and management. Curr Opin Pulm Med 2009;15:486e90. 8. Zhong YQ, Hu CP, Cai XD, Nie HP. A novel mutation of the SLC34A2 gene in a Chinese pedigree with pulmonary alveolar microlithiasis. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2009;26: 365e8 [In Chinese]. 9. Wang HY, Shen HH, Jiang ZN. Pulmonary alveolar microlithiasis: report of four familial cases. Chin Med J (Engl) 2004; 117:950e2. 10. Yang Y, Qiao JH, An JH, Zhang Y, Yu T, Jia B, et al. Detection of SLC34A2 in patients with pulmonary alveolar microlithiasis and the effect of SLC34A2 on transportation of calcium and phosphate in human alveolar epithelial cells. Zhonghua Jie He He Hu Xi Za Zhi 2008;31:908e11 [In Chinese]. 11. Zhang Y, Yang Y, Yu T, Qiao JH, Tumen WL, Wu CF, et al. Three cases of pulmonary alveolar microlithiasis in a family and clinical analysis. Zhonghua Jie He He Hu Xi Za Zhi 2008;31: 112e5 [In Chinese].
X. Yin et al. 12. Lu HS, Zhou T, Gan MF. Pulmonary alveolar microlithiasis: report of a case. Zhonghua Bing Li Xue Za Zhi 2007;36:348e9 [In Chinese]. 13. Ouyang RY, Chen P. A case of pulmonary alveolar microlithiasis. Hunan Yi Ke Da Xue Xue Bao 2003;28:370e8 [In Chinese]. 14. Yang SP, Lin CC. Pulmoonary alveolar microlithiasis; a report of two youngest cases in a family. Dis Chest 1963;44:163e7. 15. Zheng BY. Pulmonary alveolar microlithiasis: a rare familial inheritance with report of three cases in a family (author’s transl). Zhonghua Jie He He Hu Xi Xi Ji Bing Za Zhi 1979;2: 103e5 [In Chinese]. 16. Huqun, Izumi S, Miyazawa H, Ishii K, Uchiyama B, Ishida T, et al. Mutations in the SLC34A2 gene are associated with pulmonary alveolar microlithiasis. Am J Respir Crit Care Med 2007;175:263e8. 17. Corut A, Senyigit A, Ugur SA, Altin S, Ozcelik U, Calisir H, et al. Mutations in SLC34A2 cause pulmonary alveolar microlithiasis and are possibly associated with testicular microlithiasis. Am J Hum Genet 2006;79:650e6. 18. Ishihara Y, Hagiwara K, Zen K, Huqun, Hosokawa Y, Natsuhara A. A case of pulmonary alveolar microlithiasis with an intragenetic deletion in SLC34A2 detected by a genomewide SNP study. Thorax 2009;64:365e7. 19. Proesmans M, Boon M, Verbeken E, Ozcelik U, Kiper N, Van de Casseye W, et al. Pulmonary alveolar microlithiasis: a case report and review of the literature. Eur J Pediatr 2012;171(7):1069e72. 20. Dogan OT, Ozsahin SL, Gul E, Arslan S, Koksal B, Berk S, et al. A frame-shift mutation in the SLC34A2 gene in three patients with pulmonary alveolar microlithiasis in an inbred family. Intern Med 2010;49:45e9. 21. 21. Ozcelik U, Yalcin E, Ariyurek M, Ersoz DD, Cinel G, Gulhan B, et al. Long-term results of disodium etidronate treatment in pulmonary alveolar microlithiasis. Pediatr Pulmonol 2010;45(5):514e7. 22. Olauson H, Brandenburg V, Larsson TE. Mutation analysis and serum FGF23 level in a patient with pulmonary alveolar microlithiasis. Endocrine 2010;37(2):244e8. 23. Deniz O, Ors F, Tozkoparan E, Ozcan A, Gumus S, Bozlar U, Bilgic H, Ekiz K, Demirci N. High resolution computed tomographic features of pulmonary alveolar microlithiasis. Eur J Radiol 2005;55:452e60. ˚ L, Hilberg O, Bendstrup EM, Mogensen S, Simonsen U. 24. Jo ¨nsson A SLC34A2 gene mutation may explain comorbidity of pulmonary alveolarmicrolithiasis and aortic valve sclerosis. Am J Respir Crit Care Med 2012;185(4):464. 15.
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/rmed
SLC34A2 Gene mutation of pulmonary alveolar microlithiasis: Report of four cases and review of literatures Xinzhen Yin a, Huiying Wang b,*, Dingwen Wu c, Guohua Zhao a, Jingxin Shao b, Yu Dai d a
Department of Neurology, Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310009, PR China b Division of Allergy and Clinical Immunology, Department of Internal Medicine, Second Affiliated Hospital, College of Medicine, Zhejiang University, No. 88 Jiefang Road, Hangzhou, Zhejiang 310009, PR China c Children’s Hospital, Zhejiang University School of Medicine, Zhejiang Key Laboratory for Diagnosis and Therapy of Neonatal Diseases, Hangzhou 310006, PR China d Department of Laboratory, Second Affiliated Hospital, College of Medicine, Zhejiang University, Hangzhou 310009, PR China Received 31 July 2012; accepted 28 October 2012 Available online 17 November 2012
KEYWORDS Pulmonary alveolar microlithiasis; SLC34A2 gene; Mutation
Summary Pulmonary alveolar microlithiasis (PAM) is a rare autosomal recessive disorder characterized by the deposition of calcium phosphate microliths throughout the lungs. Currently the mutation of SLC34A2 gene was considered responsible for PAM. Here we reported the studies on mutation analysis of the SLC34A2 gene in three familial members and one unrelated subject of PAM by DNA direct sequencing. Meanwhile, we also reviewed and analyzed the published studies of the SLC34A2 gene mutation in PAM patients. The three familial patients were siblings of an inbred family whose parents were cousins. All four patients presented recurrent cough and exertional dyspnea. Diagnosis of PAM was made according to the typical manifestation of radiology. One homozygous mutation of the SLC34A2 gene, c.910A > T (p.K304X) was identified. The review of the SLC34A2 gene mutation showed multiple mutation symbols in PAM patients from China, Turkey, and Japan respectively. The present study supports that the clinical features, pathological and radiological characteristics of Chinese PAM patients are similar to those reported in other countries. Our investigation revealed that the c.910A > T mutation in the SCL34A2 gene was responsible for PAM patients in China. The review of literatures suggests that exon7 and exon8 seemed liable to be affected typical Mongoloid of PAM, and exon8 might be the screen target for Chinese patients. ª 2012 Elsevier Ltd. All rights reserved.
* Corresponding author. Tel.: þ86 571 87783627; fax: þ86 571 87754977. E-mail address: [email protected] (H. Wang). 0954-6111/$ - see front matter ª 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.rmed.2012.10.016
218
Introduction Pulmonary alveolar microlithiasis (PAM [MIM 265099]) is a rare disease characterized by the deposition of calcium phosphate microliths throughout the lungs. It was first described by Puhr in 1933.1 Most patients are either asymptomatic for several years or even decades, or only complaining symptoms such as intermittent mild cough or slowly progressive dyspnea. The onset age of this potentially lethal disease varies from the neonatal period to 80 years.2 Following a chronic progressive course, PAM generally results in a slow deterioration of lung function.3 A sandstorm-like chest roentgenogram is a typical diagnostic finding. A variety of environmental factors have been suggested as the etiology, nevertheless, about onethird of the reported cases are familial.4e6 The most comprehensive report that described more than 500 cases worldwide in 2004 revealed that the prevalence of PAM was predominated in Europe (42.7%) and Asia (40.6%).4 And Japan, Turkey and India are the main source of PAM cases in Asia.7 However, very limited data concerning to Chinese PAM patients were reported.8e15 Recently, mutation in the SLC34A2 gene, which encodes the sodium dependent phosphate transporter, is considered to be responsible for PAM.8,16e19 However, its mutation symbols in different cases are not investigated yet for its limited data. Here we described a novel mutation of the SLC34A2 gene in an inbred family and a sporadic one, and reanalyzed the existing data of different mutations previously reported.
Materials and methods Subjects and ethical considerations A consanguineous family (see Fig. 1A) and one unrelated, sporadic PAM patient (see Fig. 1B) were recruited for this study. Patients were diagnosed based on characteristic chest X-ray and computer tomography (CT) findings. Written informed consent was obtained from either the patient or from an authorized family member. The study was approved by the Committee on Research with Human Participants at Zhejiang University. Patients from the consanguineous family Family member Ⅱ:9, a non-smoking male worker, was diagnosed of PAM at the age of 25 years in a routine checkup.9 Eight years later, he gradually developed chronic cough and exercise-induced dyspnea. Follow-up chest CT scans revealed diffuse fine sand-like high density shadows in bilaterally fields, especially concentrated in the midlower zones. He was followed up once a year for more than thirty years and showed stable status. His parents were first cousins, the mother was healthy with normal chest X-ray manifestations, and the father deceased on his seventy year without case history. His two deceased sisters (Ⅱ:3 and Ⅱ:11) were both patients of PAM, the younger one (Ⅱ:11) was the proband. Both of them were diagnosed in a high school regular checkup asymptomatically, developed respiratory failure 30 years later and finally succumbed to the disease five years ago. Ⅱ:1, the elder brother of Ⅱ:9,
X. Yin et al. and Ⅲ:6, the son of Ⅱ:9, were unaffected with clear lung fields of chest CT scan. The sporadic patient from a non-inbred family This sporadic patient is a 42-year-old, non-smoking female, without any relationship to the foresaid family according to the detail survey of ancestry. She was also identified in a regular checkup at the age of 20. She kept asymptomatic until her 40s when she started experiencing exertional dyspnea. Physical examination revealed normal breath sound. Pulmonary function test demonstrated moderate impairment of ventilation function. A thorough survey of her family excluded the possibility of inbred marriage of her parents who were healthy. The Chest X-rays of all the family including her three brothers and a 20-year-old daughter were normal.
Genetic analysis Genomic DNA was isolated from peripheral blood samples of the three men in the family (individuals Ⅱ:1, Ⅱ:9, Ⅲ:6 in the pedigree shown in Fig. 1A), the sporadic PAM patient (individual Ⅱ:7 in the pedigree shown in Fig. 1B) and 100 healthy volunteers using standard protocols. Applying online software of Primer3, 13 pairs of primers as showed in Table 1 were designed to amplify the coding exons of the SLC34A2 gene and the intronic flanking sequences. The amplifications of all exons were performed in thermocyclers (PerkinElmer, Inc, Foster City, Calif), starting with an initial denaturation of 4 min at 95 C followed by 12 cycles of 35 s denaturation and 35 s annealing at 60 C (0.5 C decrease in each cycle, and 40 s extension at 72 C). After amplification, PCR products were run on 6% PAGE gel to verify the specifities. Then, DNA sequencing was performed in an ABI 3100 Genetic analyzer (Applied Biosystems, Invitrogen Company, Shanghai). All identified disease-associated variants were examined for presence in the 100 controls (200 chromosomes) by direct DNA sequencing.
Literature review We searched the articles in the PubMed (http://www.ncbi. nlm.nih.gov/pubmed) and China National Knowledge Infrastructure (CNKI) databases (http://www.cnki.net) using the keyword “pulmonary alveolar microlithiasis, SLC34A2”. All the papers were reviewed directly by two investigators of our team. The mutation information of the SLC34A2 gene from these articles was collected and reanalyzed together with our result for more comprehensive knowledge about its role in this disease.
Results Genotyping results Member Ⅱ:9 in the consangeous family and the sporadic case (member Ⅱ:7 from the non-inbred family) harbored a same homozygous mutation c.910A > T (p.K304X) in the SLC34A2 exon8 (Fig. 2), which was reported previously.
The SLC34A2 gene mutation in PAM
219
Figure 1 Family 1 and 2 with pulmonary alveolar microlithiasis (PAM) (square symbols, men; circular symbols, women; filled symbols, PAM affected). Cross line indicates deceased. The probands are marked arrows. Family member Ⅰ:1 and Ⅰ:2 are first cousins in family 1.
Family 1 member Ⅲ:6 who was clinically unaffected showed the same variant c.910A > T (p.K304X) in a single chromosome (Fig. 2). Family 1 member Ⅱ:1 and 100 healthy volunteers didn’t have this variant. No other variants in exons 1e7 and 9e13 were detected. Immediate truncation from Lys led by this mutation would result in premature termination, which was predicted to cause loss of function of the protein.
Review of SLC34A2 mutation in PAM Eight articles involving 25 cases studied the SLC34A2 gene mutations in PAM cases.8,10,15e21 One report of 3 cases was eliminated from our analysis for unreliable result.15 Three cases from an inbred Chinese family and one case from Sweden showed negative results.10,21 Other 6 articles with 21 cases demonstrated multiple mutation symbols of the SLC34A2 gene in PAM patients from China, Turkey, and Japan respectively. Among these reports, three point deletions, one deletion plus insertion mutation, five point mutations, one small fragment deletion and one large fragment deletion were identified (Table 2).
Discussion In present study, we described the clinical features and SLC34A2 gene mutations in an inbred PAM family and an unrelated, sporadic patient and reviewed SLC34A2 gene mutations in PAM patients. Our diagnosis of PAM was established based on the characteristic chest X-ray and CT scan findings with the diffuse intra-alveolar lamellar
Table 1 Sequence of primers for amplification of PCR and the length of products of amplification. Sequence of primers
Length of amplified product
SLC34A2-1F:CCGTCGGAGCTTTTCTCTCGG SLC34A2-1R:GTCGATCGTAAGAGTGTAGCAGC SLC34A2-2-3F:GTTGATGCTTTGCAACCAATGG SLC34A2-2-3R:TGATGACACCCACAGTGAACG SLC34A2-4F:GCTCATTGCCAAACTTCTCAGG SLC34A2-4R:GCTGGAGAGGGCTTGCTGA SLC34A2-5F:GGCCTTGGATGGAGACTTCTG SLC34A2-5R:TCCCACCCTCAGATAGACAGG SLC34A2-6F:GGTAACTTTAGCCTGCCTCCAG SLC34A2-6R:GCATGTCATCTTTGGCTGGTT SLC34A2-7F:GAGGGTGGCAGATGATACAGG SLC34A2-7R:TGTCAGCTCAGGTAGGGGATG SLC34A2-8F:CCCTGGGTTTGTGTCCTAAATC SLC34A2-8R:CTTCCTTGAAGGCAAGATTTAGTT SLC34A2-9F:CATTGCCTCCCATTCCCCACT SLC34A2-9R:AATAGGTCACCCCCAGACAAC SLC34A2-10F:TAACAATCTGTAGCCGTGGTGG SLC34A2-10R:GAATCTAAAGGACCCCCACAC SLC34A2-11-12F:TGTACAACCTCACCCCTAAGCC SLC34A2-11-12R:AGAGACCAGTTTGCAAGACCATG SLC34A2-13-1F:TGTGATGCCTGCTAGCTTACCT SLC34A2-13-1R:CAGCAGCGCATCTGGAAGCAG SLC34A2-13-2F:CTGCCGAAGAAACTCCAGAACT SLC34A2-13-2R:CCAAAGGGAATCGAGTTAGGTAG
477bp 500bp 300bp 302bp 270bp 357bp 243bp 241bp 300bp 499bp 492bp 481bp
220
X. Yin et al.
Figure 2 Sequence analysis of the c.910A > T mutation in the available members of family 1 and the sporadic patient of family 2. The affected nucleotide was indicated with an arrowhead. An A to T homozygous mutation at nucleotide 910 (arrow) in the coding region of exon8 of the SCL34A2 gene was observed in family 1 member Ⅱ:9 (B) and the sporadic patient (D). Family 1 member Ⅲ:6(A) was detected a heterozygous mutation at the same site. The point mutation was not seen in family 1 member Ⅱ:1(C) and healthy control (E).
microliths in the lung tissue without obvious clinical manifestation.3,7,22 Identification of a homozygous mutation in the SLC34A2 gene further clinched the diagnosis.8,16,17 The clinical features of our patients were unremarkable compared with previous reported cases.1e8,16e19,23 Both cases showed early onset, slow developing course, no obvious difference could be noted between the familial cases and sporadic case, either. Though extrapulmonary
calcium deposits in testis, kidney, urethra, gallbladder and aortic valve has been reported,5,6,23,24 our patients didn’t present those complications. In spite of its slow development, the prognosis of this disease is not as good as expected. Two (family 1 member Ⅱ:3 and Ⅱ:11) of three familial cases died of respiratory failure. Lung transplantation is suggested the only promising treatment, though long-term result is not proved.
The SLC34A2 gene mutation in PAM Table 2
221
SLC34A2 Sequence variants identified in patients with PAM.
Origin Cases Mutation of patient Turkish
1
c.[-6773_-6588del] þ [-6773_-6588del]
Turkish Turkish Turkish Japanese
3 1 2 2
c.[114delA] þ [114delA] c.[226C > T] þ [226C > T] c.[316G > C] þ [316G > C] c.[857871delinsAAGTTATCGCTTTTTCATC] þ [857-871delinsAAGTTATCGCTTTTTCATC] c.[910A > T] þ [910A > T]* c.[IVS8þ1G > A] þ [IVS8þ1G > A] c.[1328delT] þ [1328delT] c.[1342delG] þ [1342delG] c.[1456C > T] þ [1456C > T] a 5.5 kb long homozygous deletion
Chinese 4 Japanese 4 Turkish 1 Turkish 1 Turkish 1 Japanese 1
Location Effect on translation
Predicted consequence on protein
Reference
Promoter exon1 Exon3 Exon3 Exon4 Exon7
.
Not synthesized Ref. 17
Frameshift p.Q76X p.G106R Frameshift
Truncation Truncation Substitution Truncation
Ref. Ref. Ref. Ref.
17, Ref. 20 17 17, Ref. 20 16
Exon8 Exon8 Exon11 Exon12 Exon13 Exon2e6
p.K304X Aberrant splicing Frameshift p.V448X p.Q486X .
Truncation Truncation Truncation Truncation Truncation .
Ref. Ref. Ref. Ref. Ref. Ref.
8 16 17 17 19 18
* denotes the results of this paper.
Though one third of cases are familial suggested genetic basis might be the etiology of PAM, it is until 2006 the SLC34A2 gene has been identified to be responsible for PAM.16,17 However, currently we only collected 21 cases about SLC34A2 gene mutation in PAM. In those reports, eleven different mutations of SLC34A2 gene were detected without obvious hotspot region among those patients. Exon1, 2, 3, 4, 6, 7, 8, 11, 12 and 13 were involved mainly. The mutation site in Turkish is versatile except exon7 and exon8. Chinese patients only have mutation in exon8. Japanese patients demonstrated a 5.5 kb long homozygous deletion. All of those mutations were homozygous. Most of these mutations happened on the exons, truncation of protein was the predominant result of these mutations. All the patients originated from different regions or countries. Thus, it is more likely that the mutation is recurrent rather than identical by descent. As for the different races, Turkish obviously showed more involved exons, and the mutation in Japanese and Chinese was relatively simple, mainly in exon7 and exon8, which suggests exon7 and exon8 might be liable to be affected in. However, the mutation symbols of their patients are quite different as we noted in Table 2, in spite of the fact that Japanese and Chinese belongs to the same race, Mongoloid, and are close in area. This phenomenon might be explained by the influence of environment and life style on genetics. Our investigation demonstrated a reported mutation of homozygous mutation (c.910A > T) in exon8 of the SLC34A2 gene, which caused premature termination. The truncated protein lacking five functional domains is about half the size of the full-length protein, and has definitely lost its normal function. Although segregation of the mutation could not be confirmed by studying all affected family members due to the death of the two elder sisters, the asymptomatic heterozygous carriers (family 1 member Ⅱ:9) with normal chest X-ray finding provided the strong evidence. In Chinese patients, both the two unrelated affected familial patients and the sporadic patient had the same nonsense mutation in the exon8 of SLC34A2 gene.8 The high consistency of the mutation site releases
a strong signal that exon8 might be a good target for future gene screening in Chinese PAM cases. However, more cases should be collected to confirm it. No disease-causing mutations or single nucleotide polymorphisms in the SLC34A2 gene were identified in an inbred, Chinese PAM family reported by Yang Y et al.10 Recently, the same result has been reported in a PAM patient from Sweden.21 It suggests that PAM may be a genetically heterogeneous entity that arises from mutations in genes other than SLC34A2 although the mutation could be in the 50 and 30 untranslated regions, intron and copy number problems.17 In sum, our investigation revealed a homozygous mutation of the SLC34A2 gene in PAM patients. The review of literatures suggests that exon7 and exon8 seemed liable to be affected typical Mongoloid of PAM, and exon8 might be the screen target for Chinese patients.
Acknowledgments This project was supported partially by the National Natural Science Foundation of China (No. 30600265).
Conflict of interest statement Xinzhen Yin contributed to the design of the study, acquisition of patient, analysis and interpretation of results, and drafting the article. Huiying Wang contributed to the design of the study, patient collection, literature review and revision of the manuscript critically for important intellectual content. Dingwen Wu contributed to the design of the study, genetic analysis and writing the manuscript. Guohua Zhao contributed to the design of the study, literature review, genetic analysis and revision of the manuscript critically for important intellectual content. Jingxin Shao contributed to the design of the study, patient collection, literature review, results interpretation and writing the manuscript. Yu Dai contributed to the design of
222 the study, literature review, data interpretation and writing the manuscript. The authors have no conflict of interest to disclose.
References 1. Puhr L. Mikrolithiasis alveolaris pulmonum. Virchows Arch Pathol Anat Physiol Klin Med 1933;290:156e60. 2. Prakash UB. Pulmonary alveolar microlithiasis. Semin Respir Crit Care Med 2002;23:103e13. 3. Cluzel P, Grenier P, Bernadac P, Laurent F, Picard JD. Pulmonary alveolar microlithiasis: CT findings. J Comput Assist Tomogr 1991;15:938e42. 4. Mariotta S, Ricci A, Papale M, De Clementi F, Sposato B, Guidi L, et al. Pulmonary alveolar microlithiasis: report on 576 cases published in the literature. Sarcoidosis Vasc Diffuse Lung Dis 2004;21:173e81. 5. Ucan ES, Keyf AI, Aydilek R, Yalcin Z, Sebit S, Kudu M, et al. Pulmonary alveolar microlithiasis: review of Turkish reports. Thorax 1993;48:171e3. 6. Castellana G, Gentile M, Castellana R, Fiorente P, Lamorgese V. Pulmonary alveolar microlithiasis: clinical features, evolution of the phenotype, and review of the literature. Am J Med Genet 2002;111:220e4. 7. Tachibana T, Hagiwara K, Johkoh T. Pulmonary alveolar microlithiasis: review and management. Curr Opin Pulm Med 2009;15:486e90. 8. Zhong YQ, Hu CP, Cai XD, Nie HP. A novel mutation of the SLC34A2 gene in a Chinese pedigree with pulmonary alveolar microlithiasis. Zhonghua Yi Xue Yi Chuan Xue Za Zhi 2009;26: 365e8 [In Chinese]. 9. Wang HY, Shen HH, Jiang ZN. Pulmonary alveolar microlithiasis: report of four familial cases. Chin Med J (Engl) 2004; 117:950e2. 10. Yang Y, Qiao JH, An JH, Zhang Y, Yu T, Jia B, et al. Detection of SLC34A2 in patients with pulmonary alveolar microlithiasis and the effect of SLC34A2 on transportation of calcium and phosphate in human alveolar epithelial cells. Zhonghua Jie He He Hu Xi Za Zhi 2008;31:908e11 [In Chinese]. 11. Zhang Y, Yang Y, Yu T, Qiao JH, Tumen WL, Wu CF, et al. Three cases of pulmonary alveolar microlithiasis in a family and clinical analysis. Zhonghua Jie He He Hu Xi Za Zhi 2008;31: 112e5 [In Chinese].
X. Yin et al. 12. Lu HS, Zhou T, Gan MF. Pulmonary alveolar microlithiasis: report of a case. Zhonghua Bing Li Xue Za Zhi 2007;36:348e9 [In Chinese]. 13. Ouyang RY, Chen P. A case of pulmonary alveolar microlithiasis. Hunan Yi Ke Da Xue Xue Bao 2003;28:370e8 [In Chinese]. 14. Yang SP, Lin CC. Pulmoonary alveolar microlithiasis; a report of two youngest cases in a family. Dis Chest 1963;44:163e7. 15. Zheng BY. Pulmonary alveolar microlithiasis: a rare familial inheritance with report of three cases in a family (author’s transl). Zhonghua Jie He He Hu Xi Xi Ji Bing Za Zhi 1979;2: 103e5 [In Chinese]. 16. Huqun, Izumi S, Miyazawa H, Ishii K, Uchiyama B, Ishida T, et al. Mutations in the SLC34A2 gene are associated with pulmonary alveolar microlithiasis. Am J Respir Crit Care Med 2007;175:263e8. 17. Corut A, Senyigit A, Ugur SA, Altin S, Ozcelik U, Calisir H, et al. Mutations in SLC34A2 cause pulmonary alveolar microlithiasis and are possibly associated with testicular microlithiasis. Am J Hum Genet 2006;79:650e6. 18. Ishihara Y, Hagiwara K, Zen K, Huqun, Hosokawa Y, Natsuhara A. A case of pulmonary alveolar microlithiasis with an intragenetic deletion in SLC34A2 detected by a genomewide SNP study. Thorax 2009;64:365e7. 19. Proesmans M, Boon M, Verbeken E, Ozcelik U, Kiper N, Van de Casseye W, et al. Pulmonary alveolar microlithiasis: a case report and review of the literature. Eur J Pediatr 2012;171(7):1069e72. 20. Dogan OT, Ozsahin SL, Gul E, Arslan S, Koksal B, Berk S, et al. A frame-shift mutation in the SLC34A2 gene in three patients with pulmonary alveolar microlithiasis in an inbred family. Intern Med 2010;49:45e9. 21. 21. Ozcelik U, Yalcin E, Ariyurek M, Ersoz DD, Cinel G, Gulhan B, et al. Long-term results of disodium etidronate treatment in pulmonary alveolar microlithiasis. Pediatr Pulmonol 2010;45(5):514e7. 22. Olauson H, Brandenburg V, Larsson TE. Mutation analysis and serum FGF23 level in a patient with pulmonary alveolar microlithiasis. Endocrine 2010;37(2):244e8. 23. Deniz O, Ors F, Tozkoparan E, Ozcan A, Gumus S, Bozlar U, Bilgic H, Ekiz K, Demirci N. High resolution computed tomographic features of pulmonary alveolar microlithiasis. Eur J Radiol 2005;55:452e60. ˚ L, Hilberg O, Bendstrup EM, Mogensen S, Simonsen U. 24. Jo ¨nsson A SLC34A2 gene mutation may explain comorbidity of pulmonary alveolarmicrolithiasis and aortic valve sclerosis. Am J Respir Crit Care Med 2012;185(4):464. 15.