- Email: [email protected]
Sodium 4-phenylbutyrate protects against liver ischemia reperfusion injury by inhibition of endoplasmic reticulum-stress mediated apoptosis
Sodium 4-phenylbutyrate protects against liver ischemia reperfusion injury by inhibition of endoplasmic reticulum-stress mediated apoptosis Mario Vilatoba, MD, Christopher Eckstein, BA, Guadalupe Bilbao, MD, Cheryl A. Smyth, MS, Stacie Jenkins, BA, J. Anthony Thompson, PhD, Devin E. Eckhoff, MD, and Juan L. Contreras, MD, Birmingham, Ala
Background. Evidence is emerging that the endoplasmic reticulum (ER) participates in initiation of apoptosis induced by the unfolded protein response and by aberrant Ca++ signaling during cellular stress such as ischemia/reperfusion injury (I/R injury). ER-induced apoptosis involves the activation of caspase-12 and C/EBP homologous protein (CHOP), and the shutdown of translation initiated by phosphorylation of eIF2a. Sodium 4-phenylbutyrate (PBA) is a low molecular weight fatty acid that acts as a chemical chaperone reducing the load of mutant or unfolded proteins retained in the ER during cellular stress and also exerting anti-inflammatory activity. It has been used successfully for treatment of urea cycle disorders and sickle cell disease. Thus, we hypothesized that PBA may reduce ER-induced apoptosis triggered by I/R injury to the liver. Methods. Groups of male C57BL/6 mice were subjected to warm ischemia (70% of the liver mass, 45 minutes). Serum aspartate aminotransferase was assessed 6 hours after reperfusion; apoptosis was evaluated by enzyme-linked immunosorbent assays of caspase-12 and plasma tumor necrosis factor a, Western blot analyses of eIF2a, and reverse transcriptase-polymerase chain reaction of CHOP expression. Results. A dose-dependent decrease in aspartate aminotransferase was demonstrated in mice given intraperitoneal PBA (1 hour before and 12 hours after reperfusion), compared with vehicle-treated controls; this effect was associated with reduced pyknosis, parenchymal hemorrhages, and neutrophil infiltrates in PBA-treated mice, compared with controls. In a lethal model of total liver I/R injury, all vehicle-treated controls died within 3 days after reperfusion. In contrast, 50% survival (>30 days) was observed in animals given PBA. The beneficial effects of PBA were associated with a greater than 45% reduction in apoptosis, decreased ER-mediated apoptosis characterized by significant reduction in caspase-12 activation, and reduced levels of both phosphorylated eIF2a and CHOP. Significant reductions in plasma levels of tumor necrosis factor a and liver myeloperoxidase content were demonstrated after PBA treatment. Conclusions. Reduction in ER stress--induced hepatocellular injury was achieved by the administration of PBA. Targeting the ER-associated cell death pathway might offer a novel approach to reduce I/R injury to the liver. (Surgery 2005;138:342-51.) From the Division of Transplantation and Transplant Center, Department of Surgery, University of Alabama at Birmingham
Warm ischemia/reperfusion injury (I/R injury) of the liver occurs in different clinical conditions including hepatic resectional operations, liver
Presented at the 66th Annual Meeting of the Society of University Surgeons, Nashville, Tennessee, February 9-12, 2005. Reprint requests: Juan L. Contreras, MD, 748 Lyons-Harrison Research Bldg, 701 19th St South, Birmingham, AL 35294-0007. E-mail: [email protected]. 0039-6060/$ - see front matter Ó 2005 Mosby, Inc. All rights reserved. doi:10.1016/j.surg.2005.04.019
342 SURGERY
transplantation, and hemorrhagic shock.1 Previous studies demonstrated that after ischemia and reperfusion, cells are killed by a combination of different mechanisms, including intracellular oxidative stress, exposure to extracellular mediators, prolonged ischemia, and infiltration of polymorphonuclear leukocyte neutrophils (PMNs).1 Programmed cell death or apoptosis of liver sinusoidal cells and hepatocytes is a prominent feature of liver reperfusion injury in both experimental and clinical transplantation.2,3 In this regard, apoptosis correlates with duration of ischemia and animal survival; inhibition of mediators of apoptosis such as
Surgery Volume 138, Number 2
caspases, calpain–like proteases, or overexpression of antiapoptotic genes ameliorates the injury.4-7 Activation of proteases, particularly the family of cysteine proteases (caspases), plays a critical role in cellular execution of apoptosis. Most proteases are located in the cytosol as zymogens when they are activated by apoptotic, stimulimediated signaling cascades. Several pathways leading to caspase activation and apoptosis have been elucidated, including pathways triggered by tumor necrosis factor (TNF)/Fas-family cytokine receptors, mitochondrial release of cytochrome c and other proteins, as well as granzyme B--mediated cleavage of caspases in the context of cytolytic T-cell responses.8 However, damage or stress in many organelles (besides mitochondria) may trigger apoptosis through mechanisms that remain poorly understood. In this regard, a pathway for caspase activation and apoptosis induction has been linked to stress in the endoplasmic reticulum (ER). Conditions that impair ER function, including Ca2+ ionophores, glucose deprivation, oxidative stress, and I/R injury lead to accumulation of unfolded or misfolded proteins in the ER lumen.9 In the case of mild ER stress, cells have developed a self-protective, signal transduction pathway termed the unfolded protein response, which includes induction of molecular chaperones in the ER, translational attenuation, and ER-associated protein degradation.10 However, if the damage is severe, the unfolded protein response ultimately triggers the apoptosis pathway through 3 known mechanisms.11 The first is activation of ER-localized caspase-12,12 the second is transcriptional induction of C/EBP homologous protein (CHOP, also known as growth arrest and DNA damage–inducible gene 15313), and the third is activation of cJun NH2terminal kinase pathway,14 from which transcription factors c-Jun and ATF-2 have been implicated in the initiation of apoptosis.15 In addition, after severe cellular stress such as I/R injury, protein synthesis is inhibited because of inhibited delivery of the initiator methionine caused by phosphorylation of initiation factor 2a (eIF2a),16 which is a potent inductor of apoptosis.17 Sodium 4-phenylbutyrate (PBA) is a low molecular weight fatty acid used for treatment of urea cycle disorders, sickle cell disease, and thalassemia. PBA can act as a chemical chaperone by reducing the load of mutant or mislocated proteins retained in the ER under conditions associated with cystic fibrosis, a-1 antitrypsin deficiency, and liver injury.18-22 Therefore, targeting the ER may provide a therapeutic approach for blocking the pathologic
Vilatoba et al 343
process induced by I/R injury to the liver. However, no pharmacologic approach for treating liver ischemia–induced ER dysfunction has been reported to our knowledge. In the present study, we evaluated the hepatoprotective effect of PBA on warm I/R injury to the liver and the mechanisms underlying this hepatoprotection. METHODS Animals. Male C57BL/6 (age 6-8 weeks; Jackson Laboratories, Bar Harbor, Me) were used. All care and handling of animals were approved by the University of Alabama at Birmingham’s Institutional Animal Care and Use Committee carried out in accordance with guidelines contained in the Guide for the Care and Use of Laboratory Animals. Model of warm I/R injury and drug treatment. A model of segmental hepatic ischemia reperfusion was used as previously described,7,23 Briefly, after overnight fasting (12 hours), animals were anesthetized via single intramuscular injection of ketamine (150 mg/kg), and a laparotomy was performed. The medial lobe of the liver (;45% of the liver mass) was clamped at its base with the use of a microaneurysm clamp. The abdominal incision was closed, and the mice were allowed to recover. After 90 minutes, the animals were reanesthetized, and reperfusion was initiated by removal of the clamp. For survival analysis, a model of total hepatic ischemia and reperfusion was used as previously described.7 Briefly, clamps were placed across the right and left pedicles of the median lobe and across the pedicle of the left lateral lobe for a total of 75 minutes. Then, the caudate, right lateral, quadrate lobes, and papillary lobes were resected (30% of the liver mass). Spontaneous portocaval shunts through caudate branches and collateral vessels prevented mesenteric congestion. The body temperature was maintained at 37 ± 0.5°C with the use of a heating lamp. All surgical procedures were performed between 7 AM and 10 AM to avoid circadian variations (n = 10). Pharmaceutical grade PBA was obtained from Scandinavian Formulas Inc (SPB11; Sellersville, Pa) and administered in sterile phosphate-buffered saline intraperitoneally at the indicated concentrations 1 hour before and 12 hours after injury. Other than the sham-operated animals, all mice were subjected to I/R injury. Determination of serum aspartate transaminase and tumor necrosis factor a. Previous studies demonstrated that serum aspartate transaminase (AST) activity peaks at 6 hours postreperfusion and directly correlates with hepatic I/R injury.24
344 Vilatoba et al
Accordingly, heparinized blood samples obtained from the tail vein were obtained at 6 hours postreperfusion (n = 8). The samples were centrifuged, and the plasma was frozen immediately and stored at ÿ70°C until use. AST activity was determined with the use of commercially available reagents (Sigma, St. Louis, Mo), as previously described.23 Tumor necrosis factor a (TNF-a) concentration was determined 6 hours after reperfusion with a commercial enzyme-linked immunosorbent assay (ELISA) kit (Biosource International, Camarillo, Calif; sensitivity threshold <3 pg/mL, n = 8).23 Morphometric assessment of I/R injury. Liver biopsies were obtained 24 hours after reperfusion, fixed in 10% formalin, and embedded in paraffin. Hematoxylin and eosin--stained sections (5 lm) were evaluated as previously described.23,24 Briefly, liver biopsies were evaluated by a point-counting method for severity of hepatic injury with the use of an ordinal scale as follows: grade 0, minimal or no evidence of injury; grade 1, mild injury consisting of cytoplasmic vacuolation and focal nuclear pyknosis; grade 2, moderate to severe injury with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of intercellular borders, and mild to moderate neutrophil infiltration; grade 3, severe injury with disintegration of hepatic cords, hemorrhage, and severe PMN infiltration.24 An average of 100 adjacent points on a 1-mm2 grid were graded for each specimen (n = 4). Detection of DNA fragmentation by ELISA. DNA fragmentation was assessed 6 hours after reperfusion by ELISA (Boehringer Mannheim, Indianapolis, Ind) as previously described.25 Briefly, liver samples obtained from ischemic lobes 6 hours after reperfusion were immersed immediately in buffer containing 25 mmol/L HEPES, 5 mmol/L MgCl2, 5 mmol/L EDTA, 2 mmol/L dithiothreitol, 0.1% CHAPS, 0.5 mmol/L Pefabloc, 0.1 mg/mL leupeptin, and 0.1 mg/mL pepstatin 1:3 (wt:vol). Then, the tissue was homogenized on ice and centrifuged at 12,000g for 10 minutes (4°C). A 20% homogenate was prepared in 50 mmol/L sodium phosphate buffer (120 mmol/L NaCl, 10 mmol/L EDTA; pH 7.0) and centrifuged at 14,000g. Diluted supernatant was used for the ELISA. Results were expressed as enrichment factor, which represents the ratio of optical densities for control (sham-operated mice) and experimental conditions (n = 6). Analysis of pro--caspase-12 and phospho-eIF2a. Liver samples collected 3 hours after reperfusion were boiled with Laemmli buffer for 3 minutes, and the total protein was fractionated by 8% SDS-PAGE and transferred to nitrocellulose membranes at 4°C.
Surgery August 2005
Protein concentrations were determined with the use of a Bio-Rad Protein Assay Kit I (Bio-Rad Laboratories, Hercules, Calif). After blocking with 20 mmol/L TRIS HCl (pH 7.6), 137 mmol/L NaCl, and 0.1% TRIS-buffered saline Tween 20 containing 5% skim milk for 3 hours at room temperature, the membranes were incubated with polyclonal anti-caspase-12 antibody (Biovision Research Products, Mountain View, Calif) at 1:500 dilution and monoclonal antibody anti--phospho-eIF2a (Ser 51) (BD PharMingen, San Diego, Calif) at 1:1000 dilution at 4°C overnight. The filters were then washed and incubated with anti--horseradish peroxidase--linked antibody (Cell Signaling Technology Inc, Beverly, Calif; diluted to 1:2000) at room temperature for 1 hour. After being washed with TRIS-buffered saline Tween 20, horseradish peroxidase--labeled antibodies were visualized with the enhanced chemiluminiscence procedure (Amersham Pharmacia Biotech Piscataway, NJ). Blots were analyzed with the use of Gel-Cypher (B/T SciTech, San Diego, Calif) software. Analysis of CHOP. Liver samples from ischemic lobes were obtained 3 hours after reperfusion, snapfrozen in liquid nitrogen, and stored at ÿ70°C until use. Total messenger RNA (mRNA) was prepared with the use of the RNAeasy 96 Total RNA Isolation Kit (Qiagen, Valencia, Calif) according to the manufacturer’s protocol. RNA concentration was estimated from absorbance at 260 nm. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed as previously described.26 The conditions and primers for PCR analysis were as follows: CHOP primer 1: GCAGCCATGGCAGCTGAGTCCCTGCCTTCC; primer 2: CAGACTCGAGGTGATGCCCAC-TGTTCATGC; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer 1: ACATCAAGAAGGTGGTGAAGCAGG; primer 2: CTCTTTCCTCTTGTGCTCTTGCTGG. PCR was performed in a buffer containing 67 mmol/L TRIS HCl at pH 8.8, 4 mmol/L MgCl2, 16 mmol/L (NH4)2SO4, 33 mg/mL bovine serum albumin, and 200 lmol/ L dNTP at 95°C (1 minute) and 70°C (3 minutes) for 24 cycles. PCR analyses of GAPDH included 22 cycles. The entire reaction was separated by electrophoresis on a 3% metaphor agarose gel (FMC Bioproducts, Rockland, Me), stained with ethidium bromide, and analyzed with the use of the Molecular Analyst software package (Bio-Rad Laboratories). Determination of liver myeloperoxidase content. Liver myeloperoxidase (MPO) content was assessed 24 hours after reperfusion as an accurate and objective measure of PMN infiltration after liver ischemia.23 Briefly, 100 mg of ischemic liver
Surgery Volume 138, Number 2
Vilatoba et al 345
tissue was homogenized in 2 mL of buffer (43.2 mmol/L KH2 HPO4, 16 mmol/L Na2HPO4; pH7.4). After centrifugation for 20 minutes at 10,000g, the pellet was resuspended in 10 volumes of buffer (43.2 mmol/L KH2HPO4, 6.5 mmol/ LNa2HPO4, 10 mmol/L EDTA, 0.5% hexadecyltrimethylammonium; pH 6.0) and sonicated for 10 seconds. After heating for 2 hours (60°C), the supernatant was reacted with 3,3#,3,5#-tetramethylbenzidine (Sigma) and optical density determined at 655 nm (n = 6). Statistical analysis. Results are expressed as mean ± SD. All statistical analysis was performed in SPSS 12.0 for Windows (SPSS Inc, Chicago Ill). Significance (P value) was determined by the nonparametric Mann-Whitney -test or, where appropriate, 1-way analysis of variance. A level of P less than .05 was considered statistically significant. RESULTS PBA protects against warm I/R injury to the liver. To investigate whether PBA can protect the liver from I/R injury, we administered PBA at various doses. Pretreatment with PBA produced a dose-dependent decrease in I/R injury to the liver, demonstrated by a significant decrease in AST 6 hours after reperfusion (Fig 1, A). In accordance with these results, histologic studies demonstrated in vehicle-treated samples obtained from the ischemic liver lobes, multiple foci of apoptotic hepatocytes associated with areas of nuclear pyknosis, cytoplasmic hypereosinophilia, hemorrhage, loss of intercellular borders, and severe PMN infiltration (Fig 1, B; grade 1 = 8 ± 4%; grade 2 = 70 ± 11%, and grade 3 = 20 ± 3%), compared with sham-operated controls (grade 0 = 99 ± 1%, grade 1 = 1 ± 1%). PBA resulted in a significant reduction in the number of nonviable liver cells after reperfusion (grade 1 = 61 ± 6%, grade 2 = 37 ± 8%; P < .001). Next, we examined whether pretreatment with PBA protects mice from lethal liver I/R injury. To this end, animals were subjected to 75 minutes of total hepatic ischemia (Fig 2). All animals treated with vehicle and subjected to I/R injury died within 3 days, compared with 100% survival in sham-operated controls. A dosedependent increase in survival was demonstrated in animals given PBA, with 50% survival (>30 days) in those treated with 80 or 160 mg/kg. Despite the absence of apparent toxicity, no additional increase in survival was demonstrated after the administration of PBA at 250 mg/kg (data not shown).
Fig 1. PBA protects against I/R injury to the liver. All animals were subjected to segmental hepatic ischemia (;45% of the liver mass) for 90 minutes as described in Methods. A, AST was measured in serum samples taken 6 hours after reperfusion. PBA was given intraperitoneally at indicated doses 1 hour before and 12 hours after reperfusion. Results are express as mean ± SD (n = 7). B, Liver biopsies were taken from the ischemic lobes 24 hours after reperfusion, fixed in 10% formalin, and embedded in paraffin. Hematoxylin and eosin– stained sections were evaluated by a point-counting method for severity of hepatic injury as described in Methods. Results show a representative experiment. (Original magnification: 320.) AST, Aspartate aminotransferase; PBA, sodium 4-phenylbutyrate.
PBA decreases ER stress--mediated apoptotic signals. The incidence of apoptosis was evaluated by determination of DNA fragmentation with the use of ELISA (Fig 3). A dose-dependent decrease in apoptosis was demonstrated in animals given PBA (;50% reduction at 160 mg/kg), compared with controls. Previous studies demonstrated that caspase-12 is localized in the ER and activated by ER stress, but not by membrane- or mitochondrial-targeted
346 Vilatoba et al
Fig 2. Effect of PBA on survival in a lethal model of total liver I/R injury. Other than sham-operated controls, all mice were subjected to a total hepatic I/R injury as described in Methods. PBA was given intraperitoneally at indicated doses 1 hour before and 12 hours after reperfusion. Results are expressed as cumulative survival (n = 10 per experimental condition). PBA, Sodium 4-phenylbutyrate.
apoptotic signals.12 Three hours after reperfusion in vehicle-treated animals, Western blot analyses demonstrated significant activation of caspase-12, evidenced by a greater than 50% decrease in the levels of pro–caspase-12 (Fig 4). The activation of caspase-12 was reversed by administration of PBA. No changes in pro–caspase-12 levels were demonstrated in sham-operated animals given PBA (data not shown). Pro–caspase-12 degradation peaked at 3 hours in animals with and without PBA treatment, and returned to baseline levels within 48 hours (data not shown). A prominent feature of ER response to stress consists of translational attenuation to reduce synthesis of new protein and to prevent further accumulation of unfolded proteins.27 This response occurs at the level of translational initiation via phosphorylation of eIF2a, the alpha molecule that regulates binding of initiator Met-tRNA to the ribosome. Phosphorylation of eIF2a at Ser51 (P-eIF2a) blocks this step and inhibits protein synthesis. In this regard, significant increase in P-eIF2a has been reported after I/R injury.16,18 Levels of P-eIF2a in ischemic liver lobes were increased markedly within 3 hours after reperfusion and were detectable until 12 to 24 hours in control animals given vehicle (Fig 5). In contrast, a significant downregulation of P-eIF2a (;45% reduction, compared with controls) was demonstrated in animals treated with PBA.
Surgery August 2005
Fig 3. Effect of PBA on hepatic apoptosis after reperfusion. All animals were subjected to partial I/R injury as described in Figure 1. DNA fragmentation was evaluated from the ischemic lobes 6 hours after reperfusion by ELISA. Results are expressed as mean ± SD of the enrichment factor, which represents the ratio of optical densities for control (sham-operated mice) and experimental conditions (n = 6). PBA, Sodium 4-phenylbutyrate.
In addition to activation of caspase-12, studies demonstrated that induction of CHOP is triggered by ER stress and promotes apoptosis.28 Quantification revealed a remarkable increase in the mRNA levels of CHOP in samples obtained from ischemic lobes in animals given vehicle (Fig 6). In contrast, pretreatment with PBA significantly reduced the induction of CHOP (40%-50% decrease, compared with controls). PBA inhibits TNF-a induction and PMN infiltration after reperfusion. PMN infiltration has been recognized to play a critical role in the pathophysiology of liver I/R injury. Therefore, much attention has been focused on the role of inflammatory mediators such as TNF-a during I/R injury.1,23 In this regard, previous studies demonstrated the anti-inflammatory properties of PBA.18 As shown in Figure 7, A, a significant reduction in serum TNF-a was demonstrated in animals treated with PBA, compared with controls. As an objective assessment of PMN infiltration, liver samples obtained after reperfusion were analyzed for MPO content (Fig 7, B). In accordance with the histologic studies, animals treated with PBA presented a significant decrease in MPO content, compared with vehicle-treated controls. No changes in liver MPO content was demonstrated in shamoperated animals given PBA (data not shown).
Surgery Volume 138, Number 2
Fig 4. Effect of PBA on caspase-12 activation after liver I/R injury. All animals except sham-operated controls were subjected to partial I/R injury as described in Figure 1. A, Liver samples collected 3 hours after reperfusion from the ischemic lobes were evaluated for pro– caspase-12 by Western blot analyses as a measure of caspase-12 activation, as described in Methods. Tissue samples were from 3 representative experiments. B, The lower panel is the quantification of pro–caspase-12 levels. Results are expressed as mean ± SD (n = 5). PBA, Sodium 4-phenylbutyrate; I/R, Ischemia/reperfusion.
DISCUSSION In the present study, we demonstrated that targeting the ER by administration of therapeutic doses of PBA protected the liver against warm I/R injury, as evidenced by decreased liver enzymes and reduction in the number of nonviable cells and PMN infiltrates into the liver. The hepatoprotective properties of PBA were further demonstrated by reduced apoptosis after reperfusion. Most importantly, PBA reduced mortality in a lethal model of total I/R injury to the liver. PBA was given before the injury and thus could be implemented into clinical conditions in which I/R injury to the liver is expected, such as liver transplantation and hepatic resection. The efficacy of this treatment given after ischemia is currently under investigation in our laboratory. In this regard, Qi et al18 recently demonstrated that PBA protects not only before but also after cerebral ischemia.
Vilatoba et al 347
Fig 5. Treatment of PBA decreased phosphorylation of eIF2a. All animals except sham-operated controls were subjected to partial I/R injury as described in Figure 1. A, Liver samples from animals treated with vehicle or PBA (80 mg/kg, ip, 1 hour before injury) were collected at indicated time points and examined for phosphorylated eIF2a by Western blot analyses as described in Methods. B, The lower panel represents the quantification of phosphorylated eIF2a in all experimental groups. Results are expressed as mean ± SD (n = 5). I/R, Ischemia/ reperfusion; PBA, sodium 4-phenylbutyrate.
Over the past few years, a controversy emerged as to whether necrosis or apoptosis accounts for severe parenchymal injury demonstrated after liver reperfusion.25,29 Although apoptosis is a prominent feature in liver reperfusion injury in clinical and different experimental conditions,2-4,7,23 swelling of liver cells and their organelles, release of cell contents, eosinophilia, karyolysis, induction of inflammation, and morphologic features of oncotic necrosis are also prominent late after liver reperfusion.25 These observations suggest that both pathways are present after ischemic injury and that apoptosis and necrosis might overlap after
348 Vilatoba et al
Surgery August 2005
Fig 6. PBA repressed CHOP expression after liver I/R injury. All animals except sham-operated controls were subjected to partial I/R injury as described in Figure1. A, Liver samples collected 3 hours after reperfusion from the ischemic lobes were evaluated for CHOP expression by RT-PCR as described in Methods. Tissue samples were from 3 representative animals given vehicle or PBA (80 mg/kg, ip, 1 hour before injury) are demonstrated. B, The lower panel represents the quantification of CHOP and GADPH mRNA in the indicated groups. Results are expressed as mean ± SD (n = 5). I/R, Ischemia/reperfusion; PBA, sodium 4-phenylbutyrate; CHOP, C/EBP homologous protein; GADPH, glyceraldehyde3-phosphate dehydrogenase.
reperfusion. In this context, a ‘‘necroapoptosis’’ theory has been proposed,30 which postulates that a process begins with a common death signal or toxic stress that culminates in either cell lysis (necrosis) or programmed cellular resorption (apoptosis), depending on other modifying factors such as cellular adenosine triphosphate levels or fat content. In addition, recent studies demonstrated that apoptosis can trigger neutrophil infiltration and the consequent aggravation of cell injury including necrosis.30 Studies demonstrated liver ER stress in different conditions associated with hepatic injury, includ-
Fig 7. Effect of PBA on plasma TNF-a production and liver MPO after I/R injury. All animals except shamoperated controls were subjected to partial I/R injury as described in Figure 1. A, TNF-a concentrations were determined from blood samples taken 6 hours after reperfusion with the use of an ELISA kit according to manufacturer’s instructions. Results are expressed as mean ± SD (n = 8). I/R, Ischemia/reperfusion; PBA, sodium 4phenylbutyrate. B, PMN infiltration was assessed 24 hours after reperfusion by determination of liver MPO content as described in Methods. Results are expressed as mean ± SD (n = 6). I/R, Ischemia/reperfusion; PBA, sodium 4-phenylbutyrate.
Vilatoba et al 349
Surgery Volume 138, Number 2
ing exposure to proinflammatory cytokines, alcohol, metabolic abnormalities, viral infections, altered cellular redox, and so forth.31-34 The ER serves as a way–station during biogenesis of nearly every integral membrane and secreted protein synthesized in eukaryotic cells. It has been indicated that unfolded or misfolded proteins constitutes a fundamental threat to all living cells.27 ER stress–induced cell death involves activation of the ER resident caspase-12, which subsequently activates downstream executor caspases such as caspase-3 and caspase-9.12 In this regard, high levels of caspase-12 are expressed in the liver, and a variety of agents that produce ER stress, including thapsigargin, produces activation of liver caspase12.35 We found that marked activation of caspase12 occurs within a few hours after liver reperfusion and that PBA suppressed this activation. It has been shown that ER dysfunction is responsible for the shutdown of translation, a mechanism initiated by phosphorylation of eIF2a. In accordance with other studies,16,27,36,37, we observed a rapid increase in P-eIF2a early after reperfusion, demonstrating that suppression of protein synthesis is a common response of liver cells to I/R injury. In addition, elevated P-eIF2a and transcriptional induction result in increased CHOP, one of the main pathways leading to apoptosis.16,27,28 In our study that CHOP was elevated markedly in vehicle-treated controls after liver reperfusion. Treatment with PBA inhibited the induction of CHOP, probably related, in part, to suppression of eIF2a phosphorylation. Overall, these results suggest that PBA downregulates the apoptotic machinery of liver cells, in part, by downregulated activation of caspase-12, P-eIF2a, and CHOP. Activated Kupffer cells and PMNs have been recognized as playing critical roles during hepatic I/R injury; therefore, much attention has focused on the role of mediators of inflammation in the pathophysiology of liver I/R injury.1 TNF-a induces endothelial cell activation, apoptosis, and upregulation of adhesion molecules, and induces Kupffer cells to generate superoxide radicals.1,38 Accordingly, administration of agents that reduce the effects of TNF-a has resulted in amelioration of liver I/R injury.23,39,40 Previous studies demonstrated that PBA possesses anti-inflammatory properties. In this regard, PBA inhibits the induction of inducible macrophage-type nitric oxide synthase and expression of TNF-a under conditions of hypoxia/reoxygenation.18 We observed a greater than 50% decrease in TNF-a release after reperfusion in animals treated with PBA, compared with
controls; these results correlated with decreased PMN infiltration, as demonstrated by lower content of liver MPO. The anti-inflammatory mechanisms of PBA are currently unknown and under investigation in our laboratory. Liver transplantation has evolved as the therapy of choice for patients with end-stage liver disease. However, the waiting list for liver transplantation is growing at a fast pace, whereas the number of available organs is not growing at a proportional rate.41 The potential of using organs from marginal donors has thus become a major focus of investigation. Steatotic livers are considered one of the most common types of organs from marginal donors.42 However, steatotic livers are more susceptible to I/R injury and, when used, have poorer outcome than nonsteatotic livers.43,44 Although the cellular mechanisms underlying the increased susceptibility of these organs to I/R injury remain unclear, hepatocyte apoptosis has been observed predominantly in steatotic grafts after reperfusion injury.43,45 In this regard, fast-acting pharmacologic treatments are under investigation in an effort to improve the usability and outcomes of steatotic grafts. Accordingly, targeting the ER-associated cell death pathway with the administration of PBA to the donor and recipient might offer a novel approach in improving the results in liver transplantation using marginal donors.
CONCLUSION We found that PBA, a chemical chaperone, protects against I/R injury to the liver by inhibition of ER stress--mediated apoptosis and inflammation. Results of clinical trials have shown that PBA has few side effects and is well tolerated at high doses for long periods of time.21,22,46 Thus, targeting the ER with PBA may provide a novel therapeutic approach for conditions associated with I/R injury to the liver, including liver surgery and transplantation. REFERENCES 1. Fan C, Zwacka RM, Engelhardt JF. Therapeutic approaches for ischemia/reperfusion injury in the liver. J Mol Med 1999;77:577-92. 2. Borghi-Scoazec G, Scoazec JY, Durand F, et al. Apoptosis after ischemia-reperfusion in human liver allografts. Liver Transpl Surg 1997;3:407-15. 3. Kohli V, Selzner M, Madden JF, et al. Endothelial cell and hepatocyte deaths occur by apoptosis after ischemiareperfusion injury in the rat liver. Transplantation 1999;67: 1099-105. 4. Bilbao G, Contreras JL, Eckhoff DE, et al. Reduction of ischemia-reperfusion injury of the liver by in vivo
350 Vilatoba et al
5.
6.
7.
8. 9.
10.
11.
12.
13.
14.
15. 16.
17.
18.
19.
20.
21.
22.
23.
adenovirus-mediated gene transfer of the antiapoptotic Bcl-2 gene. Ann Surg 1999;230:185-93. Kohli V, Madden JF, Bentley RC, et al. Calpain mediates ischemic injury of the liver through modulation of apoptosis and necrosis. Gastroenterology 1999;116: 168-78. Takahashi Y, Geller DA, Gambotto A, et al. Adenovirusmediated gene therapy to liver grafts: successful gene transfer by donor pretreatment. Surgery 2000;128: 345-52. Contreras JL, Vilatoba M, Eckstein C, et al. caspase-8 and caspase-3 small interfering RNA decreases ischemia/reperfusion injury to the liver in mice. Surgery 2004;136:390-400. Hengartner MO. The biochemistry of apoptosis. Nature 2000;407:770-6. Kaufman RJ. Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls. Genes Dev 1999;13:1211-33. Cudna RE, Dickson AJ. Endoplasmic reticulum signaling as a determinant of recombinant protein expression. Biotechnol Bioeng 2003;81:56-65. Oyadomari S, Araki E, Mori M. Endoplasmic reticulum stress-mediated apoptosis in pancreatic beta-cells. Apoptosis 2002;7:335-45. Nakagawa T, Zhu H, Morishima N, et al. caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 2000;403:98-103. Wang XZ, Lawson B, Brewer JW, et al. Signals from the stressed endoplasmic reticulum induce C/EBPhomologous protein (CHOP/GADD153). Mol Cell Biol 1996;16:4273-80. Urano F, Wang X, Bertolotti A, et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000;287:664-6. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell 2000;103:239-52. DeGracia DJ, Kumar R, Owen CR, et al. Molecular pathways of protein synthesis inhibition during brain reperfusion: implications for neuronal survival or death. J Cereb Blood Flow Metab 2002;22:127-41. Clemens MJ. Initiation factor eIF2 alpha phosphorylation in stress responses and apoptosis. Prog Mol Subcell Biol 2001; 27:57-89. Qi X, Hosoi T, Okuma Y, et al. Sodium 4-phenylbutyrate protects against cerebral ischemic injury. Mol Pharmacol 2004;66:899-908. Rubenstein RC, Lyons BM. Sodium 4-phenylbutyrate downregulates HSC70 expression by facilitating mRNA degradation. Am J Physiol Lung Cell Mol Physiol 2001;281:L43-51. Bradbury NA. Focus on ‘‘Sodium 4-phenylbutyrate downregulates Hsc70: implications for intracellular trafficking of DeltaF508-CFTR’’. Am J Physiol Cell Physiol 2000;278: C257-8. Rubenstein RC, Zeitlin PL. A pilot clinical trial of oral sodium 4-phenylbutyrate (Buphenyl) in deltaF508-homozygous cystic fibrosis patients: partial restoration of nasal epithelial CFTR function. Am J Respir Crit Care Med 1998; 157:484-90. Dover GJ, Brusilow S, Charache S. Induction of fetal hemoglobin production in subjects with sickle cell anemia by oral sodium phenylbutyrate. Blood 1994;84:339-43. Eckhoff DE, Bilbao G, Frenette L, et al. 17-Beta-estradiol protects the liver against warm ischemia/reperfusion injury and is associated with increased serum nitric oxide and decreased tumor necrosis factor-alpha. Surgery 2002;132: 302-9.
Surgery August 2005
24. Camargo CA Jr, Madden JF, Gao W, et al. Interleukin-6 protects liver against warm ischemia/reperfusion injury and promotes hepatocyte proliferation in the rodent. Hepatology 1997;26:1513-20. 25. Gujral JS, Bucci TJ, Farhood A, et al. Mechanism of cell death during warm hepatic ischemia-reperfusion in rats: apoptosis or necrosis? Hepatology 2001;33:397-405. 26. Wang XZ, Kuroda M, Sok J, et al. Identification of novel stressinduced genes downstream of chop. EMBO J 1998;17: 3619-30. 27. Mori K. Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell 2000;101:451-4. 28. Zinszner H, Kuroda M, Wang X, et al. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 1998;12: 982-95. 29. Selzner N, Rudiger H, Graf R, et al. Protective strategies against ischemic injury of the liver. Gastroenterology 2003; 125:917-36. 30. Jaeschke H, Lemasters JJ. Apoptosis versus oncotic necrosis in hepatic ischemia/reperfusion injury. Gastroenterology 2003;125:1246-57. 31. Ji C, Kaplowitz N. Hyperhomocysteinemia, endoplasmic reticulum stress, and alcoholic liver injury. World J Gastroenterol 2004;10:1699-708. 32. Wang HC, Wu HC, Chen CF, et al. Different types of ground glass hepatocytes in chronic hepatitis B virus infection contain specific pre-S mutants that may induce endoplasmic reticulum stress. Am J Pathol 2003; 163:2441-9. 33. Gilmore WJ, Kirby GM. Endoplasmic reticulum stress due to altered cellular redox status positively regulates murine hepatic CYP2A5 expression. J Pharmacol Exp Ther 2004; 308:600-8. 34. Watanabe Y, Suzuki O, Haruyama T, et al. Interferongamma induces reactive oxygen species and endoplasmic reticulum stress at the hepatic apoptosis. J Cell Biochem 2003;89:244-53. 35. Xie Q, Khaoustov VI, Chung CC, et al. Effect of tauroursodeoxycholic acid on endoplasmic reticulum stress-induced caspase-12 activation. Hepatology 2002;36:592-601. 36. Kumar R, Azam S, Sullivan JM, et al. Brain ischemia and reperfusion activates the eukaryotic initiation factor 2alpha kinase, PERK. J Neurochem 2001;77:1418-21. 37. Page AB, Owen CR, Kumar R, et al. Persistent eIF2alpha(P) is colocalized with cytoplasmic cytochrome c in vulnerable hippocampal neurons after 4 hours of reperfusion following 10-minute complete brain ischemia. Acta Neuropathol (Berl) 2003;106:8-16. 38. Shibuya H, Ohkohchi N, Seya K, et al. Modulation of mitochondrial ATP synthesis and lipid peroxidation by Kupffer cells in liver grafts. Transplant Proc 1996;28:321-3. 39. Colletti LM, Remick DG, Burtch GD, et al. Role of tumor necrosis factor-alpha in the pathophysiologic alterations after hepatic ischemia/reperfusion injury in the rat. J Clin Invest 1990;85:1936-43. 40. Suzuki S, Toledo-Pereyra LH. Interleukin 1 and tumor necrosis factor production as the initial stimulants of liver ischemia and reperfusion injury. J Surg Res 1994;57:253-8. 41. Sheehy E, Conrad SL, Brigham LE, et al. Estimating the number of potential organ donors in the United States. N Engl J Med 2003;349:667-74. 42. Busuttil RW, Tanaka K. The utility of marginal donors in liver transplantation. Liver Transpl 2003;9:651-63. 43. Selzner M, Clavien PA. Fatty liver in liver transplantation and surgery. Semin Liver Dis 2001;21:105-13.
Surgery Volume 138, Number 2
44. Todo S, Demetris AJ, Makowka L, et al. Primary nonfunction of hepatic allografts with preexisting fatty infiltration. Transplantation 1989;47:903-5. 45. Baskin-Bey ES, Canbay A, Bronk SF, et al. Cathepsin B inactivation attenuates hepatocyte apoptosis and liver damage
Vilatoba et al 351
in steatotic livers after cold ischemia-warm reperfusion injury. Am J Physiol Gastrointest Liver Physiol 2005;288:G396-402. 46. Dover GJ, Brusilow S, Samid D. Increased fetal hemoglobin in patients receiving sodium 4-phenylbutyrate. N Engl J Med 1992;327:569-70.
Background. Evidence is emerging that the endoplasmic reticulum (ER) participates in initiation of apoptosis induced by the unfolded protein response and by aberrant Ca++ signaling during cellular stress such as ischemia/reperfusion injury (I/R injury). ER-induced apoptosis involves the activation of caspase-12 and C/EBP homologous protein (CHOP), and the shutdown of translation initiated by phosphorylation of eIF2a. Sodium 4-phenylbutyrate (PBA) is a low molecular weight fatty acid that acts as a chemical chaperone reducing the load of mutant or unfolded proteins retained in the ER during cellular stress and also exerting anti-inflammatory activity. It has been used successfully for treatment of urea cycle disorders and sickle cell disease. Thus, we hypothesized that PBA may reduce ER-induced apoptosis triggered by I/R injury to the liver. Methods. Groups of male C57BL/6 mice were subjected to warm ischemia (70% of the liver mass, 45 minutes). Serum aspartate aminotransferase was assessed 6 hours after reperfusion; apoptosis was evaluated by enzyme-linked immunosorbent assays of caspase-12 and plasma tumor necrosis factor a, Western blot analyses of eIF2a, and reverse transcriptase-polymerase chain reaction of CHOP expression. Results. A dose-dependent decrease in aspartate aminotransferase was demonstrated in mice given intraperitoneal PBA (1 hour before and 12 hours after reperfusion), compared with vehicle-treated controls; this effect was associated with reduced pyknosis, parenchymal hemorrhages, and neutrophil infiltrates in PBA-treated mice, compared with controls. In a lethal model of total liver I/R injury, all vehicle-treated controls died within 3 days after reperfusion. In contrast, 50% survival (>30 days) was observed in animals given PBA. The beneficial effects of PBA were associated with a greater than 45% reduction in apoptosis, decreased ER-mediated apoptosis characterized by significant reduction in caspase-12 activation, and reduced levels of both phosphorylated eIF2a and CHOP. Significant reductions in plasma levels of tumor necrosis factor a and liver myeloperoxidase content were demonstrated after PBA treatment. Conclusions. Reduction in ER stress--induced hepatocellular injury was achieved by the administration of PBA. Targeting the ER-associated cell death pathway might offer a novel approach to reduce I/R injury to the liver. (Surgery 2005;138:342-51.) From the Division of Transplantation and Transplant Center, Department of Surgery, University of Alabama at Birmingham
Warm ischemia/reperfusion injury (I/R injury) of the liver occurs in different clinical conditions including hepatic resectional operations, liver
Presented at the 66th Annual Meeting of the Society of University Surgeons, Nashville, Tennessee, February 9-12, 2005. Reprint requests: Juan L. Contreras, MD, 748 Lyons-Harrison Research Bldg, 701 19th St South, Birmingham, AL 35294-0007. E-mail: [email protected]. 0039-6060/$ - see front matter Ó 2005 Mosby, Inc. All rights reserved. doi:10.1016/j.surg.2005.04.019
342 SURGERY
transplantation, and hemorrhagic shock.1 Previous studies demonstrated that after ischemia and reperfusion, cells are killed by a combination of different mechanisms, including intracellular oxidative stress, exposure to extracellular mediators, prolonged ischemia, and infiltration of polymorphonuclear leukocyte neutrophils (PMNs).1 Programmed cell death or apoptosis of liver sinusoidal cells and hepatocytes is a prominent feature of liver reperfusion injury in both experimental and clinical transplantation.2,3 In this regard, apoptosis correlates with duration of ischemia and animal survival; inhibition of mediators of apoptosis such as
Surgery Volume 138, Number 2
caspases, calpain–like proteases, or overexpression of antiapoptotic genes ameliorates the injury.4-7 Activation of proteases, particularly the family of cysteine proteases (caspases), plays a critical role in cellular execution of apoptosis. Most proteases are located in the cytosol as zymogens when they are activated by apoptotic, stimulimediated signaling cascades. Several pathways leading to caspase activation and apoptosis have been elucidated, including pathways triggered by tumor necrosis factor (TNF)/Fas-family cytokine receptors, mitochondrial release of cytochrome c and other proteins, as well as granzyme B--mediated cleavage of caspases in the context of cytolytic T-cell responses.8 However, damage or stress in many organelles (besides mitochondria) may trigger apoptosis through mechanisms that remain poorly understood. In this regard, a pathway for caspase activation and apoptosis induction has been linked to stress in the endoplasmic reticulum (ER). Conditions that impair ER function, including Ca2+ ionophores, glucose deprivation, oxidative stress, and I/R injury lead to accumulation of unfolded or misfolded proteins in the ER lumen.9 In the case of mild ER stress, cells have developed a self-protective, signal transduction pathway termed the unfolded protein response, which includes induction of molecular chaperones in the ER, translational attenuation, and ER-associated protein degradation.10 However, if the damage is severe, the unfolded protein response ultimately triggers the apoptosis pathway through 3 known mechanisms.11 The first is activation of ER-localized caspase-12,12 the second is transcriptional induction of C/EBP homologous protein (CHOP, also known as growth arrest and DNA damage–inducible gene 15313), and the third is activation of cJun NH2terminal kinase pathway,14 from which transcription factors c-Jun and ATF-2 have been implicated in the initiation of apoptosis.15 In addition, after severe cellular stress such as I/R injury, protein synthesis is inhibited because of inhibited delivery of the initiator methionine caused by phosphorylation of initiation factor 2a (eIF2a),16 which is a potent inductor of apoptosis.17 Sodium 4-phenylbutyrate (PBA) is a low molecular weight fatty acid used for treatment of urea cycle disorders, sickle cell disease, and thalassemia. PBA can act as a chemical chaperone by reducing the load of mutant or mislocated proteins retained in the ER under conditions associated with cystic fibrosis, a-1 antitrypsin deficiency, and liver injury.18-22 Therefore, targeting the ER may provide a therapeutic approach for blocking the pathologic
Vilatoba et al 343
process induced by I/R injury to the liver. However, no pharmacologic approach for treating liver ischemia–induced ER dysfunction has been reported to our knowledge. In the present study, we evaluated the hepatoprotective effect of PBA on warm I/R injury to the liver and the mechanisms underlying this hepatoprotection. METHODS Animals. Male C57BL/6 (age 6-8 weeks; Jackson Laboratories, Bar Harbor, Me) were used. All care and handling of animals were approved by the University of Alabama at Birmingham’s Institutional Animal Care and Use Committee carried out in accordance with guidelines contained in the Guide for the Care and Use of Laboratory Animals. Model of warm I/R injury and drug treatment. A model of segmental hepatic ischemia reperfusion was used as previously described,7,23 Briefly, after overnight fasting (12 hours), animals were anesthetized via single intramuscular injection of ketamine (150 mg/kg), and a laparotomy was performed. The medial lobe of the liver (;45% of the liver mass) was clamped at its base with the use of a microaneurysm clamp. The abdominal incision was closed, and the mice were allowed to recover. After 90 minutes, the animals were reanesthetized, and reperfusion was initiated by removal of the clamp. For survival analysis, a model of total hepatic ischemia and reperfusion was used as previously described.7 Briefly, clamps were placed across the right and left pedicles of the median lobe and across the pedicle of the left lateral lobe for a total of 75 minutes. Then, the caudate, right lateral, quadrate lobes, and papillary lobes were resected (30% of the liver mass). Spontaneous portocaval shunts through caudate branches and collateral vessels prevented mesenteric congestion. The body temperature was maintained at 37 ± 0.5°C with the use of a heating lamp. All surgical procedures were performed between 7 AM and 10 AM to avoid circadian variations (n = 10). Pharmaceutical grade PBA was obtained from Scandinavian Formulas Inc (SPB11; Sellersville, Pa) and administered in sterile phosphate-buffered saline intraperitoneally at the indicated concentrations 1 hour before and 12 hours after injury. Other than the sham-operated animals, all mice were subjected to I/R injury. Determination of serum aspartate transaminase and tumor necrosis factor a. Previous studies demonstrated that serum aspartate transaminase (AST) activity peaks at 6 hours postreperfusion and directly correlates with hepatic I/R injury.24
344 Vilatoba et al
Accordingly, heparinized blood samples obtained from the tail vein were obtained at 6 hours postreperfusion (n = 8). The samples were centrifuged, and the plasma was frozen immediately and stored at ÿ70°C until use. AST activity was determined with the use of commercially available reagents (Sigma, St. Louis, Mo), as previously described.23 Tumor necrosis factor a (TNF-a) concentration was determined 6 hours after reperfusion with a commercial enzyme-linked immunosorbent assay (ELISA) kit (Biosource International, Camarillo, Calif; sensitivity threshold <3 pg/mL, n = 8).23 Morphometric assessment of I/R injury. Liver biopsies were obtained 24 hours after reperfusion, fixed in 10% formalin, and embedded in paraffin. Hematoxylin and eosin--stained sections (5 lm) were evaluated as previously described.23,24 Briefly, liver biopsies were evaluated by a point-counting method for severity of hepatic injury with the use of an ordinal scale as follows: grade 0, minimal or no evidence of injury; grade 1, mild injury consisting of cytoplasmic vacuolation and focal nuclear pyknosis; grade 2, moderate to severe injury with extensive nuclear pyknosis, cytoplasmic hypereosinophilia, loss of intercellular borders, and mild to moderate neutrophil infiltration; grade 3, severe injury with disintegration of hepatic cords, hemorrhage, and severe PMN infiltration.24 An average of 100 adjacent points on a 1-mm2 grid were graded for each specimen (n = 4). Detection of DNA fragmentation by ELISA. DNA fragmentation was assessed 6 hours after reperfusion by ELISA (Boehringer Mannheim, Indianapolis, Ind) as previously described.25 Briefly, liver samples obtained from ischemic lobes 6 hours after reperfusion were immersed immediately in buffer containing 25 mmol/L HEPES, 5 mmol/L MgCl2, 5 mmol/L EDTA, 2 mmol/L dithiothreitol, 0.1% CHAPS, 0.5 mmol/L Pefabloc, 0.1 mg/mL leupeptin, and 0.1 mg/mL pepstatin 1:3 (wt:vol). Then, the tissue was homogenized on ice and centrifuged at 12,000g for 10 minutes (4°C). A 20% homogenate was prepared in 50 mmol/L sodium phosphate buffer (120 mmol/L NaCl, 10 mmol/L EDTA; pH 7.0) and centrifuged at 14,000g. Diluted supernatant was used for the ELISA. Results were expressed as enrichment factor, which represents the ratio of optical densities for control (sham-operated mice) and experimental conditions (n = 6). Analysis of pro--caspase-12 and phospho-eIF2a. Liver samples collected 3 hours after reperfusion were boiled with Laemmli buffer for 3 minutes, and the total protein was fractionated by 8% SDS-PAGE and transferred to nitrocellulose membranes at 4°C.
Surgery August 2005
Protein concentrations were determined with the use of a Bio-Rad Protein Assay Kit I (Bio-Rad Laboratories, Hercules, Calif). After blocking with 20 mmol/L TRIS HCl (pH 7.6), 137 mmol/L NaCl, and 0.1% TRIS-buffered saline Tween 20 containing 5% skim milk for 3 hours at room temperature, the membranes were incubated with polyclonal anti-caspase-12 antibody (Biovision Research Products, Mountain View, Calif) at 1:500 dilution and monoclonal antibody anti--phospho-eIF2a (Ser 51) (BD PharMingen, San Diego, Calif) at 1:1000 dilution at 4°C overnight. The filters were then washed and incubated with anti--horseradish peroxidase--linked antibody (Cell Signaling Technology Inc, Beverly, Calif; diluted to 1:2000) at room temperature for 1 hour. After being washed with TRIS-buffered saline Tween 20, horseradish peroxidase--labeled antibodies were visualized with the enhanced chemiluminiscence procedure (Amersham Pharmacia Biotech Piscataway, NJ). Blots were analyzed with the use of Gel-Cypher (B/T SciTech, San Diego, Calif) software. Analysis of CHOP. Liver samples from ischemic lobes were obtained 3 hours after reperfusion, snapfrozen in liquid nitrogen, and stored at ÿ70°C until use. Total messenger RNA (mRNA) was prepared with the use of the RNAeasy 96 Total RNA Isolation Kit (Qiagen, Valencia, Calif) according to the manufacturer’s protocol. RNA concentration was estimated from absorbance at 260 nm. Reverse transcriptase-polymerase chain reaction (RT-PCR) was performed as previously described.26 The conditions and primers for PCR analysis were as follows: CHOP primer 1: GCAGCCATGGCAGCTGAGTCCCTGCCTTCC; primer 2: CAGACTCGAGGTGATGCCCAC-TGTTCATGC; glyceraldehyde-3-phosphate dehydrogenase (GAPDH) primer 1: ACATCAAGAAGGTGGTGAAGCAGG; primer 2: CTCTTTCCTCTTGTGCTCTTGCTGG. PCR was performed in a buffer containing 67 mmol/L TRIS HCl at pH 8.8, 4 mmol/L MgCl2, 16 mmol/L (NH4)2SO4, 33 mg/mL bovine serum albumin, and 200 lmol/ L dNTP at 95°C (1 minute) and 70°C (3 minutes) for 24 cycles. PCR analyses of GAPDH included 22 cycles. The entire reaction was separated by electrophoresis on a 3% metaphor agarose gel (FMC Bioproducts, Rockland, Me), stained with ethidium bromide, and analyzed with the use of the Molecular Analyst software package (Bio-Rad Laboratories). Determination of liver myeloperoxidase content. Liver myeloperoxidase (MPO) content was assessed 24 hours after reperfusion as an accurate and objective measure of PMN infiltration after liver ischemia.23 Briefly, 100 mg of ischemic liver
Surgery Volume 138, Number 2
Vilatoba et al 345
tissue was homogenized in 2 mL of buffer (43.2 mmol/L KH2 HPO4, 16 mmol/L Na2HPO4; pH7.4). After centrifugation for 20 minutes at 10,000g, the pellet was resuspended in 10 volumes of buffer (43.2 mmol/L KH2HPO4, 6.5 mmol/ LNa2HPO4, 10 mmol/L EDTA, 0.5% hexadecyltrimethylammonium; pH 6.0) and sonicated for 10 seconds. After heating for 2 hours (60°C), the supernatant was reacted with 3,3#,3,5#-tetramethylbenzidine (Sigma) and optical density determined at 655 nm (n = 6). Statistical analysis. Results are expressed as mean ± SD. All statistical analysis was performed in SPSS 12.0 for Windows (SPSS Inc, Chicago Ill). Significance (P value) was determined by the nonparametric Mann-Whitney -test or, where appropriate, 1-way analysis of variance. A level of P less than .05 was considered statistically significant. RESULTS PBA protects against warm I/R injury to the liver. To investigate whether PBA can protect the liver from I/R injury, we administered PBA at various doses. Pretreatment with PBA produced a dose-dependent decrease in I/R injury to the liver, demonstrated by a significant decrease in AST 6 hours after reperfusion (Fig 1, A). In accordance with these results, histologic studies demonstrated in vehicle-treated samples obtained from the ischemic liver lobes, multiple foci of apoptotic hepatocytes associated with areas of nuclear pyknosis, cytoplasmic hypereosinophilia, hemorrhage, loss of intercellular borders, and severe PMN infiltration (Fig 1, B; grade 1 = 8 ± 4%; grade 2 = 70 ± 11%, and grade 3 = 20 ± 3%), compared with sham-operated controls (grade 0 = 99 ± 1%, grade 1 = 1 ± 1%). PBA resulted in a significant reduction in the number of nonviable liver cells after reperfusion (grade 1 = 61 ± 6%, grade 2 = 37 ± 8%; P < .001). Next, we examined whether pretreatment with PBA protects mice from lethal liver I/R injury. To this end, animals were subjected to 75 minutes of total hepatic ischemia (Fig 2). All animals treated with vehicle and subjected to I/R injury died within 3 days, compared with 100% survival in sham-operated controls. A dosedependent increase in survival was demonstrated in animals given PBA, with 50% survival (>30 days) in those treated with 80 or 160 mg/kg. Despite the absence of apparent toxicity, no additional increase in survival was demonstrated after the administration of PBA at 250 mg/kg (data not shown).
Fig 1. PBA protects against I/R injury to the liver. All animals were subjected to segmental hepatic ischemia (;45% of the liver mass) for 90 minutes as described in Methods. A, AST was measured in serum samples taken 6 hours after reperfusion. PBA was given intraperitoneally at indicated doses 1 hour before and 12 hours after reperfusion. Results are express as mean ± SD (n = 7). B, Liver biopsies were taken from the ischemic lobes 24 hours after reperfusion, fixed in 10% formalin, and embedded in paraffin. Hematoxylin and eosin– stained sections were evaluated by a point-counting method for severity of hepatic injury as described in Methods. Results show a representative experiment. (Original magnification: 320.) AST, Aspartate aminotransferase; PBA, sodium 4-phenylbutyrate.
PBA decreases ER stress--mediated apoptotic signals. The incidence of apoptosis was evaluated by determination of DNA fragmentation with the use of ELISA (Fig 3). A dose-dependent decrease in apoptosis was demonstrated in animals given PBA (;50% reduction at 160 mg/kg), compared with controls. Previous studies demonstrated that caspase-12 is localized in the ER and activated by ER stress, but not by membrane- or mitochondrial-targeted
346 Vilatoba et al
Fig 2. Effect of PBA on survival in a lethal model of total liver I/R injury. Other than sham-operated controls, all mice were subjected to a total hepatic I/R injury as described in Methods. PBA was given intraperitoneally at indicated doses 1 hour before and 12 hours after reperfusion. Results are expressed as cumulative survival (n = 10 per experimental condition). PBA, Sodium 4-phenylbutyrate.
apoptotic signals.12 Three hours after reperfusion in vehicle-treated animals, Western blot analyses demonstrated significant activation of caspase-12, evidenced by a greater than 50% decrease in the levels of pro–caspase-12 (Fig 4). The activation of caspase-12 was reversed by administration of PBA. No changes in pro–caspase-12 levels were demonstrated in sham-operated animals given PBA (data not shown). Pro–caspase-12 degradation peaked at 3 hours in animals with and without PBA treatment, and returned to baseline levels within 48 hours (data not shown). A prominent feature of ER response to stress consists of translational attenuation to reduce synthesis of new protein and to prevent further accumulation of unfolded proteins.27 This response occurs at the level of translational initiation via phosphorylation of eIF2a, the alpha molecule that regulates binding of initiator Met-tRNA to the ribosome. Phosphorylation of eIF2a at Ser51 (P-eIF2a) blocks this step and inhibits protein synthesis. In this regard, significant increase in P-eIF2a has been reported after I/R injury.16,18 Levels of P-eIF2a in ischemic liver lobes were increased markedly within 3 hours after reperfusion and were detectable until 12 to 24 hours in control animals given vehicle (Fig 5). In contrast, a significant downregulation of P-eIF2a (;45% reduction, compared with controls) was demonstrated in animals treated with PBA.
Surgery August 2005
Fig 3. Effect of PBA on hepatic apoptosis after reperfusion. All animals were subjected to partial I/R injury as described in Figure 1. DNA fragmentation was evaluated from the ischemic lobes 6 hours after reperfusion by ELISA. Results are expressed as mean ± SD of the enrichment factor, which represents the ratio of optical densities for control (sham-operated mice) and experimental conditions (n = 6). PBA, Sodium 4-phenylbutyrate.
In addition to activation of caspase-12, studies demonstrated that induction of CHOP is triggered by ER stress and promotes apoptosis.28 Quantification revealed a remarkable increase in the mRNA levels of CHOP in samples obtained from ischemic lobes in animals given vehicle (Fig 6). In contrast, pretreatment with PBA significantly reduced the induction of CHOP (40%-50% decrease, compared with controls). PBA inhibits TNF-a induction and PMN infiltration after reperfusion. PMN infiltration has been recognized to play a critical role in the pathophysiology of liver I/R injury. Therefore, much attention has been focused on the role of inflammatory mediators such as TNF-a during I/R injury.1,23 In this regard, previous studies demonstrated the anti-inflammatory properties of PBA.18 As shown in Figure 7, A, a significant reduction in serum TNF-a was demonstrated in animals treated with PBA, compared with controls. As an objective assessment of PMN infiltration, liver samples obtained after reperfusion were analyzed for MPO content (Fig 7, B). In accordance with the histologic studies, animals treated with PBA presented a significant decrease in MPO content, compared with vehicle-treated controls. No changes in liver MPO content was demonstrated in shamoperated animals given PBA (data not shown).
Surgery Volume 138, Number 2
Fig 4. Effect of PBA on caspase-12 activation after liver I/R injury. All animals except sham-operated controls were subjected to partial I/R injury as described in Figure 1. A, Liver samples collected 3 hours after reperfusion from the ischemic lobes were evaluated for pro– caspase-12 by Western blot analyses as a measure of caspase-12 activation, as described in Methods. Tissue samples were from 3 representative experiments. B, The lower panel is the quantification of pro–caspase-12 levels. Results are expressed as mean ± SD (n = 5). PBA, Sodium 4-phenylbutyrate; I/R, Ischemia/reperfusion.
DISCUSSION In the present study, we demonstrated that targeting the ER by administration of therapeutic doses of PBA protected the liver against warm I/R injury, as evidenced by decreased liver enzymes and reduction in the number of nonviable cells and PMN infiltrates into the liver. The hepatoprotective properties of PBA were further demonstrated by reduced apoptosis after reperfusion. Most importantly, PBA reduced mortality in a lethal model of total I/R injury to the liver. PBA was given before the injury and thus could be implemented into clinical conditions in which I/R injury to the liver is expected, such as liver transplantation and hepatic resection. The efficacy of this treatment given after ischemia is currently under investigation in our laboratory. In this regard, Qi et al18 recently demonstrated that PBA protects not only before but also after cerebral ischemia.
Vilatoba et al 347
Fig 5. Treatment of PBA decreased phosphorylation of eIF2a. All animals except sham-operated controls were subjected to partial I/R injury as described in Figure 1. A, Liver samples from animals treated with vehicle or PBA (80 mg/kg, ip, 1 hour before injury) were collected at indicated time points and examined for phosphorylated eIF2a by Western blot analyses as described in Methods. B, The lower panel represents the quantification of phosphorylated eIF2a in all experimental groups. Results are expressed as mean ± SD (n = 5). I/R, Ischemia/ reperfusion; PBA, sodium 4-phenylbutyrate.
Over the past few years, a controversy emerged as to whether necrosis or apoptosis accounts for severe parenchymal injury demonstrated after liver reperfusion.25,29 Although apoptosis is a prominent feature in liver reperfusion injury in clinical and different experimental conditions,2-4,7,23 swelling of liver cells and their organelles, release of cell contents, eosinophilia, karyolysis, induction of inflammation, and morphologic features of oncotic necrosis are also prominent late after liver reperfusion.25 These observations suggest that both pathways are present after ischemic injury and that apoptosis and necrosis might overlap after
348 Vilatoba et al
Surgery August 2005
Fig 6. PBA repressed CHOP expression after liver I/R injury. All animals except sham-operated controls were subjected to partial I/R injury as described in Figure1. A, Liver samples collected 3 hours after reperfusion from the ischemic lobes were evaluated for CHOP expression by RT-PCR as described in Methods. Tissue samples were from 3 representative animals given vehicle or PBA (80 mg/kg, ip, 1 hour before injury) are demonstrated. B, The lower panel represents the quantification of CHOP and GADPH mRNA in the indicated groups. Results are expressed as mean ± SD (n = 5). I/R, Ischemia/reperfusion; PBA, sodium 4-phenylbutyrate; CHOP, C/EBP homologous protein; GADPH, glyceraldehyde3-phosphate dehydrogenase.
reperfusion. In this context, a ‘‘necroapoptosis’’ theory has been proposed,30 which postulates that a process begins with a common death signal or toxic stress that culminates in either cell lysis (necrosis) or programmed cellular resorption (apoptosis), depending on other modifying factors such as cellular adenosine triphosphate levels or fat content. In addition, recent studies demonstrated that apoptosis can trigger neutrophil infiltration and the consequent aggravation of cell injury including necrosis.30 Studies demonstrated liver ER stress in different conditions associated with hepatic injury, includ-
Fig 7. Effect of PBA on plasma TNF-a production and liver MPO after I/R injury. All animals except shamoperated controls were subjected to partial I/R injury as described in Figure 1. A, TNF-a concentrations were determined from blood samples taken 6 hours after reperfusion with the use of an ELISA kit according to manufacturer’s instructions. Results are expressed as mean ± SD (n = 8). I/R, Ischemia/reperfusion; PBA, sodium 4phenylbutyrate. B, PMN infiltration was assessed 24 hours after reperfusion by determination of liver MPO content as described in Methods. Results are expressed as mean ± SD (n = 6). I/R, Ischemia/reperfusion; PBA, sodium 4-phenylbutyrate.
Vilatoba et al 349
Surgery Volume 138, Number 2
ing exposure to proinflammatory cytokines, alcohol, metabolic abnormalities, viral infections, altered cellular redox, and so forth.31-34 The ER serves as a way–station during biogenesis of nearly every integral membrane and secreted protein synthesized in eukaryotic cells. It has been indicated that unfolded or misfolded proteins constitutes a fundamental threat to all living cells.27 ER stress–induced cell death involves activation of the ER resident caspase-12, which subsequently activates downstream executor caspases such as caspase-3 and caspase-9.12 In this regard, high levels of caspase-12 are expressed in the liver, and a variety of agents that produce ER stress, including thapsigargin, produces activation of liver caspase12.35 We found that marked activation of caspase12 occurs within a few hours after liver reperfusion and that PBA suppressed this activation. It has been shown that ER dysfunction is responsible for the shutdown of translation, a mechanism initiated by phosphorylation of eIF2a. In accordance with other studies,16,27,36,37, we observed a rapid increase in P-eIF2a early after reperfusion, demonstrating that suppression of protein synthesis is a common response of liver cells to I/R injury. In addition, elevated P-eIF2a and transcriptional induction result in increased CHOP, one of the main pathways leading to apoptosis.16,27,28 In our study that CHOP was elevated markedly in vehicle-treated controls after liver reperfusion. Treatment with PBA inhibited the induction of CHOP, probably related, in part, to suppression of eIF2a phosphorylation. Overall, these results suggest that PBA downregulates the apoptotic machinery of liver cells, in part, by downregulated activation of caspase-12, P-eIF2a, and CHOP. Activated Kupffer cells and PMNs have been recognized as playing critical roles during hepatic I/R injury; therefore, much attention has focused on the role of mediators of inflammation in the pathophysiology of liver I/R injury.1 TNF-a induces endothelial cell activation, apoptosis, and upregulation of adhesion molecules, and induces Kupffer cells to generate superoxide radicals.1,38 Accordingly, administration of agents that reduce the effects of TNF-a has resulted in amelioration of liver I/R injury.23,39,40 Previous studies demonstrated that PBA possesses anti-inflammatory properties. In this regard, PBA inhibits the induction of inducible macrophage-type nitric oxide synthase and expression of TNF-a under conditions of hypoxia/reoxygenation.18 We observed a greater than 50% decrease in TNF-a release after reperfusion in animals treated with PBA, compared with
controls; these results correlated with decreased PMN infiltration, as demonstrated by lower content of liver MPO. The anti-inflammatory mechanisms of PBA are currently unknown and under investigation in our laboratory. Liver transplantation has evolved as the therapy of choice for patients with end-stage liver disease. However, the waiting list for liver transplantation is growing at a fast pace, whereas the number of available organs is not growing at a proportional rate.41 The potential of using organs from marginal donors has thus become a major focus of investigation. Steatotic livers are considered one of the most common types of organs from marginal donors.42 However, steatotic livers are more susceptible to I/R injury and, when used, have poorer outcome than nonsteatotic livers.43,44 Although the cellular mechanisms underlying the increased susceptibility of these organs to I/R injury remain unclear, hepatocyte apoptosis has been observed predominantly in steatotic grafts after reperfusion injury.43,45 In this regard, fast-acting pharmacologic treatments are under investigation in an effort to improve the usability and outcomes of steatotic grafts. Accordingly, targeting the ER-associated cell death pathway with the administration of PBA to the donor and recipient might offer a novel approach in improving the results in liver transplantation using marginal donors.
CONCLUSION We found that PBA, a chemical chaperone, protects against I/R injury to the liver by inhibition of ER stress--mediated apoptosis and inflammation. Results of clinical trials have shown that PBA has few side effects and is well tolerated at high doses for long periods of time.21,22,46 Thus, targeting the ER with PBA may provide a novel therapeutic approach for conditions associated with I/R injury to the liver, including liver surgery and transplantation. REFERENCES 1. Fan C, Zwacka RM, Engelhardt JF. Therapeutic approaches for ischemia/reperfusion injury in the liver. J Mol Med 1999;77:577-92. 2. Borghi-Scoazec G, Scoazec JY, Durand F, et al. Apoptosis after ischemia-reperfusion in human liver allografts. Liver Transpl Surg 1997;3:407-15. 3. Kohli V, Selzner M, Madden JF, et al. Endothelial cell and hepatocyte deaths occur by apoptosis after ischemiareperfusion injury in the rat liver. Transplantation 1999;67: 1099-105. 4. Bilbao G, Contreras JL, Eckhoff DE, et al. Reduction of ischemia-reperfusion injury of the liver by in vivo
350 Vilatoba et al
5.
6.
7.
8. 9.
10.
11.
12.
13.
14.
15. 16.
17.
18.
19.
20.
21.
22.
23.
adenovirus-mediated gene transfer of the antiapoptotic Bcl-2 gene. Ann Surg 1999;230:185-93. Kohli V, Madden JF, Bentley RC, et al. Calpain mediates ischemic injury of the liver through modulation of apoptosis and necrosis. Gastroenterology 1999;116: 168-78. Takahashi Y, Geller DA, Gambotto A, et al. Adenovirusmediated gene therapy to liver grafts: successful gene transfer by donor pretreatment. Surgery 2000;128: 345-52. Contreras JL, Vilatoba M, Eckstein C, et al. caspase-8 and caspase-3 small interfering RNA decreases ischemia/reperfusion injury to the liver in mice. Surgery 2004;136:390-400. Hengartner MO. The biochemistry of apoptosis. Nature 2000;407:770-6. Kaufman RJ. Stress signaling from the lumen of the endoplasmic reticulum: coordination of gene transcriptional and translational controls. Genes Dev 1999;13:1211-33. Cudna RE, Dickson AJ. Endoplasmic reticulum signaling as a determinant of recombinant protein expression. Biotechnol Bioeng 2003;81:56-65. Oyadomari S, Araki E, Mori M. Endoplasmic reticulum stress-mediated apoptosis in pancreatic beta-cells. Apoptosis 2002;7:335-45. Nakagawa T, Zhu H, Morishima N, et al. caspase-12 mediates endoplasmic-reticulum-specific apoptosis and cytotoxicity by amyloid-beta. Nature 2000;403:98-103. Wang XZ, Lawson B, Brewer JW, et al. Signals from the stressed endoplasmic reticulum induce C/EBPhomologous protein (CHOP/GADD153). Mol Cell Biol 1996;16:4273-80. Urano F, Wang X, Bertolotti A, et al. Coupling of stress in the ER to activation of JNK protein kinases by transmembrane protein kinase IRE1. Science 2000;287:664-6. Davis RJ. Signal transduction by the JNK group of MAP kinases. Cell 2000;103:239-52. DeGracia DJ, Kumar R, Owen CR, et al. Molecular pathways of protein synthesis inhibition during brain reperfusion: implications for neuronal survival or death. J Cereb Blood Flow Metab 2002;22:127-41. Clemens MJ. Initiation factor eIF2 alpha phosphorylation in stress responses and apoptosis. Prog Mol Subcell Biol 2001; 27:57-89. Qi X, Hosoi T, Okuma Y, et al. Sodium 4-phenylbutyrate protects against cerebral ischemic injury. Mol Pharmacol 2004;66:899-908. Rubenstein RC, Lyons BM. Sodium 4-phenylbutyrate downregulates HSC70 expression by facilitating mRNA degradation. Am J Physiol Lung Cell Mol Physiol 2001;281:L43-51. Bradbury NA. Focus on ‘‘Sodium 4-phenylbutyrate downregulates Hsc70: implications for intracellular trafficking of DeltaF508-CFTR’’. Am J Physiol Cell Physiol 2000;278: C257-8. Rubenstein RC, Zeitlin PL. A pilot clinical trial of oral sodium 4-phenylbutyrate (Buphenyl) in deltaF508-homozygous cystic fibrosis patients: partial restoration of nasal epithelial CFTR function. Am J Respir Crit Care Med 1998; 157:484-90. Dover GJ, Brusilow S, Charache S. Induction of fetal hemoglobin production in subjects with sickle cell anemia by oral sodium phenylbutyrate. Blood 1994;84:339-43. Eckhoff DE, Bilbao G, Frenette L, et al. 17-Beta-estradiol protects the liver against warm ischemia/reperfusion injury and is associated with increased serum nitric oxide and decreased tumor necrosis factor-alpha. Surgery 2002;132: 302-9.
Surgery August 2005
24. Camargo CA Jr, Madden JF, Gao W, et al. Interleukin-6 protects liver against warm ischemia/reperfusion injury and promotes hepatocyte proliferation in the rodent. Hepatology 1997;26:1513-20. 25. Gujral JS, Bucci TJ, Farhood A, et al. Mechanism of cell death during warm hepatic ischemia-reperfusion in rats: apoptosis or necrosis? Hepatology 2001;33:397-405. 26. Wang XZ, Kuroda M, Sok J, et al. Identification of novel stressinduced genes downstream of chop. EMBO J 1998;17: 3619-30. 27. Mori K. Tripartite management of unfolded proteins in the endoplasmic reticulum. Cell 2000;101:451-4. 28. Zinszner H, Kuroda M, Wang X, et al. CHOP is implicated in programmed cell death in response to impaired function of the endoplasmic reticulum. Genes Dev 1998;12: 982-95. 29. Selzner N, Rudiger H, Graf R, et al. Protective strategies against ischemic injury of the liver. Gastroenterology 2003; 125:917-36. 30. Jaeschke H, Lemasters JJ. Apoptosis versus oncotic necrosis in hepatic ischemia/reperfusion injury. Gastroenterology 2003;125:1246-57. 31. Ji C, Kaplowitz N. Hyperhomocysteinemia, endoplasmic reticulum stress, and alcoholic liver injury. World J Gastroenterol 2004;10:1699-708. 32. Wang HC, Wu HC, Chen CF, et al. Different types of ground glass hepatocytes in chronic hepatitis B virus infection contain specific pre-S mutants that may induce endoplasmic reticulum stress. Am J Pathol 2003; 163:2441-9. 33. Gilmore WJ, Kirby GM. Endoplasmic reticulum stress due to altered cellular redox status positively regulates murine hepatic CYP2A5 expression. J Pharmacol Exp Ther 2004; 308:600-8. 34. Watanabe Y, Suzuki O, Haruyama T, et al. Interferongamma induces reactive oxygen species and endoplasmic reticulum stress at the hepatic apoptosis. J Cell Biochem 2003;89:244-53. 35. Xie Q, Khaoustov VI, Chung CC, et al. Effect of tauroursodeoxycholic acid on endoplasmic reticulum stress-induced caspase-12 activation. Hepatology 2002;36:592-601. 36. Kumar R, Azam S, Sullivan JM, et al. Brain ischemia and reperfusion activates the eukaryotic initiation factor 2alpha kinase, PERK. J Neurochem 2001;77:1418-21. 37. Page AB, Owen CR, Kumar R, et al. Persistent eIF2alpha(P) is colocalized with cytoplasmic cytochrome c in vulnerable hippocampal neurons after 4 hours of reperfusion following 10-minute complete brain ischemia. Acta Neuropathol (Berl) 2003;106:8-16. 38. Shibuya H, Ohkohchi N, Seya K, et al. Modulation of mitochondrial ATP synthesis and lipid peroxidation by Kupffer cells in liver grafts. Transplant Proc 1996;28:321-3. 39. Colletti LM, Remick DG, Burtch GD, et al. Role of tumor necrosis factor-alpha in the pathophysiologic alterations after hepatic ischemia/reperfusion injury in the rat. J Clin Invest 1990;85:1936-43. 40. Suzuki S, Toledo-Pereyra LH. Interleukin 1 and tumor necrosis factor production as the initial stimulants of liver ischemia and reperfusion injury. J Surg Res 1994;57:253-8. 41. Sheehy E, Conrad SL, Brigham LE, et al. Estimating the number of potential organ donors in the United States. N Engl J Med 2003;349:667-74. 42. Busuttil RW, Tanaka K. The utility of marginal donors in liver transplantation. Liver Transpl 2003;9:651-63. 43. Selzner M, Clavien PA. Fatty liver in liver transplantation and surgery. Semin Liver Dis 2001;21:105-13.
Surgery Volume 138, Number 2
44. Todo S, Demetris AJ, Makowka L, et al. Primary nonfunction of hepatic allografts with preexisting fatty infiltration. Transplantation 1989;47:903-5. 45. Baskin-Bey ES, Canbay A, Bronk SF, et al. Cathepsin B inactivation attenuates hepatocyte apoptosis and liver damage
Vilatoba et al 351
in steatotic livers after cold ischemia-warm reperfusion injury. Am J Physiol Gastrointest Liver Physiol 2005;288:G396-402. 46. Dover GJ, Brusilow S, Samid D. Increased fetal hemoglobin in patients receiving sodium 4-phenylbutyrate. N Engl J Med 1992;327:569-70.